JP2000511428A - Antisense nucleic acids and hammerhead ribozymes - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention is directed to antisense nucleic acids and hammerhead ribozymes, and antisense constructs that are specific for transcripts encoded by chromosomal translocations, such as bcr-abl fusions. Pharmaceutical compositions comprising the constructs.

Description

DETAILED DESCRIPTION OF THE INVENTION            Antisense nucleic acids and hammerhead ribozymes   The present invention is directed to antisense constructs, particularly transcripts encoded by chromosomal translocations. Antisense nucleic acids and hammerhead ribozymes that are unique A pharmaceutical composition comprising the chisense construct.   Antisense nucleic acids and ribozymes are powerful in gene expression and viral function Have been shown to be arschall et al., 1994; James & Al-Shamkhani, 1995; Sczakiel & Nedbal, 1995). The selectivity of the sequence is less for cellular target sequences that differ only slightly from non-target sequences. Of particular importance. For short antisense oligonucleotides (<30 nt), the Selective bond to target is determined by comparing the melting temperatures of the formed double helices. And sequence selectivity was clearly demonstrated in live cells (Sch wab et al., 1994). Conversely, for long double helices (> 30-40 nucleotides), The distinction between targets to be matched and sequences that differ by only one or a few bases is not expected. It seems that there is nothing. Therefore, melting temperatures are suitable for determining selectivity in vitro. I'm not out.   For long antisense RNAs, the rate of in vitro association with their target RNAs (a The association rate correlates with their effectiveness in vivo. This is prokaryotic With naturally occurring antisense RNA (Wagner & Simons, 1994) and human cells RNA-mediated inhibition of human immunodeficiency virus type 1 (HIV-1) replication in bacteria In harm (Rittner et al., 1993). In the latter case, antisense strands of almost the same length A substantial difference was observed in the association rates of As a result, hybridize faster Searching for antisense species to aid in the identification of improved inhibitors Is not necessarily a problem of double helix stability, but for long complementary RNA sequences There is an issue of association kinetics. Therefore, the search for a selective antisense inhibitor requires It must be based on the study of the association kinetics of complementary nucleic acids.   In the case of ribozymes, both binding to the target and its cleavage are specific for the target. It is thought to contribute to collapse. Only one hammerhead ribozyme Antisense arms, such as helix III forming sequences, and catalytic domains But with the exception of at least some of the three base pairs. (Helix I) can be designed (Tabler et al., 1994). This asymmetry Design for two functional domains, binding The antisense arm and the catalytic domain for cleavage. It Thus, association kinetics can be performed systematically. Binding domain and catalytic domain Only when the target sequence matches perfectly, both the binding and the cleavage of the target sequence are Can be arranged as is possible.   A biologically relevant model system for studying sequence selectivity is the genomic It contains transcriptionally active sequences resulting from chromosomal abnormalities in Related to the growth of malignant cells Chromosomal translocations are of particular interest. For example, the t (9; 22) translocation has a bcr A bcr-abl fusion gene consisting of the abl sequence in the sequence and 3'-part is generated (Kurzrock et al. 1988). This translocation is critical in the development of human chronic myeloid leukemia (CML). It is considered to play an important role. This view suggests that the expression of the bcr-abl gene is Studies in mice showing similar malignancies (Daley et al., 1990; Kellih er et al., 1990). abl wild-type gene (Konopka & Witte, 1985; Sawyers et al., 1994). bcr remains The function of the gene product is not yet clear, but it is a multifunctional signal conductivity tag. Is considered to function as a protein (Maru & Witte, 1991; Maru et al., 1995) Voncken et al., 1995). Therefore, selective inhibition of the bcr-abl gene is Required to spare wild-type genes.   Therefore, the technical problem underlying the present invention may be to cause a serious disease such as cancer. Specific and selective expression of fusion genes formed by potential chromosomal translocations To provide a new system for inhibition.   The solution to the above technical issues is (a) a portion complementary to the first chromosomal DNA sequence; and (b) a portion complementary to the second chromosomal DNA sequence,   By providing a nucleic acid comprising a nucleotide sequence comprising: The first and second chromosomal DNA sequences have at least one of the chromosomal translocations resulting in the fusion gene. Form a part, which includes a translocation point.   The terms "nucleic acid" and "nucleotide sequence" refer to an endogenously expressed, half- Synthetic, synthetic or chemically modified deoxyribonucleotides and / or Or a ribonucleotide nucleic acid molecule.   The phrase “part that is complementary” refers to a nucleic acid that can base pair with a given nucleic acid. Region, for example, refers to a biologically relevant target nucleic acid, and thus the target and the double-stranded nucleus Can form acids.   The term "chromosomal translocation" refers to chromosomal loci that are not linked together in normal cells. DNA sequence combinations. Departure In a specifically preferred embodiment, the chromosomal translocation is t (9; 22). The term "fusion gene" is a consequence of chromosomal rearrangement. And refers to a gene consisting of a combined DNA sequence at different chromosomal loci. Fusion Syngenes can express genetic information that is not so present in normal cells.   In a preferred embodiment of the invention, the nucleotide sequence is substantially a ribonucleotide. Consists of tide. Preferred examples of such nucleotide sequences are listed below:   In a further embodiment of the present invention, part (a) of the above nucleotide sequence and / or Or part (b) comprises the catalytic domain of a hammerhead ribozyme. Departure Nomenclature and Numbering System for Hammerhead Ribozymes Used in Ming The system corresponds to Hertel et al. (1992).   The term "catalytic domain" refers to the site-specific cleavage of another nucleic acid in trans (i n trans) refers to a nucleic acid sequence that can be catalyzed. A target nucleic acid and a nucleic acid containing a catalytic domain After the cleavage competent complex is complementary to the target Formed and promoted through part of the human chain.   