JP2001000189A - Cntf-il-6 chimeric protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a novel CNTF-IL-6 chimeric protein which contains the whole or partial amino acid sequence of ciliary neurotrophic factor(CNTF) and the whole or partial amino acid sequence of interleukin-6(IL-6) and is used for the investigation of cytokine or as various medicines. SOLUTION: This novel CNTF-IL-6 chimeric protein contains the whole or partial amino acid sequence of ciliary neurotrophic factor(CNTF) and the whole or partial amino acid sequence of interleukin-6(IL-6) in the molecule and is not only useful in the elucidation of the mechanism of exerting cytokine activity but also expectable in using as a nerve degeneration disease therapeutic agent, a thrombocytopenia therapeutic agent, a hepatocyte regenerative agent, a solid carcinoma therapeutic agent, a diabetes therapeutic agent or an obesty therapeutic agent. The chimeric protein is obtained by combining human CNTF gene obtained by screening out a human placenta DNA library with widely known IL-6 gene to integrate into an expression vector, transducingthe resultant vector into a host cell to transform it and then cultivating this transformant to express the gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to chimeric proteins, and more particularly, to a CNTF / IL-6 chimeric protein, a method for producing the same, and a medicament containing the chimeric protein.

[0002]

2. Description of the Related Art CNTF (Ciliary Neurotrophic Factor) and IL
-6 (interleukin-6) is a cytokine with similar protein structure and binding to a common receptor subunit: gp130. gp130 is a glycoprotein with a molecular weight of about 130,000 present on the nerve cell membrane, and is reported to transmit various signals to target cells (Ta
ga et al., Cell vol.58 p.573 (1989), S. Davis et al., Scie
nce vol.260 p.1805 (1993)). At present, as cytokines in which gp130 is involved as a signal transmitter,
In addition to CNTF and IL-6, LIF (leukemia inhibitory factor), IL-11 (interleukin-11), cardiotrophin-1, OSM (oncostatin M), and the like are known and form a family. .

[0003] Ciliary neurotrophic factor
ic factor (CNTF) is a protein required for the survival of chicken embryonic ciliary ganglion neurons in vitro (Manthorpe et al., 1980, J. Neurochem. 34: 69-75), and Induction of glial progenitor cell differentiation in the optic nerve and brain (Hughes et al., 1988, Nature 335: 70-73), promotion of survival of chick embryo dorsal root ganglion sensory neurons (Skaper and Va)
ron, 1986, Brain Res. 389: 39-46), motor neurons,
Supports survival and differentiation of hippocampal and prosympathetic spinal neurons [Sendtner et al., 1990, Nature 345: 440-4]
41; Ip et al., 1991, J. Neurosci. 11: 3124-3134; Blot
tner et al., 1989, Neurosci. Lett. 105: 316-320]. Regarding medicines, amyotrophic lateral sclerosis (ALS)
Application to obesity, etc. is being studied.

[0004] IL-6 was originally identified as a B cell growth factor, and induced acute phase protein in the liver, promoted differentiation of myeloma cells into macrophages, promoted growth of keratinocytes and glomerular stromal cells, promoted regeneration of peripheral nerves, Various physiological actions such as a proliferating action are known. Also,
Regarding pharmaceuticals, application to thrombocytopenia is being studied.

[0005] At present, the following papers have been reported on deletion mutants and amino acid substitution mutants of CNTF and IL-6, which are useful for identifying the binding region to the receptor. (1) Di Marco, A et al. ProNAS USA 93 9247-9252
(1996) (2) Inoue M et al. ProNAS USA 92 8579-8583 (199
5) (3) Inoue M et al. Mol. Neurobiol. 12 195-209 (19
96) (4) Inoue M et al. J. Neurochem. 69 95-101 (1997
b) Hybrid molecules constructed by domain substitution and / or combination are also used for receptor binding analysis. Hybrids of proteins having different biological activities, such as G-CSF and IL-6, have also been used for structure-function analysis. (5) Li, X., et al. J. Biol. Chem. 268, 22377-22
384 (1993) The following patents suggest that IL-6 and domain variants such as OSM and LIF may be prepared and applied to therapeutic agents for cancer and rheumatism. (6) WO 9305169 (EP 601043) Huchinson Cancer Res.
Cent. Fred. However, no example has been reported in which a hybrid (chimeric) gene combining CNTF and IL-6 domains was prepared and the expression of the gene showed CNTF and / or IL-6 agonist activity. .

