JP2001145486A - Reactor for chemical reaction in micro volume for plurality of specimens - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a reactor enabling a chemical reaction in a volume from 10 to 100 μm for continuously treating 100-1,000 specimens. SOLUTION: This is a reactor for a chemical reaction having a capillary reacting part filled with a carrier liquid not miscible with water, wherein the reactor consists of (1) a specimen injector injecting aqueous specimens into the capillary at every predetermined interval, (2) a system for pumping a transportation liquid and aqueous specimen in the capillary, (3) a thermostat for controlling the temperature of the capillary reactor, and (4) a detector.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a chemical reaction apparatus, and more particularly, to a method for continuously processing, for example, 10 to 1000 samples in a volume of, for example, 2 to 100 μl. The present invention relates to a small volume chemical reaction apparatus.
The device of the present invention is a device that can continuously perform biochemical and chemical reactions in a reaction device on individual samples continuous in a microtube, and is a device that can be widely applied to various analyzes and preparations.

[0002] Typically, the chemical reactor of the present invention comprises P
It can be used for diagnostic medicine, food inspection, drug development, breed improvement, forensic medicine, etc. by analyzing DNA by CR (polymerase chain reaction), testing enzyme activity, and the like.

[0003]

2. Description of the Related Art In recent years, molecular biology has been remarkably advanced, and it has become an important issue to apply various analytical techniques produced in the field to industrial fields. Above all, the analysis of DNA base sequences has attracted attention for its wide application range, and for example, the practical application of the diagnosis of single nucleotide polymorphism (SNP) is near.

[0004] In testing for gene defects, for example, BRCA1
It is known that there is a 50% or more chance that breast cancer will occur by the age of 50 if the gene is abnormal, and that one in 2,000 Japanese women has an abnormality. Combined with other hereditary breast cancers, the annual deaths are estimated at 20,000. Therefore, such deaths have been estimated in breast cancer alone, and the number of deaths or illnesses due to other genetic defects is likely to be many times higher. Therefore, early diagnosis of gene defects is extremely important, and development of a multi-sample test technique is an issue.

[0005] In addition, many gene polymorphisms have been found in humans, which are associated with some traits.
For example, side effects can differ hundreds of times from person to person with the same therapeutics, and they have been found to be based on polymorphisms in certain genes. In such a case, it is necessary to perform a genetic diagnosis in advance to estimate a safe dose.

As described above, it is expected that DNA analysis will be widely applied to disease treatment, prevention, and constitution diagnosis in the near future. DNA analysis is also very useful for early detection of pathogenic bacteria and viruses in humans, livestock and cereals, such as E. coli O-157 and plant viruses.

However, in order to achieve this, it is essential to establish a technique for automatically analyzing a large number of samples. For example, the ability of an analytical center to handle samples from hospitals and health centers requires that it automatically process thousands to tens of thousands of samples per day.

In DNA analysis, research and development of DNA chips and mass spectrometry have been actively promoted for this purpose.
Although it is becoming possible at the laboratory stage, considering the processing of a large number of samples at the above level, there are problems that must be solved for each. For example, in the case of a DNA chip, the background is high, the density of the probe must be increased, and it is necessary to stably store light at ice temperature for a long period of time. Also,
Although mass spectrometry has attracted attention because it can be analyzed in a short time, it has technical problems such as pretreatment by the Sanger reaction having to be performed on multiple samples.

[0009]

A typical enzymatic reaction is
1) Preparation of sample, 2) Injection into reactor, 3) Performing reaction (incubation) by raising temperature to appropriate temperature, 4) Stopping by cooling, 5) Collection of reaction solution. 5)
It would be best if the reactants could be analyzed without a sampling operation, but it is desirable to be able to move from sampling to online analysis in the next best case. However, enzymes and biological materials such as DNA in the samples are easily degraded, so that thousands of samples need to be automatically processed quickly. In addition, the reaction is not reliable unless it is quantitatively reproduced, so it is necessary to quantitatively set the reaction solution volume, reaction temperature, reaction time, and the like. Therefore, the reaction for each sample must be performed in a batch process, and conventionally, this has been attempted in a reaction tube. However, such a process requires an advanced robotic machine instead of a human and is costly. The challenge is how to solve this dilemma.