In a preferred embodiment, the above defined nucleic acid is an asymmetric hammerhead. Contains the sequence of the ribozyme; ie, one of the regions flanking the catalytic domain Are shorter in length than others. Part (a) and / or part (b) Helix I- and / or Helix III-forming region of the Merhead ribozyme At least a portion of   The expression "helix I- and / or helix III-forming region" refers to the 3 ' And / or a ribozyme sequence flanking the catalytic domain on the 5 'side, respectively Points to the column area. Preferred examples of the asymmetric hammerhead ribozyme sequence Are listed below.   Another embodiment of the present invention relates to a nucleus that, when transcribed into RNA, corresponds to a nucleic acid as described above. It relates to DNA sequences containing acids. The term "when transcribed" refers to a suitable RNA Enzymatic conversion of a DNA sequence into an RNA sequence by a protease.   Another embodiment of the present invention relates to a DNA comprising a nucleic acid or DNA sequence, as described above, and And / or an RNA vector. The term "vector" refers to an exogenous nucleotid Refers to DNA and / or RNA replicons that can be used to amplify the nucleotide sequence. Especially unpaired The hammerhead ribozyme context is useful in the context of the hammerhead -It is a DNA or RNA vector that enables the expression of ribozymes. One example is a non- Place the nucleic acid encoding the symmetric hammerhead ribozyme under the appropriate promoter. In the stream, so that transcription from the promoter is functional and catalytically active A DNA vector that produces an asymmetric hammerhead ribozyme.   Another embodiment of the invention comprises a nucleic acid, DNA sequence or vector as described above Related to host organisms. The term “host organism” refers to viruses, bacteria, fungi, plants, Or feeding About animals.   A preferred embodiment of the present invention relates to the above nucleotide sequence or asymmetric hammer. Episomal replication system capable of amplifying nucleic acid encoding a head ribozyme A host organism having a host system. The term "episomal replication system" Refers to a replication system that is independent of the main genome; that is, plasmid DNA or Lus is an episomal replication system.   A further preferred embodiment of the present invention provides that at least one of the aforementioned nucleic acids is present in its genome. A genetically engineered host organism, including one. The term "genome" is Refers to the entire genetic material that can be passed on to generations. In particular, the present invention relates to functional, catalytic Organisms that inherit the property of synthesizing chemically active asymmetric hammerhead ribozymes About.   A further embodiment of the present invention provides that a host organism as described above is prepared according to procedures known in the art. Culturing under suitable conditions and from culture (cells and / or culture medium) Production of a nucleic acid, DNA sequence or vector as described above, including isolating the desired product. Regarding the raw method.   In a further embodiment, the invention relates to a nucleic acid, a DNA sequence or a vector as described above. Comprising, if necessary, together with a pharmaceutically acceptable carrier and / or diluent, Pharmaceutical group About adult. The pharmaceutical composition comprises chronic myeloid leukemia, acute lymphoblastic leukemia Chromosomal transitions, such as acute myeloid leukemia, and low-stage non-Hodgkin lymphoma It can be used to treat locus-based diseases. In particular, the nucleic acids, DNA sequences or vectors described above. Is the purging of hematopoietic stem cells from malignant cells in the treatment of patients Parenteral and other means of administration to remove target RNA in human patients, including Can be used.   The nucleic acids directed to the bcr-abl described herein may be a bcr-treated blcr. bcr and abl wild-type residues due to effective inhibition and sequence selectivity in -abl-positive cells It works on both unmodified and unmodified expression. Normal for bcr and abl wild-type genes The latter property is extremely important, since proper expression is essential for normal cell growth. Book Experimental testing of sequence selectivity as described herein is novel.   The drawings show:   Figure 1: Description of the construct from bcr-abl used in this work. (A) Upper part shows target RN Schematic mapping of bluescript-based plasmids for in vitro transcription of A Show Black arrows indicate the orientation of the T7 and T3 promoters. In addition, three markers RNAs ab / 1b, bcr and bcr-abl are shown. Numbers in white bars are bcr-abl, abl And bcr gene Kuson is shown respectively. The numbers shown at the top indicate the length of the RNA. (B) Parent Ann Thisense RNA and ribozymes. The numbers at the top indicate the length of the RNA. (C) Ribosai Sequence of the complex formed between the RNA and bcr-abl substrate RNA. The cleavage position is indicated by the arrow and And bcr-abl fusion points, indicated by dotted lines.   Figure 2: Schematic depiction of kinetic in vitro selection and rapid hybridization. Identification of chisense RNA and ribozyme species.   Figure 3: Antisense RNA species from αBA62 as a function of antisense strand length. Annealing with bcr-abl, ab / 1b or bcr target RNA. (A) Modified polyacryl Single-stranded fractionation of the above hybridization reaction by amide gel electrophoresis And time course of the composition of the hybrid fraction. The number at the top of the lane indicates the time in minutes Show. Arrowheads indicate RNA length in nucleotides. Annealing reaction with ab / 1b RNA Phosphor imagers ranging from 20 to 30 nt in the hybrid fraction With the signal, it was possible to calculate the rate constant. However, these The signal is not clearly seen in this figure. (B) Association rate constant (k_obs) A plot of the strand length.   Figure 4: αARz7 as a function of antisense strand length Annealing of 2 antisense RNA species with bcr-abl, ab / 1b or bcr target RNA (Refer to the legend note to FIG. 3 for parts A and B of this figure).   Figure 5: bcr-abl, ab / 1b, and other antisense RNA species derived from αBA72, αBA80, and αBRz57. Or the association rate constant for annealing with bcr target RNA (k_obs) Vs antisense strand Long.   