[0006]

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a modified domain of CNTF and IL-6 which is useful for elucidating the mechanism of expression of cytokine activity and has potential application to medicine. .

[0007]

Means for Solving the Problems The present inventors have developed various C
When an NTF variant was prepared and its activity was examined, in the variant obtained by domain exchange between CNTF and IL-6, especially the A helix, AB loop and D helix were integrally retained in the molecule. CNTF I
The present inventors have found that an L-6 variant, that is, a CNTF / IL-6 chimeric protein, exhibits CNTF and / or IL-6 activity, and thus completed the present invention.

[0008] That is, the present invention relates to the following chimeric proteins. (1) The complete or partial amino acid sequence of CNTF and I
A chimeric protein comprising the entire or partial amino acid sequence of L-6 in the molecule. (2) has a configuration of a four-helix cytokine in which A helix, AB loop, B helix, BC loop, C helix, CD loop, and D helix are successively arranged, and the partial amino acid sequence of CNTF is A helix , A
-The chimeric protein of (1), wherein the partial amino acid sequences of the B loop and D helix, IL-6 are B helix, BC loop, C helix and CD loop. (3) DNA encoding the chimeric protein according to (1) or (2). (4) A vector containing the DNA according to (3). (5) A cell containing the vector according to (4). (6) The cells described in (5) are cultured, and CN
A method for producing a CNTF-IL-6 chimeric protein, comprising isolating and purifying a chimeric protein containing the whole or partial amino acid sequence of TF and the whole or partial amino acid sequence of IL-6 in the molecule. (7) A medicament comprising the chimeric protein according to (1) to (3) as an active ingredient.

Hereinafter, the present invention will be described in detail. As used herein, "CNTF" refers to mammalian ciliary neurotrophic factor. The entire amino acid sequence of human and rat CNTF (200
Residue) is described in J. Neurochem. 57 1003-1012 (1991) p.1006,
It is disclosed in Fig.1p.1007 and Fig.2. "IL-6"
Means mammalian interleukin-6 (Interleukin-6)
Means The entire amino acid sequence of human IL-6 (185 residues in the mature part) is described in J. Immunol. 139 4116-4121 (1987).
p.4119 and FIG. 2 show that the entire amino acid sequence of mouse IL-6 (186 residues in the mature part) is shown in Neuron 7, 197-208 (199
1) It is disclosed in p.198, Fig.1. The amino acid sequences of human CNTF and mature human IL-6 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

The amino acid sequences of the A helix, B helix, C helix and D helix region of hCNTF are as follows. CNTF (13-42, 69-
96, 105-129, 152-180). hIL-6
The amino acid sequences of the A helix, B helix, C helix, and D helix region are as follows. I
L-6 (19-48, 80-101, 109-131,
152-184). The definition of each domain of the present invention is not strict and includes a range of about ± 5 residues (Bazan, JF, Neuron 7, 197).
-208 (1991) p.198).

[0011] The chimeric protein of the present invention basically comprises
Similar to the tertiary structure of CNTF and IL-6 such as A helix, AB loop, B helix, BC loop, C helix, CD loop, and D helix, it is composed of four helices and three loop portions between them. Is done. The combination can be appropriately selected, but preferably, A
It is a four-helix cytokine in which a helix, AB loop, B helix, BC loop, C helix, CD loop, and D helix are linked. In addition, as long as the chimeric protein thus prepared can substantially bind to the gp130 receptor, all or part of an arbitrary helix or loop may be added to or removed from this basic structure.
Amino acid sequence substitution can also be performed on these domain variant genes by a known site-specific mutagenesis method. Although the present invention is not limited to this, Table 1 below shows representative domain combinations (capital C is CNTF sequence, capital I is IL
-6).

