JP2001204472A - Primer single-stranded dna, method for preparing double- stranded cdna using the same, and method for amplifying one-sided single-stranded dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To synthesize each cDNA from various mRNAs in a trace amount of a specimen preserving an information concerning the directionality of a gene, to evenly amplify these, and to further amplify only one-sided single strand of the amplified double-stranded cDNA. SOLUTION: This method for preparing a one-sided single-stranded DNA of double-stranded DNA comprises the steps of: (a) hybridizing a primer single- stranded DNA designed to inhibit an exonuclease activity of a DNA polymerase to a poly A end of a mRNA, (b) linking an adaptor double-stranded DNA to one side of the double-stranded DNA, (c) amplifying the double-stranded cDNA by the elongation using two single-stranded DNAs constituting the adaptor double-stranded DNA as primers, and (d) asymmetrically amplifying a one-sided single-stranded DNA of the amplified double-stranded cDNA by the PCR using a primer single-stranded DNA hybridizing to a dA stretch of a double-stranded DNA and the adaptor double-stranded DNA.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for simultaneously amplifying various kinds of DNA from a small amount of a sample. More specifically, the present invention relates to a method for preparing corresponding double-stranded cDNAs from various types of mRNA in a trace sample, amplifying them, and further amplifying only one side of each amplified double-stranded cDNA.

[0002]

BACKGROUND OF THE INVENTION In vitro nucleic acid amplification technology has provided a powerful tool for the detection and analysis of small amounts of nucleic acids.
Such techniques have provided significant advancements in the diagnosis of infectious and genetic diseases, isolation of genes for biochemical analysis, and detection of specific nucleic acids in forensic medicine.
At present, the most versatile technology is the polymerase chain reaction (Polymerase Chain Rea) using a thermostable polymerase (Taq polymerase).
ction (hereinafter referred to as PCR or PCR method), which can amplify DNA (fragment) several hundred thousand times.

However, the PCR method is mainly used for a specific DN.
A is intended to amplify A
However, it was difficult to amplify all at once. On the other hand,
Attempts have been made to simultaneously amplify several DNAs at once, but the types of DNA to be amplified are as small as about 5 and the length of the amplified DNA is also about 1 kb. Furthermore, when DNA amplification is repeated, short DN
Although A is liable to be amplified, it has hardly been overcome. Therefore, if a DNA amplification method for simultaneously amplifying many types of DNA from short to long at the same time is developed, for example, when diagnosing an infectious disease exemplified above, a plurality of nucleic acids may be present in a specimen. When present, a single assay is possible, eliminating the need to perform multiple separate assays.

As one of the methods for analyzing gene expression, a new SAGE (serial analysis) has been newly developed.
A s of gene expression method has been proposed. Victor E. Velcuescu et al., Sc
issue 270, 484, 1995. This method uses sequence tags expressed from transcripts of a wide variety of genes present in tissues or cells.
(d sequence tag) is cut out, and the genes are identified (cataloged) at once by serially connecting and sequencing, and the expression of the various genes is analyzed. As an application, it is possible to specify a disease (for example, cancer) by comparing genes expressed in each of the normal, onset, and disease states. Thus, it is expected to help elucidate, for example, the mechanism of cancer.

[0005] Therefore, if the above-described DNA amplification method is developed, it is possible to simultaneously and uniformly amplify many kinds of DNAs in a sample, and the mixture of amplified DNA products can be immediately subjected to the SAGE method. Can be used and analyzed. Here, the expression “amplify uniformly” means that each DNA is amplified without changing the ratio of the number of the DNAs present.

[0006]

In view of the above situation, the present inventor has proposed that an adapter DN be added to DNA to be amplified.
A (hereinafter, used synonymously with the adapter double-stranded DNA) and a method of uniformly amplifying DNA using a primer that hybridizes to the adapter-DNA (hereinafter, referred to as “adapter double-stranded DNA”)
Homogeneous amplification PCR or homogenous amplification PCR method), and adapter DNAs and primers for use therein have been developed.

[0007] Further, the present inventors have developed long-chain DNA.
Enzymes used to amplify the (long DNA amplification enzyme), reaction temperature, reaction cycles, the result of examining the operating conditions and operations in the PCR, such as Mg ²⁺ concentrations, the adapter D
Using NA and primers, multiple types of DNA were successfully and simultaneously amplified. The uniform amplification PCR, including these detailed PCR conditions, the adapter DNA, the primers and the like are described in JP-A-9-234074 (Japanese Patent Application No. 8-45927). Therefore, the entire content of this disclosure is incorporated herein by reference,
In this specification, a part of the description may be omitted.

However, if the single-stranded single strand (also referred to as single-stranded single strand) of the DNA amplified by the homogeneous amplification PCR method is further amplified by the asymmetric PCR method, the yield of the PCR amplification product becomes extremely low. The problem came out.

[0009] Further, prior to the homogeneous amplification PCR, the DNA (cDNA) to be amplified is subjected to mR
Attempts to prepare DNA from NA in a conventional manner also resulted in the problem that the portion corresponding to the poly A terminus of the mRNA was removed, and the primer used in asymmetric PCR could not recognize the poly A terminus.

Accordingly, an object of the present invention is to solve these problems associated with the homogeneous amplification PCR method and to provide a more improved homogeneous amplification PCR method.