Figure 6: Antisense oligodeoxyribonucleotides αBA23 and αBA28 and Mediated by the RNaseH of the bcr, ab / 1b, and bcr-abl RNA sequences in the presence of Cleavage selectivity. The numbers above the lanes indicate the incubation time in minutes. bc The r-abl cleavage products P1 and P2 are indicated by black arrowheads. White arrowhead is another cleavage Indicates an object.   FIG. 7: bcr, ab / 1b, and in the presence of nuclear extracts from various amounts of human cells Selectivity of RNaseH-mediated cleavage of the bcr-abl RNA sequence. Nuclear extraction in total reaction volume The object part is indicated by%. The number at the top of the lane indicates the incubation time. Indicated by The bcr-abl cleavage products P1 and P2 are indicated by black arrowheads.   Figure 8: Folding ability of sequences 120 nt upstream and downstream of the bcr-abl fusion point. The calculation is As described recently (Sczakiel et al., 1993), the window size was 50 nt and Performed with a step width of 1 nt. The local minimum shown in ninth place is ΔG relating to the structure at positions 9 to 58 including the structural elements (+11 to +58) shown in the figure Indicates a value.   The following examples illustrate the invention: RNA strand showing ab / 1b, bcr, and bcr-abl (b3 / a2) sequences   Using the human Philadelphia positive (Ph +) cell line K562 (Lozzio & Lozzio, 1975) Perform mRNA isolation and reverse transcription followed by ab / 1b, bcr, and bcr-abl sequences. CDNA was amplified by PCR. The primers for PCR were constructed using bcr-abl fusion About 300 nucleotides upstream and about 300 nucleotides downstream of point b3 / a2, i.e., ab / 1b R It was selected to contain regions equal to NA and bcr RNA, respectively (FIG. 1A). 3 All three target transcripts consisted of about 600 nucleotides for two reasons. ( i) The authentic local structure near the fusion point sequence should be preserved by this RNA length It is. This view has independent folding units formed during RNA transcription. Based on evidence suggesting that RNA may have a domain-like structure (Zarrinkar & Williamson, 1994). The 300 nt stretch on either side of the fusion point does not naturally occur May allow the formation of three-dimensional local RNA structures. (ii) a chain length of 600 nucleotides Is at least four times greater than the length of the antisense species used herein. Therefore ,I During the course of the in vitro selection assay (Rittner et al., 1993), single-stranded fractions were Can be separated from the double helical fraction which is a prerequisite.   For in vitro transcription of RNA, amplified bcr-abl, ab / 1b and bcr cDNA The fragment was ligated to the plasmid 'Bluescript' and the sequence of the resulting construct was It was sequenced and examined. Wild-type sequences ab / 1b and bcr, respectively, and b3 / a2 fusion Was obtained. However, nucleotide sequence comparisons are an Showed that the sequence isolated from was different from the original sequence. ab / 1b cDNA sequence Contained an additional ATG at the 3 'end of exon 1b (Shtivelman et al., 1986). similar Observations were made by Bernards et al. (1987). bcr cDNA is the published bcr sequence At positions 552 and 579 of 'A' to 'G' (Heisterkamp et al., 1985). I However, these differences are due to the antisense and release Because it is located outside the target region of the bozyme construct, Is not relevant (Fig. 1). Antisense RNA and asymmetric ribozymes directed against the bcr-abl fusion point sequence M   Use cloned bcr-abl sequence pBSbcr / abl600 Antisense RNA species directed to three parent bcr-abl and two asymmetric A plasmid was prepared for in vitro transcription of Nmmerhead ribozyme (Fig. 1B, C). The three antisense species differ in the length of the part that is complementary to the abl sequence. (12, 22, or 30 nt, respectively) and share the same 50 nt bcr-directed sequence. Have. Asymmetric hammerhead ribozymes have one anti-antibody instead of two Coupling through the sense arm. They can be used in vitro and in living cells. Have been shown to work equally well as their symmetric equivalents (Tabler et al., 1994). This A ribozyme (αBRz57) directed to one bcr-abl used in the study of It was designed to bind through a row and cleave within the bcr portion. Second bcr-abl Ribozyme (αARz72) is preferentially bound via the bcr sequence and Cleavage within minutes (FIG. 1C). Identification of complementary RNA selective binding: association kinetics   Parental antisense RNA and ribozymes are synthesized by in vitro transcription. At one end³²P-labeled. Limited alkaline hydrolysis shares a common end Yielded a pool of RNA species that were continuously shortened at the other end. Such related The association rate constant for the species is shown schematically in FIG. At 37 ° C. and physiological ionic strength (100 mM NaCl), as shown in FIG.   Any of the three parent antisense constructs αBA62, αBA72, or αBA80 and 2 Of each of the related species derived from the two parent asymmetric ribozymes αARz72 or αBRz57 Association rate constants related to chain length are shown in FIGS. 3-5. The maximum association rate constant is 1-3 × 10^FourM^-1s^-1Value was reached.   The 25- to 31-mer from αBA62, which associates most quickly with the bcr-abl target, but not the Or more than an order of magnitude slower than the association with either the ab / 1b target. Similarly, even longer 34 ΑBA72-derived species in the range of ~ 39 nucleotides and a length range of 58-62 nucleotides ΑARz72-derived species showed kinetically selective annealing (FIG. 4). However However, none of the αBRz57-derived species works selectively, and in the 53-62 nt range bcr- Annealing with the abl sequence was even slower than annealing with the ab / 1b sequence ( (Fig. 5). Hammerhead ribozyme that specifically cleaves the bcr-abl fusion point sequence   Ribozyme αARz33 directed to two selected bcr-abls (59 quantities from αARz72 ) And αBRz42 (72mer from αBRz57), both the association and cleavage steps Three Fruit that contributes to the specific destruction of either the target bcr-abl, bcr, or ab / 1b, respectively Under the experimental conditions, selectivity was measured. The measurement is carried out first at a temperature of 37 ° C and at physiological Made at ionic strength. However, undesired cleavage of the ab / 1b or bcr sequence The reaction was performed even at 50 ° C, where the cleavage reaction was faster, to more closely monitor . The half-life of the bcr-abl target ranges from 10 to 12 hours at 37 ° C and about 2.5 hours at 50 ° C RNA. (Table 1). Conversely, the half-life of the bcr sequence is greater than 150 hours for both ribozymes. It was long. Not only cleaved ab / 1b sequence, but directed to 19 contiguous ab / 1b For αARz33, which also binds through some of the