[0012]

[Table 1]

Among them, A helix, AB loop, B helix, BC loop, C helix, C helix
Consists of D loop and D helix, A helix,
Chimeric protein in which AB loop and D helix are derived from CNTF and B helix, BC loop, C helix and CD loop are derived from IL-6, that is, chimera 4 has CNTF agonist activity and IL- 6 is specific in that it has both agonistic activities, and is a preferred example of the chimeric protein of the present invention.

[0014]

DETAILED DESCRIPTION OF THE INVENTION (Production method) The chimeric protein (or an addition, substitution, or deletion mutant thereof) of the present invention is obtained, for example, by culturing a transformed host expressing the chimeric protein under conditions permitting its expression. , And chimeric proteins can be produced by recombinant DNA technology. More specifically, the target compound is a)
Providing DNA encoding the chimeric protein, or chemically synthesizing such DNA, b) introducing this DNA into an appropriate expression vector, and c) transferring the resulting hybrid vector into a recipient host, d) selecting a transformed host from an untransformed host, for example by culturing under conditions in which only the transformed host will survive; e) culturing the transformed host under conditions permitting expression of the chimeric protein; f) isolating the chimeric protein. The steps involved in producing a chimeric protein by recombinant DNA technology are described in more detail below.

(Material) CNTF gene: natural type CNTF
Has already been cloned, and using the information in the following literature, J. Samblook "Molecular clonin
g: Alaboratory manual (molecular cloning:
Laboratory manual) ”, human, rabbit,
Rat-derived ones can be prepared or obtained. The following is
This is a paper or patent describing the DNA sequence and amino acid sequence of CNTF. KA Stockli et al., Nature 342 920 (1989) LF Lin et al., Science 246 1023 (1989) P. Masiakowski et al. J. Neurochem. 57 1003 (1991) A. Negro et al. Eur. J. Biochem 201 289 (1991) US 5,846,935 Regeneron: CNTF substituted at position 63 A commercially available human placental DNA library (Clontech) is convenient for obtaining the human CNTF gene (Inoue M et al. ProNAS USA 92 8579). -8583 (199
Five)).

IL-6 gene: The structural gene of native IL-6 has already been cloned,
J. Samblook "Molecular cloning: A laboratory manu
al (molecular cloning: laboratory manual) "
According to the conventional method described above, those derived from humans can be easily prepared. The DNA sequence and amino acid sequence of IL-6 are as follows:
(1) Human: J. Immunol. 139 4116-4121 (1987) p.41
19, Fig.2, (2) Mouse: Neuron 7, 197-208 (199
1) p.198, Fig.1, (3) Human: EMBO J. 6 2939-2945
(1987). For obtaining the human IL-6 gene, commercially available human lymphoma DNA (Clontech) is convenient.

In recent years, mutant genes with various mutations have been created for both CNTF and IL-6, but not only natural CNTF and IL-6 genes,
The genes of these addition, substitution, and / or deletion mutants can also be used for producing the chimeric protein of the present invention.

(Recombination operation) The above-mentioned CNTF and IL-6
A known method can be applied to obtain a DNA encoding a desired domain variant by processing a vector carrying the structural gene of the above. For example, in the case of the chimera 1 described above, a restriction fragment carrying a DNA sequence encoding the [A helix] of native hCNTF and [A-
B loop + B helix + BC loop + C helix + CD loop + D helix] A restriction fragment carrying a sequence is prepared, they are ligated in a solution, and the resulting construct is cloned. When a suitable restriction enzyme site is not present during ligation of the CNTF gene fragment and the IL-6 gene fragment, a synthetic oligonucleotide linker is inserted into any of the fragments, or the DNA sequence near the end is modified to obtain the desired restriction enzyme. Make a part,
Precise coupling can be achieved. After each cloning, the structure of the chimeric molecule is verified by restriction mapping and DNA sequence analysis.