[0010]

According to the present invention, a large number of small-volume aqueous samples are arranged at predetermined intervals in a fine tube filled with a carrier liquid immiscible with water, and the samples are automatically and continuously arranged. What we were trying to deal with was a traditional problem,
It is intended to solve 1) quantification of the reaction solution volume, reaction temperature, reaction time, etc. of a small volume sample, and 2) simultaneous processing of a large number of samples simultaneously.

That is, the present invention relates to a chemical reaction apparatus having a fine tube reaction section filled with a carrier liquid immiscible with water, which comprises: (1) injecting an aqueous sample into a fine tube at predetermined intervals; A sample injection device, (2) a device for sending a carrier liquid and an aqueous sample in a microtube, (3) a temperature control device for controlling the temperature of a reaction portion of the microtube, and (4) a device including a detection device. It is. Specifically, the present invention provides an apparatus as described above, wherein the carrier liquid is an inert, hydrophobic oil, more specifically the carrier liquid is a mineral oil.

The chemical reaction device of the present invention can be used as a DNA analysis device based on the polymerase chain reaction (PCR) and a DNA analysis device based on the cycle sequencing reaction.

Further, the present invention provides the above-mentioned apparatus further comprising (5) a reaction liquid sampling apparatus.

[0014]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in more detail.

As shown in FIG. 1, a feature of the apparatus of the present invention is that, for example, a fine tube having an inner diameter of about 1 to 5 mm is filled with a carrier liquid that is immiscible with water, and an aqueous sample is placed therein at predetermined intervals. One or more, for example, 10-1000 cells are injected, and a small amount (for example, usually about 2 to 100 μl) of each sample is used as a reaction unit, for example, by controlling the temperature of a microtube reaction section through a heat block or the like. It is to let. To make it possible as a chemical reactor, some additional mechanisms must be prepared, but many can be applied by diverting or modifying existing technologies. The main technologies, which vary depending on the purpose, are described below. (A) Microtube Since the microtube used in the apparatus of the present invention is disposed in each apparatus included in the apparatus of the present invention, it is chemically and thermally stable (for example, at 100 to 200 ° C, (Preferably stable at 100 to 150 ° C.). For example, an inner diameter of 1 to 5 mm can be used. If the microtubules are rigid, it is difficult to assemble the system. For example, polyethylene, polypropylene, Teflon with high water repellency, inexpensive polyvinyl chloride, etc. can be selected according to the purpose.

Depending on the reaction or the like, dissolved air may be generated in the fine tube as the temperature in the fine tube increases.
In such a case, it is preferable to use a gas-permeable tube having a degassing function of HPLC. (B) Carrier liquid The carrier liquid used in the present invention is preferably a liquid that is immiscible with water, has low water solubility (for example, 10 ⁻² g / 100 g H ₂ O or less), is water-repellent, and has a boiling point of Those satisfying that the temperature is 100 ° C. or higher, that they are chemically and thermally inert, and that the influence of the background upon optical analysis is small are satisfied. Generally, synthetic lubricating oils such as refined mineral oil, silicone oil, and polyolefin can be used, but mineral oil is sufficient. Furthermore, when performing optical measurement with the reaction solution,
When the flow rates need to be strictly uniform, it is necessary to use pure liquids that are not mixtures. In the present invention, it is possible to recirculate the carrier liquid as it is, but it is more practical to collect the liquid in a liquid storage, separate the aqueous solution portion of the residue, and then reuse it. (1) Sample Injection Apparatus The present invention is characterized in that a plurality of aqueous samples are quantitatively arranged at predetermined intervals in a fine tube, which is a main flow path, through which a carrier liquid flows, without mixing air. .