[0011]

[Means for Solving the Problems] From the above viewpoints,
The present inventors have newly added, in addition to the adapter DNA, 2
By developing different types of primers and using these primers in the pre-stage and post-stage of the homogeneous amplification PCR, the efficiency of amplifying one-sided single strand by asymmetric PCR after homogeneous amplification PCR is greatly increased, and the Even when starting, it was found that a single-stranded single-stranded amplified product could be supplied in a sufficient amount from the mRNA contained therein.

That is, according to the present invention, the mRNA
DT that hybridizes to the re-A site _nSequence at the 3 'end
Having a blocking group at the 5 'end,
The other part is the adapter ligated to the double-stranded cDNA.
Of the single-stranded DNA constituting the single-stranded DNA,
One whose end not binding to cDNA is the 5 'end
Consisting of a base sequence substantially identical to the sequence of the strand DNA
A primer single stranded DNA is provided. Below,
Immer single-stranded DNA is converted to the first primer DNA (also
Is abbreviated as a first primer). First primer
DNA is used when preparing cDNA from mRNA
Things. Preferably, the first primer DNA is
Includes restriction enzyme recognition sites.

According to the present invention, the dT _n sequence is
The other end is a single-stranded DNA which is not linked to the double-stranded cDNA of the single-stranded DNA constituting the adapter double-stranded DNA and which is linked to the double-stranded cDNA. A primer single-stranded DNA comprising a base sequence having sufficient homology to the DNA sequence is provided. "Having sufficient homology" means that primers hybridize to double-stranded DNA and asymmetric PCR
Means that the sequence can be performed. Hereinafter, this single-stranded primer DNA is used as a second primer D
Abbreviated as NA (also the second primer). The second primer DNA is used for asymmetric PCR which amplifies only one side of a double-stranded cDNA.

According to the present invention, there is also provided a method for preparing a double-stranded cDNA, wherein
And the primer DN
The mRNA is reverse transcribed using A as a primer,
There is provided a method for preparing a double-stranded cDNA, characterized in that the double-stranded cDNA is converted into a double-stranded cDNA by NA polymerase.

According to the present invention, there is provided a method for preparing single-stranded DNA from mRNA, comprising the steps of: (a) hybridizing a first primer DNA to a polyA site of mRNA, and using the primer DNA as a primer The mRNA is reverse transcribed and further converted into double-stranded cDNA by a DNA polymerase. (B) An adapter double-stranded DNA is prepared. The adapter double-stranded DNA has an adapter double-stranded D at one end.
Either one of the single-stranded DNAs constituting NA protrudes so as not to bind to the DNA to be amplified or other adapter-double-stranded DNA; (c) the adapter double-stranded DNA is Chain cDN
(D) using the two single-stranded DNAs constituting the adapter double-stranded DNA as primers and using the double-stranded cD
NA, using the double-stranded cDNA as a template, performing an extension reaction with a DNA amplification enzyme, and amplifying the double-stranded cDNA; (e) combining a second primer DNA with the amplified double-stranded cDNA The cDNA is hybridized as a primer, an extension reaction is performed by a DNA amplification enzyme using the amplified double-stranded cDNA as a template, and the amplified double-stranded c
Asymmetrically amplify only one side of the DNA;
One-sided single-stranded DNA comprising the above steps
Is provided.

In addition, according to the present invention, double-stranded cDNA
(A) preparing a double-stranded cDNA having an adapter double-stranded DNA linked at both ends; (b) adding a second primer DNA to the double-stranded cDNA Hybridized as a primer, the double-stranded cDN
A is used as a template to perform an extension reaction with a DNA amplification enzyme, and asymmetrically amplifies only one-sided single-stranded DNA of the double-stranded cDNA. Is done.

Further, according to the present invention, a method for preparing the first and second primer DNAs and a double-stranded cDNA, a method for preparing a single-stranded single-stranded DNA, and an amplification of the single-stranded DNA In the method, the adapter double-stranded DNA has the following characteristics.

At one end, the adapter double-stranded DNA
One of the single-stranded DNAs constituting the double-stranded cDNA to be amplified or other adapter double-stranded DNA
Projecting so that it cannot be connected to Here, preferably, at the non-terminal end which binds to the DNA to be amplified, the single-stranded DNA whose end corresponds to the 5 ′ end of the single-stranded DNA constituting the adapter double-stranded DNA is phosphorylated. That you are.

Further, preferably, the adapter double-stranded DNA is provided with a restriction enzyme site for generating a sticky end or a restriction enzyme site for generating a blunt end, and
Includes other than the end that does not bind to DNA.

More preferably, the adapter double-stranded DNA is a single-stranded DNA having the sequence of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having the sequence of SEQ ID NO: 2 in the sequence listing. Are hybridized.

Most preferably, the adapter double-stranded DNA
Is a single-stranded DN having the sequence described in SEQ ID NO: 1 in the sequence listing.
A and the sequence described in SEQ ID NO: 2 in the sequence listing, and 5 ′
When a single-stranded DNA having a phosphorylated end is hybridized and constituted, each of the first primer DNA and the second primer DNA is 24 to 15 "c" of SEQ ID NO: 1 in the sequence listing. The base sequence up to the "c" is included.