Furthermore, the desired site of the chimeric protein can be modified by site-directed mutagenesis [MJ
A review of Zoller and M. Smith, Methods Enzymol. 1
00,468 (1983); D. Botstein and D. Shortle, Scienc.
e 229, 1193 (1985)]. Mutagenesis can be performed on the complete chimeric protein gene or any part thereof, and after mutagenesis, the gene may be ligated as described above to obtain a mutant chimeric protein gene.

Further, a desired gene can be amplified and obtained by using the polymerase chain reaction (PCR) method. That is, a DNA is obtained by a PCR method using Taq polymerase with a gene or cDNA as a template and two kinds of synthetic oligonucleotides as primers.
The gene may be amplified in vitro using an amplifier (HA Erlich et al., PCR Te
chemistry (1990)).

(Expression Vector and Host) An expression vector can be prepared by incorporating cDNAs encoding these chimeras into a plasmid carrying an appropriate promoter. These expression vectors are introduced into an appropriate host, transform cells, and used for production of the chimeric protein of the present invention. An appropriate system may be selected for the expression vector and the host from known techniques. Table 2 shows representative expression systems and references.

[0022]

[Table 2]

Expression vectors suitable for expression in E. coli hosts are commercially available (TOYOBO) and are particularly suitable for the practice of the present invention. Incidentally, the chimeric protein of the present invention,
Fusion expression, can be produced by any method of direct expression or secretion expression, additional peptide in fusion expression,
DNA encoding signal peptide in secretory expression
The sequence can be appropriately selected from known systems. Those that are compatible with the desired chimeric protein may be experimentally confirmed and used.

(Regeneration or Purification) The chimeric protein produced by the recombinant technique can be regenerated or purified by a method known in the field of biochemistry. Treatment with a denaturing agent and a reducing agent, ion exchange chromatography, gel filtration, reverse phase HPLC, ammonium sulfate precipitation, ultrafiltration, etc., are used in an appropriate combination. Antibodies against the CNTF / IL-6 chimeric protein can be prepared by a method known per se for both polyclonal and monoclonal antibodies. The specific antibody can be used for an immunocolumn such as an antibody column or ELISA.

The chimeric protein of the present invention can be used as a therapeutic agent for neurodegenerative diseases, a therapeutic agent for thrombocytopenia, a therapeutic agent for hepatocyte regeneration, a therapeutic agent for solid cancer, a therapeutic agent for diabetes, or a therapeutic agent for obesity, like CNTF or IL-6. Can be expected to be used.

As the pharmaceutical preparation, any of an injection, an oral preparation, a liquid preparation and a lyophilized product can be used, and an injection preparation for subcutaneous intramuscular administration is particularly preferable. For these parenteral preparations, stabilizers, buffers and carriers known in the art can be used. For example, plasma-derived proteins such as albumin, amino acids such as glycine, and sugars such as mannitol can be used. Tween 80 to prevent aggregation
For example, a surfactant such as a bactericide may be added for long-term storage. When a long-term effect is required, the preparation can be formulated using a known protein sustained-release preparation carrier (polylactic acid-polyglycolic acid copolymer, collagen, silicon, etc.).

[0027]

The present invention will be described below with reference to examples. Example 1 Construction of plasmid for expressing CNTF / IL-6 chimeric protein (Acquisition of CNTF / IL-6 gene) The human CNTF gene was reported from human placenta DNA (Clontech) and reported previously (Inoue,
M., Proc. Natl. Acad. Sci. USA 92, 8579-8583 (199
5)) and cloned into plasmid pcDL-SRα (T
akebe, Y. et al. Mol. Cell Biol. 8, 466-472 (198
The plasmid pcDLCNTF was obtained by insertion into the EcoRI site of 8)). In addition, from the human kidney cancer YCR1 cell cDNA library,
The clone was cloned with a [ ³² P] -labeled oligonucleotide probe corresponding to IL-6, and similarly the plasmid pcDL-SRα was Eco-
Plasmid pcDLhIL-6 carrying the full-length human IL-6 gene was obtained by insertion into the RI site.