The sample injection device can use the principle of a sample injector developed by a high-performance liquid chromatograph or a gas chromatograph. That is, it is a method of instantly replacing a part of the flow path with a flow path containing a sample. In order to continuously perform this and arrange a plurality of aqueous samples, a main flow path, a sample introduction flow path, and a washing flow path may be provided in the apparatus and set to be sequentially replaced.

FIG. 2 shows an example. (A) is a three-dimensional view,
(B) shows a sectional view. The rotating body 3 sandwiched between the two discs 8 is provided with three flow paths, and is provided so that liquid does not leak. The transport liquid is transported in the main flow path 5 by a liquid transport device. The sample introduction channel 6 has, for example, injection ports on the left and right sides, and from one side, a basic reaction solution common to each sample (the solution contains, for example, a buffer solution, an enzyme, a coenzyme, and the like necessary for the reaction). ) Is introduced using the reservoir 9.
For example, when performing a PCR reaction, the reaction base solution contains:
Buffer (50 mM KCl, 10 mM Tris-HCl (pH 8.3), 2.5 mM M
gCl ₂ , 0.02% gelatin, 2 μM primer 1, 2 μM primer 2, each 1.25 mM dNTP (A, T, G, C), 2U Taq polymerase) A dye terminator kit (for example, Amersham thermosequencing dye terminator kit) containing A, G, C, and T labeled with different dyes is included. From the other side (sample inlet 11), each sample sample,
For example, when detecting by PCR, the template DNA is injected into the sample introduction channel. In the colony on the plate, the specimen sample can be stabbed into the colony with a toothpick and inoculated with the toothpick from the specimen inlet 11. In the cleaning flow path 7, the carrier liquid is flushed with a cleaning liquid such as ethanol in the cleaning liquid reservoir 12, and the compressed air 14 blows off the ethanol.

By switching the rotator at regular intervals, a plurality of minute aqueous samples can be continuously placed in the carrier liquid in the main channel. (2) Liquid sending device As a device for sending a liquid while maintaining the arrangement made in the main flow path in the fine tube by the above (1), any device used in the field can be used without particular limitation. it can. For example, a peristaltic pump or a liquid sending pump for liquid chromatography can be used. In order to use the peristaltic pump in it, the tube of the driving part to be applied to the peristaltic pump must be rubber,
For example, by using a silicone rubber tube having an inner diameter of 1 to 2 mm at the end of a system in which fine tubes are continuously arranged, the liquid feeder of the present invention can be obtained. Further, when the fine tube is made of a highly durable Teflon-coated polyethylene (trade name: Pharmed tube) or the like, it is also possible to directly use a peristaltic pump. When the liquid sending device is a liquid sending pump, the fine tube can be connected as it is if it is made of polyethylene, Teflon or the like. (3) Temperature control device Each sample injected by the sample injection device is sent into the temperature control device by the liquid sending device and reacted. If the device provides a place where the sample reacts,
There is no particular limitation.

In the reaction of the present invention, an enzyme reaction or PC
R includes a cycle reaction, and in the enzymatic reaction, the reaction is carried out at a predetermined temperature (usually about 37 ° C.) for a certain period of time, and the reaction is stopped by cooling (0-4 ° C.)
In R and DNA cycle sequencing, three types of temperatures (typically 94 ° C., 55 ° C., and 72 ° C., respectively) need to be circulated 20 to 40 times in denaturation, annealing, and extension reactions of DNA. There is no particular limitation as long as such a device can control the temperature. For example, various devices suitable for the purpose, such as a thermostatic liquid bath or a heat block provided with a thermostat capable of controlling the temperature, can be used.

In the present invention, in order to use a fine tube,
It is characterized in that the time required for temperature transmission to reach a predetermined temperature quickly can be greatly reduced.

