JP2001106671A - Solid phase support for oligonucleotide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a solid phase support for synthesis of oligonucleotide. SOLUTION: This solid phase supporter is a compound shown by the formula [R is an alkyl, aryl, arylalkyl, heteroalkyl or heteroaryl] for synthesis of oligonucleotide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for synthesizing an oligonucleotide having a low molecular weight tail molecule bonded to the 3′-terminal of the oligonucleotide via a linking molecule. Oligonucleotides having molecules and intermediates utilized in the synthesis of such oligonucleotides.

[0002]

BACKGROUND OF THE INVENTION Oligonucleotides have a variety of uses, including acting as primers in the polymerase chain reaction synthesis of DNA. Oligodeoxynucleotides (ODN) are conveniently synthesized on a solid support using the phosphite-triester synthesis method. See T. Atkins et al. For details of such synthesis [T. Atkinson,
M. Smith, Oligonucleatide Synthesis, A practica
l Approach, MJ Gait (ed.), IRL press, pp. 35-
81 (1984)]. This document discloses detailed steps depending on the process conditions for the actual synthesis of oligonucleotides. In fact, the method described in this document is currently utilized in commercial oligonucleotide synthesizers available from various manufacturers.

[0003] Aserain et al. [Proc.
Natl. Acad. Sci. 81,3297-3301 (198
4))] discloses the synthesis of certain oligonucleotides. There, an intercalating reagent is covalently attached to the oligodeoxynucleotide. The intercalating reagent used is 2-methoxy-6-chloro-9-aminoacridine. The acridine molecule is covalently bound to the oligonucleotide via a methylene chain of 3 to 6 carbon atoms linking the 3'-phosphate of the oligodeoxynucleotide to the 9-amino group of the acridine molecule. The authors of this study have found that acridine-modified oligonucleotides show great stability with intercalating reagents (ie, acridine) in the presence of complementary sequences. The authors measured certain thermodynamic parameters and show that through these parameters the covalent attachment of the acridine ring strongly stabilizes the binding of the synthetic oligonucleotide to the complementary sequence. The melting temperature (Tm) of an oligonucleotide with bound intercalating reagent and complementary strand is higher than the melting temperature of a similar oligonucleotide without intercalating reagent and complementary strand. The authors conclude that these results clearly indicate that the presence of the intercalating reagent strongly stabilizes the complex formed between the oligonucleotide and its complementary strand. ing.

In a similar study, Letsinger et al. (Lets
inger et.al. (Proc. Natl. Acad. sci. 86,6553-
6556 (1989)), making a group of oligonucleotides with cholesteryl groups covalently linked in the phosphate linkage between the 3 'termini of the nucleotides.
Oligomers of various lengths have been synthesized. Oligomers having a cholesteryl moiety adjacent to either the 3 'terminus or both the 3' and 5 'termini are compared to oligomers not so substituted. These compounds are HI
It was tested for its inhibitory effect on V-replication. Immobilization of one cholesteryl group adjacent to the 3 'end of 20 oligonucleotides substantially increased the antimicrobial activity of the oligonucleotides. When the second cholesteryl group was immobilized on the 5 ′ end of the oligonucleotide, the antibacterial activity was reduced as compared with the monocholesteryl derivative oligomer.

The compounds of Letsinger et al. Were first prepared manually by hand with support-bound dinucleoside hydrogen phosphonate derivatives. The cholesteryl group is then attached to the internucleotide phosphorus by oxidative phosphoramidation. Oligonucleotides use phosphoramidation,
It was extended from the first dinucleoside by a commercially available DNA synthesizer.

[0006] Commercially available controlled pore glass beads for oligonucleotide synthesis are available [CPG,
Inc., Pierce Chemical Co. and Sigma Chemical
Co.]. As described above (Atkins and Smith), controlled pore glass beads (hereinafter CPG) are long-chain alkylamines, for example, which have free amino groups available at their termini, while being bound to CPG. Modified by the manufacturer with the alkylamine used. Various amide bonds are obtained with the terminal amine of the long chain alkylamine on the CPG for attachment to the oligonucleotide that grows during its synthesis. An improvement in this synthesis was described by Pon et al. [Pon et. Al. BioTechniques 6 (8), 768 (198).
8))]. In this report. Pon et al. Previously capped potentially contaminating side chains on long-chain alkylamine CPGs and replaced them with the commonly used toxic coupling reagent DCC (dicyclohexylcarbodiimide).
The use of EC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide, water-soluble carbodiimide or EDC) has been introduced.

[0007] Nelson et.al (Nuc. Acids)
Research 17 (18), 7187-7194 (198
9))) recently reported the synthesis of oligonucleotides incorporating a 3 'terminal substituent. In order to prepare an oligonucleotide with a 3'-terminal tail molecule, Nelson et al.
Induces 1,2-propanediol followed by p-
Treated with nitrophenol. The activated derivative is then immobilized on a long chain alkylamine CPG support. The dimethoxytrityl protecting group is removed from the primary alcohol, propanediol, and the oligonucleotide is synthesized stepwise from the primary hydroxy group while immobilized on the CPG support. The synthetic nucleotide was deprotected and separated from the CPG carrier. However, the purity of this 3'-amine modified oligonucleotide has not been proven. At this stage of the synthesis,
The 3 'terminal substituent must still be attached to the oligonucleotide. Biotin-X
Biotinylate with X-NHS ester. After biotinylation, a second purification by both Sephadex and HPLC is required.

The above-mentioned method of Nelson et al. Forms an oligonucleotide having a functional group that can be induced and modified with a tail molecule forming reagent, and then repurifies the oligonucleotide. However, derivatization with tail molecule forming reagents is performed only after completion of oligonucleotide synthesis. Valuable oligonucleotides that are finally completed systematically through the steps of assembling nucleotides by nucleotides suffer losses due to incomplete reactions, side reactions, and the number of purification operations required after derivatization due to derivatization to such oligonucleotides. It is. In addition, this synthesis does not employ the Pon et al. Improvement described above.

[0009]

The usefulness of oligonucleotides is demonstrated, for example, in 3'-tailed cholesterol and 3'-tailed acridine oligonucleotides as described in Letsinger et al. And Asseline et al. It can be improved by including a low molecular weight group at the terminal. The stability of the 3'-tailed oligonucleotide in serum is also increased. For example, unmodified O
DN is rapidly degraded by 3'-exonuclease in media containing serum. Certain chemical modifications of the 3'-terminal phosphodiester can prevent this degradation. Shaw et al. [Show et. al. (Nucl. Acids Res. 19
(4), 747 (1991))] significantly improved nuclease stability by converting the phosphodiester bond between the last two nucleotides to a phosphorothioate, phosphoramidate, or reverse bond. Other linkages that have been shown to improve nuclease stability include α-
There are deoxynucleotide derivatives and methylphosphonate derivatives.

[0010]

SUMMARY OF THE INVENTION It is a primary object of the first aspect of the present invention to provide an improved method for oligonucleotide synthesis having a low molecular weight tail molecule attached to the 3 'end of the oligonucleotide. Yet another object is to provide a method for the synthesis of oligonucleotides of low molecular weight linked to an oligomer via a linking molecule. Another object of the present invention is to provide, at the 3 'end, an oligonucleotide derivatized with a phosphonate ester and a tail molecule attached to the phosphonate ester. Furthermore, the purpose is to provide suitable linking molecules and supports for the production of oligonucleotides. It is a further object to provide a linking molecule with a suitable low molecular weight molecule such that an oligonucleotide can be assembled.

A second aspect of the present invention discloses a linking molecule having a protected amino group, which can be used for oligonucleotide synthesis. A third aspect of the present invention provides a reagent with a tail molecule having an insertion group (intercalating group) that can be added to an oligonucleotide modified with an amino group. A fourth aspect of the present invention can be used for oligonucleotide synthesis,
A linking molecule having a protected alkanol group is disclosed.

These and other objects that will become apparent from the remainder of this specification have been described by way of a 3 ′ linkage via a linking molecule.
Achieved by oligonucleotide synthesis with a low molecular weight tail molecule attached to the end. The method of the first embodiment is to select as a linking molecule a molecule having three independent functional groups, each exhibiting a different chemical reactivity, apart from the reactivity of the other two functional groups. Consists of The first functional group of the linking molecule is reacted with a low molecular weight tail molecule to attach the tail molecule to the linking molecule. The second functional group of the linking molecule is treated with succinic anhydride and the resulting carboxylic acid residue is reacted with the solid support to bind or bind to the linking molecule with a tail molecule attached to the solid support. Fix it.

Throughout the disclosure, the attachment of the linking molecule bearing a hydroxyl group (eg, R-OH) to the solid support is completed via a succinate linkage, as described above. Thus, in the "support-OR" formula, the designation "support-O" includes such succinate linkages.

The first 3'-phosphoramidite nucleotide is then reacted with a third functional group on the linking molecule, linking the nucleotide to the linking molecule via the 3 'end. When the first nucleotide is attached to the linking molecule, the nucleotide binds to the tail molecule via the linking molecule and also attaches or is fixed to the solid support via the linking molecule. Further, the 3'-phosphoramidite nucleotide is subsequently reacted with the 5 'end of the preceding nucleotide, producing a synthetic oligonucleotide attached to the linking molecule at the 3' end of the oligonucleotide. As with the first nucleotide, the synthetic nucleotide binds to the linking molecule via the 3 'end while it binds to the tail molecule and the solid support. Thus, the growing oligonucleotide is bound to a solid support while further reacting with the oligonucleotide. The oligonucleotide with the tail molecule attached to the 3 'end via the linking molecule is then detached from the solid support by breaking the link between the second functional group of the linking molecule and the solid support. An oligonucleotide having a tail molecule attached to the 3'-end via a linking molecule is then isolated.

In a preferred embodiment of the first aspect of the present invention, the functional groups on the linking molecule include primary alcohols, secondary alcohols and amines. Reacting the tail molecule with an amine to bind the tail molecule to the linking molecule and reacting the solid support with the secondary alcohol to attach the linking molecule having the tail molecule to the solid support; The roamidite nucleotide is reacted with the primary alcohol to bind the linking molecule.

(2S, 4R) -4-hydroxy-2-hydroxymethylpyrrolidine (4-hydroxy-2S-trans) -2-pyrrolidinemethanol or trans-4
-Hydroxy-L-prolinol) is particularly preferred as a linking molecule.

The tail molecule includes a reporter group, an intercalating group, a lipophilic group, and a cleavage group (cleaving group).
Selected as any one of a number of molecules of interest. A suitable lipophilic group is cholesterol. Suitable as reporter groups are biotin and fluorophores such as acridine, fluorescein, rhodamine,
Lysamine rhodamine B, malachite green, erythromycin, tetramethylrhodamine, eosin, pyrene, anthracene, 4-dimethylaminonaphthalene, 2
-Dimethylaminonaphthalene, 7-dimethylamino-4
-Methylcoumarin, 7-dimethylaminocoumarin, 7-
Hydroxy-4-methylcoumarin, 7-hydroxycoumarin, 7-methoxycoumarin, 7-acetoxycoumarin, 7-diethylamino-3-phenyl-4-methylcoumarin, isoluminol, benzophenone, dansyl,
Dabcyl, mansyl, sulfodamine, 4-acetylamido-4'-stilbene-2,2'-disulfonate disodium salt and 4-benzamide-4'-stilbene-
2,2'-disulfonate disodium salt. Suitable as intercalating groups would be acridine, ellipticine, methidium, ethidium, phenan, phenanthroline, suloline, 2-hydroxyethanethiolate-2,2 ', 2 "-terpyridine-platinum (II) and quinoxaline. Cleavage group
Is suitable as EDTA for binding iron (Fe).
Ligand or porphyrin ligand, and copper (Cu)
For binding phenanthroline (phenanthroline)
Is a ligand.

For the reaction of the linking molecule with the amine, the tail molecule is selected to include a unique connecting group, or an additional connecting group is attached to the tail molecule via appropriate chemical synthesis. With the use of an additional connecting group, it is used after linking to link the tail molecule to the connecting molecule like a unique connecting group. Regardless of whether intrinsic or additional connecting groups are used, connecting groups are those that react with the linking molecule to link the tail molecule to the linking molecule. The third functional group of the linking molecule is selectively protected after linking the tail molecule to the linking molecule via the first functional group and before linking the linking molecule to the solid support. The linking molecule having the protected third functional group is
It is then attached to the solid support via a second functional group. The third functional group is then deprotected and the first phosphoramidite nucleotide is attached to the linking molecule via the deprotected functional group.

The object of the first aspect of the present invention is further achieved by an oligonucleotide derivative having a 3'-terminal hydroxyl group (hydroxy group). The phosphate ester is located on the 3'-terminal hydroxyl group and has the formula

Embedded image Or

Embedded image (In the formula, Z is -CO-Qn-R, -CO-O-Qn-R,-
CO-NH-Qn-R, -CS-NH-Qn-R, or-
SO ₂ -Qn-R, m and m 'are independently less than 11 positive integer, n represents 0 or 1, Q is connected radical, R represents a reporter group, intercalating groups, lipophilic groups and cleaving Selected from the group consisting of:

Of this group, particularly preferred are structural formulas

Embedded image Is a compound of

Particularly preferred 3'-tailed oligonucleotides include oligonucleotides having either cholesterol or acridine attached to the 3 'end of the oligomer via a linking molecule. The cholesterol group is attached to the linking molecule using a carbamate bond, and the acridine group, preferably 9-ethylacridine or another 9-alkylacridine, is an amide bond (actually, the ethyl group of 9-ethylacridine is assumed). (In this case, an alkylamine bond). The other tail molecule is linked to the linking molecule via a urea, thiourea or sulfonamide bond.

When linking the tail molecule to the linking molecule, the connecting group Q is preferably alkyl, alkoxy, alkoxyalkyl, alkenyl, cycloalkyl, aryl, aryloxy, aralkyl, heterocyclic, heteroaryl, substituted aryl, substituted aryl, Selected from the group consisting of aralkyl.

Further, an object of the first aspect of the present invention is that

Embedded image Or

Embedded image (In the formula, Z is -CO-Qn-R, -CO-O-Qn-R,-
CO-NH-Qn-R, -CS-NH-Qn-R, or-
SO ₂ -Qn-R, m and m 'are independently positive integers smaller than 11, n is 0 or 1, Q is a connecting group, R is a reporter group, an intercalating (inserting) group, a lipophilic group. And Y is H or dimethoxytrityl and X is a solid support), which is achieved with compounds and supports for oligonucleotide synthesis. Useful supports include controlled pore glass supports derived from long chain alkylamines.