(Construction of Chimeric Protein Gene) FIG. 1 shows a schematic diagram of the structure of the chimeric protein. CNTF and IL-
Since 6 is a 4-helix bundle protein consisting of A, B, C and D helices, a helix of hCNTF was replaced with the corresponding helix of IL-6 to construct a chimeric molecule. Chimera 1 has the helix of the hCNTF N-terminal A helix followed by the sequence of IL-6. Chimera 1
Chimera 2 was obtained by further substituting the AB loop (IL-6) of Example 1 with the CNTF sequence. Chimera 3 contains h
Consisting of the A / B helix of CNTF and the C / D helix of hIL-6, chimera 4 comprises the A helix / AB loop / D helix of hCNTF and the B helix of hIL-6.
It consists of a helix / BC loop / C helix / CD loop. Chimeras 5-8 each have the opposite configuration of chimeras 1-4 (Table 1).

PCR was used to construct the chimeric protein gene. For example, CNTF A helix, AB loop and D helix, IL-6 B helix, B-helix
In the case of chimera 4 consisting of C loop, C helix and CD loop, it was constructed by the method shown in FIG. As a first step in the PCR, the hCNTF: A helix and h
IL-6: Primer 1 for B helix (SEQ ID NO: 3)
And primer 14 (SEQ ID NO: 11)
Amplification was performed using CNTF as a template. The hIL-6: C helix fragment and the EcoRI linker-bound hCNTF D helix were combined with primer 13 (SEQ ID NO: 10) and primer 1
5 (SEQ ID NO: 12). The PCR product is
It was purified on a 5% polyacrylamide gel and used for PCR amplification using the following primers 1 and 13. The obtained amplified fragment was isolated after electrophoresis on a 1.5% agarose gel, and purified using Gene clean (BIO 101 Inc.). The obtained chimera 4 gene was precipitated with ethanol, pcDL-SR
It was inserted into the EcoRI site of α. Other chimeric genes were constructed by PCR shown in Table 3 below.

[0030]

[Table 3]

Example 2 Expression and Quantification of Chimeric Protein (Expression of Chimeric Protein) The chimeric protein expression plasmid was transformed into CO using transfectase (Gibco-BRL).
S cells were transfected and Dulbecco's modified Eagle's medium (DMEM, Gibco) -10% (v / v) fetal calf serum (FCS, JRH Bioscience) was used to transform the cells into 5%.
The cells were cultured at 37 ° C. for 3 days in the presence of% CO 2. Chimera 1-4 having N-terminus of hCNTF without signal sequence
Recovered the cells after 3 days of culture. Thereafter, the collected cells were washed with phosphate-buffered saline (PBS).
The cells were dissolved in 1% SDS-0.1 PBS. The lysate was separated from SDS on a detergent removing gel (Pieace) column and centrifuged (Centricon, Millipore).
Was concentrated to about 1 μg / ml. On the other hand, IL-6
In the case of Chimera 5-8 having an N-terminal secretion signal, the medium was centrifuged at 100,000 xg for 1 hour at 4 ° C, and the culture supernatant was collected. Using these cell lysate and medium supernatant,
Protein quantification and biological assays were performed.

(Quantification of chimeric protein) hIL-6 (commercial product: Genzyme) or hCNTF (E. coli expression, Mas
The concentration of the expressed chimeric protein was determined by immunoblotting using iakowski et al. as a standard). That is, a conditioned medium or cell lysate sample is
Purified by -20% gradient SDS-PAGE, PVD
After transfer to an F membrane (BioRad), bound [ ¹²⁵ I] was quantified using an image analyzer (Bass2000, Fuji).
Rabbit anti-hIL-6 antibody (Genz
yme) was used for the chimera 2-8, a rabbit anti-hCNTF antibody obtained by sensitization with purified hCNTF, and a goat anti-rabbit [ ¹²⁵ I] IgG (Amersham) was used for the secondary antibody. The concentrations of the chimeric proteins were 1: 0.8 μg / ml for chimera, 4: 5 μg / ml for chimera, 8:12 μg / ml for chimera, and 1 μg / ml for the other chimeric proteins.