FIG. 3 shows an example of a heat block for PCR. The device consists of three aluminum blocks 16
The pipes circulate through the inside of each block plate, and the constant temperature liquid 17 circulates in the pipes. In PCR, the temperature of the heat block is set at 94 ° C., 55 ° C., and 72 ° C. from the side closer to the sample injection device, holes are formed in the block, and the fine tubes penetrate for the number of reaction cycles. . The thickness of each heat block is determined so that the time required for the reaction unit to pass therethrough matches the time required for PCR denaturation, annealing, and extension reaction. FIG. 3 discloses a reactor in which the thickness is changed in consideration of the fact that the first denaturation time is as long as 5 minutes.
In addition, as a reaction device that can set the reaction time freely,
A method in which a fine tube is immersed in a thermostatic liquid bath is considered. (4) Detecting device As the detecting device, it is possible to use various detectors usually used according to the purpose. When the chemical reaction device of the present invention is a device for many diagnoses by PCR or enzyme reaction, a fluorescence analyzer or an absorption spectrometer can be used as a detector. By using the detection device, it is possible to analyze the reaction solution without collecting it from the microtube. H is often used for this purpose
What is necessary is just to use the detector used for PLC.

An advantage of the chemical reaction apparatus of the present invention is that, in the fluorescence analysis, the microtube is directly guided into a dark room, irradiated with excitation light, and the fluorescence emitted from the reaction solution can be received at a right angle from the excitation light. It is. In addition, it is possible to measure absorption, refractive index, and the like, but it is necessary to flatten the shape of the fine tube portion at the measurement portion to extend the optical path, and to make the material of the fine tube highly transparent. As such a detecting device, HP
Several μl volumes used in LC can be used.

What constitutes the device of the present invention is as described above, but it is also possible to additionally provide the following device. (5) Reaction liquid sampling device As shown in FIG. 6, it is also possible to collect a reaction solution from each sample in the microtube after the reaction, and apply it to, for example, a further detection device.

Specifically, an apparatus for replacing a certain part of the flow path is used as in the sample injection apparatus of (1). In this case, replacement is performed in advance with a flow path filled with oil. That is, the main flow path,
It is possible to provide a sample collection flow path and an oil replacement flow path and design them to replace each other, which is essentially the same as the sample injection device shown in FIG.

When analyzing the collected sample using an analytical instrument, sampling can be performed from a sample inlet.
If the analyzer to be connected is a capillary electrophoresis type sequencer, the capillary may be inserted here. Further, the reaction liquid sampling device can be directly connected to the analytical instrument online. The amount of the sampling liquid can be adjusted by the diameter of the rotating body flow path. At the time of sampling, mixing of oil for transportation must be avoided, but the timing of switching the rotating body may be determined by considering the flow rate using the signal from the detection device. It is also possible to shorten the length of the replacement portion so as not to require the transfer oil and to collect the center of the reaction solution.

The chemical reaction apparatus of the present invention is advantageous in that it can be applied to various applications and can automatically process a large amount of sample. An application example is shown below. Temperature control is the key to the PCR reaction of a DNA analyzer based on PCR . As a temperature controller, three metal heat blocks are prepared, and the denaturation temperature (94 ° C.) and the denaturation temperature (94
° C), an annealing temperature (typically 55 ° C) and an elongation reaction temperature (72 ° C), and the thickness of the thermostatic plate is set so that the liquid passage time matches the processing time at that temperature. For example, if the flow rate is 2 cm / min, 5
Minutes, 30 seconds, 90 seconds, 90 seconds
Set to 0cm, 1cm, 3cm, 3cm. Except for the initial thermostat for the denaturation temperature, micropores are opened in the other three thermostats, and the microtubules are repeated by the number of temperature cycles (FIG. 3).

The liquid is guided at a constant speed using a liquid sending pump,
Discharge to liquid reservoir. The presence or absence of DNA amplification by the above reaction is determined by adding ethidium bromide (final concentration 1 μm)
g / ml) and perform fluorescence analysis after the reaction. If the material of the microtube is translucent such as polyethylene, the fluorescence intensity at 560 nm is measured using 260 nm of a mercury lamp as the excitation light. For example, when using an inner diameter of 2 mm and a microtube, 10 μl of PCR
The solution is about 3.2 mm long in a fine tube and 6.8 mm in oil
At regular intervals, 120 samples per hour, 1
Can process 1200 samples in 0 hours operation. The above example is
Although the arrangement density of the reaction solution is set to one per cm, the throughput can be increased several times by narrowing the oil wall or reducing the volume of the reaction solution. The reaction time can be shortened by using a high-speed Taq DNA polymerase. Further, since it is easy to operate a plurality of such systems in parallel, it is possible to increase the processing amount accordingly.