Of this group, particularly preferred are structural formulas

Embedded image Is a compound of

The object of the first aspect of the present invention is further to

Embedded image Or

Embedded image (In the formula, Z is -CO-Qn-R, -CO-O-Qn-R,-
CO-NH-Qn-R, -CS-NH-Qn-R, or-
SO ₂ -Qn-R, m and m 'are each independently a positive integer smaller than 11, n is 0 or 1, Q is a connecting group, and R is a reporter group, an intercalating group, a lipophilic group and a cleavage group. Wherein Y is H or dimethoxytrityl).

Of this group, particularly preferred are those having the structural formula

Embedded image Is a compound of

In each of the above structural formulas, m and m ′ are positive integers smaller than 11, that is, each independently represents 1, 2, or
3, 4, 5, 6, 7, 8, 9 or 10. Particularly preferred are compounds wherein m and m 'are 6 or less, that is, independently 1, 2, 3, 4, 5, or 6.

Another aspect of the presently claimed invention is to provide improved compounds and methods for the synthesis of the conventional carboxylic acid tetrafluorophenyl (TFP). Such activated ester derivatives are advantageously (1)
Used for the synthesis of acridine-CPG (this is the 3'-
It can also be used for the synthesis of oligonucleotides with tail molecules), (2) 3′-amine—used for modification after the synthesis of oligonucleotides with tail molecules, and (3) for modification of ribonucleotides with internal amine modification Can be used.

An embodiment of the present invention further discloses an aminohexyl-modified solid support and a hexanol-modified solid support that are advantageously used for the synthesis of 3'-tailed oligonucleotides.

[0030]

BEST MODE FOR CARRYING OUT THE INVENTION A.1 ' Oligonucleotide with Tail Molecule
Modification with 3'-tail molecule for direct synthesis of leotide
Solid Support (Method A) The present inventors have found that an oligonucleotide having a low molecular weight tail molecule attached to the 3 ′ end of the oligonucleotide can be synthesized using the linking molecule. The linking molecules are chosen to have three chemically distinct functional groups.
With such a linking molecule, a low molecular weight tail molecule is first attached to the linking molecule. The linking molecule with the low molecular weight tail molecule is then bound or immobilized on a solid support. The oligonucleotide is then synthesized. During synthesis, the oligonucleotide is immobilized on a linking molecule, which is then immobilized on a solid support system. Oligonucleotides are synthesized using standard phosphoramidite chemistry, either manually or on a DNA synthesizer. Upon completion of the synthesis of the oligonucleotide, the synthetic oligonucleotide having the linking molecule and the low molecular weight tail molecule attached thereto is cleaved from the solid support. This releases the oligonucleotide from the solid phase system. Oligonucleotides have a low molecular weight tail molecule attached to the 3 'end via a linking molecule.

Using the above manufacturing steps, oligonucleotides having a low molecular weight tail molecule attached to the 3 'end need only be subjected to a single purification step. Thus,
Oligonucleotides with the molecule attached to the 3 'end are easier and faster to produce than conventional techniques.

The linking molecule having a suitable low molecular weight attached thereto is synthesized independently of oligonucleotide synthesis. Once the linking molecule with the linked tail molecule is made by reacting the tail molecule with the first functional group of the linking molecule, the combination of linking molecule and tail molecule will each have a 3 'terminal. Can be regarded as suitable reagents for use in DNA synthesizers for the production of a number of different oligonucleotides with low molecular weight molecules attached to DNA. This allows for the synthesis and storage of large quantities of combinations of linking molecules and tail molecules, if desired. In addition, other combinations of linking molecules with various other tail molecules are made in a similar manner. These can be used by non-organic chemists of oligonucleotide synthesis using a DNA synthesizer. Thus, even those who are not skilled in the field of synthetic organic chemistry, as the first reagent in such an automatic DNA synthesizer for the synthesis of nucleotides having a selected low molecular weight tail molecule attached to the 3 'end. Some of the linking molecule-tail molecule combinations can be readily used.

In addition, many oligonucleotides having a common sequence for many nucleotides and different sequences for the remainder of the oligonucleotide but having the same 3'-tail molecule in question as the linking molecule are simply It can be produced by resolving a solid support having partially formed "common" oligonucleotides and coupling this to a linking molecule and a tail molecule of interest. The synthesis of the different parts of the oligonucleotide is accomplished by loading the individual parts of the solid support having the common part of the oligonucleotide into a DNA synthesizer to complete the desired sequence of nucleotides.

Compound (2S, 4R) -4-hydroxy-2
-Hydroxymethylpyrrolidine, compound I of step I, (4
-Hydroxy- (2S-trans) -2-pyrrolidinemethanol or trans-4-hydroxy-L-prolinol also serves as a particularly useful linking molecule for attaching the molecule of interest to the 3 'end of the oligonucleotide. .
This compound is readily prepared from commercially available N-CBZ-L-hydroxyproline (sigma chemical Co.). Stanfield et al. [Stanfield et.al. (J. Org.chem. 4)
6, 4799 (1981)) reduction of N-CBZ-L-hydroxyproline using an analogous procedure to that described by the borane - tetrahydrofuran complex (Al
drich chemical Co.). This reduction proceeds while maintaining the optical purity, and compound 1 is obtained. The CBZ protecting group of compound 1 is easily removed using palladium-carbon reduction under a stream of hydrogen. This reaction proceeds smoothly and gives a quantitative yield of compound 2.

Compound 2 contains a primary hydroxyl group which is used as a base substance from which oligonucleotides are synthesized. In addition, compound 2 contains a secondary alcohol group used to attach the solid support and a secondary amine used to attach the tail molecule of interest. Upon completion of the oligonucleotide synthesis, the tail molecule of interest remains attached to the oligonucleotide via the linking molecule. After cleavage of the completed oligonucleotide containing the molecule of interest linked via the linking molecule from the solid support, the secondary hydroxyl groups of the linking molecule are essentially spatially retained, linking the linking molecule to the first nucleotide. Move away from near the phosphate bond to be bound. This results in increased stability of the linkage between the linking molecule and the 3 'terminal phosphonate group of the oligonucleotide.

Furthermore, since compound 2 is a single optical isomer and not a mixture of various stereoisomers, the bond between the 3 'end of the oligonucleotide and the linking molecule also results in a single isomer. Does not produce a mixture of stereoisomers that will affect physical properties. This is particularly important when attaching an intercalating group or other reactive group to the 3 'end of the oligonucleotide. This is because optimal binding of the intercalating agent to double-stranded nucleotides and complementary DNA moieties has precise and important prerequisites for steric morphology.

Other linking molecules have the structural formula

Embedded image (Wherein m and m ′ are positive integers from 1 to 10)
It is. These linking molecules also have an amino group in the structure,
It also has a primary hydroxyl group and a secondary hydroxyl functional group. Two particularly useful linking molecules of this class are 3-amino-1,2-propanediol and 4-amino-1,3-butanediol (13) (see step III).

The attachment of the tail molecule of interest to the linking molecule takes place completely independently of the oligonucleotide synthesis described above.
The low molecular weight tail molecule of interest is attached to the linking molecule using organic chemistry techniques and reactions. The secondary amino group of the linking molecule can link the low molecular weight tail molecule of interest to the linking molecule, eg, compound 2
It is utilized to bind via any of a number of suitable connecting groups or bonds, such as, for example, an amide, carbamate, urea, thiourea or sulfonamide bond. With this disclosure, any other suitable reaction between a linking molecule, for example, a secondary amine of compound 2 and a compound of interest, with a suitable connecting group or linking group can also be performed.
It will be suggested to those skilled in the art.

For the purpose of clarifying the specification and the appended claims, the term "linking molecule" and the term "linking group" as used to attach a tail molecule to the linking molecule will be used. In order to avoid confusion between the two, "connecting groups" (Connecti
The term ng group ") is used to indicate connecting or connecting groups. Regardless of the name given to these groups,
These groups link, connect or attach the tail molecule to the linking molecule.

When the molecule of interest, which is the 3 'tail molecule of the oligonucleotide, is thus connected to a linking molecule, the primary hydroxyl group on the linking molecule is preferably protected with a group such as, for example, a dimethoxytrityl group. . This is conveniently achieved using dimethoxytrityl chloride (DMTrcl) in pyridine in the presence of 4-dimethylaminopyridine (DMAP). This selectively protects the primary alcohol group of the linking molecule. The secondary alcohol of the linking molecule is then converted to a succinic ester using succinic anhydride.
The succinate of the linking molecule having the low molecular weight compound of interest can be obtained by either the conventional method of p-nitrophenol-DCC of Atkinson et al. (Supra) or the modified DEC method of Pon et al. (Supra). And connected to a glass support with controlled pores. DEC is DC
It is currently the preferred method, as long as it is less toxic than C, in that it is water soluble and eliminates the need to treat the succinate with p-nitrophenol.

The linking molecule having the linked low molecular weight compound of interest protected with a dimethoxytrityl group is then linked to the linking molecule.
It is linked or immobilized in a standard manner to a glass substrate of regulated pores having long-chain alkylamine groups. Restricted pore glass supports derivatized with long-chain alkylamines are available [Pierce Chemical or Sigma
Chemical]. These are preactivated with dichloroacetic acid using the method of Pont et al. (Supra) and then reacted in pyridine with a linking molecule protected with a dimethoxytrityl group bearing the binding molecule of interest using DEC as the coupling reagent. After linking the linking molecule to the solid support, the excess long-chain alkylamino group on the support is capped by acetylation with acetic anhydride.

The dimethoxytrityl group is removed from the primary alcohol of the linking molecule by treatment with 3% dichloroacetic acid in dichloroethane. The resulting regulated pore glass support, having the primary hydroxyl group of the deprotected linking molecule together with the low molecular weight tail molecule linked via the linking molecule, is ready for oligonucleotide synthesis. The solid support with the linking molecule and the molecule of interest can also be produced in large quantities and then aliquoted for the synthesis of large numbers of oligonucleotides or stored for later use. In any case, oligonucleotide synthesis
Using formamide chemistry on a DNA synthesizer, such as the Milligen DNA synthesizer, in a standard manner, starting from the primary hydroxyl group of the linking molecule.

Once the synthesis of the oligonucleotide is completed, the oligonucleotide is deprotected by standard methods for oligonucleotides synthesized on an automatic DNA synthesizer. Oligonucleotides with a low molecular weight tail molecule attached to the 3 'end via a linking molecule are then cleaved from the solid support by standard methods of automated DNA synthesis using concentrated ammonia at room temperature in a conventional manner.

To purify an oligonucleotide having a low molecular weight tail molecule linked to the 3 'end via a linking molecule, only one purification is required. This is reversed phase high speed liquid
(HPLC) Conveniently using chromatography. The low molecular weight tail molecule to be attached to the 3 'end of the oligonucleotide can be one of many molecules of biological interest. Included in this group can be reporter groups, intercalating (inserting) groups, lipophilic groups and cleaving groups. Of the lipophilic groups, currently particularly preferred is cholesterol. Particularly preferred at present for the reporter groups are biotin and fluorophores, such as acridine, fluorescein, rhodamine, lisamine rhodamine B, malachite green, erythrosine, tetramethylrhodamine, eosin, pyrene, anthracene, 4-dimethylaminonaphthalene, 2-dimethylaminonaphthalene, Dimethylaminonaphthalene, 7-
Dimethylamino-4-methylcoumarin, 7-dimethylaminocoumarin, 7-hydroxy-4-methylcoumarin,
7-hydroxycoumarin, 7-methoxycoumarin, 7-
Acetoxycoumarin, 7-diethylamino-3-phenyl-4-methylcoumarin, isoluminol, benzophenone, dansyl, dabsyl, mansyl, sulfo-rhodamine, 4-acetamido-4'-stilbene-2,2'-
Disulfonate disodium salt, 4-benzamide-4 '
-Stilbene-2,2'-disulfonate disodium salt. Especially preferred for intercalating groups are acridine, ellipticine, methidium, ethidium, phenanthroline, 2-hydroxyethanethiolate-2,2 ', 2 "-terpyridine-platinum (II)
And quinoxaline. Presently, for the initiating groups, particularly preferred are EDTA or porphyrin ligands for binding iron and phenanthroline ligands for binding copper.

For a tail molecule that does not include a unique connecting group for attaching the tail molecule to the amino group of the linking molecule,
The tail molecule is reacted with a suitable reagent to attach an additional connecting group capable of reacting with the amine substituent of the linking molecule. Thus, regardless of whether the tail molecule has a unique connecting group capable of reacting with the amine of the linking molecule, or whether an additional connecting group must bind and react with the amino group of the linking molecule, The tail molecule is reacted with the amine group of the linking molecule to bind the tail molecule to the linking molecule. The following formula:

Embedded image Or

Embedded image In order to bind the tail molecule R via the linking molecule represented by the bond, the Z is selected from the following group. -CO-Qn-R, -CO-O-Qn-R, -CO-NH
-Qn-R, -CS-NH-Qn-R or -SO-
Wherein m and m 'are independently selected as positive integers less than 11, n is selected as 0 or 1, and Q is a connecting group. The tail molecule R is selected from the group consisting of a reporter group, an intercalating group, a lipophilic group and a cleavage group, wherein Y is H or dimethoxytrityl.

As an example, cholesterol chloroformate is reacted with a linking molecule to link the cholesterol group to the linking molecule via a carbamate connecting group. Further by way of example, reaction of 9-acridinepropionic acid with a linking molecule results in a linking molecule linked to 9-ethylacridine via an amide bond (see Step II).

If the cholesterol chloroformate described above is used as a precursor of the tail molecule, n is 0, and thus there is no Q, and Z is -CO-O-cholesterol. If 9-acridinepropionic acid as described above is used as a precursor of the tail molecule, n is 1 and therefore Q is present;
An alkyl residue, ie ethyl (Step II). In this example Z is -CO- (CH _{2) 2} -9- acridine.

When n is 1 and Q is present, an alkyl, alkoxy, alkoxyalkyl, alkenyl, cycloalkyl, aryl, aryloxy, aralkyl, heterocyclic, heteroaryl, substituted aryl or substituted aralkyl group is used as the connecting group Q. Suitable for Useful as a precursor molecule for the preparation of the compounds of the above formula when Z is a carbamate of the formula -CO-O-Qn-R is chloroformate. Z is a structural formula -CO-NH
Useful as precursor molecules for the preparation of compounds of the above formula when they are ureas of -Qn-R are isocyanates. For the preparation of compounds of the above formula where Z is a thiourea of the formula -CS-NH-Qn-R, isothiocyanates are useful as precursor molecules. Further, for the manufacture of the above formula of the compound where Z is a sulfonamide of structure -SO ₂ -Qn-R, sulfonyl halides are useful as a precursor molecule.