Example 3 Activity of Chimeric Protein (Method of Measuring Biological Activity of CNTF) The CNTF activity was measured according to a previously reported report (Inoue et al., 1995, supra), at the age of 10 days old (E10) chicken embryos isolated. Root ganglion neurons were used. That is, cells are prepared and separated, and 100
IU / ml penicillin (Gibco), 100 IU / ml streptomycin (Gibco), 250 ng / ml amphotericin B (Gibco)
co, 2 mM L-glutamine, 5% (v / v) FCS and 5
-96-well microplate (Falcon) containing DMEM containing fluorodeoxyuridine (Nacalai Tesque, Inc.)
40) per well on polyornithine-laminin substrate
Planted 00-5000 neurons. After 72 hours of culture, cell viability was determined by MTT (3- [4,5-dimethylthiazol-2-yl] 2,5-di
phenyltetrazolium bromide) assay.

(Method of Measuring Biological Activity of IL-6)
-6 dependent mouse-mouse hybrid cell line, MH
The method described in the paper of Matsuda et al. (Protein, Nucleic Acid, Enzyme. 33 (8): 1317-22 (1
988)). That is, MH
60 cells were placed in a 96-well tissue culture plate (Nunc), 1
100 μl / well of DMEM with 10% FCS 100 μl
During l, suspended at a density of 2x10 ⁵ cells, 5% CO ₂ presence and 66 hours at 37 ° C.. ^[3 H] thymidine (37kB
q / well), and the cells were further cultured for 6 hours. Thereafter, the cells were collected, and the incorporated [ ³ H] thymidine was measured using a beta plate (Pharmacia).

(CNTF activity of chimeric protein) In the aforementioned E10DRG neuron system, among the chimeric proteins measured, chimeras 1, 2, 3, 5, 6 and 7
Showed no neuronal survival maintaining activity. However, chimera 4 or chimera 8 showed activity to maintain the survival of E10DRG neurons (FIG. 3). Neurons that survived in the presence of Chimera 4 or Chimera 8 had round cell bodies exhibiting a bright peripheral phase and exhibited the characteristics of active neurons (FIG. 4).

(IL-6 activity of chimeric protein) In the aforementioned IL-6-dependent MH60 cell line, chimera 1
The specific activity was similar to that of IL-6. Chimera 4 showed higher [ ³ H] thymidine incorporation than the control cell lysate (mock transfection of pcDL-SRα). Chimera 4 is IL
It was shown to retain -6 activity (FIG. 5).

[0037]

EFFECTS OF THE INVENTION The chimeric protein of the present invention is useful for elucidating the mechanism of expression of cytokine activity, and is also useful for the treatment of neurodegenerative diseases, thrombocytopenia, hepatocyte regeneration, solid cancer, and diabetes. Alternatively, it can be expected to be used as a therapeutic agent for obesity.

[0038]

[Sequence List] SEQUENCE LISTING <110> Sumitomo Pharmaceuticals Co., Ltd. <120> Chimera protein of CNTF and IL-6 <130> 132609 <160> 17 <170> PatentIn Ver. 2.0 <210> 1 <211> 200 <212> PRT <213> Homo sapiens <220> human CNTF <400> 1 Met Ala Phe Thr Glu His Ser Pro Leu Thr Pro His Arg Arg Asp Leu 1 5 10 15 Cys Ser Arg Ser Ile Trp Leu Ala Arg Lys Ile Arg Ser Asp Leu Thr 20 25 30 Ala Leu Thr Glu Ser Tyr Val Lys His Gln Gly Leu Asn Lys Asn Ile 35 40 45 Asn Leu Asp Ser Ala Asp Gly Met Pro Val Ala Ser Thr Asp Gln Trp 50 55 60 Ser Glu Leu Thr Glu Ala Glu Arg Leu Gln Glu Asn Leu Gln Ala Tyr 65 70 75 80 Arg Thr Phe His Val Leu Leu Ala Arg Leu Leu Glu Asp Gln Gln Val 85 90 95 His Phe Thr Pro Thr Glu Gly Asp Phe His Gln Ala Ile His Thr Leu 100 105 110 Leu Leu Gln Val Ala Ala Phe Ala Tyr Gln Ile Glu Glu Leu Met Ile 115 120 125 Leu Leu Glu Tyr Lys Ile Pro Arg Asn Glu Ala Asp Gly Met Pro Ile 130 135 140 Asn Val Gly Asp Gly Gly Leu Phe Glu Lys Lys Leu Trp Gly Leu Lys 145 150 155 160 Val Leu Gln Glu Leu Ser Gln Trp Thr Val Arg Ser Ile His Asp Leu 165 170 175 Arg Phe Ile Ser Ser His Gln Thr Gly Ile Pro Ala Arg Gly Ser His 180 185 190 Tyr Ile Ala Asn Asn Lys Lys Met 195 200