[0022]

BEST MODE FOR CARRYING OUT THE INVENTION As used herein, the term “DNA to be amplified” refers to a double-stranded cDNA present at the beginning of PCR, to which an adapter binds. A DNA in which the DNA to be amplified and the adapter DNA bind to each other is also referred to herein as "template DNA". The term “mRNA” as used herein refers to, for example, mRNA contained in isolated mammalian cells or tissues. Further, the term “substantially the same” as used herein includes those in which one or more bases are deleted, substituted, or added to the nucleotide sequence to the extent that the function as a primer is not impaired. .

(Homogeneous Amplification PCR Method) As described above, the present homogeneous amplification PCR method is described in detail in JP-A-9-234074. In the conventional PCR method, the amplified D
The NA is first hybridized with the primers. However, when it is desired to simultaneously amplify a wide variety of DNAs from short to long at the same time, there is no primer that hybridizes to all DNAs. , Degenerate probe) to the PCR buffer. The reaction may then produce unacceptably high levels of non-specific amplification and background. In contrast, the homogenous amplification PC according to the present invention does not directly hybridize the primer to the amplified DNA.
This is a feature of the R method. By doing so, even if a pair of primers is used, a plurality of DNAs can be simultaneously and uniformly amplified. A common adapter DNA is ligated to both ends of each DNA in order to provide each DNA to be amplified with a site where the pair of primers can hybridize. Considering such ligation or subsequent PCR, and further cloning of the PCR amplification product, the adapter D
The NA has to be designed.

(Adapter DNA) The adapter-double-stranded DNA according to the present invention meets the following requirements.
At one end, one of the single-stranded DNAs constituting the adapter double-stranded DNA is projected so as not to bind to the DNA to be amplified or another adapter double-stranded DNA. Here, preferably, the DNA to be amplified
At the end that binds to, the single-stranded DNA whose end corresponds to the 5 ′ end of the single-stranded DNA constituting the adapter double-stranded DNA is phosphorylated. here,
Adapter double-stranded DN on the side that binds to the DNA to be amplified
The terminus of A may be blunt or protruding such that the adapters do not bind and bind to the DNA to be amplified.

From the above structural characteristics, the adapter DNA according to the present invention can bind to the DNA to be amplified only at one end. Therefore, by the adapter DNA of the present invention,
Only one adapter can be accurately bound in one direction to each end of the DNA to be amplified. In addition, since the adapters are not connected many times, PCR can be performed accurately.

The length of the adapter double-stranded DNA is preferably one having a length of 16 bases or more of the single-stranded DNA constituting the adapter that protrudes at the end not linked to the DNA to be amplified. Practically, it is particularly preferable that the single-stranded DNA has 24 bases or more. There is no particular upper limit on the length of the single-stranded DNA, but a length of up to about 40 bases is practically preferable.

A preferred adapter double strand D according to the present invention
NA has the above characteristics, and further contains a sticky end or a restriction enzyme site that generates a blunt end other than the end not binding to the DNA to be amplified. More preferably, the former restriction enzyme site is EcoRI or NotI,
The latter restriction enzyme site is EcoRV. After PCR, when the amplified DNA is treated with the restriction enzyme site, it becomes easy to introduce the amplified DNA into the vector.

A specific example of the structure of the adapter double-stranded DNA is a single-stranded DNA having the sequence shown in SEQ ID NO: 1 in the sequence listing and a sequence represented by SEQ ID NO: 2 in the sequence listing, 5 ′ It is obtained by hybridizing with a single-stranded DNA having a phosphorylated end. The structure is shown in the following formula. Formula (1) 5 ′ AGG AAT TCA GCG GC
C GCA GAT ATC 3'3 'C TAA AGT
CGC CGG CGT CTA TAG 5 '(in the formula, preferably, the "G" at the 5' end of the lower chain is phosphorylated.) A single strand having the sequence shown in SEQ ID NO: 1 in the sequence listing The method for preparing DNA and single-stranded DNA such as single-stranded DNA having the sequence shown in SEQ ID NO: 2 in the Sequence Listing is not particularly limited, but is preferably synthesized automatically by a DNA synthesizer according to a conventional method.

The method for preparing single-stranded single-stranded DNA of the present invention comprises:
Preparation of cDNA from mRNA, resulting double-stranded cDN
A comprises three steps: amplification by homogeneous amplification PCR, and amplification of single-stranded single-stranded DNA of the amplified double-stranded cDNA. The method for amplifying single-stranded single-stranded DNA by the asymmetric PCR method of the present invention comprises this last step. Each step is shown in FIG. 1 using the specific primers and adapter double-stranded DNA employed in the examples as examples. Hereinafter, each step will be described.

(Preparation of cDNA) mRNA in a trace sample
Is reverse transcribed into a single-stranded cDNA by a reverse transcriptase in this step, and the single-stranded cDNA is converted into a double-stranded cDNA by a DNA polymerase. This step should be easily carried out according to a conventional method, but as in the present invention,
When preparing a cDNA from an extremely small amount (for example, about 100 ng) of mRNA, a standard cDNA is used.
A synthesis kit (eg, AmershamPharmac)
IA TimeSaver cDNA Syntheses
Using is Kit), an overwhelming amount of cDNA products in which the portion derived from the poly A terminus of mRNA has been removed can be obtained. This is because the RNA / cDNA complex (duplex) generated by reverse transcription was
NA polymerase (eg, DNA polymerase)
This is because, when the polymerase is converted into double-stranded cDNA by se I), the polymerase digests the DNA termini.
Although DNA polymerases are known to have such exonuclease activity, commercially available standard cDN
In the A synthesis kit, the amount of the enzyme and the like were prepared assuming that a considerable amount of mRNA was processed, and this was not a problem in the normal case. However, as in the present invention, a small amount of mRNA
If the sample is treated with the same kit, the enzyme will be in a large excess with respect to the substrate, and the exonuclease activity will be remarkable. Therefore, in the present invention, when synthesizing cDNA,
Instead of the commonly used oligo (dT) _n primer, a primer (first primer DNA) having a blocked 5 'end of the primer is designed and used,
An attempt was made to prevent end-digestion of the cDNA product by NA polymerase.