bases, the selectivity was temperature dependent, Not as markedly as with αBRz42. At 37 ° C, using αARz33, bcr-abl The half-life of the sequence is approximately 7.5 times shorter than the half-life of the ab / 1b sequence and is less than the half-life of the bcr sequence. At least 10 times shorter when compared (Table 1). At 50 ° C, bcr-abl and ab / 1b sequences The difference from the half-life was only two-fold (Table 1). In vivo of both ribozymes No cleavage occurred with the use of the inactive derivative. Table 1: bcr, ab / 1b, and bcr-abl target chains of ribozymes αARz33 and αBRz42 Half-life of the cleavage reaction withFor antisense oligodeoxyribonucleotide and RNaseH of bcr-abl RNA Selective cleavage by   Assays to identify rapidly annealing antisense species are shown in FIGS. 3-5. As was done with RNA. Using deoxyribonucleotides (DNA) The selective annealing of the antisense species derived from the experiment was monitored. Synthesis When antisense DNA is used instead of RNA, RNA-DN with a minimum length of 6-8 base pairs A hybrid chain To allow the RNaseH annealing reaction to continue. Given Under experimental conditions, the process of associating complementary nucleic acids is rate-limiting and DNA-RNA heterozygous. There was no RNaseH-mediated cleavage of the heavy helix. Three targets (bcr-abl, bcr, and ab / All of 1b) are chemically synthesized oligodeoxyribonucleotides αBA23, αB In the presence of A25, αBA28, or αBA30, respectively, and in the presence of RNaseH And incubated. Oligonucleotides αBA25 and αBA30 were derived from αBA62. It corresponds exactly to the native RNA-25 and -30mers (FIG. 3). All αBA62-derived distributions The rows have two additional non-complementary 'G'-nucleotides at their 5' end. It To investigate their role, two antisense orientations lacking two 'G's at the 5' end were used. Gonucleotides (αBA23 and αBA28) were synthesized. About species αBA23 and αBA28 The results are shown in FIG. All constructs are either poor in bcr or ab / 1b wild-type sequences or Strongly cleaves the bcr-abl target under conditions that result in insignificant degradation, Showed that selective binding occurred in a mixture of all potential target strands. Oligonu Nucleotides αBA28 and αBA30 with 16 nucleotides that are complementary to bcr When used again, another cleavage product appears (open triangle in FIG. 6), which is Is not assigned to the cleavage of bcr RNA in the vicinity I can't.   To examine sequence selectivity under conditions closer to living cells, αBA23 and αBA25 The RNaseH assay used was performed in the presence of nuclear extracts isolated from human cells . When the nuclear extract formed 3% to 30% of the total reaction volume, bcr-ablRNA contained bcr and It disappeared significantly faster than abl RNA, indicating selective degradation of the bcr-abl chain. Antisen In the absence of S-oligonucleotide and RNaseH, degradation of all three RNAs Higher amounts of nuclear extract occurred at an increasing and indistinguishable rate. The result is bcr-ab l Eliminates endogenous nuclease activity that preferentially degrades RNA. Conversely, increase In nuclear extracts, bcr-abl RNA is much faster than bcr and abl RNA Decomposed (FIG. 7). Quantification of band intensity by phosphor imager (data shown (Not shown), in 10% nuclear extract, αBA23 sequence selectivity was measured in 3% nuclear extract. It was shown to be about twice as large as specified (FIG. 7). A higher amount of nuclear extract (30% (Data not shown), which is even larger and impairs sequence selectivity. Strongly suggests similar levels or even stronger in vivo. Association of antisense oligodeoxyribonucleotides Speed constant   To elucidate the role of the 2'-OH group in association, antisense from αBA62 ・ Complementary DNA and RNA of a set of oligonucleotide and bcr-abl target RNA The annealing kinetics were compared (Table 2). All DNA species are significantly different from the bcr-abl target. (10^Three-Ten^FourM^-1s^-1) Anneal to reflect the accessibility of the fusion point Under similar experimental conditions in vitro, it is three to five times slower than homologous complementary RNA. Was.   Due to the requirements for efficient transcription in vitro, all of the antisense species Contained two 'G' residues at their 5 'end (αBA25 and αBA30). Further In addition, association kinetic studies were performed on αB, a derivative lacking two noncomplementary 'G' residues at the 5 'end. Performed using A23 and αBA28. Two longer species, αBA28 and αBA3 The association rate constant of 0 was similar regardless of the 5'-GG residue (about 3.6 x 10^ThreeM^-1s^-1, Table 2). For the shorter oligonucleotides αBA23 and αBA25, An increase in the association rate constant for αBA23 lacking two 'G' residues was measured (6.8 × Ten^ThreeVs 4.4 × 10^ThreeM^-1s^-1), Where the addition of two non-complementary 'G' residues at the 5 'end is It was shown to be significantly disadvantageous for double helix formation in vitro. Table 2: Antisense oligonucleotides and bcr, ab / 1b, and bcr-abl targets Second-order rate constant for association with the chain (k_obs) Selectivity of antisense nucleic acids and hammerhead ribozymes   Selective binding in vitro can be achieved with short complementary sequences (<30 nt) as well as longer phases. Complementary RNA strands (> 30 nt) were observed. This is the equilibrium of the annealing reaction, Stability of the double helix (T_mValue could not be explained. Conversely, the association speed Is an appropriate parameter for assessing selectivity. However, oligode Oxyribonucleotides react more slowly than similar RNAs. Neal. For example, oligodeoxyribonucleotides αBA25 and αBA30 (Table 2) annealed 3-5 times more slowly than each RNA strand (FIG. 3). However However, the comparable selectivity between the tested oligomeric DNA and RNA is Indicate that the parameters are independent of the type of nucleic acid used. Therefore The strategy used in this work also includes a variety of chemically modified antisense nucleic acids and And ribozymes.   As confirmed by the selective cleavage of bcr-abl RNA in the presence of RNaseH (data Are not shown), the two 'G' residues present at the 5 'end of constructs αBA25 and αBA30. The group had no significant effect on selectivity. Nevertheless, the annealing Significant reduction was observed compared to derivatives lacking two 'G' residues (Table 2).   In many cases, the change in complementary RNA species from selective to non-selective is sharp, i.e. , Addition or deletion of only 1 to 3 nucleotides has kinetic selectivity, Short antisense species (Southern et al., 1992), as well as long antisense RNA (Rittne r et al., 1993) can significantly affect the association rate constant consistent with earlier studies. You.   