A variety of sulfonyl halide-based precursor tail molecules are available from Molecular Probes, Inc., Eugene, Oregon. Such sulphonyl halides are aromatic sulphonyl halides, wherein the sulphonyl halide moiety is, for example, a connecting group (moiety) specific to one of the rings of the tail molecule of interest, such as a rhodamine, naphthalene, pyrene or anthracene ring. ). In such an example, n is 0 in the above formula, so there is no connecting group Q. In general,
The halide ion is chlorine or fluorine, but bromine and iodine may also be useful.

A useful sulfonyl halide is sulforhodamine (trade name "Jexas Red", Molecular Probe).
s, Inc.). Also useful are risamine rhodamine B sulfonyl chloride, lisamine rhodamine B sulfonyl fluoride, 5-dimethylaminonaphthalene-1-sulfonyl chloride (dansyl chloride), 2-dimethylaminonaphthalene-5.
-Sulfonyl chloride, 2-dimethylaminonaphthalene-6-sulfonyl chloride, 6- (N-methylanilino) -naphthalene-2-sulfonyl chloride (mansyl chloride), 1-pyrenesulfonyl chloride, 2
-Anthracene sulfonyl chloride, 5-dimethylaminonaphthalene-1-sulfonyl fluoride (dansyl fluoride), and 4-dimethylamino-azobenzene-4'-sulfonyl chloride (dasyl chloride).

Various isothiocyanate-based precursor tail molecules are useful for creating a thiourea linkage between the tail molecule and the linking molecule. As with the sulfonyl halides described above, the isothiocyanate is generally present as a unique connecting group on the aromatic ring of the tail molecule, where n is 0 and therefore Q is absent. Such isothiocyanates are also available from Molecular Probes, Inc.

Suitable isothiocyanates for reacting with the linking molecule are fluorescein-5-isothiocyanate,
Fluorescein-6-isothiocyanate, tetramethylrhodamine-5- (and -6) -isothiocyanate, rhodamine X isothiocyanate, malachite green isothiocyanate, eosin-5-isothiocyanate, erythrosine-5-isothiocyanate, 7-
Diethylamino-3- (4'-isothiocyanatephenyl) -4-methylcoumarin, p- (5-dimethylaminonaphthalene-1-sulfonyl) aminophenylisothiocyanate, N- (4- (6-dimethylamino-2-benzofuranyl) ) Phenyl isothiocyanate hydrochloride, 1-pyrene isothiocyanate, 2-anthracene isothiocyanate, 4-dimethylaminonaphthyl-1-isothiocyanate, 9-acridine isothiocyanate, 4-
Isorluminol isothiocyanate, 4-dimethylaminophenylazophenyl-4′-isothiocyanate,
Benzophenone-4-isothiocyanate, 4,4′-diisothiocyanate stilbene-2,2′-disulfonate disodium salt, 4,4′-diisothiocyanate dihydrostilbene-2,2′-disulfonate disodium salt,
4-acetylamide-4'-isothiocyanate stilbene-2,2'-disulfonate disodium salt, and 4
-Benzamide-4'-isothiocyanate stilbene-2,2'-disulfonate disodium salt.

Other useful precursor molecules for the tail molecule, including those where n is 1 and thus a connecting group Q is present, are tetrafluorophenyl (TFP) esters, 5- (and 6-) carboxyfluorescein di Acetate succinimidyl ester, 7-dimethylaminocoumarin-4-acetic acid, 7-
Amino-4-methylcoumarin-3-acetic acid, 7-diethylaminocoumarin-3-carboxylic acid, 7-hydroxycoumarin-4-acetic acid, 7-hydroxy-4-methylcoumarin-3-acetic acid, 7-hydroxy-coumarin-3 -Carboxylic acid, 7-methoxycoumarin-3-carboxylic acid, 7-carboxymethoxy-4-methylcoumarin, 7-acetoxycoumarin-3-carboxylic acid, acridone-2-acetic acid, acridone-10-acetic acid, 9-anthracene Propionic acid, 1-pyrenebutanoic acid (pyrenebutyric acid) and N- (5-
Dimethylaminonaphthalene-1-sulfonyl) glycine
(Dansylglycine).

EDTA.Fe (II) has been used as a cleavage group with oligonucleotides. The EDTA molecule is attached to the base of the uridine nucleoside. A carboxyl terminated chain was extended from the uracil group to which EDTA was attached. In this method, while an EDTA-bound nucleoside is obtained, an oligonucleotide incorporating such a nucleoside is interfered by the EDTA molecule due to the presence of EDTA on the base, and as a result, the DNA between the DNA strand complementary to the oligomer is formed. Primary base binding can be disrupted. By use of the linking molecule of the present invention, the EDTA group is extended from the linking molecule away from the nucleotide bases, and thus to a position that does not interfere much more because of the first base pair on the complementary strand of DNA.

Reacting the linking molecule with an alkyl isocyanate such as, for example, ethyl isocyanate acetate, followed by treatment with ethylenediamine and EDTA-triethylester-N-hydroxysuccinimide ester provides the linking molecule with an EDT via an amide bond.
It will serve to attach the A group. In this case,
Additional connecting groups are used to form a bond with the linking molecule of the EDTA cleavage group. The conditions for the cleavage reaction were Dreye
r (Proc. Natl. Acad. Sci. 82 , 968-972).
(1985)), by adding a suitable oxidizing agent such as Fe (II) and dithiothreitol in an aqueous solution.

Further, the cleavage group, phenanthroline-Cu
(I) Upon binding the complex, 1,10-phenanthroline is aminated at the 5 or 6 position. The amine is then succinylated. The resulting terminal carboxylate is activated, for example by conversion to an N-hydroxysuccinimide ester, and used for reaction of the linking molecule with an amine or with an additional connecting group attached to the linking molecule. Cleavage with this reagent is described by Francois et al.
(Biochemistry 27 , 2272-2276 (198
The procedure is started by adding copper sulfate and mercaptopropionic acid in the same manner as in 8)).

Similarly, the secondary amino substituent of ellipticine is directly succinylated with succinic anhydride in pyridine,
The tetrahydrofuran is then used for attachment to the linking molecule.
N-hydroxysuccinimide ester (NHS) with DCC (1,3-dicyclohexylcarbodiimide) in (THF)
Ester). Quinoxaline requires amination of its ring prior to succinylation and activation, in a manner similar to periphenanthroline.

Bition having a long-chain spacer can be converted to succinimidyl ester by Molecular Probes.
It is also commercially available from. This product, 6- (6-biotinoylamino) hexanoylamino) hexanoic succinimide ester, is also referred to as biotin-XX-succinimide ester. In the same manner as the phenanthroline succinimide ester described above, it reacts with the amino group of the linking molecule and attaches a biotin tail molecule to the linking molecule.

Dervan et al. (J. Am. Chem. Soc. 10
0 , 1968 (1978)), p-carboxymethidium can be prepared for attachment to the linking molecule via its carboxyl group. Similarly, ethidium is produced.

A. 2. Synthesis of acridine TFP ester
And improved method of producing acridine CPG 9-Acridine alkanoic acid is strongly bound to DNA
(S. Tahenaka et al., Anal. Sci. 4 , 481 (198).
8)), can be produced with various different chain lengths. Acridine-modified ODNs have strict geometrical requirements for efficient insertion of the acridine molecule between the double-stranded base pairs of DNA, but these geometrical conditions are not predictable. difficult. Therefore, it is preferred to have a linking chain length that can be easily modified. In addition, the length of various bonds is evaluated with respect to bond strength. Oligonucleotide
The binding strength of (ODN) to its complementary nucleic acid strand is readily determined by thermal denaturation (Tm) studies.

Acridine alkanoic acids with various alkyl chain lengths are described in Jense and L.A. Howland (J. Am.
Chem. Soc. 48 , 1926 (1989)) by heating the corresponding aliphatic dicarboxylic acid with diphenylamine and zinc chloride. For example, a condensation reaction with adipic acid yielded 45 g (16% yield) of 5- (9-acridinyl) pentanoic acid. The two alkyl chain lengths used for the production of acridine-CPG are based on the other 3′-acridine tail molecule ODN (U.
Proc. Natl. Acad. Sci. USA 81 , 32
97 (1984)) was chosen to approximate the previously reported length to give the optimal Tm.

One embodiment of this aspect of the invention provides an improved method for the synthesis of acridine-CPG. This improvement uses an active ester derivative of acridinyl carboxylic acid as a precursor molecule.

[0063] Various acridinyl carboxylic acid active ester was evaluated as potential precursors for the acridine -CPG (10, 23). N-hydroxysuccinimide
(NHS) esters and p-nitrophenyl esters convert carboxylic acids to dicyclohexylcarbodiimide (DCC)
And then reacted with N-hydroxysuccinimide or p-nitrophenol. However, these condensation reactions involve starting carboxylic acid and by-product dicyclohexylurea (DCU).
Are difficult to perform because both are insoluble in organic solvents commonly used for DCC activation. Furthermore, these reactions were not completed and the desired ester could not be easily purified by silica gel column chromatography due to its instability. In contrast, TFP (tetrafluorophenyl) ester is suitably reactive with the nucleophilic amino group of trans-4-hydroxy-L-prolinol 2 and is sufficiently stable to allow purification by flash chromatography.

A typical method for activating a carboxylic acid to a TFP ester will be described. TFP esters 19 or 20 initially activate the carboxylic acid with 2-fluoromethylpyridinium tosylate (FMPT),
Prepared by forming an unstable intermediate and then reacting the unstable intermediate with 2,3,5,6-tetrafluorophenol to form a stable product (Step IV, Method a) reference). This reaction does not produce insoluble DCU, and the insoluble acridinyl carboxylic acid becomes soluble as the reaction proceeds. The obtained homogeneous mixture was purified by flash chromatography after removing the solvent. FMPT is a polar aprotic organic solvent
(Such as ether, THF, DMF and acetonitrile)
Particularly preferred activators for less soluble carboxylic acids.

The present invention also discloses improved reagents for the production of TFP esters. In summary, 2,3,5,6-
Treatment of tetrafluorophenol with trifluoroacetic anhydride gives TFP trifluoroacetate 18 . This improved reagent 18 was used as shown in Step IV, Method b,
When reacted with carboxylic acid in the presence of triethylamine, T
The FP ester is obtained. For example, 9-acridinylpropanoic acid was prepared by adding TFP trifluoroacetate 1 in methylene chloride.
Treatment with 8 and triethylamine gives the desired acridinyl TFP ester 19 .

In addition, other carboxylic acids are suitable for reaction with TFP trifluoroacetate 18 . In this regard,
Representative carboxylic acids are N-CBZ-L-phenylalanylglycine, protoporphyrin IX, 3-amino-9
-Ethylcarbazole succinimide and the like. Advantages of the disclosed reagent 18 and method of use thereof include the following. (1) TFP trifluoroacetate is easily produced from inexpensive starting materials. (2) Using this synthesis method,
No expensive condensation reagents are required to make the TFP ester. (3) Improved purification of the TFP ester product because trifluoroacetate is the only by-product of the disclosed reaction.

In particular, the preferred method (Example XXVII)
I, Method 2), in which the acridine-CPG support ( 10 and 23 ) comprises trans-4-hydroxy-L-prolinol 2 and the appropriate acridinyl as shown in Step V. Propionic acid or pentanoic acid TFP ester ( 19
Or 20 ). Purified TFP ester
Reacting 19 or 20 with aminodiol 2 gives a quantitative yield of the key intermediate amide product 7 or 21 . This method (Method 2) gives more reproducible results than the production of diolamide 7 directly from acridine carboxylic acid via the intermediate N-methylpyridinium ester (Example IX, Method 1, Step II) reference). 7 or
The 21 primary hydroxyl groups are selectively protected as DMTr ethers under standard conditions, giving 8 or 22 in good yield. The remaining secondary hydroxyl group is succinylated, and the resulting carboxylic acid is controlled with a long-chain alkylamine to control the pore glass support.
(LCAA-CPG), the desired ACr-CP
G ( 10 or 23 ) is obtained. DMTr of these CPGs
The degree of filling is 18.5 μmol / g and 20.6 μmol / g, respectively.

B. Use acridine TFP ester
Post-Synthesis Modification of 3'-Amine-Modified ODN (Method B) Oligonucleotides with a 3'-tail molecule are synthesized directly from a solid support having a 3'-tail molecule covalently attached (Method A,
See sections A.1 and A.2.). Alternatively, ODNs with 3'-tail molecules are synthesized using special solid supports that incorporate protected nucleophilic amino or thiol groups. A conjugate group is then introduced into such a 3'-tailed ODN by post-synthesis of the deprotected ODN with a suitable electrophile. In this aspect of the claimed invention, post-synthesis modification by Method B is advantageously used to introduce a sensitive 3'-tail molecule that cannot survive the synthesis conditions required for Method A. Further, method B
The advantages of are related to the large number of electrophilic conjugate groups utilized in the corresponding starting materials. In addition, method B requires a small amount of modified O
It is advantageously used for the production of DN.

OD with 3'-tail molecule disclosed herein
The two methods for N production (Method A and Method B) were compared by examining the reaction of acridine TFP esters 19 and 20 with a 3'-amine-tailed ODN. More specifically, 11 units of ODN with a 3'-amine-tail molecule having a sequence complementary to the initiation codon region of mRNA corresponding to the surface antigen protein of hepatitis B were produced. Such 3'-tailed ODNs with improved target nucleic acid binding would be advantageously used as antisense oligonucleotides.

C. Synthesis of ODN with 3'-amine-tail molecule
An embodiment of the present invention further comprises a 3 ′ as shown in step IV.
-To provide an improved solid support for the synthesis of ODNs with amine-tail molecules. Particularly preferred supports in this regard are 6
-Aminohexyl-modified CPG (AH-CPG) produced using -aminohexan-1-ol.

At present, modification of the 3'-end of ODN is available on commercial supports (eg, Clonrech Laboratories, Inc., Inc.).
"Amin-ON-CPG" by Palo Alto, CA). However, as noted above, such supports
(Corresponding to the support disclosed by Nelson et al., Supra)
Includes the production of at least two distinct 3'-tailed ODN products by PAGE analysis (about 1: 1),
Has significant additional disadvantages. In addition, derivatization of the 3'-amine tail molecule with various active esters always results in low yields, and HPLC (High Performance Liquid Chromatography) analysis shows that less than 50% of the starting ODN with 3'-amine tail molecule. Only reacts.