(First Primer DNA) The first primer DNA of the present invention
The primer DNA, the dT _n sequences that hybridize to the poly A terminus of the mRNA 3 'has at the end, and 5'
It has a blocking group at the end, and the other part is characterized by comprising a base sequence substantially identical to the sequence of one single-stranded DNA constituting the adapter double-stranded DNA.

The dT _n sequence serves as an oligo (dT) _n primer (where n is an integer of 12 to 18),
The number of n is not particularly limited as long as it hybridizes with sufficient strength to the poly A terminal of the mRNA, but the same number (ie, 12 to 18) is practically preferable. In addition, the blocking group at the 5 ′ end may be a group that is resistant to the exonuclease activity of DNA polymerase (ie, has a bond other than the 3 ′, 5′-phosphodiester bond of the polynucleotide). There is no particular limitation. For example, a biotin group, an amino group, an S-oligo group and the like can be mentioned. The “other portion” is a base sequence that is substantially identical to the sequence of one single-stranded DNA constituting the adapter double-stranded DNA. There is no limitation. The base sequence is a sequence of a single-stranded DNA in which the end that does not bind to the double-stranded cDNA to be amplified corresponds to the 5 ′ end of the single-stranded DNA that substantially constitutes the adapter double-stranded DNA. . Here, oligo (dT) is used as a primer.
_{n with} the 5 'end of the primer blocked as described above
Although NA is also taken into consideration, another aspect of the present invention, when uniformly amplifying double-stranded DNA to be amplified, requires a sequence complementary to the base sequence of the adapter double-stranded DNA, In the present invention, “a single-stranded DNA constituting an adapter double-stranded DNA, a double-stranded cDNA to be amplified
Single-stranded DNA in which the non-binding end is the 5 'end
Must be substantially identical to the sequence of Further, preferably, the first primer DNA is
When reverse-transcribed mRNA is made into a part of double-stranded cDNA by DNA polymerase, it creates one restriction enzyme site. This corresponds to the adapter double-stranded DN according to the present invention.
For exactly the same reason that A contains a restriction enzyme site.
Preferred restriction enzyme sites here include EcoRI,
NotI or EcoRV is mentioned, and the generated restriction enzyme sites correspond to those contained in the adapter double-stranded DNA.

A specific example of the first primer DNA of the present invention is 5 ′ (biotin) GAA TTC AGC G
GC CGC AGA TAT CTT TTT TTT T
TT TTT TTT T, and its sequence is described in SEQ ID NO: 3 in the sequence listing. At this time, the adapter double strand is a single-stranded DN having the nucleotide sequence of SEQ ID NO: 1 in the sequence listing.
A is obtained by hybridizing A with a single-stranded DNA having the nucleotide sequence of SEQ ID NO: 2 in the sequence listing. The portion of this sequence other than the dT stretch, except for the 5'-terminal biotin group, corresponds to the 5 'end of the single-stranded DNA constituting the adapter double-stranded, which is not bound to the double-stranded cDNA to be amplified. Sequence of single-stranded DNA (SEQ ID NO: 1)
And almost match. Therefore, the restriction enzyme sites generated by this primer are EcoRI, NotI, and EcoR.
V site. The DNA having the sequence of SEQ ID NO: 3 is automatically synthesized by a DNA synthesizer according to a conventional method.

The first primer DNA of the present invention has the above-mentioned structure, and by using this, a desired double-stranded cDNA can be synthesized from mRNA using a standard cDNA synthesis kit according to a conventional method. Obtained double-stranded cDNA
As the “amplified DNA”, and the end without the polyA site was ligated to the adapter DNA.
Amplification is carried out using the homogeneous amplification PCR disclosed in Japanese Patent Application Laid-Open No. H10-260, 1993.
The amplified double-stranded cDNA is further subjected to asymmetric PCR.

(Asymmetric PCR) Another aspect of the present invention is to amplify only single-stranded single-stranded DNA, which is the sense strand of double-stranded cDNA, using asymmetric PCR. In general,
It is biochemically significant to obtain a single-stranded cDNA separately from its complementary cDNA, for example, to selectively amplify only the sense strand of the cDNA. The asymmetric PCR method used for this is well known to those skilled in the art, but when amplifying a wide variety of DNAs uniformly, applying standard reaction conditions, the yield of PCR amplification products is very low. Encountered an unexpected problem. That is, the double-stranded cDNA amplification product shown in FIG.
As A, an asymmetric PC using oligo dT _n primer
Performing R resulted in very low yields of the desired amplification. This is the primer (i.e., dT _n) but is dA _n stretches hybridizing the double-stranded cDNA, poor stability of the hybrid between dT _n and dA _n, because the primer is easily dissociated it is conceivable that. Therefore, it is difficult for the chain extension reaction to occur appropriately thereafter.