Annealing of the complementary RNA is performed by an enhancer such as hnRNP protein (e.g., hnRNP  A1 protein; Pontius & Be rg, 1990) or the compound cetyltrimethylammonium bromide, (For an overview, see Pontius, 1993). Cellular factors Bo could also provide faster annealing. Annie mediated by accelerator Assuming that the increase in rings is affected by the degree of sequence complementarity, selectivity also increases. Will be added. This view suggests that antisense species αBA23 in the presence of nuclear extracts Consistent with increased selectivity (FIG. 7).   For technical reasons, selectivity of truncated derivatives of two asymmetric ribozymes It was difficult to evaluate. In experiments using the ribozyme αARz33 derived from αARz72, In addition, ribozyme-mediated cleavage of ab / 1b RNA was observed. This observation was made in solution Ability of αARz33 to form a 19 bp duplex with ab / 1b RNA and to cleave abl RNA May reflect this. Annealing of any of the target sequences of αARz33 Is not observed under the conditions used in the in vitro selection assay shown in FIG. won. After the assembly reaction, the semi-denaturing strip was preceded by electrophoresis, which could explain the lack of binding. The samples were incubated under different conditions (1% SDS, urea). This discovery was formed Because the duplex is not stable, the in vitro selection method can lead to complementary species shorter than about 20 nt. Means that it cannot be used. Conversely, chain lengths greater than 25 bp So, the results are reliable, and in the case of antisense species, for the 20-mer, for example It was measured by annealing the 20-mer derived from αARz72 with ab / 1b.   The selectivity of αBRz42 in cleavage experiments (Table 1) was seen in annealing experiments It was larger (Fig. 7). This observation reflects the half-life of the intact target RNA in cleavage experiments (Table 1). Is explained by the fact that it is a consequence of both efficient annealing and cleavage. Wear. Cleavage by αBRz42 can only occur with either bcr-abl or bcr sequences And cannot occur with an abl sequence. Therefore, cleavage of the abl target could not be detected and this Cleavage of the bcr target does not occur due to the fact that the RNA does not anneal (FIG. 7). Reduced accessibility of bcr-abl b3 / a2 fusion point sequences   The maximum association rate constant measured in this work (1-3 × 10^FourM^-1s^-1) Is usually 10^Five~Ten⁶M^-1 s^-1Rate constants of naturally occurring complementary RNAs in the range (Wagner & Simons, 1994) It was not as large. Artificial antisense RNA and HIV directed against HIV-1 sequences And the association rate constant measured for ribozymes are 10^Four~Ten^FiveM^-1s^-1To a value between (Homann et al., 1993b; Mark, summarized by Sczakiel) Printing). Kinetic approach of the bcr-abl b3 / a2 fusion sequence This observed decrease in gender is due to structural striations that can be caused by relatively stable local structures. The case suggests that there is a similar inaccessibility. A stable local RNA structure Levels can be negatively affected, i.e., the effectiveness of complementary RNA in living cells. Was. However, the reduced accessibility, as can be derived from the results of this work, Does not necessarily affect selectivity. For example, the three targets of the construct from αBRz57 The annealing pattern of the set with the chain (FIG. 5) shows that the accessibility (local structure) is bcr-ab The differences in the l vs. ab / 1b sequence (positions 53-63 in FIG. 5) Indicates a strong suggestion.   The extent of RNA folding, that is, the extent of intramolecular interactions, is determined by local folding Can be monitored by ability. The parameters calculated by this computer are , A given stretch of sequence is folded, complementary RNA and antisense in living cells May provide some information on the probability of an effective interaction between RNA efficacy and , The lowest free energy measure of a structure (Sczakiel et al., 1993). Therefore, the station Assuming local folding ability can monitor the accessibility of a given sequence stretch It seems reasonable to do so. bcr-abl sequence in general and fusion The folding ability near the point is low when compared to other sequences (Δ G_{mean (-300 ~ + 300)}= -7.6kcal / mol; ΔG_{mean (-120 ~ + 120)}= -8.8kcal / mol), relative Show extensive intramolecular interactions (FIG. 8): these results have been reported to date. Consistent with weak inhibition. The local minimum of the folding ability 9 nt downstream of the fusion point (ΔG = -16.8 kcal / mol, FIG. 8) shows that stable secondary structural elements can be formed in this region Indicates that In fact, the sequence between positions +11 and +58 downstream of the fusion point (FIG. 8) is predicted Low-energy (stable) stem-bulge-stem-loop element The element also has a secondary structure of bcr-abl with a total length of up to 600 nt. Individual structural elements as predicted for longer stretches of the sequence To be found. An antiserum that rapidly hybridizes to abl sections longer than 12 nt All of the strains (αBA72, αBA80, αARz72 and αBRz57) have one of the abl sequences (αBA62). Anneals about 2-3 times more slowly than species containing only 2 nt, Spanning (+11 to +58) complementary sequences may not support or even interfere with binding To indicate that   The folding capability of the bcr-abl array is above the fusion point in various window sizes. It shows higher values in flow. This is because the sequence of the upstream bcr is folded in the molecule. Does not appear to be broadly related to As shown by the redisy species αBA25 and αBA30 (FIG. 3, Table 2), It appears to be more available for initiating / extending duplex formation with a sense species. Implications for the design of complementary nucleic acids directed at bcr-abl   The pairing reaction between two complementary strands is at least two mismatches. It consists of indispensable steps. First, the alignment of both strands via Watson-Crick base pairing Column-specific recognition, followed by the onset and extension of double helix formation. In both processes, It can occur through the same base, which may be the case with short antisense sequences or In some cases, even longer antisense RNAs are likely to occur (Homann 1993b). However, this is not an absolute requirement and the naturally occurring complementary RN In the case of A, the first interaction is a reversible loop-loop interaction ('kissing' (ki ssing)), followed by the onset of duplex formation at another site, Often the free 3 'end of the antisense strand and the accessible complementary portion of the target strand are (See Wagner & Simons, 1994 for review). Ideally, Ribozymes and ribozymes are accessible sequences of the target strand with complementary sequences that are accessible. Deza to meet Should be imported.   