The suggested mixed products include: (1) the transfer of the phosphate moiety of the first nucleotide from O to N during the synthesis of ODN on a commercially available solid support; and (2) the tail molecule during ODN synthesis. May be the result of the deprotection of the FMOC moiety of OH and subsequent capping with acetic anhydride and / or (3) the formation of a cyclic phosphate between the primary and secondary hydroxyl groups of the tail molecule, with concomitant loss of ODN. In all cases, the resulting ODN with 3'-tail molecule
Can then form distinct species according to PAGE analysis without reacting with the active ester.

The modified solid support herein is OD
Overcoming these shortcomings associated with commercially available solid supports for modification of the 3 'end of N. Other advantageous features provided by the claimed modified solid support include (1) a unique amine protecting group that also serves as a CPG binding site and (2) a dimethoxytrityl protected hydroxyl group. Furthermore, these modified supports can be adapted to all methods used in commercial DNA synthesizers.

The ODN with a 3'-amine-tail molecule is preferably removed from the CPG support on a DNA synthesizer. Since the claimed support has no adjacent diol,
Elimination of the 3'-amine-tailed ODN from the support with ammonium hydroxide is compatible with preservation of the aminohexyl group at the 3 'end of the ODN. Conversely, amine-ON-C
Since PG contains vicinal diols, elimination of ODN from this support with ammonium hydroxide results in significant loss of tail molecules from ODN.

U. Asseline and N.M. T. Thuong (T
rt. Lete. 31 , 81-84 (1990)) reported a solid support for introducing a 3'-aminohexyl tail molecule into ODN. Disadvantages associated with this solid support include: (1) a seven-step synthetic method for making the support (see the four-step method described herein); Data analysis suggesting that only a low yield of solid support is obtained, including (3) lack of data suggesting that a theoretical yield of ODN with 3'-tail molecule of this solid support is obtained .

To make the claimed solid support, in addition to the preferred 6-aminohexane-1-ol reagent,
Other aminoalkanols are commercially available and suitable for producing modified CPGs according to the present invention. By substituting aminoalkanols of various alkyl chain lengths for 6-aminohexan-1-ol, ODNs having 3'-amine tail molecules of various lengths are synthesized by the methods disclosed herein. In contrast, aminodiols of various lengths are generally not commercially available and, therefore, solid supports with a range of alkyl chain lengths cannot be easily produced by the method of Nelson et al. Therefore, various 3′-
ODNs having an amine tail molecule cannot be readily synthesized using amine-ON-CPG or modifications thereof. further,
Other spacer groups (ie, where R is alkyl, aryl, arylalkyl, heteroalkyl or heteroaryl) are inserted between the amino group of the claimed modified solid support and the hydroxyl group protected by DMTr. . In a preferred embodiment, R is 1 to 10 n in (CH ₂₎ n. In particular, in a preferred embodiment, R is (CH ₂ ) ₆ .

An oligonucleotide having a 3'-amine tail molecule can be efficiently synthesized using the modified solid support of the present invention. Such 3'-amine-tailed oligonucleotides are contrasted with similar 3'-tailed ODNs produced using commercially available amine-ON-CPG supports. Representative modified solid supports of the claimed invention obtained high yields of ODN with 3'-amine tail molecule as a single product by both HPLC and PAGE. Subsequent derivatization of the 3'-amine-tailed ODN made from the claimed modified solid support was rapidly completed and gave a quantitative yield of 3'-modified ODN without the need for HPLC purification.

D. Intramolecular acridine TFP ester
Reaction with Min-Modified ODN The present invention provides multiple internal intercalating groups
Provide a means to introduce Such a large number of internal intercalating groups can result in increased binding of the ODN to the target nucleic acid strand, but can have strict mathematical requirements for effective intercalation. The expected increase in binding affinity of nucleic acids due to intercalating groups can be neutralized or reduced by steric effects that disrupt the normal Watson-Crick base pairing of the duplex.

The claimed method uses an acridine TFP ester to produce a double modified ODN flanking either one or two base pairs of the smallest duplex formed between the ODN and the target. including. According to the present invention, internally modified ODNs are designed that have a linkage that optimizes the interaction between the intercalating group and the target nucleic acid strand. For example, the 5-aminopropyl-deoxyuridine group was selectively introduced into ODN, and the effect of one and two internal acridine modifications on Tm was studied. For a single internal amine modification, the coupling efficiency (Tm)
ODN was reacted with acridine TFP ester 19 or 20 to determine the effect of chain length on Acridine TFP. An acridine-modified ODN with a 5 carbon-length bond increased the Tm by 5.9 ° C as compared to the unmodified control, whereas a 3-carbon-length bond had a 1 m increase compared to the same control. .1 ° C only increased. When two internal acridine modifications were tested, the optimized bond length was 4
An increase in Tm from 5.5 ° C. (unmodified ODN) to 56.2 ° C. (two-way inserted ODN) was observed. In addition, numerous internal acridine modifications can improve the stability of ODN to cell consumption and nuclease digestion.

E. OD with 3'-tail molecule in cell culture
Improved stability of N (hexanol-CPG) unmodified ODN is rapidly degraded by 3'-exonuclease in serum containing media. Certain chemical modifications of the 3'-terminal phosphodiester linkage (i.e., changing the phosphodiester linkage between the last two nucleases to a phosphorothioate, phosphoramidate, or reverse conjugate) increase the stability of the ODN to nucleases. Significant improvement. Another chemical bond is an α-deoxynucleotide derivative (C. Cazenave et al. Nucl. Acids Res. 15 ,
Increased nuclease stability can be obtained, such as 10507 (1987)) and methylphosphonate derivatives. Since the intercalating group is a bulky 3'-substituent, it can also protect the terminal phosphodiester bond from 3'-exonuclease (E. Uhlmann and A. Pyman, Chem. Rev. 9
0 , 543 (1990)). For example, ODNs with 3'-cholesterol, 3'-acridine- and 3'-hexylamine-tail molecules have been studied in cell culture assays and unmodified ODNs
Showed increased stability as compared to.

In one embodiment of the present invention, a method for synthesizing oligonucleotides that prevent degradation by 3'-exonuclease using a modified solid support is disclosed. This modified solid support is useful for in vivo evaluation of the structure-activity relationship of ODNs and other 3'-modifications such as cholesterol or acridine without the other 3'-modifications.
It can be used advantageously to synthesize DN. Since the 3'-modified ODN made in this way does not interfere with hybridization, the modified solid support described herein can
It is currently a suitable replacement for the immobilized, DMTr protected nucleosides used in ODN synthesis. Disadvantages associated with these immobilized nucleosides include high cost and the need to have four types of CPG utilized. Conversely, within the scope of the claimed method, wherein the 3'-terminal nucleoside is added as a phosphoramidite, the modified solid support can be used as a universal reagent for the production of ODN sequences. Furthermore, in contrast to the DMTr protected 5'-hydroxyl group of the immobilized nucleoside, the DMTr protected hydroxyl group on the bond protruding from the solid support is not inhibited. Therefore, the hydroxyl groups protected by DMTr on the modified solid support have increased access to bulky phosphoramidite reagents and can provide high yields of ODN products.

The modified solid support of this aspect of the invention is characterized by an R group (ie, alkyl, aryl, arylalkyl, heteroalkyl or heteroaryl) connecting the support to a DMTr protected hydroxyl group. In a preferred embodiment, R is 2 to 10 n in (CH ₂₎ n. In particular, in a preferred embodiment, R is (CH ₂ ) ₆ . The preparation of a representative modified solid support, hexanol-CPG, is shown in Step VII. An important intermediate in the synthesis of hexanol-CPG, O- (4,4'-dimethoxytrityl)-
1,6-hexanediol 37 can be obtained from F.I. Seela and K.C. Kaiser (Nucl. Acids Res. 15 , 3113 (1
987)) using the modified method of
Manufactured by treating with Cl. Succinylation of the intermediate followed by immobilization on a long chain alkylamine controlled pore glass support (LCAA-CPG) gives hexanol-CPG.

[0083] "Antisense" oligodeoxynucleotides with a 3'-hexanol-tail molecule have been studied in models of biological systems. These antisense ODNs are available from Paramecium tetraurelia.
Etraurelia) had a remarkable effect on the swimming behavior. Wild-type cells and cells treated with random or sense ODN had no effect.

The examples described below illustrate steps I through VII.
It corresponds to the reaction series of I. Steps I and II
I represents a cholesteryl group having the symbol "Chol". Step I shows the synthesis of cholesterol-CPG 6 ;
Step II describes the synthesis of acridine-CPG 10 , step III describes the synthesis of cholesterol-CPG 17 , and step IV describes the synthesis of acridine TFP esters 19 and 2.
0 represents the synthesis of step 0 , step V shows an improved synthesis of acridine-CPG 10 and 23 , step VI describes the synthesis of aminohexyl-CPG 30 and step VII describes the synthesis of hexanol-CPG 38 And the step VIII is 3 ′
-Shows the structure of the acridine tail molecule.

Example I (2S, 4R) -N-benzyloxycarbonyl-4-h
Droxy-2-hydroxymethylpyrrolidine (1) CBZ hydroxyproline (4.76 g, 18 mmol, Sigma
Chemical Co.) anhydrous tetrahydrofuran (20 m
L) in an ice-cooled solution of a 1 M borane-tetrahydrofuran complex in tetrahydrofuran (45 m
L, Aldrich) was added. 15 at 0-50 ° C under argon
After stirring for 4.5 minutes at room temperature and then for 4.5 hours, the reaction mixture was quenched with methanol (50 mL). After 30 minutes, the reaction solution was concentrated, and the remaining colorless syrup was purified by a gradient method using methanol-methylene chloride (gradient elution method).
Using flash chromatography (3.5 × 23 c
m, silica). The product was eluted with 10% methanol. Removal of the solvent from the fractions containing the pure product gave (1) (2.18 g, 46% yield) as a colorless syrup. TLC (95: 5 / methylene chloride: methanol), Rf = 0.
16. IR (neat) 3600-3100 (br), 2
940,1680,1420, and ^{1355cm -1. 1 H-NMR (} CDCl 3) 7.36 (s, 5H), 5.17 (s, 2
H), 4.50 (m, 2H), 3.67 (m, 4H), 2.09 (m, 3H)
. H) analysis _{(C 13 H 17 NO 4 ·} 0.3H 2 O ) Calculated values:. C, 60.83; H, 6.91; N, 5.46 Found: C, 60.85; H, 6.88; N, 5.36.

Example II (2S, 4R) -4-hydroxy-2-hydroxymethyl
Pyrrolidine (2) (trans-4-hydroxy-L-prolinol) CBZ hydroxyprolinol (1) (1.92 g, 7.6 m)
mol) in methanol (50 mL) under a hydrogen balloon.
% Palladium on carbon (320 mg). After 16 hours, no starting material remained as indicated by thin layer chromatography (9: 1 methylene chloride: methanol). The reaction mixture was filtered through celite (washed with methanol) and the filtrate was concentrated to give the desired product (2) quantitatively as a yellow syrup. This syrup was dissolved in ethanol to give a 0.5M stock solution (15.2 mL). IR (neat) 3600-3100 (br), 2920, 153
0 and ^{1410cm - 1. 1 H NMR (D} 2 O) 4.40 (m, 1H), 3.60 (m, 3H),
3.02 (d, of d, 1H, J = 12.4,4.8 Hz), 2.77
(d of t, 1H, J = 12.4, 1.8 Hz), 1.84 (m, 1
H), 1.60 (m, 1HO).

Example III (2S, 4R) -N-cholesteryloxycarbonyl-4
Chlorinated cholesterol chloroformate (1.48 g, 3.3 mmol) was added to a 0.5 M ethanol solution (7.6 mL, 3.8 mmol) of -hydroxy-2-hydroxymethylpyrrolidine (3) hydroxyprolinol (2). Methylene (8m
L) The solution was added and the mixture was stirred at room temperature for 1.5 hours.
The cloudy reaction was poured into ice water (100 mL) and the heterogeneous mixture was extracted with hot ethyl acetate (3 × 150 mL). The collected organic layer was washed with brine, dried over magnesium sulfate, and concentrated. The solid residue was purified by flash chromatography (4 × 15 cm silica) using methanol-hexane: ethyl acetate (1: 1) (gradient). The product was eluted with 10% methanol. Removal of the solvent from the fractions containing the pure product gave (3) (1.42 g, 81
% Yield) was obtained as a white solid. TLC (95: 5 / methylene chloride: methanol), Rf = 0.
10.10% sulfuric acid - product and spraying heated with methanol analysis values colored in black (C ₃₃ H ₅₅ as NO ₄₎ Calculated: C, 74.81; H, 10.46 ; N, 2.64 Found: C, 74.74; H, 10.33; N, 2.50.

Example IV (2S, 4R) -N-cholesteryloxycarbonyl-4
-Hydroxy-2-dimethoxytrityloxymethylpi
Loridine (4) diol (3) (1.42 g, 2.68 mmol) in dry pyridine
(27 mL) solution and triethylamine (0.2 mL) with stirring.
524 mL), 4-dimethylaminopyridine (16.5 mL)
g), and dimethoxytrityl chloride (1.10 g, 3.
23 mmol) was added. After stirring for 4.5 hours under a stream of argon, the solvent was removed from the reaction mixture, and the remaining pyridine was distilled off together with toluene. The residue was washed with ether (100 mL)
-Partitioned between water (40 mL). The aqueous layer was washed with ether (80m
L), the combined organic layers were washed with brine, dried over sodium sulfate and concentrated. The residue was purified by flash chromatography (4.5 × 20 cm silica) using ethyl acetate-hexane (gradient). The product was eluted with 2: 1 / hexane: ethyl acetate immediately after obtaining a yellow impurity. Removal of the solvent from the fractions containing the pure product afforded (4) (1.33 g, 60% yield) as a pale yellow foamy solid. TLC (95: 5 / methylene chloride: methanol), Rf = 0.
49. The product turned orange when sprayed with 10% sulfuric acid-methanol. ¹ H NMR (CDCl ₃ ) 7.26 (m, 9H), 6.81 (d, 4
H, J = 8.8 Hz), 5.30 (m, 1H), 4.50 (m, 2H),
4.15 (m, 1H), 3.78 (s, 6H), 3.7-3.0 (m, 4
. H), 2.4-0.6 (m, 46H) analysis (as C ₅₄ H ₇₃ NO ₆₎ Calculated:. C, 77.94; H, 8.84; N, 1.68 Found : C, 77.26; H, 8.82; N, 1.56.