Therefore, according to the present invention, (a) preparing a double-stranded cDNA in which adapter double-stranded DNAs are linked on both sides, respectively; (b) the double-stranded cDNA using a second primer DNA as a primer Hybridized to double-stranded cDNA
Is subjected to an extension reaction using a DNA amplification enzyme as a template, and only one-sided single-stranded DNA of the double-stranded cDNA is asymmetrically amplified;
A method for amplifying NA is provided. This method is characterized by the second primer employed in step (b) as compared with the conventional method.

(Second Primer DNA) The second primer DNA of the present invention
Is one single-stranded DN constituting the adapter double-stranded DNA linked to the double-stranded cDNA.
A nucleotide sequence having sufficient homology to the nucleotide sequence of A and double-stranded cDN obtained by reverse transcription of mRNA
A dT _n sequence that hybridizes to the poly A site of A
It is characterized by having at the end.

The dT _n sequence serves as an oligo (dT) _n primer, and the number of n is not particularly limited as long as it hybridizes with sufficient strength to the template DNA.
A range of from about to about 18 is practically preferred. dT _n nucleotide sequence other than the sequence may be single-stranded D constituting the adapter duplex DNA
It has sufficient homology to the sequence of NA. More preferably, the base sequences may be substantially the same.
In addition, regarding the length and the type of base included,
Although not particularly limited, it is appropriately selected from the viewpoint of the homology and the hybridization. The base length preferably ranges from about 10 to about 22.

A specific example of the second primer DNA of the present invention is 5'GAT TTC AGC GGC CGC
AGA TAT C (T) _n 3 ′, where n is as previously defined, and the sequences of some DNAs are set forth as examples in SEQ ID NOs: 4-13 in the Sequence Listing. At this time, the adapter double strand was prepared by hybridizing a single-stranded DNA having the base sequence of SEQ ID NO: 1 in the sequence listing with a single-stranded DNA having the base sequence of SEQ ID NO: 2 in the sequence listing. Things. The portion other than the dT stretch in the above sequence is the sequence of the single-stranded DNA constituting the adapter double-stranded DNA in which the end not binding to the double-stranded cDNA to be amplified corresponds to the 5 ′ end (sequence). It matches number 1). Note that DNAs having these sequences are automatically synthesized by a DNA synthesizer according to a conventional method.

The second primer DNA of the present invention has the above-mentioned structure, and when this is used to carry out asymmetric PCR according to a conventional method, only the single-stranded DNA on one side of the double-stranded cDNA is asymmetric. Amplification can be performed efficiently and a desired single-stranded cDNA can be obtained.

[0041]

The present invention will be described in more detail with reference to the following Examples and Test Examples, but the present invention is not limited to these Examples.

<Test Example 1> Synthesis of cDNA from mRNA A small amount (about 100 ng) of mRNA was used to synthesize cDNA according to a conventional method. As a result, the length of the dT stretch portion corresponding to the poly-A terminal of the mRNA was determined. We considered whether it would be synthesized by.

1. Synthesis of cDNA for Amplification 100 ng of polyA ⁺ RNA (derived from human brain, manufactured by Clontech) from Amersham-Pharmacia cDN
Asynthesis using kit (oligo dT _12-18 primer), was as the method described in the manual, to synthesize a double-stranded cDNA, further K1enow F
The ends of the cDNA were blunted using a fragment (manufactured by Amersham Pharmacia).

2. Preparation of cDNA sample for PCR Firstly, after synthesizing an adapter DNA that also serves as a primer site for PCR and flowing it on a polyacrylamide gel,
It was cut out and purified. Synthesized single-stranded adapter D
The sequence of NA is as follows. Adapt evening 1: 5 '
AGGAATTCAGCGGCGCAGATATC
3'Adapt evening 2: 3'CTTAAGTCCGCCGGC
GTCATAG5 ′ The sequence of Adapta-1 is the sequence shown in SEQ ID NO: 1 in the sequence listing, and the sequence of Adapta-2 is the sequence shown in SEQ ID NO: 2 in the sequence listing.

For Adapter-2, 5 'under the following conditions:
Terminal phosphorylation was performed. Adapter-2 (20 pmol / μ1) 25 μl 10 mM ATP 5 μl 10 times kination buffer 5 μl T4 polynucleotide kinase (10 U / μ1) 3 μl Sterilized double distilled water 12 μl Total 50 μl Reaction at 37 ° C. for 60 minutes, then heat inactivation of enzyme Then, 25 μl of Adapter-1 (20 pmol / μl) was added thereto, denatured at 95 ° C. for 10 minutes, and allowed to stand at room temperature for 1 hour to perform annealing to obtain a double-stranded adapter.

This adapter and the cDNA synthesized above
(Double-stranded), and a ligation reaction was carried out in the following reaction system. cDNA sample 20 μl Adapt- (6.7 pmol / μl) 4.5 μl BSA (2 mg / ml) 2 μl Hexamine cobalt chloride (20 mM) 2 μl Spermidine HCl (20 mM) 2 μl 10-fold ligation buffer 4 μl T4 ligase 2 μl 2 μl distilled water 2 μl A total of 40 μl reactions were performed at 16 ° C. overnight.