However, in living cells, only double helix formation is effective; I don't think it's enough for destruction. In the case of antisense DNA (oligodeoxyribonucleotide), RNaseH is probably Related to target RNA degradation. In the case of antisense RNA, RNaseIII-like activity is 25-30 Recognizes perfectly formed double-stranded RNA beyond a certain minimum length in the range of base pairs (Nellen & Sczakiel, printing). For this reason, kinetic Short (<30 nt) antisense species identified by selection are deoxyribonucleotides. It must be synthesized as a peptide, but long-chain (> 30 nt) species are also synthesized and converted to RNA. Can be applied.   Limited kinetic and structural accessibility of sequences near the bcr-abl fusion point Weak or almost no antisense of bcr-abl gene expression observed in Compatible with drug-mediated inhibition. This is due to the more refined local structure of the fusion region sequence. Suggests a dense appearance. The local minimum at +9 is a clear point for antisense recognition. Disadvantageously, further downstream sequences are less suitable for selectivity. For this reason Allows for a selective and efficient antisense sequence, with the bcr portion near the fusion point and To the first 8 nucleotides of the abl sequence. Template construction for in vitro synthesis of target RNA, antisense RNA and ribozymes Construction   The cDNAs for the synthesis of the target RNAs bcr-abl, ab / 1b and bcr were converted to the CML cell line K562 (Loz zio & Lozzio, 1975). Described K562 cellular RNA (Chomczynski & Sacchi) 1987). Reverse transcription and PCR targets The quasi-method was applied. primers 93/25 and 93/21 for bcr-abl cDNA synthesis, Primers 93/21 and 93/22 for ab / 1b cDNA and primers for bcr cDNA Immers 93/25 and 93/26 were used. The sequence of the primer is: 93/21: 5'-AGGAGTGTT TCTCCAGACTG-3 ', 93/22: 5'-TGCTTCCTTTTGTTATGGAA-3', 93/25: 5'-ATGTCTCCCAGCA TGGCCTT-3 ', 93/26: 5'-TTACTTCGATCCCATTCATG-3'. The resulting PCR product Blues blunt-ended with mung bean nuclease and cleaved with SmaI Clone into Crypto M13 (Stratagene), plasmid pBSbcr / abl600, pBSab1 This resulted in 1b603 and pBSbcr600. bcr-abl sense RNA is generated by T7 RNA polymerase. Thus, ab / 1b and bcr sense RNAs can be transformed in vitro by T3 RNA polymerase. (FIG. 1A). Proceeding from pBSbcr / abl600, we have three bcr-abl Directed antisense The cDNA of the RNA species was constructed by PCR. Hybridizes 50 nt upstream of the fusion point, A unique bcr-directed primer (bcr50) containing a Ppul01 restriction site at the 5 'end Used for PCR amplification of cDNA. The primers directed to abl have a fusion point of 12 Hybridize to nucleotides downstream of (abl12), 22 (abl22) and 30 (abl30), respectively. And contained the sequence of the T7 promoter and an XbaI site. In addition, Rebosai Primer bcr50 and Primer rzabl containing the gene sequence and T7 promoter sequence Using 23 to design a cDNA for the hammerhead ribozyme by PCR did. This ribozyme binds preferentially via the bcr portion of the bcr-abl RNA, Cleavage within the part. Antisease cleaved within the bcr portion and directed to abl for binding The cDNA for the second ribozyme using the sense sequence was ligated to the primer abl50 (T5 sequence). And rzbcr7 (including the ribozyme sequence; FIGS. 1B and 1C). I built it. The sequence of the primer is:   The PCR product was cloned into pUC131 using XbaI and Ppu101 sites and Mids pBA62, pBA72, pBA80, pARz72 and pBRz57 were obtained. All plasmids are Experimentally controlled by sequence analysis, antisense RNA and Bozymes αBA62, αBA72, αBA80, αARz72 and αBRz57 are T7 RNA polymerases Transcribed in vitro.   αARz33 and αBRz42 and their corresponding in vitro inactive derivatives For in vitro transcription, T7 Promo The PCR product containing the primers was used. PCR fragment for αARz33 Primer bcr11 (5'-GCCAAGCTTGCAGAGTTCAAAAGCCCTTC-3 ') and pCRz72 And rzabl23_a(5'-GCCTCTAGATAATACGACTCACT-3 ') or rzabl23_i(Inactive in vitro Sex: amplified using 5'-GCCTCTAGATAATACGACTCACTATAGGGCTGCCTAATAAGGCCT-3 ') . The PCR fragment for αBRz42 was derived from plasmid pBRz57 and -Abl36 (5'-GCCTCTAGATAATACGACTCACTATAGGGCGCTCAAAGTCAGATGCTACT-3 ') and r zbcr7_a(5'-GCCAAGCTTAGTTTCGGCCTCGAGGCCTC-3 ') or rzbcr7_i(In vitro Activity; synthesized using 5′-GCCAAGCTTAGTTTCGGCCTCGAGGCCTTATTAGCAAA-3 ′). Both The sequence of the in vitro active ribozyme is: (i) αARz33: 5′-GGGCUGCCUGAUGAGGCCUC GAGGCCGAAACUGGCCGCUGAAGGGCUUUUGAACUCUGCAAGCU-3 ', (ii) αBRZ42: 5'-GGGCGCUC AAAGUCAGAUGCUACUGGCCGCUGAAGGGCUUUUGCUGAUGAGGCCUCGAGGCCGAAACUAAGCU-3 ' You. Helix 2 sequences are shown in bold. Underlined G residues are in vitro Is replaced by an A residue for an inactive ribozyme. In vitro transcription of RNA   Prior to in vitro transcription, the plasmid DNA is PBSbcr / abl600 by EcoRI, pBSbcr600 by BamHI And BamHI or Sstl to clear pBSabl603, followed by the 3 'overhang of the Sstl site. Filled with Nou enzyme. Plasmids pBA62, pBA72, pBA80, pARz72 and pBRz5 7 was linearized with HindIII. PCR products are ligated with HindIII prior to in vitro transcription. Cleaved. Inverted by PCR product and T3 RNA polymerase (Boehringer Mannheim) In vitro transformation of plasmid DNA except for pBSabl1b603 and pBSbcr600 For transcription, T7 RNA polymerase (Boehringer Mannheim) was used. Linearized 5 μg of the template DNA obtained was transformed in vitro as described (Rittner et al., 1993). I copied it. 200 μl 20 mM MgSO_FourAfter addition of the mixture, the mixture was washed with 20 U DNaseI (Boehringer Man transcripts are subjected to gel filtration (Sephadex G-50, Pharmacia; TE buffer) (10 mM Tris / HCl pH 8, 1 mM EDTA)). Of radiolabeled RNA For in vitro transcription, 0.5 μg of template DNA was used under the same conditions as above. Unmarked Nucleoside triphosphates ATP, CTP and GTP at a final concentration of 1.25 mM and unlabeled UTP at a final concentration of At 0.04 mM and 20 μCi of [α-³²P] UTP (3000 Ci / mmol, Amersham, Brown Schweig) was added to the 20 μl reaction. RNA was purified by gel filtration. RNA³²P-terminal label   The 5 'end of the in vitro transcribed RNA (10 pmol) was ligated with calf intestinal phosphatase. Dephosphorylation followed by 50 μCi of [γ-as described (Sambrook et al., 1989).³² By [P] ATP (3000 Ci / mmol) and polynucleotide kinase (Boehringer Mannheim) By rephosphorylation³²P-labeled.   