Example V (2S, 4R) -N-cholesteryloxycarbonyl-4
-Succinyloxy-2-dimethoxytrityloxime
A solution of tylpyrrolidinone (5) alcohol (4) (1.22 g, 1.47 mmol) in dry pyridine (12 mL) was stirred with succinic anhydride (443 mg, 4.
43 mmol) and dimethylaminopyridine (89 mg, 0.7
3 mmol) was added and the reaction mixture was stirred under argon for 26 hours. The solvent was removed and residual pyridine was distilled off together with toluene. The residue was dissolved in chloroform (40 mL), washed with brine, dried over sodium sulfate and concentrated to give the product (5) quantitatively as a beige foamy solid. TLC (95: 5 / methylene chloride: methanol), Rf = 0.
32. The product turned orange when sprayed with 10% sulfuric acid-methanol.

Example VI Cholesterol-CPG Support (6) Succinylated cholesterol derivative (5) was prepared according to the method described in the literature (RT Pon et al., Biotechn. 6,768 (198).
8)) Pore glass support controlled with long-chain alkylamine
(LCAA-CPG, Sigma). LCAA-C
PG (5.0 g) was added to 3% dichloroacetic acid-methylene chloride (10 g).
0 mL) and stirred for 3 hours. The CPG was filtered through a 30 mL volumetric glass melt filter, and chloroform (150 mL) was used.
And ether (150 mL). The obtained solid was dried under reduced pressure, and dried pyridine (50 mL), succinylated cholesterol derivative (5) (932 mg, 1 mmol) and triethylamine (0.4 mL) were placed in a 250 mL round bottom flask.
L), 1-ethyl-3- (3-dimethylaminopropyl)
It was mixed with carbodiimide (1.92 g, 10 mmol) and 4-dimethylaminopyridine (60 mg). The mixture was placed in an orbital mixer and stirred at 100 rpm for 38 hours.
The CPG was filtered through a 30 mL volume glass melt filter, washed with pyridine (50 mL), methanol (100 mL), chloroform (50 mL) and ether (50 mL) and dried under reduced pressure. Residual amino groups on CPG were capped by stirring the support in dry pyridine (15 mL) and acetic anhydride (2.0 mL). Two hours later,
The CPG was filtered, washed as above, and dried under reduced pressure to give product (6) (5.0 g). It is prepared according to the methods described in the literature (T. Atkinson and M. Smith, Oligonc.
lcotide Synthesis, a Practical Approach, M.
J. Gait, M, J. (ed.), IRL press (1984), p4
The CPG support was analyzed for dimethoxytrityl content according to 8) and was found to have a loading of 17.6 μmol / g.

Example VII Cholesterol-CPG to 3 'Cholesterol Tail Molecule
An amount of cholesterol-CPG corresponding to the synthetic dimethoxytrityl content (1 micromol) of the attached oligonucleotide was filled with an empty column (for example, Applied
Biosystem Inc. or Cruachem column). Oligonucleotides having the nucleotide sequence CTCCATGTTCGTCACA were produced on a Milligen DNA synthesizer utilizing standard phosphoramidite chemistry. 5'-D
The MTr protecting group was left. Oligonucleotides were cleaved from CPG and deprotected by treatment with concentrated ammonia (2 mL) at room temperature for 3 days. The supernatant was directly applied to a PRP-1 reverse-phase high performance liquid chromatography column (20 to 100%
Acetonitrile-triethylammonium acetate (p
Eluted with a gradient of H7.5)). The product was collected in one portion and lyophilized to give the 5'-DMTr protected product. The DMTr group was removed by treatment with 80% acetic acid at room temperature for 16 hours and repurified by HPLC. Analysis of the collected product by UV 260 nm revealed a product of 0.54 m
g. If we repeat this method separately,
The DMTr group is removed with 3% DCA while in the synthesizer,
The yield of oligonucleotide was increased.

Example VIII (2S, 4R) -N- (9-acridinepropanamidyl)
-4-hydroxy-2-hydroxymethylpyrrolidine
(7) {1- [3- (9-acridinyl) -1-oxopropyl]
-5-hydroxymethyl- (3R-trans) -3-pyro
Lysinol; Step II} 9-Acridinepropionic acid (125.5 mg, 0.5 mmol) in methylene chloride (1.5 mL) (H. Jensen and LJH)
owl and J. Am. Chem. Soc. 48 , 1926 (198
9)), ethyldiisopropylamine (0.104 mL, 0.1%).
(6 mmol), 2-fluoro-1-methylpyridinium tosylate (FMPT) (0.6 mmol) was added to the slurry with stirring. After 1.5 hours at room temperature, the cloudy brown solution was cooled in an ice-saline bath to hydroxyprolinol (2).
(0.5 mmol) in ethanol was added with stirring.
After stirring for 1 hour at room temperature, methanol was added to the reaction mixture.
(10 mL) was added to stop the reaction, and the mixture was concentrated. The residue was treated with methanol-methylene chloride (gradient),
Flash chromatography (1.5 x 24 cm silica)
Was purified. Removal of the solvent from the fractions containing the pure product provided (7) (112 mg, 64% yield) as a yellow foamy solid. TLC (90: 10 / methylene chloride: methanol), Rf =
The 0.50 product appeared as a yellow spot emitting blue fluorescence. IR (KBr) 3400 (br), 1620,1440,1070
^{cm -1. 1 H NMR (CDCl} 3) 8.30 (d, 4H, J = 9.4Hz),
7.82 (t, 2H, J-6.6 Hz), 7.62 (m, 2H), 4.3
1 (m, 2H), 4.05 (t, 2H, J = 8.2 Hz), 3.70 (m, 2H)
1H), 3.50 (m, 2H), 3.22 (d, 2H, J = 1.4H
z), 2.78 (m, 2H), 2.03 (m, 1H), 1.64 (m, 1
. H) analysis _{(C 21 H 22 N 2 O} 3 · 0.5H 2 O ) Calculated values:. C, 70.18; H, 6.45; N, 7.79 Found: C, 70. 41; H, 6.45; N, 7.68.

Example IX (2S, 4R) -N- (9-acridinepropanamidyl)
-4-Hydroxy-2-dimethoxytrityloxymethyl
Pyridine of rupyrrolidine (8) diol (7) (100 mg, 0.285 mmol)
To the (2.5 mL) solution was added 4-dimethylaminopyridine (6.4 mg), triethylamine (0.13 mL), and dimethoxytrityl chloride (154 mg) with stirring.
After stirring for 16 hours under a stream of argon, the solvent was removed from the mixture, the remaining pyridine was still distilled off with methylene chloride, the residue was dissolved in methylene chloride (5 mL) and water (2 mL) was added.
× 3 mL) and then washed with brine (3 mL), dried over sodium sulfate and the solvent was removed. The residue was treated with methanol-1: 1 / hexane: ethyl acetate (gradient),
Purified by flash chromatography. The fractions containing the pure product are collected and the solvent is removed (8)
(123 mg, 66% yield) was obtained as a yellow foamy solid. TLC (45: 45: 10 / hexane: ethyl acetate: methanol), Rf = 0.26 The product appeared as a blue fluorescing yellow spot and turned orange when sprayed with 10% sulfuric acid-methanol. IR (KBr) 3400 (br), 1620,1440,1070
^{cm -1. 1 H NMR (CDCl} 3) 8.17 (m, 4H), 7.75 (t, 2
H, J = 7.0 Hz), 7.57-7.09 (m, 9H), 6.82
(d, 2H, J = 8.8 Hz), 6.66 (m, 2H), 4.56 (m, 2
H), 3.65-2.90 (m, 2H), 2.69 (m, 2H), 2.1
. 5 (m, 1H), 1.95 (m, 1H) analysis _{(C 42 H 40 N 2 O} 5 · 0.5H 2 as O) Calculated: C, 76.23; H, 6.24 ; N, 4.23. Found: C, 76.53; H, 6.67; N, 3.80.

Example X (2S, 4R) -N- (9-acridinepropanamidyl)
-4-succinyloxy-2-dimethoxytrityloxy
To a stirred solution of cimethylpyrrolidine (9) alcohol (8) (120 mg, 0.184 mmol) in dry pyridine (1.5 mL) was added 4-dimethylaminopyridine (11.2 mg). The mixture was stirred under argon for 40 hours before removing the solvent. Residual pyridine was distilled off with toluene and removed. The residue was dissolved in chloroform (3 mL), washed with brine, dried over sodium sulfate and concentrated to give the product (9) (128 mg, 93% yield) as a yellow foamy solid. TLC (95: 5 / methylene chloride: methanol), Rf = 0.
13. The product appeared as a blue fluorescent yellow spot and turned orange when sprayed with 10% sulfuric acid-methanol.

Example XI Acridine-CPG Support (10) Cholesterol-CPG Support (6) Using the method described above, a pore in which a succinylated acridine derivative (9) is controlled with a long-chain alkylamine Solid on a glass support. LCAA-C with acid wash in round bottom flask
PG (0.85 g) was added to dry pyridine (8.5 mL), triethylamine (0.068 mL), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (325 mg, 1.7 mmol).
l), and 4-dimethylaminopyridine (10.2 mg), and the mixture was stirred for 19 hours under a stream of argon.
The CPG was filtered, washed with pyridine, methanol, chloroform and ether, and then dried under reduced pressure. Amino groups remaining on the CPG were removed using dry pyridine (2.5
(mL) and acetic anhydride (0.34 mL) by stirring the support. After 2 hours, the CPG is filtered, washed as above and dried under reduced pressure to give the product (1
0) (0.85 g) was obtained. This material was analyzed for dimethoxytrityl content and the CPG support was 18.5 μm
It was found to have a filling degree of ol / g.

Example XII 3'-acridine-tail from acridine-CPG (10)
Acridine-CPG (10) was packed in an oligonucleotide synthesis column in an amount corresponding to the dimethoxytrityl content (1 micromol) of the synthesized oligonucleotide (10 ') . Nucleotide sequence 5'-CTCTCCATCTTC
Oligonucleotides with GTCACA were produced on a Milligen DNA synthesizer, utilizing standard phosphoramidite chemistry. The resulting oligonucleotide was converted to its CP
G was cleaved and treated with concentrated ammonia (2 mL) at 40 ° C. for 24 hours to deprotect. The supernatant was directly applied to a PRP-1 reverse-phase high performance liquid chromatography column (20% to 100% acetonitrile-triethylammonium acetate (pH
Eluting with a 7.5 gradient). The product (10 ') was collected in one fraction and lyophilized to give a fluorescent oligonucleotide product (10') (1.99 mg) (UV260n).
m) was obtained as a pale yellow solid.

Example XIII 4-N-benzyloxycarbonyl-3-hydroxybutyrate
Acid (11) 4-amino-3-hydroxybutyric acid (5.0 g, 42.0 mmol,
(Sigma Chemical Co.) in sodium hydroxide (3.7 g).
Was dissolved in a solution of water (35 mL), and CBZ chloride (7.88 g, 46.2 mmol) was added dropwise to the ice-cooled solution over 20 minutes.
The mixture was stirred in ice for 2 hours and then ether (50 mL)
To remove excess CBZ chloride. 3 water layers
Acidify with NHCl (20 mL) and add ethyl acetate (4 × 50 mL).
L). The extracts were combined, dried over magnesium sulfate, and the solvent was distilled off under reduced pressure to obtain a colorless syrup-like substance, which was immediately crystallized. Recrystallization from chloroform gave the desired product (11) (4.70 g, 44% yield) as white crystals (mp 94-95 ° C). ¹ H NMR (CDCl ₃ ) 7.35 (s, 5H), 6.70 (s, 2
H), 5.70 (s, 1H), 5.15 (s, 2H), 4.35-3.9
5 (m, 1H), 3.25-3.00 (m, 2H), 2.50 (d, 2
H, J = 6.5 Hz).

Example XIV 1-N-benzyloxycarbonyl-2,4-butanedi
A solution of all (12) acid (11) (4.57 g, 18.0 mmol) in dry tetrahydrofuran (18 mL) was added dropwise to an ice-cooled tetrahydrofuran solution of 1 M borane-tetrahydrofuran (Aldrch chemical Co.) while stirring under an argon atmosphere. did. After the addition is complete, the mixture is kept stirring at room temperature for 30 minutes and then
The reaction was stopped by adding 0% acetic acid-methanol (36 mL).
The solvent was removed under reduced pressure and the residue was washed with ethyl acetate (80 mL) with 1.5N hydrochloric acid, water and saturated aqueous sodium hydrogen carbonate solution. After drying over potassium carbonate, the solvent was distilled off under reduced pressure to obtain a white solid. Recrystallization from benzene-hexane gave the desired product (12) (1.69 g, 38% yield) as white crystals (mp 80.5-82 ° C). ¹ H NMR (CDCl ₃ ) 7.35 (s, 5H), 5.50 (t, 1
H, J = 6.0 Hz), 5.10 (s, 2H), 3.75 (t, 2HJ)
= 6.0), 4.10-2.65 (m, 5H), 1.60 (q, 2H,
J = 6.0 Hz).

Example XV 1-Amino-2,4-butanediol (13) Step III : CBZ protected aminodiol (12) (1.6)
9 g, 7.06 mmol) in palladium hydroxide-carbon (800 m
g), ethanol (100 mL), and 1,4-cyclohexadiene (20 mL), and the mixture was heated to reflux for 16 hours. Thin layer chromatography (10% methanol-methylene chloride) showed no starting material remaining. The mixture is filtered through celite on a semi-solid glass funnel (washed with ethanol) and the solvent is removed in vacuo to give the desired product (13).
(0.84 g) was obtained as a yellow syrup. Dilution to 7 mL with ethanol gave a 1 M stock solution of aminodiol (13). ¹ H NMR (D ₂ O) 4.80 (s, 4H), 3.80 (t, 2H,
J = 6.0 Hz), 4.00-3.65 (m, 1H), 3.40-
2.50 (m, 2H), 1.95-1.55 (m, 2H).