<210> 2 <211> 185 <212> PRT <213> Homo sapiens <220> humen IL-6 <400> 2 Ala Pro Val Pro Pro Gly Glu Asp Ser Lys Asp Val Ala Ala Pro His 1 5 10 15 Arg Gln Pro Leu Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr 20 25 30 Ile Leu Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Cys Asn Lys Ser 35 40 45 Asn Met Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu Asn Asn Leu Asn 50 55 60 Leu Pro Lys Met Ala Glu Lys Asp Gly Cys Phe Gln Ser Gly Phe Asn 65 70 75 80 Glu Glu Thr Cys Leu Val Lys Ile Ile Ile Thr Gly Leu Leu Glu Phe Glu 85 90 95 Val Tyr Leu Glu Tyr Leu Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln 100 105 110 Ala Arg Ala Val Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln 115 120 125 Lys Lys Ala Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr 130 135 140 Asn Ala Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln 145 150 155 160 Asp Met Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu Phe Leu Gln 165 170 175 Ser Ser Leu Arg Ala Leu Arg Gln Met 180 185

<210> 3 <211> 30 <212> DNA <213> Homo sapiens <400> 3 gagagaattc atggctttca cagagcattc 30

<210> 4 <211> 36 <212> DNA <213> Homo sapiens <400> 4 tatgtgaagc atcagggctg taacaagagt aacatg 36

<210> 5 <211> 36 <212> DNA <213> Homo sapiens <400> 5 catgttactc ttgttacagc cctgatgctt cacata 36

<210> 6 <211> 36 <212> DNA <213> Homo sapiens <400> 6 gcagagcgac tccaagagga ggagacttgc ctggtg 36

<210> 7 <211> 36 <212> DNA <213> Homo sapiens <400> 7 caccaggcaa gtctcctcct cttggagtcg ctctgc 36

<210> 8 <211> 36 <212> DNA <213> Homo sapiens <400> 8 cattttaccc caaccgaaga gagtagtgag gaacaa 36

<210> 9 <211> 36 <212> DNA <213> Homo sapiens <400> 9 ttgttcctca ctactctctt cggttggggt aaaatg 36

<210> 10 <211> 30 <212> DNA <213> Homo sapiens <400> 10 tctcgaattcc tacattttct tgttgttagc 30

<210> 11 <211> 128 <212> DNA <213> Homo sapiens <400> 11 actcatctgc acagctctgg cttgttcctc actactctca aatctgttct ggaggtactc 60 taggtatacc tcaaactcca aaagaccagt gatgattttc accaggcaag tctcctcctctccctccctccctccctccctcctcctcctcctcctcctcctccctc

<210> 12 <211> 128 <212> DNA <213> Homo sapiens <400> 12 gagagtagtg aggaacaagc cagagctgtg cagatgagta caaaagtcct gatccagttc 60 ctgcagaaaa aggcaaagaa tctagatgca ataaccaccc ctgacccagaccagcattagcaatgca atg

<210> 13 <211> 30 <212> DNA <213> Homo sapiens <400> 13 gagagaattc ctacatttgc cgaagagccc 30

<210> 14 <211> 30 <212> DNA <213> Homo sapiens <400> 14 gagagaattc atgaactcct tctccacaag 30

[0052]

[Brief description of the drawings]

FIG. 1 is a schematic structural diagram of a chimeric protein. Black bars and bold lines represent hCNTF helix and loop sites, respectively. The white bar and the thin line are hIL
-6 helix and loop site.