3 ′ labeling of the RNA was performed as described in Barrio et al. (1978). Briefly state 5 pmol of RNA in 330 μM ATP, 50 mM Hepes buffer pH 8.3 in a final volume of 20 μl, 20mM MgCl_Two, 10 units T4 RNA ligase (Boehringer Mannheim) and 50 μCi [³²P] Using pCp (3000 Ci / mmol, Amersham, Braunschweig) for 14 hours at 15 ° C Cubbed. RNA was purified by gel filtration. Alkaline hydrolysis of antisense RNA and ribozymes   Create random mixture of antisense RNA and ribozyme directed to bcr-abl To make³²P-terminally labeled parent RNA and ribozymes are described (Rittner (1993), and continuously shortened by alkaline hydrolysis. Briefly stated In brief, 2.5 pmol of end-labeled RNA in TE buffer (10 mM Tris / HCl pH 8.0, 1 mM EDTA) , 1.5 volumes of 0. 5M NaHCO_ThreeAnd heated to 96 ° C for 12-14 minutes, then cooled on ice and The solution was desalted by filtration. After ethanol precipitation, the RNA was dissolved in TE buffer. Continued And heat the mixture of RNA species at 75 ° C for 10 minutes to allow hybridization assays. Cool slowly to 37 ° C before use in b. In vitro selection method for identification of rapidly hybridizing antisense RNA species   The experimental procedure was recently described (Rittner et al., 1993) and is shown schematically in FIG. . Briefly, 5 'or 3' labeled hydrolyzed RNA was converted to 100 mM NaCl, 20 mM M Tris / HCl pH 7.4 and 10 mM MgCl_TwoIn a final volume of 20 μl of solution containing 1.6, 3.2 or 6.4 pmol of bcr-abl, ab / 1b or bcr target RNA, respectively At 37 ° C. At different times during the incubation, pre- 30 μl of stop buffer (50 mM Tris / HCl pH8; 15 mM EDTA, 0.2% SDS , 8M urea, 0.04% bromophenol blue, 0.04% xylene cyanol) One aliquot was transferred. Single-stranded antisense RNA and target RNA / antisense The RNA double helix was subjected to native agarose gel electrophoresis (1.2%, 89 mM Tris / HCl pH 8.3). , 89 mM boric acid, 2 mM EDTA). Cut single- and double-stranded RNA from the gel Centrifugation of the excised gel slice frozen in liquid nitrogen. Therefore, it was recovered. After ethanol precipitation, the RNA was redissolved in stop buffer and denatured (12% polyacrylamide gel containing 7M urea in 89mM Tris-borate buffer pH 8.3) Was analyzed by polyacrylamide gel electrophoresis. The gel is dried and Exposure to Lum. Measuring the hybridization rate for individual antisense RNA species   Dry polyacrylamide or agaro for quantitative analysis of band intensity Gel was scanned by a phosphor imager (Molecular Dynamics) . Measure band intensity using 'IMAGE QUANT' software (Molecular Dynamics). Specified. The data was transferred to the program 'EXCEL' (Microsoft). Hybridization Band intensity of individual antisense RNA or ribozyme species The zym cleavage reaction was plotted against the time axis. Exponential decay curve Non-linear regression using ram 'GRAFIT' (Erithacus Software, London, UK) Adjusted by RNaseH cleavage reaction   Three³²The p-labeled substrate RNA species bcr-abl, ab / 1b and bcr (100 pM) were 0 mM NaCl, 20 mM Tris / HCl pH 7.4 and 10 mM MgCl_TwoContaining a final volume of 20 μl In solution, different phosphorothioate antisense oligonucleotides αBA23 (5'-GCTGAAGGGCTTTTGAACTCT-3 '), αBA25 (5'-GGGCTGAAGGGCTTTTGAACTCTGC-3'), αBA28 (5′-GCTGAAGGGCTTTTGAACTCTGCTTAAA-3 ′), or αBA30 (5′-GGGCTGAAGGGC TTTTGAACTCTGCTTAAA-3 ′) (1 μM final volume) and 1 U of E. coli RNaseH (B oehringer Mannheim) at 37 ° C. Incubation At different time points, a 3 μl aliquot was added to a 30 μl stop, pre-chilled on ice. Buffer (50 mM Tris / HCl pH8; 15 mM EDTA, 0.2% SDS, 8 M urea, 0.04% bromphe Nord Blue, 0.04% xylene cyanol). After heating at 95 ° C for 5 minutes The reaction products were subjected to polyacrylamide gel electrophoresis under denaturing conditions (4%), followed by The dried gel was analyzed by autoradiography.   In experiments using nuclear extracts, the reaction mixture was analyzed using human SW480 cells (3.5 mg / ml protein). ) Were carried out to contain different amounts (3%, 10% or 30%) of the nuclear extract from). RNaseH anti Different 30 μl stop buffer to remove protein from time-removed samples Phenol / chloroform / isoamyl alcohol (25: 24: 1 ). Nuclear extracts were prepared as described (Schreiber et al., 1989). Was. Ribozyme activity in vitro   Ribozyme activity was measured under single turnover conditions. Preparation of RNA , Cleavage reaction, and product separation by polyacrylamide gel electrophoresis. Performed as described recently (Homann et al., 1993a). Briefly, 30 fmol (1.5 n M) radiolabeled target RNA and at least a 10-fold excess of unlabeled ribozyme RNA (> 300 fmol;> 15 nM) in 100 mM NaCl, 10 mM MgCl_TwoAnd 20 mM Tris / HCl pH 7.4 Incubate at 37 ° C. or 50 ° C. in a final volume of 20 μl. Reaction mixing Aliquots of the product were removed at different time points, 50 mM Tris / HCl pH8; 15 mM EDTA, 0. 2% SDS, 8M urea, 0.04% bromophenol blue and 0.04% xylene cyanol The reaction was stopped by adding 30 μl of a solution containing Sample at 0 ° C Store and 5% polyacrylamide gel (0.125% bisacrylic acid) under denaturing conditions (8M urea) Amide) and analyzed by electrophoresis. Was. The gel was dried and scanned on a phosphor imager. Determination of association rate constant of antisense oligodeoxyribonucleotide   Radiolabelled phosphorothioate antisense oligodeoxynucleotide Pide (1 nM final concentration) was added to a total volume of 20 μl of hybridization buffer (see above). ) In three target RNAs bcr-abl, ab / 1b or bcr (300 nM or 450 nM final concentration) Incubated with either. After different incubation times, 3μ Remove 1 aliquot and 25 μl of pre-cooled stop buffer (see above) And analyzed by non-denaturing agarose gel electrophoresis. Dry gel and fill with X-ray And scanned with a phosphor imager. Ex vivo test using human cellsPatients and cells   Transforms human peripheral blood mononuclear cells (MNCs) into chronic, advanced or blast crisis chronic myeloid Obtained from a leukemia patient. Erythrocytes and cell debris are transferred to a lymphocyte separation medium Lymphoprep (N ycomed Pharma, Oslo, Norway) for density centrifugation. Therefore, it was removed. Separation of CD34 + cells from the MNC fraction was performed according to the manufacturer's MACS immunomagnetic separation system (Miltenyi Biotec, Bergisch Gladbach, (Germany). For transfection, add 10% experimental cells. Heat-inactivated calf serum, 100 IU / ml penicillin, 100 μg / ml streptomycin, 2 m The cells were cultured in RPMI-1640 medium supplemented with mol / L L-glutamine.Oligodeoxyribonucleotide (ODN)   The ODN used for transfection studies had the following sequence:   The two internucleotide linkages at the 3 'and 5' ends of the ODN are phosphorothioe Internal deoxyribonucleotides are linked by phosphodiesters Was done. ODN is purified by reversed-phase high-performance liquid chromatography and Lyophilized.ODN Treatment of CML cells   Prior to transfection, 2.5 μl ODN (200 μM, 1 μM cell suspension 500 μl to the final concentration of ODN in 1 l of 15 μl DOTAP (N- [1- (2,3-dioleoyl Xy) propyl] -N, N, N-trimethylammonium methyl sulfate, Boehringe r Mannheim, Mannheim, Germany) and Hepes buffer (20 mM, pH 7.4) To a final volume of 75 μl. Mix the mixture for the formation of the ODN / cationic lipid complex. Incubated for 15 minutes at room temperature and added dropwise to the cell suspension. MNC and CD34 + fine The final volume of the vesicle is 1 × 10⁶500 μl at a final density of cells / ml. ODN For 6 hours at 37 ° C. Cells are pelleted by centrifugation. And resuspended in fresh medium. 