Similarly, in the sample injection device in the chemical reaction device of the present invention, an Escherichia coli colony is pierced with a toothpick to attach a plasmid, and then added as a template from a sample injection port to a sample introduction channel containing a basic reaction solution. Since this system can be used, genomic libraries and cDNA libraries can be screened using this system. DNA including DNA cycle sequencing reactor
Analyzing equipment Currently, DNA sequencing (sequencing) involves:
It is common to carry out a Sanger reaction before that stage.
This is a one-way DNA polymerase reaction with the addition of four dideoxynucleotides (ddNTPs). This reaction is essentially the same as PCR, and a temperature cycle reaction may be performed in a temperature control device. Therefore, the same temperature control as described above is performed. However, in order to improve the accuracy of the Sanger reaction, a cycle of only the denaturation-extension reaction is added after the completion of the cycle of the denaturation-annealing-extension reaction. This corrects the reaction in which the elongation reaction was stopped irrespective of ddNTP. For example, the former cycle 20 times,
The latter cycle is 20 times. After completion of the reaction, the reaction solution is collected by a reaction solution collection device, and supplied to a sequence analyzer online. Suitable sequence analyzers are currently available for capillary electrophoresis sequencers (Appl.
ied Biosystem ABI PRISM310, PRISM3700, etc.). This apparatus is a multi-sample type sequencer having a capillary of 100 scales, and automatically sequentially injects a Sanger reaction solution.

The apparatus of the present invention can be applied to a quadrupole mass analyzer or a time-of-flight mass analyzer online. There is an advantage that the measurement time can be within a few seconds. However, since only tens of bases can be read, it is appropriate to use differently according to the purpose and the capillary electrophoresis method capable of reading 100 bases or more. Mass spectrometry is advantageous for SNP analysis, and electrophoresis is advantageous for genome sequencing. Enzyme assays Various tests that use blood and urine for diagnostics use enzyme assays and biochemical reactions. In this method, when an enzyme whose activity is to be measured reacts or a secondary metabolite whose abundance is to be detected reacts, it is colored or emits fluorescence. Since the reaction solution can be used as it is, it is possible to use a fluorescence analyzer or an absorption spectrometer as it is, so that the method becomes simple, and a large number of samples can be assayed.

[0031]

According to the present invention, a small number of samples are arranged in a microtube at predetermined intervals, and a large number of samples having the same reaction can be automatically processed. The reaction that can exhibit the most merit is a thermal cycle reaction represented by PCR because a microtube is used. As described in the application example above, if the reaction solution volume, the use of high-speed Taq polymerase, and the multiplex system are advanced, tens of thousands of samples can be processed per day. The analysis based on the PCR reaction is currently 1) SNP analysis (single nucleotide polymorphism) 2) Food and environmental inspection (analysis of pathogenic bacteria and viruses) 3) Genome sequencing 4) Forensic medicine (criminal investigation) 5) Industrial microorganisms, livestock, A wide range of fields such as cereal and horticultural plant breeding and genetic engineering are expected, and the effectiveness of each is expected to be demonstrated.

[0032]

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples.

Example 1 Inspection of Salmonella in Foods A chemical reaction apparatus as shown in FIG. 4 was prepared. As a fine tube, a translucent Teflon tube having an inner diameter of 2 mm and a length of 2.5 m (PFA5679, manufactured by Sun Plastics Co., Ltd.) was used, and a mineral oil (Wako, special grade) was used as a carrier liquid. One end of the fine tube is inserted and fixed in a tank containing mineral oil. The other end is connected to a 50cm long, 1.8mm inside diameter silicone rubber tube and is contained in an oil receiving tank. A silicon rubber tube was set as a liquid sending device in a driving portion of a peristaltic pump (AC2129, AT-), and the mineral oil was set so as to be guided into the oil receiving tank at a speed of 2 cm / min through the fine tube. During this time, the sample injector (sample injector), temperature controller (multiple heat block)
And a detection device (fluorescence detector).