Example XVI 1-N-cholesteryloxycarbonyl-2,4-buta
Diol (14) aminodiol ( 13) (6.0 mmol) in ethanol (6.0 m
L) in an ice-cold solution of cholesterol chloroformate (2.
A solution of 25 g (5.00 mmol) in methylene chloride (5 mL) was added. The mixture was removed from the ice bath, stirred for 1.5 hours under a stream of argon, and then poured into ice water (150 g). The mixture was extracted with ethyl acetate (2 × 150 mL) and the extract was washed with water (2 × 150 mL).
× 100 mL) and brine (1 × 100 mL), dried over magnesium sulfate, and the solvent was distilled off. The solid residue was dissolved in tetrahydrofuran (10 mL) and chromatographed on a silica gel column (3.5 × 15 cm, packed with 1: 1 hexane: ethyl acetate). After elution with 1: 1 hexane: ethyl acetate (300 mL), 45:45:10 hexane:
The product was eluted with ethyl acetate: methanol.
Removal of the solvent gave a sticky white solid (14) (2.04 g, 79
%)was gotten. ¹ H NMR (CDCl ₃ ) 5.38 (d, 1H), 5.14 (t, 1
H), 4.50 (m, 1H), 4.00-3.70 (m, 3H), 3.6
0-3.00 (m, 2H), 2.40-2.20 (m, 2H), 2.1
0-0.60 (m, 3H).

Example XXII 1-N-cholesteryloxycarbonyl-2-hydroxy
Ci-4-dimethoxytrityloxybutane (15) diol (14) (1.74 g, 3.35 mmol) in dry pyridine
(25 mL) of stirred solution of dimethoxytrityl chloride.
(1.36 g, 4.02 mmol), triethylamine (0.655)
mL) and 4-dimethylaminopyridine (20.5 mg) were added. The reaction mixture was stirred for 16 hours under a stream of argon and then partitioned between water (25 mL) and ether (75 mL).
The aqueous layer was separately extracted with ether (75 mL), and the combined extracts were washed with water, brine, and dried over sodium sulfate.
The solvent was distilled off. The residue was purified on a silica gel column (3.5 × 1
(3 cm, packed with 4: 1 hexane: ethyl acetate). Fractions containing the product (contaminated with yellow impurities) were collected and evaporated to give a yellow foamy solid (2.22 g). Repeated chromatography using 5% methanol-methylene chloride and 4: 1 hexane: ethyl acetate provided the pure product (15) as a pale yellow foamy solid. _{^{1 H NMR (CDCl 3) 7.45-7.10}} (m, 9H), 6.
80 (d, 4H, J = 8.8 Hz), 5.38 (d, 1H), 5.05
(br t, 1H), 4.50 (m, 1H), 3.90-3.80 (m, 2
H), 3.80 (s, 6H), 3.50-2.95 (m, 4H), 2.3
0 (m, 2H), 2.10-0.60 (m, 43H) analysis (as C ₃₃ H ₇₃ NO ₆₎ Calculated:. C, 77.62; H, 8.97; N, 1. 17. Found: C, 77.41; H, 8.97; N, 1.60.

Example XVIII 1-N-cholesteryloxycarbonyl-2-succini
4 -Dimethylaminopyridine (3 mL) was added to a stirred solution of luoxy -4-dimethoxytrityloxybutane (16) alcohol (15) (415 mg, 0.506 mmol) in dry pyridine (2 mL).
0 mg) and succinic anhydride (48 mg, 0.48 mmol) were added and the mixture was stirred for 24 hours under a stream of argon. Thin layer chromatography (5% methanol-methylene chloride) showed traces of unreacted starting material. The solvent was removed and the residual pyridine was distilled off along with toluene (2 × 10 mL). The remaining yellow foamy solid (16) was used for conversion to p-nitrophenyl ester and immobilization on CPG.

Example XIX Cholesterol-CPG support (17) Succinylated cholesterol derivative (16) was
n and Smith (Oligonuclcotide Synthesis, a Pra
ctical Approach, MJ Gait, (ed.) IRLpress, pp
47-49 (1984)), using a long-chain alkylamine-controlled porous glass support (LCAA-CPG,
(Sigma). Crude succinate (16) (105m
g) with p-nitrophenol (16 mg) and dry pyridine
(0.05 mL) together with dry dioxane (1.0 mL). Dicyclohexylcarbodiimide (52 mg, 0.2
5 mmol) was added and the mixture was stirred at room temperature for 15 minutes, then cooled in a refrigerator for 16 hours. The crude p-nitrophenyl ester solution was filtered through a small amount of Celite and D
The CU is removed and the filtrate is then directly treated with dimethylformamide.
Added to LCAA-CPG (0.50 g) in (DMF) (1.5 mL). After addition of ethyl diisopropylamine (0.1 mL), the mixture was stirred in a stream of argon for 18 hours. The CPG was filtered through a slush glass funnel and washed with dimethylformamide (3 × 10 mL), methanol (3 × 10 mL) and ether (3 × 10 mL). Derived CPG
Was dried with a vacuum pump, then treated with dry pyridine (1.5 mL) and acetic anhydride (0.2 mL) and capped. After stirring under argon for 3 hours, the CPG was filtered, washed with methanol (3 × 10 mL) and ether (3 × 10 mL) and dried with a vacuum pump to give cholesterol-CPG (1
7) (0.46 g) was obtained. The CPG was analyzed for DMTr content according to the protocol described by Gait and found to have a CPG support loading of 24 μmol / g.

Example XX Cholesterol-CPG (17) to 3'-cholesterol
-Cholesterol-CP for the synthesis of 5'DMTr-thymidine with tail molecules for oligonucleotide synthesis
To test the stability of G (17), a single thymidine residue was added to a solid support (41.6 mg, 1 micromol). Milligen with standard phosphoramidite coupling chemistry
A DNA synthesizer was used. The 5'-dimethoxytrityl protecting group on the thymidine was not removed to aid isolation and confirmation of the product. The CPG is acetonitrile
(8 mL) to remove traces of unreacted DMTr-thymidine phosphoramidite and other non-covalently bound impurities. The CPG was dried with a vacuum pump and analyzed for DMTr content as described above and found to have a packing degree of 27 micromol / g. The thymidine with a 3'-cholesterol tail molecule was cleaved by treating the support (20 mg) with concentrated ammonia (10 mL) in a 5 mL reaction bottle (Teflon® liner) at 44 ° C for 24 hours. After removing the supernatant (Pasteur pipette), the support was washed with methanol (3 × 2 mL) to isolate thymidine with a 3′-cholesterol tail molecule. Combine the washings, remove the solvent (rotary evaporator / vacuum pump), 7:
Analysis was performed by thin-layer chromatography on a silica gel plate using 1: 1: 1: 1 ethyl acetate: acetone: methanol: water: acetic acid. One major spot including DMTr
(Rf = 0.63) was colored orange when sprayed with 10% sulfuric acid-methanol. Only traces of DMTr-thymidine (Rf = 0.84) were detected, thus indicating the stability of cholesterol binding. After ammonia treatment for 24 hours, the CPG support has 1.4 μmol / g D
The MTr content is indicated. Ammonia treatment of DMTr-thymidine derivatized cholesterol-CPG at 44 ° C. for 5 hours gave the same thin layer chromatography results as 24 hours treatment. The CPG support after ammonia treatment for 5 hours is 3.2
A DMTr content of μmol / g was indicated.

Example XII with an acridine 3'-tail molecule
The oligonucleotide (10 ') obtained from was studied for its melting temperature properties in the presence of a complementary oligonucleotide chain. The presence of the acridine intercalating agent has a Tm (melting temperature) of about 4 ° C. compared to a similar oligonucleotide without the 3′-tail molecule acridine.
Rose.

A suitable reporter group attached to the 3 'tail molecule of a suitable oligonucleotide is useful for confirming (identifying) the presence of the oligonucleotide. The fluorescence, chemiluminescence, or other properties of such reporter groups serve to non-radioactively label these nucleotides. Thus, nucleotides in a sample of interest, such as a biological sample, can be identified by the presence of fluorescence or other similar properties. For example, a lipophilic tail group, such as a 3 'oligonucleotide with a cholesterol tail molecule, helps the permeability of the oligonucleotide to the cell membrane, thus increasing the intracellular concentration of the oligonucleotide or promoting the permeability of the cell membrane. Achieved. A cleavage group at the 3 'end of the oligonucleotide can link the oligonucleotide to such a complementary sequence and aid in subsequent site-specific cleavage of the DNA with the complementary sequence of the oligonucleotide. Such use may relate to gene identification, isolation, and the like.

Other tail molecules or conjugates (conjugates)
Will be chosen based on both other biological and physical properties. Such other biotail molecules may include appropriately blocked synthetic peptides, puromycin, digoxigenin, and the like. Other tail molecules with useful physical properties include spin-labeled compounds, DTPA chelators,
Phospholipids, di- and trinitrophenyl groups, crosslinking reagents,
Examples include alkylating agents, azidobenzene, psoralen, iodoacetamide, azidoproflavin and azidouracil.

Example XXI 2,3,5,6-tetrafluorophenyltrifluoroa
Acetate (18) trifluoroacetic anhydride (28 mL, 0.2 mol) was added to 2,3,
5,6-tetrafluorophenol (27.1 g, 0.163
mmol) with stirring. Boron trifluoride ether adduct (0.2 ml) was added and the mixture was heated at reflux overnight. The residual solution was distilled at normal pressure to remove trifluoroacetic anhydride and trifluoroacetic acid. Desired product (18)
(32.2 g, 75% yield) was collected as a colorless liquid at 45 ° C. (18 mm). d = 1.52 g / mL IR (CHCl ₃ ) 3010, 1815, 1525, 1485,
1235, 1180, 1110, 955 cm ^-1 . Analytical value (as C ₈ HO ₂ F ₇ ) Calculated: C, 36.66; H, 0.38; F, 50.74. Found: C, 36.31 H, 0.43; F, 50.95.

Example XXII 2,3,5,6-tetrafluorophenyl 3- (9-acryl
Jiniru) Pro Pioneto (19) How a: 3- (9-acridinyl) propionic acid (400 meters
g, 1.59 mmol) and triethylamine (0.22 mL) in methylene chloride (20 mL) in 2-fluoromethylpyridinium tosylate (FMPT) (496 mg, 1.75 mmol).
Was added and the mixture was stirred at room temperature for 15 minutes. 2,3,5,
6-tetrafluorophenol (317 mg, 1.91 mmol)
And triethylamine (0.22 mL) were added and the mixture was stirred for 15 minutes. The heterogeneous mixture was evaporated and the residue was purified by flash chromatography (2 × 29 cm silica) using 1: 1 hexane: ethyl acetate. The fractions containing the pure product are combined and evaporated to dryness to give the desired product (19) (250 mg, 39% yield)
Was obtained as a pale yellow solid. Melting point 183-185 ° C; TLC (1: 1 hexane: ethyl acetate), Rf = 0.70, blue fluorescence under long wavelength ultraviolet (UV) IR (KBr) 3075, 1790, 1520 and 10
95 cm ^-1 ; ¹ H NMR (CDCL ₃ ) 8.29 (d, 4H, J = 8.0 H)
z), 7.82 (t, 2H, J = 7.2 Hz), 7.64 (t, 2H, J
= 8.6 Hz), 7.04 (m, 1H), 4.13 (t, 2H, J = 8.
7 Hz), 3.16 (t, 2 H, J = 8.7 Hz). Analysis (C ₂₂ H ₁₃ NO as ₂ F ₄₎ Calculated: C, 66.17; H, 3.28 ; N, 3.51; F,
19.03 found: C, 66.01; H, 3.11; N, 3.33; F,
19.13.

Method b : To a stirred slurry of 3- (9-acridinyl) propionic acid (251 mg, 1 mmol) in methylene chloride (10 mL) was added triethylamine (200 μL, 1.4 mmol) and TFP trifluoroacetate 18 (200 μL). . After stirring for 2 days under argon, the heterogeneous mixture was filtered through celite and the filtrate was evaporated to dryness. The residue was purified by flash chromatography (2 × 25 cm silica) using 1: 1 hexane: ethyl acetate. The fractions containing the product were collected and evaporated to dryness.
The residue was repurified by flash chromatography (2 × 25 cm silica) using methylene chloride. The pure product eluted with 5% ethyl acetate-methylene chloride as a yellow band. Fractions containing the pure product were combined and evaporated to dryness to give 19 (67 mg, 17% yield) as a pale yellow solid.

Example XXIII 2,3,5,6-tetrafluorophenyl 5- (9-acryl
Dinyl) pentanoate (20) Method a (described above) similar to Example XII was used for the preparation of 20 .
5- (9-acridinyl) pentanoic acid (262 mg, 1 mmol)
To 20 (180 mg, 42% yield) as a pale yellow solid. Melting point 122-124 ° C TLC (1: 1 hexane: ethyl acetate), Rf = 0.63, blue fluorescence at long wavelength UV. IR (KBr) 3075, 2960, 1790, 1515,
1105, 955 and 750 cm ^-1 ; ¹ H NMR (CDCL ₃ ) 8.26 (d, 4 H, J = 9.2 H)
z), 7.92 (t, 2H, J = 6.8 Hz), 7.58 (t, 2H, J
= 8.8 Hz), 7.00 (m, 1H), 3.71 (t, 2H, J = 7.
8 Hz), 2.78 (t, 2 H, J = 6.4 Hz), 2.05 (m, 4
H). Analytical value (as C ₂₄ H ₁₇ NO ₂ F ₄ ) Calculated: C, 67.45; H, 4.01; N, 3.28; F,
17.78 found: C, 67.18; H, 3.87; N, 3.02; F,
17.67.