18 hours later, using half of the ODN / DOTAP complex A second transfection was performed. Subsequently, the cells were transferred to MethoCult H4433 ”Com plete ”methylcellulose medium (StemCell Technologies Inc., Vancouver, Canada) Nada) and double plated. Cell density in methylcellulose medium: MNC (1 × 10^Five/ ml), CD34 + (1 × 10^Three/ ml). Colonies were counted after 14 days.Reverse transcription and polymerase chain reaction   1x10 for bcr-abl fusion point analysis⁷RNA from cells Extracted. The fusion point was reverse transcribed, followed by polymerase chain reaction and agarose. Determined by analysis by gel electrophoresis. Table 3: Antisense oligodeoxyribonucleotides directed to bcr-abl Inhibition of Clonogenic Growth of Primary CML Cells by Treatment with ATPAbbreviation: CP: chronic phase             AP: advanced stage             BC: blast crisis             MNC: mononuclear cell (peripheral blood)             CD34 +: CD34-rich hematopoietic cells from peripheral blood

[Procedure of Amendment] Article 184-8, Paragraph 1 of the Patent Act [Date of Submission] September 21, 1998 (September 21, 1998) [Details of Amendment] Claims 1. The nucleotide sequence comprises: (a) a portion complementary to the first chromosomal DNA sequence; and (b) a portion complementary to the second chromosomal DNA sequence, wherein the first and second chromosomal DNAs are The sequence forms at least a portion of a chromosomal translocation resulting in a fusion gene, wherein the portion includes a translocation point, wherein the nucleotide sequence of the nucleic acid consists essentially of ribonucleotides, wherein the nucleotide sequence is: A nucleic acid comprising at least one of the following. 2. A DNA sequence corresponding to the nucleic acid of claim 1 when transcribed. 3. A vector comprising the nucleic acid according to claim 1 or the DNA sequence according to claim 2. 4. A host organism comprising a nucleic acid according to claim 1, a DNA sequence according to claim 2, or a vector according to claim 3. 5. A method for producing the nucleic acid according to claim 1, the DNA sequence according to claim 2, or the vector according to claim 3, wherein the host organism according to claim 4 is cultured under suitable conditions. A method comprising isolating the desired product from the product. 6. A pharmaceutical composition comprising a nucleic acid according to claim 1, a DNA sequence according to claim 2 or a vector according to claim 3, optionally together with a pharmaceutically acceptable carrier and / or diluent. 7. The pharmaceutical composition according to claim 6, for the treatment of a disease based on chromosomal translocation. 8. 8. The pharmaceutical composition according to claim 7, wherein the disease is chronic myeloid leukemia.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 48/00 A61K 48/00 C12N 5/10 C12N 9/00 9/00 C12Q 1/68 A C12Q 1 / 68 C12N 5/00 B (72) Inventor Cronenwett Ralph Germany Day-69120 Heidelberg Schledelstraße 103

Claims (1)

[Claims] 1. The nucleotide sequence comprises: (a) a portion complementary to the first chromosomal DNA sequence; and (b) a portion complementary to the second chromosomal DNA sequence, wherein the first and second chromosomal DNAs are A nucleic acid wherein the sequence forms at least a portion of a chromosomal translocation resulting in a fusion gene, wherein the portion comprises a translocation point. 2. 2. The nucleic acid of claim 1, wherein the first and second chromosomal DNA sequences are from the same or different chromosomes. 3. The nucleic acid according to claim 1 or 2, wherein the chromosomal translocation is t (9; 22). 4. The nucleic acid according to any one of claims 1 to 3, wherein the fusion gene is a bcr-abl fusion gene. 5. The nucleic acid according to any one of claims 1 to 4, wherein the nucleotide sequence consists essentially of ribonucleotides. 6. The nucleotide sequence has at least one of the following sequences: The nucleic acid according to claim 5, comprising: 7. The nucleic acid according to claim 5, wherein part (a) and / or part (b) comprises the catalytic domain of a hammerhead ribozyme. 8. The nucleic acid according to claim 7, wherein part (a) forms at least a part of the helix I- and / or helix III-forming region of the hammerhead ribozyme. 9. 9. The nucleic acid according to claim 7, wherein part (b) forms at least a part of the helix I- and / or helix III-forming region of the hammerhead ribozyme. 10. The nucleotide sequence has at least one of the following sequences: The nucleic acid according to any one of claims 7 to 9, comprising: 11. A DNA sequence corresponding to the nucleic acid according to any one of claims 5 to 10 when transcribed. 12. A vector comprising the nucleic acid according to any one of claims 1 to 10 or the DNA sequence according to claim 11. 13. A host organism comprising a nucleic acid according to any one of claims 1 to 10, a DNA sequence according to claim 11, or a vector according to claim 12. 14． A method for producing the nucleic acid according to any one of claims 1 to 10, the DNA sequence according to claim 11, or the vector according to claim 12, wherein the host organism according to claim 13 is subjected to suitable conditions. A method comprising culturing underneath and isolating the desired product from the culture. 15. A nucleic acid according to any one of claims 1 to 10, a DNA sequence according to claim 11 or a vector according to claim 12, optionally together with a pharmaceutically acceptable carrier and / or diluent. A pharmaceutical composition comprising: 16. 16. The pharmaceutical composition according to claim 15, for the treatment of a disease based on chromosomal translocation. 17． 17. The pharmaceutical composition according to claim 16, wherein the disease is chronic myeloid leukemia.