After completion of the reaction, phenol extraction was performed, and S3
00 span column (Amersham Pharmacia)
Unreacted adapter was removed using. Thus, a double-stranded cDNA (template DNA) linked to the adapter was obtained.

3. 1. Amplification of cDNA sample The cDNA sample obtained in the above was further amplified by a homogeneous amplification PCR reaction under the following conditions. Basal solution Primer (5 pmol / μl) 1 μl Mg (OAc) ₂ (25 mM) 1.2 μl 2 mM dNTP 1.6 μl 3.3 times PCR buffer 2.4 μl Ampli Wax 1 particle 3 minutes at 75 ° C./20° C. Melted the wax in 10 minutes to form a layer. Upper solution 3.3 times PCR buffer 3.6 μl KOD Taq polymerase 0.4 μl Template DNA 2.0 μl Sterile distilled water 6.0 μl The PCR reaction was carried out at 94 ° C. for 1 minute and then reacted at 94 ° C. (94 ° C.)
Cycle for 15 seconds at 68 ° C. for 10 minutes) is repeated 16 times, followed by (15 seconds at 94 ° C. → 10 minutes at 68 ° C. + 15).
Seconds x (n-1) where "n" is the number of repetitions, 1≤
(n ≦ 12 natural number) cycle was repeated 12 times, followed by standing at 68 ° C. for 15 seconds and at 72 ° C. for 10 minutes.

"3.3 times PCR buffer"
0.4 M TrisHcl (pH 8.0), 100 mM
KCl, 60 mM (NH ₄ ) ₂ SO ₄ , 1 Triton X
-100, and a mixture of 0.1 μg / μl BSA.

4. Cloning and analysis The obtained PCR product was separated by 0.7% agarose electrophoresis, cut into three ranges, and extracted from the gel. Immediately extract the extracted fragment into TA cloning kit
(Manufactured by Invitrogen), followed by sequencing from both ends to determine the terminal sequence.

Of the 23 clones whose terminal sequences were determined by the above method, one clone having a dT number of 18 or more was 1
There were only pieces. From this, a very small amount (100 n
g) of mRNA,
Thereafter, it was found that most of the cDNA contained clones having no dT stretch of a length necessary for performing asymmetric PCR.

<Example 1> A primer having the following sequences (a sequence in which a sequence required for amplification by the homogeneous amplification PCR method is linked to a dT stretch), and a 5'-terminal biotinylated primer, and 5'-terminal and 5'-terminal '
A primer having the third terminal biotinylated was synthesized by a conventional method. 5 '(biotin) GAATTCAGCGGCCGC
AGATATCTTTTTTTTTTTTTTTTTTTT
3 '5' (biotin) GAA (biotin) TTCA
GCGGCCGCAGATATCTTTTTTTTTTTT
TTTTTTTTT3 'The sequences of these primers are shown in SEQ ID NOs: 3 and 4 in the sequence listing.

First, a 5 ′ terminal biotinylated primer (b
When each step (1-4) of Test Example 1 was performed using iotin-phosphoamidite, the number of clones having a dT stretch length of 18 or more was increased to half (6/12) of the whole. I was able to. Furthermore, using each of the 5′-terminal and the third biotinylated primer as a primer, each step of Test Example 1 (1.−
4. ), The number of clones having a dT number of 18 or more could be increased to 60% (6/10) of the total. Compared with the result of Test Example 1, the amplified P
The conservation of the dT stretch of the CR product was significantly improved.

Since asymmetric PCR usually requires a minimum of 18 dTs, it is considered that a dT stretch clone having a length shorter than this would greatly reduce the synthesis efficiency during PCR. In the present invention, since a large number of clones having a dT of 18 or more can be stored as described above, a cDNA suitable for performing asymmetric PCR next can be produced.

<Test Example 2> Asymmetric PCR performed conventionally
Are as follows. That is, the oligo (d
T) Using ₃₀ primers, (94 ° C, 1 minute) → (50
PCR is performed in a cycle of (° C, 1 minute) → (72 ° C, 4 minutes). However, when the PCR is performed as described above, the asymmetric P
It was found that the yield of CR product was lower than expected. Therefore, according to the following method, first, the asymmetric PCR
Was examined for efficiency (ratio of amplification).

Specifically, under the following reaction conditions, [α- ³²
Asymmetric PCR was performed in the presence of [P] dCTP. Lower layer primer (5 pmol) 2.5 μl dNTP 4 μl (2.5 mMd ATP / dGTP / dTTP, 0.25 mM dCTP) 25 mM Mg (OAc) ₂ 3 μl 3.3 × PCR buffer 6 μl [α- ³² P] dCTP 3 μl dH ₂ in O 1.5 [mu] l upper rTthXL polymerase 1μl 3.3 times for PCR buffer 9 [mu] l template DNA (333ng / μl) 3μl dH 2 O 17μl S300 spun column (Amersham Pharmacia), unreacted [α- ^{3 2} P] After removing dCTP,
Liquid scintillator (Becton Ditzkinson INS)
TAELPlus) was used to measure the amount of ³² P uptake.

In an experiment using a sample after homogenous amplification as a template DNA, the incorporation of ³² P was 825 cpm for the first time,
The second time was 525 cpm. As an approximation, assuming that 100% is obtained when all of the template DNA is amplified, asymmetric PCR
Efficiency is 2-3%.