The sample injector is as shown in FIG.
Commercially available sample injector used for PLC (SV-6020
N, Tosoh) was modified and used. As shown in FIG. 3, the multiple heat block was custom made by passing a pipe through an aluminum plate, and a constant temperature liquid was circulated through the pipe. Specifically, the temperature of the heat block is set to 94 ° C., 55 ° C., 72 ° C. from the side closer to the sample injection device, and the liquid passage time is the processing time at that temperature, specifically 30 seconds ( 1cm (10cm only for the first time), 3cm, 3c so that it becomes 90 seconds and 90 seconds for the first time.
Set to m. As the thermostatic liquid, a silicone oil was used, and a circulating pump (Titec JP-40) was used for improvement. Glass cloth was used for the heat insulating material. Temperature variation was ± 2 ° C. As a fluorescence detector, a flow cell (capacity 12) of a commercially available product (F-1050 spectrofluorimeter, Hitachi) used for HPLC
μl, a channel shape (1.3 mm × 1.3 mm × 12 mm) was used.

(Preparation of sample) 1 g of food (pork meat) was weighed, crushed, and bouillon agar medium (Kyokuto Pharmaceutical Co., Ltd.)
30 ml), which does not contain agar)
The cells were cultured at 37 ° C. for 24 hours. After the reaction, 1m from the reaction solution
1 was sampled, centrifuged, collected, suspended in 100 μl of sterile water, and heat-treated at 95 ° C. for 5 minutes. The reaction solution was centrifuged (12000 rpm), and 50 μl of the supernatant was collected to obtain a sample.
As a positive control, Salmonella (S. typ.)
himurium, IFO 14194 (Fermentation Research Laboratories)) was inoculated into 1 g of food the day before with a platinum loop and left at room temperature for 24 hours to prepare a control.

(Inspection) A primer set (SIN-1 & -2, TAKARA,
(Concentration: 20 μM) To 30 ml of each solution, 1 ml of Super Taq Premix (Sawaday Technology) and 30 μl of a 1 mg / ml ethidium bromide solution were added to prepare a mixed solution. Metered syringe with Teflon tubing). 50 μl
Each sample was sent to the sample introduction channel, and 1 μl of the prepared food heat extract sample was inoculated from a sample inlet attached to the sample introduction channel. Since the amount of 50 μl of the above-mentioned basic reaction solution exceeds the capacity of the sample introduction channel (about 10 μl), when the basic reaction solution is introduced, it overflows. However, this overflow also serves to wash the sample introduction channel.

The liquid sending speed was set to 2 cm / min using the liquid sending device, the sample was reacted in the temperature controller (30 cycles), and the fluorescence analysis was performed by continuously measuring the fluorescence intensity at 560 nm with 260 nm excitation light. did. FIG. 5 shows the measurement results. The horizontal axis represents the measurement sample number, and the vertical axis represents the average value of the fluorescence intensity in arbitrary units. Sample No. 1 is a positive control, the other samples were not amplified, indicating that Salmonella was not present.

Example 2 Early Diagnosis of Phenylketonuria Since phenylketonuria can be prevented from intellectual impairment by giving a diet therapy (low phenylalanine diet) by early detection after birth, early diagnosis is extremely difficult. is important. This occurs due to an abnormality in phenylalanine hydroxylase, the gene of which is on chromosome 12.

(Outline of Apparatus of the Present Invention) An outline of the apparatus of the present embodiment is shown in FIG. Specifically, a reaction liquid sampling device is further provided in the device shown in FIG. 4, and the Sanger reaction is performed after ordinary PCR amplification. The reaction liquid sampling device is the same as the device shown in FIG. 2, and the reaction liquid is sampled from a sample inlet attached to the sample introduction channel shown in FIG. Here, the oil replacement channel and the reaction base solution reservoir are not used.