[0053]

FIG. 2 shows a method for constructing a chimeric protein gene (chimera 4). The shaded area indicates the hCNTF gene, and the white and black areas indicate the hIL-6 sequence. Primers 15 and 14
Are the complementary sequences, which anneal the fragments AB and CD produced by the first and second PCR amplifications.

[0054]

FIG. 3. Measurement of CNTF activity of chimeric protein using chicken E10DRG neurons. (A) CNTF activity of chimeras 1-4 recovered from cell lysates. Open triangles indicate lysates of COS cells, solid circles indicate lysates of COS cells with purified CNTF added. (B) CN of chimera 5-8
TF activity. These chimeras were recovered from cell supernatants of COS cells. The open triangle indicates the supernatant of the COS cell, and the control group is the one obtained by adding IL-6 to the COS cell culture supernatant (solid circle). Bars represent standard deviation.

[0055]

FIG. 4. C in chicken E10 DRG neurons
Typical microscopic analysis example showing NTF activity. Chicken E10
DRG neurons were cultured for 3 days in the absence of hCNTF, chimera 4, or their absence. A: control group (no addition), B: hCNTF (100 ng / ml), C: chimera 4
(100 ng / ml).

[0056]

FIG. 5: Measurement of IL-6 activity of chimeric protein using IL-6-dependent cell line: MH60. (A) IL-6 activity of chimeras 1-4 recovered from cell lysates. Open triangles are lysates of untransfected COS cells,
The filled circles are those obtained by adding IL-6 to the COS cell lysate. (B) IL-6 activity of chimera 5-8. The open triangle indicates the supernatant of the COS cell, and the control group is the one obtained by adding IL-6 to the COS cell culture supernatant (solid circle). Bars represent standard deviation.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) C12N 5/10 C12P 21/02 C C12P 21/02 A61K 37/02 C12N 5/00 BF term (reference) 4B024 BA21 BA26 BA80 CA04 CA07 CA09 CA20 DA02 EA04 FA18 GA11 GA18 HA13 HA14 4B064 AG01 AG03 CA10 CA19 CC01 CC24 CE02 DA01 DA13 4B065 AA90X AA93Y AB01 AC14 AC16 BA02 BA30 BB01 BC01 BD01 BD50 CA24 CA44 CA46 4C084 AA59 MA18 MA18 BA18MA12 ZA532 ZA702 ZA752 ZB262 ZC352 4H045 AA10 AA20 AA30 BA41 CA44 CA46 DA02 DA21 EA20 EA50 FA74

Claims (7)

[Claims] 1. A chimeric protein comprising the whole or partial amino acid sequence of CNTF and the whole or partial amino acid sequence of IL-6 in a molecule. 2. An A helix, an AB loop, a B helix, a BC loop, a C helix, a CD loop,
It has a configuration of a 4-helix cytokine in which D helices are linked, and the partial amino acid sequence of CNTF is A helix, AB loop and D helix, and the partial amino acid sequence of IL-6 is B helix, BC loop, C
The chimeric protein according to claim 1, which is a helix and a CD loop. 3. A DNA encoding the chimeric protein according to claim 1 or 2. A vector comprising the DNA according to claim 3. [5] A cell comprising the vector according to [4]. 6. The cell according to claim 5, which is cultured, and the whole or partial amino acid sequence of CNTF and IL-
CNTF-IL characterized by isolating and purifying a chimeric protein containing the full or partial amino acid sequence of No. 6 in the molecule
-6 A method for producing a chimeric protein. 7. A medicament comprising the chimeric protein according to claim 1 as an active ingredient.