<Example 2> Single-stranded DNA of adapter
(Sequence of SEQ ID NO: 2)
Various primers of nucleotide length of the sequences and dT ₁₈ are combined to synthesize, by increasing the base length of the variable portion was examined whether raised the efficiency of how asymmetric PCR. As a template, clones A and B having 18 dA stretches were selected from the cDNA prepared in Test Example 1 and used. The reaction conditions for asymmetric PCR were the same as in Test Example 2. In addition, SEQ ID NO: 1 was used as a positive control.
PCR using the DNA having the sequence of SEQ ID NO: 2 and the DNA having the sequence of SEQ ID NO: 2 (used in the homogeneous amplification PCR) as a primer, and incorporating it into the PCR product (amplified double-stranded cDNA) 1/2 of the amount of ³² P thus obtained was set to 100%. Table 1 shows the results of the PCR expressed in% for each primer.

[0059]

[Table 1]

From the results in Table 1, it can be seen that increasing the number of bases in the variable portion significantly improves the efficiency of asymmetric PCR.

<Example 3> Normal d used in Test Example 1
T₁₂-₁₈Primers (clones with a terminal T of 18 or more
5% or less) and the 5 'terminal biotin used in Example 1.
Primers (about 50% of clones with a terminal T of 18 or more)
) To obtain a homogeneously amplified PCR product (double-stranded c
DNA) in the same manner as in Example 2,
R. The primers used here are listed in Table 1.
Primer numbers 1, 3, 4, 5, and 7
Was. Obtained using 5 'terminal biotinylated primer
When the homogeneously amplified PCR product is subjected to asymmetric PCR,
Normal primer (oligo dT ₁₂-₁₈Primer)
The homogeneously amplified PCR product obtained by
As a result, the efficiency of asymmetric PCR increased. Each
The rate of increase is 1.57, 2.70, 2.97, 3.10,
It was 3.74 times (in this order). Most asymmetric PCR effect
Primer No. 7 had the highest efficiency.
The efficiency is about 20% of the positive control
Had been reached.

Furthermore, the base length of the portion of the single-stranded DNA constituting the adapter double-stranded DNA which hybridizes to the single-stranded DNA having the nucleotide sequence of SEQ ID NO: 2 is fixed at 22 bases, and To dT _n (n = 12, 15,
18) Various primers to which the stretch-bound primers were synthesized (SEQ ID NOS: 11 (n = 18), 12 (n = 15), 13 (n
= 12)) and asymmetric PCR using the homogeneously amplified PCR product obtained from the 5′-terminal biotinylated primer.
Was evaluated for efficiency. Among the dT ₁₂ , dT ₁₅ , and dT ₁₈ , the most efficient asymmetric PCR was dT ₁₂ ,
The efficiency reached about 27.7% of the positive control.

Since the efficiency of asymmetric PCR before application of the primer of the present invention can be estimated to be about 2 to 3%, the efficiency of asymmetric PCR is improved by about 10 times or more.

[0064]

The first primer of the present invention has its 5 ′
Since it has a blocking group at the end, cD
When synthesizing NA, dA stretch of the DNA (the m
The portion corresponding to the poly-A end of RNA) is preserved in the resulting double-stranded cDNA without being digested and scraped off by the exonuclease activity of DNA polymerase. Therefore, this allows for later asymmetric PCR
For example, the dA stretch of the double-stranded cDNA can be used for such operations. Further, information on the direction of the gene is stored in this manner. Further, the first primer of the present invention is a homogenous amplification P using the subsequent adapter DNA.
Since it is designed to have the necessary sequence in CR,
Therefore, the double-stranded cDNA can be efficiently amplified.

The second primer of the present invention has a dT stretch and a sequence that hybridizes to the adapter DNA. When the sequence portion of the second primer which hybridizes to the adapter DNA is hybridized to the portion corresponding to the adapter DNA of the double-stranded cDNA, the dT
The dissociation of the stretch from the dA stretch is suppressed, and the extension reaction proceeds. This allows for asymmetric PCR
Can efficiently amplify only one side of the double-stranded cDNA.

In addition, the use of the first primer and the second primer makes it possible to convert a small amount of mRNA into cDNA.
And amplifying the single-stranded single-stranded cDNA of the amplified double-stranded cDNA by asymmetric PCR efficiently.

Furthermore, since a wide variety of DNAs can be simultaneously and uniformly amplified by the homogeneous amplification PCR, when combined with the primers of the present invention, a wide variety of mRNAs can be obtained from a very small amount of sample by using a variety of mRNAs. The information of the direction of the gene can be stored as it is and used as cDNA for further amplification. Therefore, the mR in such a small amount of sample
NA, that is, gene expression can be analyzed.