The sample injection device, liquid sending device, detection device, fine tube, carrier liquid, and speed control were the same as those in Example 1 and were carried out in the same manner. The temperature control device, which is a reaction device, used a heat block as shown in FIG. 3 and Example 1, but the method of passing the fine tube through the heat block was 9 cycles in the first 20 cycles.
4 ° C-55 ° C-72 ° C, the last 20 cycles at 94 ° C
The temperature was set to be -72 ° C. Each processing time is 30 seconds for the first 20 cycles (5 minutes only for the first time), 90 seconds, 9
The remaining 20 cycles were set to 30 seconds and 90 seconds in the same manner as in Example 1 so as to be 0 seconds. The presence or absence of amplification of the target DNA is monitored by a fluorescence detector, and the sample that has not been amplified must not be sent to the next step (Sanger reaction), and the timing when the amplified sample is sampled by the reaction solution collection device Use to take.
The steps are 1) PCR amplification step, b) Sanger reaction step,
c) It consists of three parts of the sequencing step.

In the PCR amplification step, amplification was carried out across the site where the mutation of the phenylalanine hydroxylase (PAH) gene occurs. In the next Sanger reaction step, the amplified DNA
Was used as a template to perform a Sanger reaction using a dye-labeled ddNTP (dye terminator) and primers for nest amplification (amplification of the inner sequence). In the thermal cycle, the same temperature control as in the PCR amplification step was repeated.
In the final sequencing step, the reaction solution is introduced directly into the capillary of the capillary electrophoresis sequencer from the collection port of the reaction solution collection device to perform sequencing.
Here, 10 samples were performed via a manual.

(Genetic test) Total blood DNA was obtained from dried filter paper blood (obtained from Osaka University Hospital) of 10 infants (1 year old) by the method of Giulla et al. (Extracted with hot water, Giulla, TA,
After the centrifugation (15,000 rpm), the precipitate was dissolved in a digestion buffer (0.32 M sucrose, 10 mM Tris-HCl (pH 7.5), 5 mM Mg).
Wash twice with Cl ₂ , 1% Triton X-100) and buffer for PCR (50 mM KCl, 10 mM Tris-HCl (pH8.3), 2.5 mM MgCl
₂ , 0.02% gelatin) was suspended in a solution to which proteinase K (10 units) was added per 0.1 ml to prepare a sample. The DNA sequence of the phenylalanine hydroxylase gene is registered under the accession number U49897 of DDBJ. P which amplifies from base number 1650 to 1770 based on the data
CR primer, PAH1-FW (CCAAGGAGA
AAGTAAGGAAC), PAH1-REV1 (CA
GCCAAAATCTTAAGCTGC), and 175
Primers that amplify to 0, PAH1-REV2 (TG
GGTATTGTCCAAGACCTC) was synthesized (Sawasdee Technology).

In the PCR amplification step, 1 ml of SuperTaq Premix (Sawaday Technology), PAH1-FW and PA
Each of the H1-REV1 primers (20 μM concentration solution)
0 μl and 1 μl of a 1 mg / ml ethidium bromide solution were mixed to prepare a reaction base solution.

In the same manner as in Example 1, the reaction base solution (50 μm) was used.
is introduced into the sample introduction channel, and blood DNA is introduced from the sample inlet.
Was added to prepare a PCR reaction solution. After switching to the main channel, it was subjected to a thermal cycle. 94 ° C-55 ° C-72 ° C for the first 20 cycles
And the other 20 cycles were performed at 94 ° C.-72 ° C.
Was done. After the reaction, 5 μl of each sample was collected from the reaction solution collection device, and DN was collected with a spin column (Pharmacia SP-400)
A was purified and quantified. This was performed continuously for 10 samples.

In the Sanger reaction step, a cycle sequence solution (Applied Bios
ystem, Dye Terminator Cycle Sequence FS Core kit)
To 1.0 ml, 30 μl of PAH1-REV2 (concentration: 2 μM) was added as a primer to prepare a reaction base solution. 5
0 μl was introduced into the sample introduction channel, and 2 μl (about 0.5 μg) of the DNA solution purified by the above-described spin column was added from the sample inlet. It was put in the main channel, and the same thermal cycle as in the PCR amplification step was repeated.