Example XXIV 1- [3- (9-acridinyl) -1-oxopropyl]-
5-hydroxymethyl- (3R-trans) -3-pyrroli
Dinol (7) Step V : Acridine TFP ester 19 (206 mg, 0.
52 mmol) in methylene chloride (8 mL) was added to aminodiol 2 (0.57 mmol) and triethylamine (86 μL).
Was added dropwise to an ice-cold solution of ethanol (1.14 mL). The mixture was stirred at room temperature for 18 hours and concentrated. The residue was purified by flash chromatography using 5% methanol in methylene chloride to give the desired product 7 (181 mg, 100% yield) as a yellow foamy solid. TLC (9: 1 methylene chloride: methanol), Rf = 0.50, yellow spot emitting blue fluorescence at long wavelength UV IR (KBr) 3400 (br), 1620, 1440 and 1070 cm ^-1 ; ¹ H NMR (CDCl ₃ ) 8.30 (d, 4H, J = 9.4H)
z), 7.82 (t, 2H, J = 6.6 Hz), 7.62 (m, 2H),
4.31 (m, 2H), 4.05 (t, 2H, J = 8.2 Hz), 3.7
0 (m, 1H), 3.50 (m, 2H), 3.22 (d, 2H, J = 1.
4Hz), 2.78 (m, 2H), 2.03 (m, 1H), 1.64 (m,
1H). Analytical value (as C ₂₁ H ₂₂ N ₂ O ₃ .0.5H ₂ O) Calculated: C, 70.18; H, 6.45; N, 7.79 Found: C, 70.41; H, 6.45; N, 7.68. UV (pH 7.2) λmax = 252 nm (ε101,000),
260 nm (ε6400), 356 nm (ε6200). Fluorescence (pH 7.2) Excitation at 355 nm, Emission at 460 nm

Example XXV 1- [5- (9-Acridinyl) -1-oxopentyl]-
5-hydroxymethyl- (3R-trans) -3-pyrroli
Dinol (21) A method similar to that described in Example XXIV was used for the preparation of 21 . Acridine TFP ester 20 (1.28 g, 3.00 m
mol) to 21 (1.04 g, 92% yield) as a pale yellow foamy solid. TLC (45:45:10 hexane: ethyl acetate: methanol), Rf = 0.14 Yellow spot emitting blue fluorescence at long wavelength UV, IR (CHCl ₃ ) 3350 (br), 3010, 2930, 1
610 and 1435 cm ^-1 ; ¹ H NMR (CDCl ₃ ) 8.22 (d, 4H, J = 9.0 H)
z), 7.77 (t, 2H, J = 6.6 Hz), 7.56 (t, 2H, J
= 7.8Hz), 4.27 (m, 2H), 3.7-3.4 (m, 6H),
2.3-1.6 (m, 10H). Analytical values (as C ₂₃ H ₂₆ N ₂ O ₃ 0.75 H ₂ O) Calculated: C, 70.48; H, 7.07; N, 7.15 Found: C, 70.33; H, 6.89; N, 7.15.

[0114]Example XXVI 1- [5- (9-acridinyl) -1-oxopentyl]-
5- [bis (4-methoxyphenyl) phenylmethoxy] meth
Cyl- (3R-trans) -pyrrolidinol (22) 22 Using the same method as described in Example IX for the preparation of
Was. Diol21(103 mg, 0.272 mmol)22
(78 mg, 42% yield) was obtained as a pale yellow foamy solid.
Was. TLC (45:45:10 hexane: ethyl acetate: methanol
), Rf = 0.41 A 10% sulfuric acid / methanoic
Color orange when sprayed with phenolic. IR (KBr) 3350 (br), 2930, 1610, 151
0 and 1250cm ^-1;¹H NMR (CDCl_Three) 8.
24 (d, 4H, J = 8.8 Hz), 7.76 (m, 2H), 7.53
(m, 2H), 7.35-7.10 (m, 9H), 6.79 (m, 4H),
4.7-4.3 (m, 2H), 4.08 (m, 1H), 3.9-3.3
(m, 11H), 3.10 (m, 2H), 2.32-1.71 (m, 6
H).

Example XXVII Acridine-CPG support (23) The same procedure as described in Examples X and XI was used for the preparation of 23 . Alcohol 22 (58 mg, 80 μmol) and L
CAA-CPG (0.39 g) gave 23 with a DMTr loading of the CPG support of 20.6 μmol / g.

Example XXVIII 3'-Tail molecule using CPG supports 6, 10 and 23
Direct synthesis of oligonucleotides (24-26) Hepatitis B surface antigen protein (5'-TCCATGTTCTCGT)
Oligonucleotides with a 3'-tail molecule having a sequence complementary to the initiation codon region of the mRNA corresponding to were synthesized using CPG supports 6 , 10, and 23 . Such 3'-tailed ODNs with improved binding can be advantageously used as antisense oligonucleotides.

The synthesis of a 3'-tailed oligonucleotide having the sequence 5'-TCCATGTTCGT was performed in Example VII.
And XII, solid supports 6 and 10
Was performed using each of them. Same 3 'using solid support 23
-Synthesis of oligonucleotide with tail molecule is performed on solid support 23
Was used in the same manner as in Example XII, except that was replaced with the solid support 10 .

Example XXIX Preparation of 3'-aminohexyl-CPG (AH-CPG) a. 1,3- Dioxo -2- (6-hydroxyhex-1-
Yl) -isoindole-5-carboxylic acid (27) 6-aminohexane-1-ol (11.7 g, 10 mmol)
And 1,2,4-benzenetricarboxylic anhydride (7.68)
g, 4 mmol) was heated to 175-225 ° C. for 15 minutes or until the evolution of water vapor ceased. The melt was poured into water to give a white crystalline solid. The solid was collected by vacuum filtration, and analytical purity dried overnight vacuum (reduced pressure) 27 (9.
(1 g, 78%). 127-135 ° C ¹ H NMR (DMSO-d ₆ ): δ 8.344 (1H, d, H-
7. [6]); 8.208 (1H, s, H-4); 7.967 (1H,
d, H-6 [7]); 3.578 (2H, t, H-1 ′ [6 ′];
365 (2H, t, H-6 '[1']); 1.7-1.2 (8H, m,
H-2 ', 3', 4 ', 5'); analysis _{(C 15 H 17 N 1 O} 5 ) Calculated value: C, 61.85; H, 5.88 ; N, 4.81; Found Values: C, 61.56; H, 6.12; N, 4.98.

B. 1,3-Dioxo-2- (6-dimethoxy)
Trityloxyhex-1-yl) isoindole-5
-Carboxylic acid (28) 27 (2.91 g, 10 mmol) in pyridine (50 mL) and triethylamine (1.9 mL) was dissolved in dimethoxytrityl chloride (7.11 g, 20 mmol) and 4-dimethylaminopyridine (63 mg). Was added. The mixture was stirred overnight and then evaporated to dryness. The residue was treated with methylene chloride (10
0 mL), and the resulting solution is ice-cooled with 1M citric acid.
(100 mL), then washed with water (100 mL), dried over sodium sulfate, and the solvent was distilled off. The obtained hard syrup 27 was used without purification again.

C. P-Nitrophenyl 1,3-dioxo-2
-(6-dimethoxytrityloxyhex-1-yl) iso
To a mixture of indole-5-carboxylic acid (29) 28 (2.4 g, 4 mmol) in methylene chloride was added triethylamine. After cooling the solution in an ice water bath, p-nitrophenyl chloroformate was added, and the mixture was stirred at 4 ° C for 5 hours. After adding 4-dimethylaminopyridine to the cooled solution, the solution was allowed to rise at room temperature. After stirring at room temperature overnight,
Repeat the solution repeatedly with saturated sodium bicarbonate solution (5 × 10 mL)
It was then extracted once with ice-cold 1M citric acid. The organic layer was dried over sodium sulfate and evaporated to dryness. The residue was flash chromatographed on a silica gel column (29 × 150 mm) using toluene-ethyl acetate (5: 1) as eluent. Collect fractions containing pure substances,
Evaporation to dryness gave an analytical purity of 29 (1.7 g, 60%). Analysis (C ₄₂ H ₃₈ N as ₂ O ₉₎ Calculated: C, 70.58; H, 5.36 ; N, 3.92; Found: C, 70.57; H, 5.22 ; N , 3.84.

D. 3'-amine CPG support (AH-CP
G) (30) Long chain alkylamine CPG was activated with 3% dichloroacetic acid-methylene chloride. 29 g of the active CPG (1 g)
3 mg, 0.2 mmol) was treated with a solution of pyridine (10 mL) and triethylamine (1 mL), and the reaction mixture was gently treated with 2 mL.
Stir for 4 hours. Acetic anhydride (0.5m
L) was treated and capped by gently stirring for 24 hours. The CPG was filtered and pyridine (1
× 5 mL) and then washed with acetonitrile (3 × 5 mL) and air-dried. The obtained AH-CPG 30 was vacuum dried at room temperature for 2 days. AH-CPG by treatment with perchloric acid
Analysis indicated a filling degree of 20 μmmol / g. The AH-C
The PG support (50 mg, 1 μmol) was loaded onto a standard 1 μmol synthesizer column.

Example XXX Synthesis of Amine-Modified Oligonucleotides (32,33) ODN was prepared on a 1 micromolar scale using standard β-cyanoethyl phosphoramidite coupling chemistry (Atkinson & Smith, supra). Manufactured from two different CPG supports. A prepared as described above in Example XXIX
H-CPG 30 was used to synthesize 32 . Clon
"Amin" obtained from Tech Lab, Inc. (Alto, CA).
e-ON "CPG was used to synthesize 33 .

Amine-modified ODNs 32 and 33 having the sequence 5'-TCCATGTTCGT were prepared using either Milligen 7500 or Applied Biosystems Model 380B with protocols supplied by the manufacturer. After deprotection with ammonia, the tritiated ODN was separated from the ammonia solution by Hamilton PR.
HP by direct injection into a P-1 column (305 x 7.0 mm)
LC purification and purification of the amine-modified ODN product 32 or 33 with 20-45% acetonitrile-0.1 M TEAA (pH
7.5) 20 minutes using (primary gradient) (efflux rate =
(4 mL / min). Combine the appropriate fractions,
It was concentrated to dryness with a savant speed-vac. 80% residue
Detritylation with acetic acid (500 μL, 28 ° C., 70 minutes)
M sodium acetate (100 μL) and 1-butanol (4 m
L), centrifuged, washed with ethanol (1 mL), centrifuged, evaporated to dryness and reconstituted with sterile distilled water (1 mL). The concentration of ODN 32 or 33 is 260 nm U
Determined from V absorption. All ODN concentrations are pH 7.2P
Measured in BS (9.2 mM disodium phosphate, 0.8 mM monosodium phosphate, 0.131 M salt). The extinction coefficient of each ODN is determined by the closest model (CR Cantor et al., Biopol
ymers 9, 1059 (1970))
_It was used to calculate a theoretical concentration (μg / mL) ratio of ₂₆₀ . Purified ODN 32 or 33 was purified from Dyama using 5-45% acetonitrile-TEAA (primary gradient).
It was analyzed by HPLC (flow rate = 1 mL / min) on a xC-18 column. ODN purity was confirmed by denaturing PAGE analysis.

Example XXXI Synthesis of 3'-acridine-tailed ODN (32a) 3'-amine-analyzed by C-18 HPLC for analytical use
ODN 32 with tail molecule showed one peak and PAGE showed only one band. Isolated 3'-amine-modified OD
N 32 [100 μg (29 nmol)] was dissolved in water (100 μL) and 1.0 M borate buffer (50 μM, pH 8.3).
1: 1 of newly prepared acridine TFP ester 19
M-pyrrole: 5.0 mg / mL solution of acetonitrile (2
20 μL, 1.1 mg, 3.0 μmol) was added and the heterogeneous mixture was shaken at room temperature. The progress of the reaction was monitored by HPLC. ODN 32 with amine-tail molecule and acridine TF
The reaction with Pester 19 was completed within one hour. 13
The crude reaction mixture was mixed with water (1.5 mL) in order to more easily separate
It was previously purified by centrifugation through a 00 MW cut ultrafiltration membrane (Centricon-3 microconcentrator; Amicon) to a final volume of 〜100 μL. 5% of this solution
~ 45% acetonitrile-0.1M TEAA (primary gradient) and D in 20 minutes (efflux rate = 1 mL / min)
HPLC on a yanamax C-18 column (0.75 x 25 cm)
And purified. The product was collected in one fraction and concentrated on a Speed-Vac. Sterile distilled water (100
μL) and regenerate before acridine-modified ODN3
The concentration of 2 a was determined from A ₂₆₀ measurements. The theoretical yield for 29 nmol was 108 μg, the actual yield was 39 μg.
Purity of the ODN product 3 2 a is HPLC and PAG
Quantified by E.

[0125] Since some loss of ODN3 2a during ultrafiltration occurs, acridine - using a different way to purify the modified ODN3 2a. 3'- of all departures
Since ODN3 2 tailed reacted, - hexylamine
Acridine - modified ODN3 purification Sephadex (trade name) of 2a G-25 (NAP-25 column, pharmacia, Piscata
way, NJ) through a pre-packed column containing gel filtration. The column was equilibrated with water (25 mL), then the crude mixture was applied and the acridine-modified ODN
Was eluted with water (0.5 mL fraction). Pure product
Fractions containing (as revealed by C-18 HPLC) were combined and concentrated on a Speed-Vac. The pale yellow solid residue 3 2a regenerated with water (200 [mu] L), 260 nm of U
Analyzed with V light. The concentration was measured as 108 μg / 200 μL. The theoretical yield is 108 μg.

Example XXXII 3'-Acridine-tail molecule using amine-OnCPG
Synthesis of ODN (33a, 33b) Using the same reaction conditions described above in Example XXXI, HP
The ODN 33 with 3'-amine-tail molecule for LC purification was pH 8.
Acridine TFP ester in triborate buffer ( 19 or
20 ). After shaking for several hours, HPLC analysis showed that about 70% of ODN 33 with 3'-amine tail molecule remained unreacted. PA of crude reaction mixture
GA analysis showed that only the least mobile zone was completely reacted. Further treatment of 19 with borate buffer did not increase the extent of the reaction. After 22 hours, the mixture was concentrated and low molecular weight impurities were removed by centrifugation through a 3,000 MW cut-off ultrafiltration membrane. The reservoir was purified by C-18HPLC, ODN3 3a or 3 3b and concentrated as a single peak According to C-18 HPLC, it was obtained as a single band according to PAGE.

Table I shows the properties of the modified and unmodified oligonucleotide 5'-TCCATGTTCTGT.

Table I. Properties of oligodeoxynucleotides ODN (a) MW A ₂₆₀ = 1 (b) Yield% (c) HPLC, PAGE, Tm (j) modification (μg / mL) min ^f Rm ^h ° C target 6199 29.6 21 8.7 0.60-None Control 3298 33.6 53 8.0 0.79 45.4-45.9 None 33 3451 35.2 42 9.0 0.80 ¹ 45.9 3'-amine (amine-ON) 34 3477 35.4 27 9.2 0.75 46.3 3'-amine (hexylamine) 24 3890 3.97 48 19.0 ^g 0.74 52.4 3'-CHOL 25 3710 36.4 43 11.1 0.75 52.7 3'-ACR (3C) 26 3738 36.7 64 12.8 0.74 52.7 3'-ACR (5C) 33a 3684 36.2 14 11.9 0.75 51.3 3'-ACR (3C) 33b 3712 36.4 27 13.0 0.74 52.8 3 ' -ACR (5C) 32a 3710 36.4 36 ^d , 100 ^e 13.3 − 50.8 3'-ACR (3C) ^a The sequence of 20 units ODN (target) is 5′-GTGACGAACATGGGAGAA CAT. 11 units ODN (control) is 5'-TCCATGTTCGT. % yield ^b 260 nm in the calculated value ^c CPG1myumol concentrations of ODN to 1.00 absorbance units is obtained isolated ODN, the 3 2a, 3 3a and 3 3b yield μmol of ODN with the starting amine tailed Based. ^d C-18 HPLC Purification ^e gel filtration purification ^f elution time; Fig1 ^h Rm relative ratio ⁱ main travel distance for bromophenol blue using a gradient of HPLC system ^g 35 to 80% acetonitrile according (30 minutes) Share Rm product ^j Tm is the temperature step VIII of the midpoint of the maximum gradient of a ₂₆₀ versus temperature shows the structure of the ODN 25, 26, 3 2a, 3 3a, 3 are incorporated 3b 3'acridine tail molecule . AH
-CPG is relative to the yield obtained with amine-ONCPG,
An improved yield of ODN with 3'-acridine-tail molecule was obtained.