[0068]

[Sequence List] SEQUENCE LISTING <110> Sumitomo Electric Industries, Ltd. <120> Single-stranded DNA primers, a process for preparing a double-stranded DNA through use of the primer, and a process for amplifying a single-stranded DNA <130> 099Y0392 <160> 13 <170> PatentIn Ver. 2.1 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 1 aggaattcag cggccgcaga tatc 24 <210 > 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 2 gatatctgcg gccgctgaat tc 22 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220 > <221> modified # base <222> 1 <223> n is a biotin-modified guanine.PCR primer <400> 3 naattcagcg gccgcagata tctttttttt tttttttttt 40 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> <221> modified # base <222> 1 <223> n is a biotin-modified guanine. <222> 3 <223> n is a biotin-modified guanine.PCR primer <400> 4 nanttcagcg gccgcagata tctttttttt tttttttttt 40 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <22 3> PCR primer <400> 5 cgcagatatc tttttttttt tttttttt 28 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 6 gccgcagata tctttttttt tttttttttt 30 <210> 7 < 211> 32 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 7 cggccgcaga tatctttttt tttttttttt tt 32 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> < 223> PCR primer <400> 8 agcggccgca gatatctttt tttttttttt tttt 34 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 9 tcagcggccg cagatatctt tttttttttt tttttt 36 <210> 10 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 10 tttcagcggc cgcagatatc tttttttttt tttttttt 38 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220 > <223> PCR primer <400> 11 gatttcagcg gccgcagata tctttttttt tttttttttt 40 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 12 gatttcagcg gccgcagata tctttttttt ttttttt < 210> 13 <211> 34 <212> DNA <213> Artificial Sequence < 220> <223> PCR primer <400> 13 gatttcagcg gccgcagata tctttttttt tttt 34

[Brief description of the drawings]

FIG. 1 illustrates the primers of the present invention by way of example, mRN
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a reaction scheme diagram schematically illustrating a method of the present invention for preparing and amplifying a double-stranded cDNA from A and further amplifying and preparing only one side of the single-stranded cDNA by asymmetric PCR.

Claims (8)

[Claims] 1. A dT _n sequence that hybridizes to the polyA site of mRNA at the 3 ′ end and a blocking group at the 5 ′ end, and the other part is a double-stranded cDNA.
A base sequence which is substantially the same as the sequence of the single-stranded DNA in which the end not bound to the double-stranded cDNA corresponds to the 5 ′ end of the single-stranded DNA constituting the adapter double-stranded DNA A single-stranded primer DNA comprising: 2. A single-stranded DN having a dT _n sequence at the 5 ′ end and the other portion constituting an adapter double-stranded DNA
A single-stranded primer DNA comprising a base sequence having sufficient homology to the sequence of the single-stranded DNA in which the terminal not binding to the double-stranded cDNA is the 5 'end of A. 3. The primer single-strand D according to claim 1, wherein the adapter double-stranded DNA has the following characteristics.
NA. At one end, one of the single-stranded DNAs constituting the adapter double-stranded DNA protrudes such that it cannot bind to the double-stranded cDNA to be amplified or another adapter double-stranded DNA. 4. The method according to claim 1, wherein the adapter double-stranded DNA hybridizes a single-stranded DNA having the sequence of SEQ ID NO: 1 in the sequence listing with a single-stranded DNA having the sequence of SEQ ID NO: 2 in the sequence listing. The primer single-stranded DNA according to any one of claims 1 to 3, wherein the primer single-stranded DNA is constituted by allowing the primer to be formed. 5. The single-stranded primer DNA according to claim 1 or 2, comprising a nucleotide sequence from the 15th C to the 24th C in the nucleotide sequence of SEQ ID NO: 1 in the sequence listing. 6. A method for preparing a double-stranded cDNA, wherein the primer single-stranded DNA according to claim 1 is hybridized to a poly A site of mRNA, and the primer single-stranded D
A method for preparing a double-stranded cDNA, comprising reverse-transcribed the mRNA using NA as a primer, and further converting the mRNA into a double-stranded cDNA with a DNA polymerase. 7. A method for preparing single-stranded DNA from mRNA, comprising the steps of: (a) converting the primer single-stranded DNA according to claim 1 into mR
Hybridized to the poly A site of NA, reverse transcribed the mRNA using the primer single-stranded DNA as a primer, and further double-stranded cDNA by DNA polymerase.
(B) An adapter double-stranded DNA is prepared. The adapter double-stranded DNA has an adapter double-stranded D at one end.
Either one of the single-stranded DNAs constituting NA protrudes so as not to bind to the DNA to be amplified or other adapter-double-stranded DNA; (c) the adapter double-stranded DNA is Chain cDN
(D) hybridizing to the double-stranded cDNA using the two single-stranded DNAs constituting the adapter double-stranded DNA as primers, Using D as a template
Allowing an extension reaction to be performed by an NA amplification enzyme and amplifying the double-stranded cDNA; (e) hybridizing the single-stranded primer DNA according to claim 2 to the amplified double-stranded cDNA as a primer; Using the amplified double-stranded cDNA as a template, perform an extension reaction with a DNA amplification enzyme, and asymmetrically amplify only one-sided single-stranded DNA of the amplified double-stranded cDNA; A method for preparing a single-stranded DNA, characterized in that: 8. A method for amplifying a single-stranded DNA on one side of a double-stranded cDNA, comprising: (a) preparing a double-stranded cDNA in which adapter double-stranded DNAs are linked on both sides; (b) The primer single-stranded DNA described in the above is hybridized to the double-stranded cDNA as a primer, an extension reaction is carried out with a DNA amplification enzyme using the double-stranded cDNA as a template, and the single-stranded single-stranded of the double-stranded cDNA Asymmetrically amplifying only DNA; single-stranded single-stranded DN comprising the above steps
Method for amplifying A.