In the sequencing step, the reaction solution was introduced directly from the collection port into a capillary electrophoresis sequencer (ABI PRISM310, Applied Biosystem), which was an analyzer, and sequenced according to the device manual.

Normal PAH gene 1681-1700
Is the sequence of CAATAACCCTGGCCCTTCTCA
In this case, 9 samples except the control were normal. In abnormal people (haplotype 2), the 1689th was changed to T (Dilella, AG, et al., Science 2301350).
-1354 (1985). )

[0048]

[Sequence List] <110> Koji Kajimura: Director General, Agency of Industrial Science and Technology <120> Microvolume Chemical Reaction Equippment (130> 113MS0236 <160> 4 <210> 1 <211> <212> DNA <213> Artificial Sequence <400> 1 CCAAGGAGAA AGTAAGGAAC 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 CAGCCAAAAT CTTAAGCTGC 20 <210> 3 <211> <212> DNA <213> Artificial Sequence <400 > 3 TGGGTATTGT CCAAGACCTC <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 CAATACCTCG GCCCTTCTCA 20

[Brief description of the drawings]

FIG. 1 shows a cross-sectional view of a microtube in an apparatus of the present invention.

FIG. 2 shows an example (a three-dimensional view and a sectional view) of a sample injection device in the device of the present invention.

FIG. 3 shows an example of a temperature control device in the device of the present invention.

FIG. 4 shows an example of the chemical reaction device of the present invention.

FIG. 5 shows the results of a Salmonella test on foods obtained in Example 1.

FIG. 6 shows an example of the chemical reaction device of the present invention.

[Explanation of symbols]

 DESCRIPTION OF SYMBOLS 1 Carrier liquid 2 Aqueous sample 3 Rotating body 4 Rotating shaft 5 Main flow path (fine tube) 6 Sample introduction flow path 7 Washing flow path 8 Disk disk 9 Reservoir 10 Reaction basic liquid 11 Sample injection port 12 Cleaning liquid reservoir 13 Cleaning liquid 14 Compressed air 15 Drain 16 Heat block 17 Constant temperature liquid 18 Insulation material 19 From sample injection device to 20 detection device

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 16, 2000 (2006.1.
6)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Correction contents]

[Claims]

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12Q 1/68 G01N 35/08 C 4G075 G01N 35/08 C12N 15/00 A F term (Reference) 2G058 AA01 BB02 BB09 BB15 DA02 FB05 FB12 FB25 GA02 GA14 4B024 AA20 HA19 4B029 AA23 BB20 4B063 QA01 QA13 QA17 QA18 QQ42 QQ52 QR08 QR62 QS02 QS25 4G057 AB21 AB38 AD03 AE21 4G075 AA12 BDA DAB BD

Claims (6)

[Claims] Claims: 1. A chemical reaction device having a fine tube reaction part filled with a carrier liquid immiscible with water, the device comprising:
(1) a sample injection device for injecting an aqueous sample into a microtube at a predetermined interval; (2) a device for feeding a carrier liquid and an aqueous sample in the microtube; and (3) a temperature control device for controlling the temperature of a reaction portion of the microtube. And (4) a device including a detection device. 2. The apparatus according to claim 1, wherein the carrier liquid is an inert hydrophobic oil. 3. The method according to claim 2, wherein the carrier liquid is a mineral oil.
An apparatus according to claim 1. 4. The apparatus according to claim 1, wherein the chemical reaction device is a DNA analysis device based on a polymerase chain reaction (PCR).
3. The apparatus according to any one of 3. 5. The apparatus according to claim 1, wherein the chemical reaction device is a DNA analysis device based on a cycle sequencing reaction.
An apparatus according to any one of the above. 6. The apparatus according to claim 1, further comprising (5) an apparatus for collecting a reaction solution.