Example XXXIII Synthesis of Internal Amine-Modified ODNs (34-36) Internal amine modifications were performed by KJ Gibson and SJ Benk.
ovic. (Nucl, Acid Res. 15 , 655 (1987)).
Introduced by the protocol described in Example XXX with a 5'-DMTr-3'-0-cyanoethyldiisopropyl phosphoramidite derivative of 2'-deoxyuridine. In summary, ODN5'-TCCATGTTCGT
Was internally modified with a, b, and / or c, as shown below. Position a (34), position a + b (35) or position a + c (3
In 6) three different ODNs were prepared by amine modification.

Example XXXIV Internally Modified Acridine ODN (34a, 34b, 35a, 35
b, 36a, synthetic internally amine 36b) - a modification of the ODN 34, 35, 36, according to the method described in Example XXXI, acridine TFP S. <br/> ether 19 is reacted with each ODN product 3 4a, 3 generates 5a and 3 6a or acridine TFP ester,
20 to produce ODN products 34b , 35b and 36b , respectively.

Example XXXV Thermal Denaturation Experiment To determine the effect of 3'-tail molecule on binding affinity,
Tm experiments were performed using the various 3'-modified ODNs described above. The thermal dissociation curve shows an unmodified 20-unit ODN target (5'-GTGAC) that is complementary to the selected 3'-tailed ODN and is appropriately complementary.
Obtained by tracking the change in A ₂₆₀ of the aqueous solution containing equimolar amounts of GAACATGGAGAACAT).
The 20 unit ODN target provides a nucleotide overhang,
This may affect the interaction of the ODN with the 3'-modification.
Such interactions will be equally important in real biological targets. For these experiments, the target was DNA, not RNA, a similar biological target. If acridine is now efficiently inserted between the base pairs of the miniduplex by hybridization with the target strand, the Tm of the acridine-modified ODN target duplex can be increased. Unmodified 11 units ODN at each Tm
Used as a control in the study.

The ODN was prepared as a 2 μM solution in pH 7.2 PBS. A Gilford System 2600 UV-VIS spectrophotometer equipped with a Gilford 2527 thermoprogrammer was used. Using temperature control cuvette (cuvette),
While measuring the temperature at 0.5 ° C / min,
To 85 ° C. Tm was measured using the ultimate derivative. For replication experiments, Tms was given within 0.5 ° C.
One representative experimental data is listed in Table I in Example XXXII.

A significant increase in the melting temperature of ODN 24 with a 3'-cholesterol-tail molecule compared to unmodified ODN was observed, which was previously reported (RL Lettingen et al., Proc.
Natl. Acad. Sci. USA 86 , 6553 (1989))
This was significantly different from the similar study of ODN with 3'-cholesterol-tail molecule. In the Tm studies described herein, the overhang of the complementary target can affect the Tm, as well as the interaction of the target nucleic acid with the lipophilic tail molecule.

ODNs 25 and 26 showed comparable binding affinities for the target ODN (ie, comparable TDNs).
m). ODN 25 and 26 (i.e., 3- and 5-lengths of bonds of carbon) is terribly surprising difference between the Tm of was observed, ODN3 3a and 3 2a are, ODN 2
5, 26, and 3 compared to 3b of? Tm, was only produced only a small increase in Tm. These data suggest that the strength of the bond, the reliability of the stereochemistry, and / or sequence-dependent intercalation effects can affect Tm.

Table II Tm data of internally modified acridine-ODN Target sequence: 3'-TAC AAG AGG TAC AAG CAG TG-5 'Position of U abc Antisense 11 units: 5'-TCC AUG UUC GT-3' U = 5-aminopropyl-2'-deoxyuridine

Table II shows unmodified ODN and internally modified OD
Tm obtained with N (internal modification at both 1 and 2 places)
Provide data. The Tm of the unmodified and internally modified ODN was determined and the difference between the unmodified ODNTm and the Tm for each internally modified ODN was calculated (ΔTm (° C.)). Calculated T
The difference in m ranged from -2.1 ° C to + 10.7 ° C. The length of the 5-carbon bond resulted in a large Tm increase (i.e., 34
b, 35b, 36b), but such a large increase in Tm is not easily predictable. The inclusion of a second intercalating acridine group had an additional effect on increasing Tm. These data provide information on bond length, sequence-dependent intercalation effects, and / or amide bond hydrogen bonding.
(Resulting from an amine modification reaction with an acridine TFP ester) has been shown to be able to affect Tm.

Example XXXVI O- (4,4'-dimethoxytrityl) -1,6-hexane
Diol (37) DMTr-cl (3.38 g, 10 mmol) and diisopropylethylamine (3.45 mL, 20 mmol) in dry pyridine (5
1,6-hexanediol (5.91 g,
50 mmol) was added. After stirring for 4 hours, 5% sodium bicarbonate (85 mL) was added to stop the reaction, and the mixture was extracted with methylene chloride (2 × 100 mL). The organic layer was washed with water (2 × 10
0 mL) then brine (100 mL), dried over sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (3.5 × 1) using methylene chloride.
(7 cm silica). Fractions containing the pure product were combined and concentrated to give 37 (1.40 g) as a yellow syrup. TLC (95: 5 methylene chloride:
(Methanol), Rf = 0.40, yellow spot: this turned orange when sprayed with 10% sulfuric acid-methanol. ¹ H NMR (CDCl ₃ ) 7.5-7.1 (m, 9H), 6.81
(m, 4H), 3.80 (s, 3H), 3.77 (s, 3H), 3.64
(q, 2H, J = 6.6 Hz), 3.02 (q, 2H, J = 6.0 H)
z), 1.7-1.2 (m, 8H). Analytical value (as C ₂₇ H ₃₂ O ₄ .0.7H ₂ O) Calculated: C, 74.87; H, 7.77 Found: C, 74.61; H, 7.36.

Example XXXVIII Hexanol-CPG (38) Alcohol 37 (530 mg, 1.26 mmol) in dry pyridine
Succinic anhydride (380 mg, 3.8) was added to the stirred solution in (10 mL).
0 mmol) and DMAP (76 mg) were added. The mixture was stirred under argon for 23 hours and evaporated to dryness. Residual pyridine was azeotropically distilled with toluene. Chloroform the residue
(30 mL), washed with brine, dried over sodium sulfate, and concentrated to give a quantitative yield of succinate as a yellow foamy solid. TLC (95: 5 methylene chloride: methanol), Rf = 0.1
9. The product appeared as a yellow spot and turned orange when sprayed with 10% sulfuric acid-methanol.

The crude succinylated derivative (104 mg, 0.1
LCAA-CPG (1.0 g) acid-washed to 200 mmol),
Dry pyridine (10 mL), triethylamine (0.080 mL)
L), EDC (380 mg, 2.0 mmol) and DMAP (12
mg) was added and the mixture was stirred under argon for 46 hours.
The CPG was filtered, washed with pyridine, methanol, chloroform and ether, then dried in vacuo. C
The remaining amino groups on the PG are removed by drying the support with dry pyridine.
(3.5 mL) and capped by stirring in acetic anhydride (0.46 mL). After 3 hours, the CPG was filtered,
Washing with methanol, chloroform and ether and drying in vacuo gave the product 38 (1.0 g). This CPG was analyzed for DMTr content and found to be 2
It was found to have a loading of 6.2 μmol / g.

Example XXXVIII Calmodulin antise with a 3'-hexanol-tail molecule
Hexanol-CPG 38 corresponding to the synthetic DMTr content (38 mg, 1 μmol) of the ODN (39) was replaced with an empty ODN synthesis column (American Bis).
netecs, Inc.). Paramesium
24 units having a sequence complementary to the initiation codon region (-12 to +12) of calmodulin mRNA of E. coli.
(5'TAATTATTCAGCCATTTATTTAGT
T) was converted to hexanol-CPG 38 , an ABI 380B DNA synthesizer utilizing standard phosphoramidite chemistry,
And using the protocol supplied by the manufacturer. The 5'-DMTr protecting group was not removed. OD
N is separated from the support and then 30% aqueous ammonia
(2 ml) at 40-44 ° C for 24 hours to deprotect. The supernatant is directly applied to a PRP-1 reverse phase HPLC column.
(305 x 7.0 mm), 20-45% acetonitrile / 0.1 M TEAA (pH 7.5) (primary gradient)
And eluted at a flow rate of 1 mL / min for 20 minutes. The product was collected in one fraction and concentrated on a Speed-Vac to give the 5'-DMTr protected product. The DMTr group was removed by treatment with 80% acetic acid (300 μL) at 28 ° C. for 80 minutes, and ODN with 3′-hexanol-tail molecule was precipitated with 2.4 M sodium chloride (100 μL) and 1-butanol (4 mL). Was. The mixture is centrifuged and ethanol (1 mL)
And further centrifuged and evaporated to dryness. The remaining white solid was regenerated with sterile distilled water (1 mL) and filtered through a 0.2 μm filter. The concentration of ODN 39 is 260 nm U
As determined from V absorption, it was 3.75 mg / mL.
The theoretical yield for 1 μmol is 7.49 mg. Purified ODN 39 was purified using 5-45% acetonitrile / TEAA
(Primary gradient) for 20 minutes (flow rate = 1 mL)
/ Min) while eluting with a Dynamax C-18 column (0.75
× 25 cm) and analyzed by HPLC. One major peak eluted at 9.9 minutes (> 95% purity). ODN
39 purity was confirmed by PAGE denaturation analysis (1 band).

Example XXXIX Biological Action of ODN39 with Hexanol-Tail Molecule Paramecium tetraureli
The swimming behavior of a) has been used as a biological model system to study the antisense effects of injected ODN 39 . Paramecium tetrauria
swimming behavior elia) a series of ion channels in the cell membrane (voltage-dependent Ca ² + and K + channel and Ca
² + -dependent Na + and K + channels). These ion channels work in tandem,
Ciliary movement produces an action potential that leads to reversal. This reversal causes the paramesium tetraurea to swim backwards. The regulatory protein calmodulin plays a pivotal role in regulating membrane potential and swimming behavior in Paramesium tetraurea.

The 3'-hexanol-tail molecule antisense ODN 39 was used to suppress the expression of the calmodulin gene in Paramesium tetraurea. This antisense ODN 39 was injected into the cytoplasm (cell cytoplasm) with a microsyringe, and the behavior of the cells was monitored over time. The injected cells were analyzed by incubation in a solution testing the function of the Na + channel. Cells of the wild-type strain swim backwards in such a solution for about 15 seconds; individual cells injected with antisense ODN 39 showed a much reduced behavioral response. 15 ~
After 20 hours, the backward swimming time of the injected cells dropped to a minimum of about 2 seconds (FIG. 1). Normal backward swimming behavior was restored when cells that had been microinjected with ODN 39 at time 0 were subsequently injected with calmodulin 15 hours later. 24 units representing either random or sense sequences
Injection of ODN with 3'-hexanol-tail molecule did not cause any change in backward swimming (FIG. 2).

The 3'-hexanol-tail molecule calmodulin antisense ODN 39 was 0.42 mg / mL (56 μM).
Even low concentrations were effective (Figure 3). Conversely, 3 '
-Calmodulin antisense ODN without modification had no effect even at a high concentration of 6.1 mg / mL (835 μM). Thus, the 3'-tail molecule antisense ODN
39 showed at least 15 times greater potency (titer) than similar unmodified ODN. This increased potency is due to the improved stability of the 3'-tailed ODN against 3'-exonuclease degradation. Assuming an injection volume of 10 pL and a paramesium tetraurea volume of 200 pL,
The minimum cytoplasmic concentration of ODN 39 for the observable biological effect was calculated to be 2.8 μM.

Although the preferred embodiments of the present invention have been described above, they are described for the purpose of explanation only, and other specific examples, modifications, improvements, etc. will be apparent to those skilled in the art.
The invention is not limited to the preferred embodiments but is set forth in the following claims.

[0143]

Embedded image

[0144]

Embedded image

[0145]

Embedded image

[0146]

Embedded image

[0147]

Embedded image

[0148]

Embedded image Step VI (a) melting, 175-225 ° C .; (b) pyridine, Et ₃ N, DMTrCl; (c) 1: P-nitrophenylchloroformate, Et ₃ N, CH ₂ Cl ₂ ; 2: DMAP (E) 1: pyridine, Et ₃ N; 2: Ac ₃ O.

[0149]

Embedded image

[Means for Solving the Problems] BEST MODE FOR CARRYING OUT THE INVENTION 【Example】 【The invention's effect】 [Brief description of the drawings]

FIG. 1 shows the time course of the swimming behavior of Paramecium after microsilidine injection of antisense ODN39.

FIG. 2 shows the biological effects of antisense ODN39—random or sense ODN.

FIG. 3 is a dose response curve of antisense ODN39 in an assay of paramesium swimming behavior.

 ────────────────────────────────────────────────── ─── Continuing the front page (72) Michael W. Reed, Inventor United States, 98155 Washington, Seattle, NE One Hundred And Eighth Street, No. 3575 (72) Inventor Rich By Meyer Jr. USA WI, Woodinville, WA, NE One Handed and Seventy Sixth Place, No. 15411 Ninety Sixth Place, 18449 (72) Inventor John Sea Turbon, 98011 Washington, USA Zell, Enui One Hundred and Sixty Six vinegar Place, No. 12117

Claims (1)

[Claims] 1. The formula: Wherein R is alkyl, aryl, arylalkyl,
Heteroalkyl or heteroaryl. ] A solid support for oligonucleotide synthesis represented by the formula: