JP2000503532A - Gene delivery vehicle targeting ligand - Google Patents

Abstract

  (57) [Summary] Disclosed are fusion proteins consisting of an MHC class I molecule, an MHC class II fraction, or β2 microglobulin, and a targeting ligand. Also disclosed are nucleic acid molecules encoding such fusion proteins and suitable expression cassettes and host cells. Also provided are methods for targeting a gene delivery vehicle to a selected cell type utilizing a gene delivery vehicle comprising one of the above fusion proteins on its surface.

Description

DETAILED DESCRIPTION OF THE INVENTION                     Gene delivery vehicle targeting ligandTechnical field   The present invention relates generally to gene delivery vehicles, and more particularly, to genetic delivery vehicles. Methods for targeting the offspring delivery vehicle.Background of the Invention   Since the discovery of DNA in the 1940s and through the latest era of recombinant DNA technology Subsequently, it is possible that the course of the disease can be influenced through its interaction with biological nucleic acids. Substantial research is underway to understand its potential. Most recently, genes have been modified. A wide variety of methods to alter or affect (eg, retro Ills, adenovirus, vaccinia virus, herpes virus, and Ade Includes viral vectors derived from the associated virus (Jolly, Cancer Gene Therap y1 (l): 51-64, 1994)).   To target viral vectors such as retroviral vectors, many Methods have been attempted. For example, Neda et al. (J. Bjo 1. Chem. 266 (22): 14143-1414). 6, 1991) is a viable virus particle capable of targeting human hepatocytes in vitro. Lactose was chemically coupled to the virus particles to produce offspring. But, Such methods have limited applicability and target hepatocytes in tissue culture. It is only shown that this can be done.   Others have developed antibodies (Goud et al.) To target virions to specific cell types. , Vjr. 163: 251-254, 1988) or antibody fragments (Roux et al., PNAS 86: 9070-908). 3, 1989; Etienne-Julan et al. of Gen. Vir. 73: 3251-3255, 1992) Attempted to link to the particles. However, such a method is not suitable for specific cell types. Did not cause the establishment of a proviral state, although it caused binding of the torovirus (In Goud et al.) Or resulted in only low levels of transduction (Roux et al. And Eti enne et al.). In addition, any of these references target cells in vivo No use of such a composition was described.   By selecting a vehicle that normally infects a cell type, the cell type is characterized. Other attempts to target differently have also been made. For example, Shimada et al. (J. Clin. I. nvest. 88: 1043-1047, 1991) describes an HIV fragment for specifically targeting CD4 + T cells. A gene transfer system was developed. However, one problem with such a system is that Producing a helper virus (HIV in the case above), which Is unsuitable for human treatment.   Other scientists have probably attempted to target HIV-infected T cells (Young et al., Science 2 50: 1421, 1990), the CD4 protein was isolated from chicken leukemia virus Simultaneous in-frame with protein or mouse leukemia virus transmembrane proteins Was expressed. Although the CD4 protein was expressed by the virus, No evidence was provided that the particles could transduce T target cells.   Recombinant gene delivery vehicles such as retroviruses (particularly delivered in vivo In order to more specifically target a specific cell surface component, Recombinant gene delivery vehicles capable of targeting offspring or cells bearing receptors I will provide a. The present invention provides these as well as other related advantages.Summary of the Invention   Briefly, the present invention provides a gene delivery vehicle for selected cells or tissues. Provided are compositions and methods for targeting. In one aspect of the invention, MHC class I molecule, MHC class II molecule, or β2 microglobulin, and target A fusion protein comprising a ligating ligand is provided. In certain embodiments, the target Ligating ligands can be antibody variable regions, hormones such as melanocyte stimulating hormone, or Or erythropoietin.   In another aspect of the invention, an MHC class I molecule, an MHC class II molecule, or β2 Fusion protein comprising microglobulin and one member of a high affinity binding pair Quality is provided. In one embodiment, one member of the high affinity binding pair is , Avidin.   The present invention also provides a nucleic acid molecule encoding a protein as described above (eg, DNA. RNA, or some combination of the two), indicating the expression of such a nucleic acid molecule. Expression cassettes and host cells containing these expression cassettes are provided. You.   In another aspect, a gene having one of the above fusion proteins on its surface A delivery vehicle is provided. A typical gene delivery vehicle is a recombinant retrovirus. Including Rus and Alphavirus. In a related aspect, a heterogeneous Replication-defective retroviral vector particles containing proteins containing MHC class II molecules A child is provided.   In other aspects, the gag / pol expression cassette, the env expression cassette, and the fusions described above. Containing an expression cassette that directs the expression of a sequence encoding one of the A caging cell line is provided. Such packaging cell lines and recombination A vector producing cell line comprising a retroviral vector is also provided.   In another aspect of the present invention, a gene delivery vehicle for a selected cell type in a warm-blooded animal. A gene delivery vehicle for warm blooded animals as described above. A method is provided that includes the step of administering one. In related aspects, such The method comprises the steps of (a) administering a gene delivery vehicle as described above to a warm-blooded animal. And (b) providing the targeting element bound to the second member of the high affinity binding pair to a warm-blooded animal. Wherein the bound targeting element is selected from the warm-blooded animal. Is capable of binding specifically to the selected cell type, and the second member is specific for the first member. Gene delivery vehicles can be targeted to selected cell types General steps of the steps performed.   In one embodiment, the high affinity binding pair is biotin / avidin, cystati / Papain, val-phosphonate / carboxy-peptider ZeA, and selected from the group consisting of 4CABP / RuBisCo. In another embodiment , The targeting element can be an antibody variable region or an immune accessory lecule). In another embodiment, the gene delivery vehicle is retrograde. Ils vector particles, or liposomes or polycation condensed It can be a nucleic acid.   In a further embodiment of the invention, the gene delivery vehicle comprises a heterologous sequence (e.g., For example, cytotoxic proteins (eg, ricin, abrin, diphtheria toxin, La toxin, gelonin, pokeweed, antiviral proteins, Ritin, Shigella toxin, and Pseudomonas exotoxin A), antisense Or ribozyme sequences, or immune adjuvant molecules (eg, IL-2, IL-12, IL-15 , Γ-interferon, ICAM-I, ICAM-2, β-microglobin, LFA3, and HLA class I molecules and genes encoding HLA class II molecules). Other fruit In embodiments, the heterologous sequence has little or no cytotoxicity. Gene products that activate non-toxic compounds into toxic products (eg, HSVTK or VZVTK) Code. In yet other embodiments, the heterologous sequence is Factor VIII, ADA, HPR With replacement genes encoding proteins such as T, CFTCR, and LDL receptors possible. In yet another alternative embodiment, the heterologous sequence is HBV, HCV, HPV, EV An immunogenic portion of a virus selected from the group consisting of BV, FeLV, FIV, and HIV. Can code.   These and other aspects of the invention refer to the following detailed description and the accompanying drawings. It will be clear. In addition, certain procedures or compositions (eg, plasmids, etc.) Are described below in more detail, and thus each Are incorporated by reference in their entirety, as if individually indicated.BRIEF DESCRIPTION OF THE FIGURES   FIG. 1 is a schematic diagram of pSC6.   FIG. 2 is a schematic diagram of pSC6 / HLA-A2.   FIG. 3 provides a representative sequence of the HLA-2 template.   FIG. 4 provides a representative sequence of the gp350 / 220 peptide.   FIG. 5 is a schematic diagram of pCRII / 350-A2.   FIG. 6 shows a schematic of the positions of the PCR primers selected for amplification of the antibody variable region. FIG.   FIG. 7 is a schematic diagram of pSC6 / HLA-DRα.   FIG. 8 provides a representative sequence of the HLA DR template.   FIG. 9 provides a schematic of pSC6 / EPO-β2M.Detailed description of the invention   Before describing the present invention, definitions of certain terms used hereinafter are set forth. Doing so can help with that understanding.     "Gene delivery vehicle"Is one or more genes or sequences of interest A construct that can be delivered into and, in a preferred embodiment, express it. U. Representative examples of such vehicles include viral vectors, nucleic acid expression vectors Contains naked DNA, and certain eukaryotic cells (eg, producer cells) . Preferably, the gene delivery vehicle of the present invention is greater than about X kilodaltons X, where X is 50, 100, 150, 200, 250, 300, 400, 500, 600, 70 0, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 4,000, and 5,000. Group. In various aspects of the invention, the genetic pre-delivery vehicle comprises Whether expressed or included as an integral part of the gene delivery vehicle It has some fusion proteins (discussed below) on its surface.     "Vector constructs, "Retro virus vector, "Recombinant vector" and"Recombinant retrovirus vector"Has a nucleic acid molecule of interest and In certain embodiments, it refers to a nucleic acid construct capable of directing its expression. Retro ui Lus vectors contain at least one transcription promoter / enhancer or promoter. Locus determining element, or other means (eg, alternative splicein) RNA, nuclear RNA transport, post-translational modification of messengers, or post-translational repair of proteins Decoration) must contain other elements that control gene expression. this Such vector constructs also include a packaging signal, a long terminal repeat (LTR). ) Or a part thereof, and the positive and Negative strand primer binding sites (these are already in the retroviral vector If not present). Recombination if necessary Retroviral vectors also contain polyadenylation, selectable markers (eg, Ne o, TK, hygromycin, phleomycin, histidinol, or DHFR), And one or more restriction sites and signals directed to the translation termination sequence. . By way of example, such vectors typically include a 5 'LTR, a tRNA binding site, Pack Caging signal, origin of second strand DNA synthesis, and 3 'LTR, or one of these Including parts.     "Recombinant retrovirus"Retroviral gene delivery vehicle",and "Retrovirus vector particles", As used in the present invention, Both are retroviruses having one gene of interest. Retrovirus It may include a selectable marker. Recombinant retrovirus reverse transcribes its genetic material into DNA This genetic material can be integrated into the DNA of the host cell upon infection.     "Nucleic acid expression vector"Or"Expression cassetteIs the sequence or gene of interest Refers to an assembly that can direct the expression of The nucleic acid expression vector, when transcribed, A promoter operably linked to the sequence or gene of interest; It must contain an adenylation sequence. In certain embodiments of the present invention, the book The nucleic acid expression vectors described herein can be included in a plasmid construct. In addition to the components of the nucleic acid expression vector, the plasmid construct also provides a bacterial origin of replication, One or more selectable markers, a sig where the plasmid construct is present as single stranded DNA Null) (eg, the M13 replication origin), multiple cloning sites, and (Eg, the SV40 or adenovirus origin of replication).     "Packaging cellsIndicates that the recombinant retroviral vector is defective A cell that contains the necessary elements for the production of an infectious recombinant retrovirus . Typically, such packaging cells contain gag, pol, and env proteins. It contains one or more expression cassettes capable of expressing the protein encoding the protein.     "Producer cells"Or"Vector-producing cells"Recombined Retrowi A cell containing all the elements necessary for the production of a lus vector particle.     "High affinity binding pairIs 10^-yK less than M_DGood pair that can be combined with Where y is selected from the group consisting of 8, 9, 10, 11, 12, 13, 14, and 15. You. Where A and B are members of a high affinity binding pair. (In addition, two molecules As the affinity of_DShould be understood by those skilled in the art that is there). The affinity constant can be determined by, for example, Scatchard analysis (Scatchard, Ann. NY Acad. Sc. i. 51: 660-672, 1949). Can be determined. Representative examples of suitable affinity binding pairs include biotin / avidin, cis Statin / papain, phosphonate / carboxypeptidase A, and 4CABP / R Including uBisCo.     "Targeting element"" Refers to a molecule capable of specifically binding a selected cell type . As utilized in the context of the present invention, the targeting element comprises a bound target If the biological effects of the activation element can be seen in the cell type, or > 10-fold during binding of the bound targeting element to non-target cells When there is a significant difference, and preferably a difference of 25, 50 or 100 times, It is believed that the selected cell types bind specifically. Generally, targeting elements Is 10 for the selected cell type^-FiveLess than M, preferably 10^-6Less than M, more preferably 10^-7M not Full, and most preferably 10^-8Less than M (Scatchard analysis (Scatchard, Ann. N.Y.A. cad.Sci. 51: 660-672, see 1949))_DJoin Preferably. In addition, the targeting element can be used to determine the affinity constant of a high affinity binding pair. Binds to selected cell types with at least 1 log (ie, 10-fold) less affinity Is generally preferred. (In other words, K_DThe value is at least 1 log 10 times larger). Suitable targeting elements are preferably non-immunogenic, It is not degraded by proteolysis and is not removed by the immune system. Especially preferred New targeting element, which is bound to a member of a high affinity binding pair Has a half-life (in the absence of clearing agent) of between 10 minutes and 1 week in animals Should have. Representative examples of suitable targeting elements are described in more detail below. be written.     "Fining agent"Binds to and / or binds to the circulating bound targeting element. Refers to a molecule that can be crosslinked. Preferably, the clarifying agent is non-immunogenic and bound Specific to the targeting element and sufficient to avoid rapid renal clearance Big. In addition, the fining agent is preferably not degraded by proteolysis, And is not removed by the immune system. Particularly preferred fining for use in the present invention The agent binds to the bound targeting element at a site other than the affinity binding member. And most preferably blocks binding of the targeting element to its target. Including those that bind in a checkable fashion. In the context of the present invention, multiple cuts (c le aving) agents can be utilized, for example, Marshall et al., Brit. J. Cancer 69: 502-507,199 Including those described by No. 4.   As described above, the present invention provides a gene delivery vehicle for a selected cell type in a warm-blooded animal. Provided are compositions and methods for targeting Such compositions and methods Is, for example, an MHC class I or class II molecule, or β2 microglobulin, Fusion proteins comprising targeting ligands or members of high affinity binding pairs Quality is allocated to the surface of the gene delivery vehicle during its construction. Follow. Thus, such gene delivery vehicles can be used for specific or selected cells. Targeting the gene delivery vehicle to the cell type (This is present as a fusion protein on the surface of the gene delivery vehicle) May be utilized in the methods described herein. Appropriate Representative examples of various fusion proteins and gene delivery vehicles and their preparation The methods of preparation and administration are described in more detail below:                         A.Construction of fusion proteins. 1. Surface fatigue molecule-MHC class I molecule, MHC class II molecule, and β2-microglobulin In   A wide variety of cell membrane molecules not encoded by the virus are described herein. For the construction of fusion proteins. In this regard, MHC class I molecules , MHC class II molecules, and β2 microglobulin are provided as examples. Nevertheless, it should be understood that the invention is not so limited. Details In particular, it utilizes a wide variety of other virion surface molecules that are not encoded by the virus. Can be This includes, for example, transferrin receptor, CD43, CD44, CD63, CD 7l, adhesion molecules (eg, CD3, CD4, CD11a, CD12, CD13, CD14, CD15, CD16, CD17 , CD18, LF1 (CD11a / CD18), CD25, CD54, CD55 (DAF), CD59 (MIRL)), or non-human Animal equivalents (applies to all markers).   Briefly, the major histocompatibility complex (MHC) is produced by various cell types. Region of highly polymorphic genes expressed on the surface of This complex The proteins that are loaded are called MHC molecules or MHC antigens, and these It is a major determinant of hemi-rejection. There are two main types of MHC gene products: MHC class I and class II molecules, both types of molecules bind to membranes and Present the peptide antigen on the cell surface.   Class I molecules comprise two separate polypeptide chains; about 44 kD in humans, and In mice, a 47 kD MHC-encoding heavy chain (α-chain) and a 12 kD non-MHC-encoding β-chain. Heavy Most of the chain extends out of the cell, with a short hydrophobic transmembrane segment and about 30 amino acids With a cytosolic carboxy terminal tail. β chain is non-covalently linked to the extracellular portion of the heavy chain. Interact and do not bind directly to the cell surface. Class I molecules are Can be separated into four separate regions: the peptide binding region (α-1 and α-2 Ig-like region; transmembrane region and cytoplasmic region. Different MHC class I molecules The crystal structure analysis of α-helix shows that α-1 and α-2 domains interact Forming an eight-chain β-pleated sheet platform that supports two parallel chains It was shown. The two α-helices have a bottom formed by a β-sheet. Form the left side. The cleft can bind to a 10-20 amino acid peptide and Foreign peptides are sites for binding MHC class I for presentation to T cells Presumed.   A comparison of numerous mouse and human Class I molecules shows that almost all polymorphic residues are peptidic. Found in the alpha helix or beta sheet of the The side chains are oriented so as to face into the groove and thus for binding to the peptide sequence Indicated that it is available. The Ig-like (α-3) region of class I molecules is a peptide The bond region is linked to the transmembrane region. This area covers all tested Class I It is highly conserved among molecules and shares homology with Ig constant domains. The beta chain of a class I molecule is identical in all human class I molecules. Class 1 The -β chain is also known as β2-microglobulin and associates with the α-3 region. Similarly, it contains a disulfide-linked loop homologous to the Ig constant domain (Guessow et al., J. Mol. Immunol. 139: 3132, 1987) (Robinson et al., Immunogenetjcs 20: 655, 1984).   MHC class II molecules comprise two chains, called the α-chain (32-34 kD) and the β-chain (29-32 kD). It is composed of polypeptide chains. Both class II chains are polymorphic. Class II minutes Although the three-dimensional structure of the offspring has not yet been elucidated, primary sequence analysis Reveals structural similarities between offspring and class II molecules. Humans have DR, DQ, and And three class II genetic loci encoding DP and DP molecules. Individual class II genes Was previously isolated and inserted into expression constructs by various investigators. This These are described, for example, in Nishimura et al. Immun. 145: 353-360, 1990, DQw6A; Klohe DRα: DR1β1, DRα: DR4β1, DRα: DR5 according to J. Immunol. 141: 2158-2164, 1988. β1, DRα: DR5βIII (Drw52), DRα: DR7β1, DRα: DR4 / 7βIV (Drw53), DQ7α: DQ w2β, DQ7α: DQw3β, and “Pw4α: DPw4β; and Wilkinson et al., J. Exp. . 167: 1442-1458, 1988, DR2βa (from DR2Dw2), and DR2βb (from DR2Dw2). )including. 2. High affinity binding pair   As mentioned above, in one aspect, the fusion proteins of the invention have high affinity binding. It may include one member of the union. Briefly, a wide variety of high affinity binding pairs Can be used. This is, for example, 10^-14Cystatin / papain with M affinity (Bjork and Ylinenjarvi, Biochemistry 29: 1770-1776, 1990); 10^-14M affinity Val-phosphonate / carboxypeptidase A (Kaplan and Bartlett) Biochemistry 30: 8165-8170, 1991); 10^-134CABP-RuBisCo with M affinity Schloss, J .; Biol. Che., 263: 4145-4150, 1988); and 10^-11Has M affinity Tobacco horn worm (hornwor) diuretic hormone / tobacco horn worm diuretic hormone Receptor (Reagan et al., Arch. Insect Biochem. Physio 1.23: 135-145, 1993). including.   A wide variety of other high affinity binding pairs are also available, e.g., By preparing and selecting the body and selecting antibodies with high affinity Such antibodies can be further developed by screening for Generally, U.S. Pat.Nos. RE 32,011, 4,902,614, 4,543,439, and 4 , 411,993; Monoclona1 Antjbodjes, Hybridjdomas: A New Djmensj. on in Biologica1 Analyses, Plenum Press, Kennett, McKearn, and Bechtol (Eds.), 1980, and Antibodjes: A Laboratory Manual, Harlow and Lane ( Ed.), Cold Spring Harbor Laboratory Press, 1988). is there Alternatively, the antibody or antibody fragment can also be produced and (William D. Huse et al., "Immunoglobulin Reper in Lambda Phage." Making a large combinatorial library of trees ", Scjence 246: 1275-1281, 1989 1 See February; L. Sastry et al., "Es for the Production of Monoclonal Catalytic Antibodies. Cloning of the immunological repertoire in cherichj acoli: heavy chain variable region features Construction of a Differential cDNA Library ", Proc. Natl. Acad. Sci. USA86: 5728-5732, 19 See also August 1989; Michelle Alting-Mees et al. Current Library: A Rapid Alternative to Hybridomas ", Strategjes in Molecula r Bjo1ogy 3: 1-9, also see January 1990; these references can be found in Stratac Describes a commercial system available from yte, La Jolla, California, wherein the system is recombinant Technology to produce antibodies). The advantage of using a high affinity binding pair is that Ability to add any cocktail of targeting ligands from one producer cell Generation of powerful targetable vectors. 3. Targeting ligand   In the context of the present invention, the gene delivery vehicle is specifically directed to the selected cell type A wide variety of targeting elements can be utilized to accomplish this. Generally, the target The activating element is a protein or peptide, but other nonproteinaceous molecules Can also function as targeting elements. For example, in one embodiment of the present invention, In addition, antibodies (including, for example, antibody variable regions) may target selected cell types. (Generally Wilchek and Bayer, Ana 1. Bioche. m 171: 1-32, 1988). A typical example targets anti-CD34 antigen on stem cells Anti-CD34 antibodies (eg, 12.8 (Andrews et al., Blood 67: 842) 1986) and Mylo (Civin et al., J. Immunol. 133: 157, 1984; also referred to as HPCA-2). And commercially available from Becton DiCkinson), useful for targeting CD4 + T cells. Anti-CD4 antibodies, anti-CD8 antibodies to target CD8 + cells, ovarian cells and HER2 / neu monoclonal antibody 4D5 for targeting breast cells (Sarup et al., Growth  Regu 1.1: 72-82, 1991), c-erbB-2 monoclonal for targeting breast cells Antibody GFD-OA-p185-1 (Alper et al., Cell Growth Djffer. 1: 591-9, 1990), colon cells And TAG72 monoclonal Abs for targeting breast cells: CC49 and B72.3 (Ki ng et al. Bjochem. 281: 317-23, 1992), and for targeting colorectal cancer cells Carcinoembryonic antigen monoclonal antibody ZCEO25 (Nap et al., Canc. Res. 52: 2329-39, 1992). )including.   Other suitable targeting elements include hormones and hormone receptors. Typical examples are follicle-stimulating hormone and luteal form on ovarian and testis cells Adult hormone, melanocyte stimulating hormone and epidermal growth factor for epidermal cells, And human growth hormone for most bone and skeletal muscle cells.   In other embodiments, the immune accessory molecules are specific receptors on various cells Can be used to target Examples are macrophages and natural killers -Interferon targeted to cells, interleukin for T lymphocytes, And erythropoietin and CSF for bone marrow cells.   In yet another embodiment, the peptide, such as substance P, has Neuromedins (Conlon, J. Neuroc) hem. 51: 988, 1988) was used to target uterine cells for contractile activity. And proteins that correspond to ligands for known cell surface receptors Quality (e.g., insulin) can be controlled by the insulin receptor on cells for glucose regulation. It can be used to target putters.   In still other embodiments, the other ligands and antibodies target the selected cell type. Can be used to target. This could include, for example: a 125 kD antigen on human lung cancer Monoclonal antibody c-SF-25 (Takahashi et al., Sc1ence259: 1460,19 93); Antibodies to various lung cancer antigens (Souhami, Thorax 47: 53-56, 1992); human Antibody to ovarian cancer antigen 14C1 (Gallagher et al., Br. J. Cancer 64: 35-40, 199l); H / Le for targeting lung cancer^y/ Le^bAntibodies to antigens (Masayuki et al., N. Eng. Med. 327: 14-18, 1992); for targeting nerve growth factor receptors on nerve tumors Nerve growth factor (Chao et al., Science 232: 518, 1986); targeting macrophages Receptor for androgen (Anderson and Looney, Immun. Today 1: 264-266,1987) Lectins (Sharon and Lis, Science 246: 227, 1989); targeting colorectal cancer I collagen (Pullam and Bodmer, Nature 356: 529, 1992) for T cells Interleukin-1 (Fa nslow et al., Science 248: 739, 1990); macrophage scavenger receptor. (And atherosclerotic plaques; Brown et al., Ann. Rev. Biochem 52: 223- 261, 1983) to target acetylated low density lipoproteins ( "LDU"), as well as macrophage scavenger receptor targeting Of acetylation of protein (Paulinski et al., PNAS 86: 1372-1376, 1989); virus receptor -(Haywood, J. Vjr. 68 (l): l-5, 1994); transferrin receptor on tumor cells Transferrin (Huebers et al., Physio. Rev. 67: 520,58). 2, 1987); vascular endothelium to target cells where increased angiogenesis occurs ( vasoendothelial) growth factor ("vegF"); and urokinase plasminogen Urokinase plasminogen for binding to the activator receptor (UPAR) Including activator.   Alternatively, the ligand can be obtained using recombinant techniques (Scott and Smith, Science 249: 386, 199). 0; Devlin et al., Science 249: 404, 1990; Houghten et al., Nature 354: 841991; Matthews et al. And Enells, Science 260: 1113, 1993; Nissim et al., EMB0J. 13 (3): 692-698, 1994) Or an organic compound library (eg, EricErb et al., Proc Natl Acad Sci.US A 91: 11422-11426, 1994, K.S.Lam et al., Nature 354: 82-84, 1991). Can be selected from a library prepared using the technique of (1).   In yet a further embodiment, the targeting element or ligand is a particular Carbohydrates or other non-peptidic components that naturally modify the protein sequence of the Can get. A typical example is to add a galactose-terminal carbohydrate and then And a sequence targeting the asialoglycoprotein receptor. Related implementation In some embodiments, the targeting element is later added by a chemical or enzymatic method. And this is the chemical or chemical required to add the appropriate ligand. Providing appropriate peptide sequences in hybrid molecules that favor biochemical reactions This can be facilitated.   In a preferred aspect of the invention, the targeting ligand comprises two or more different proteins. Chimeric proteins or fusion proteins composed of protein or non-protein components It can be parkin. Briefly, proteins generally have a defined secondary, A hydrophobic core and a more hydrophilic surface with a tertiary and often quaternary structure Takes a particular three-dimensional structure encoded by its amino acid sequence. Typically , Oligopeptide targeting ligands do not assume a completely folded structure, Amino acid sequence defining part of a specific secondary structure and a specific binding motif Can be made from a portion of the protein sequence that can have Such a binding motif is , Generally between secondary structural units such as α-helices or β-sheet chains. Found in regions exposed on the surface of the protein, such as loops that are released. Roux The loop is generally flexible and can vary in length to a high degree, and generally allows There are few restrictions on the arrays that can be accommodated. The other binding region of the protein is a single Cleft between protein domains, or elements with different three-dimensional structure Can be found in the areas you meet.   Generally, a binding domain is attached to another protein to bind to a particular target. To add or change a protein, a new sequence is To the extent that they cannot be properly folded or processed and transported in the cell. Must be fused to the existing sequence so as not to disrupt its structural integrity No. The most common insertion site is an amino acid that leaves the rest of the protein intact. No terminal or carboxyl terminal. Another insertion site for the new sequence is polypep The entire domain of the tide and another domain (eg, immunoadhesin) In some cases, for example, IL-2 replaces the intact immunoglobulin variable region (Which may produce a child). Small peptide sequences are also High degree of sequence mutagenicity in exposed loops or amino acid sequence alignments At the amino acid or carboxy terminus Can be inserted inside the substrate.   Representative examples of suitable chimeric or fusion molecules are described in the Examples below (Examples 2 5) is described in more detail.                         B.Gene delivery vehicle. 1. Construction of Retrovirus Enzyme Delivery Vehicle   As described above, the present invention has or expresses a selected nucleic acid molecule of interest. And a recombinant retrovirus constructed as described above. Retrovirus of the present invention Gene delivery vehicles are compatible with a wide variety of retroviruses, such as B, C, and D Retroviruses and spumaviruses and lentiviruses) Easily constructed (RNA Tumor Viruses, 2nd edition, Cold Spring Harbor Laborator) y, 1985). Such retroviruses are provided herein. Disclosure and standard recombinant techniques (see, eg, Sambrook et al., Moecular Clonjng: A Laboratory Manua1, 2nd edition, Cold Spring Harbor Laboratory Press, 1989; Ku nkle, PNAS 82: 488, 1985). Can be easily utilized to assemble or construct. In addition, certain implementations of the invention In embodiments, some of the retroviral gene delivery vehicles comprise different retroviruses. It can be derived from irs. For example, in one embodiment of the present invention, -LTR can be derived from mouse sarcoma virus and the tRNA binding site is The packaging signal may be derived from murine leukemia virus, and The origin of second strand synthesis may be from chicken leukemia virus.   Representative of retroviral gene delivery vehicles that can be utilized in the context of the present invention Typical examples are, for example, EP 0,415,731; WO 90/07936; WO 94/03622; WO 93/25698; W O 93/25234; U.S. Patent No. 5,219,740; WO 93/11230; WO 93/10218; Vile and H art, Cancer Res. 53: 3860-3864, 1993; Vile and Hart, Cancer Res. 53: 962- 967, 1993; Ram et al., Cancer Res. 53: 83-88, 1993; Takamiya et al. Neurosci. R es. 33: 493-503, 1992; Baba et al. Neurosurg. 79: 729-735, 1993 (U.S. Pat. 4,777,127, GB 2,200,651, EP 0,345,242, and WO 91/02805) Including things. Particularly preferred recombinant retroviruses are WO 91/02805 and WO 95/0 5789.   Packaging cell lines suitable for use with the above vector constructs include It can be readily prepared (see WO 92/05266) and provided herein. According to the disclosure, producer cell lines (vehicles) for the production of recombinant vector particles are described. (Also referred to as a cell line or "VCL"). 2. Alpha Wilnus Delivery Vehicle   The present invention also provides various alphaviruses that can function as gene delivery vehicles. Provide the vector. Several different alphavirus vector systems are described in the present invention. Can be constructed and utilized in A representative example of such a system is WO 95/07994. Including those described in 3. Other viral gene delivery vehicles   In addition to retroviral and Sindbis virus vectors, Other viral vector systems can also be utilized as gene delivery vehicles. this Representative examples of such gene delivery vehicles include, for example, poxvirus, canary Apox virus or vaccinia virus (Fisher-Hoch et al., PNAS 86: 317- 321, 1989; Flexner et al., Ann. N.Y. Acad. Sci. 569: 86-103, 1989; Flexner et al., V accine 8: 17-21, 1990; U.S. Patent Nos. 4,603,112; 4,769,330; 5,017,487; WO 89/01973); SV40 (Mulligan et al., Nature 277: 108-114,1979); Influenza virus (Luytjes et al., Cel 1 59: 1107-1113, 1989; McMicheal et al., N. Eng. J. Med. 309: 13-17, 1983; and Yap et al., Nature 273: 238-239, 1978); Rupes (Kit, Adv. Exp. Med. Bjo 1. 215: 219-236, 1989; U.S. Patent No. 5,288,641). No.); HIV (Poznansky, J. Virol. 65: 532-536, 1991); Measles (EP 0 440,219); Viruses such as the Mouriki forest virus, and the coronavirus, and other viruses Irs series (eg, EP 0,440,219; WO 92/06693; US Pat. No. 5,166,057). No. In addition, the viral carrier is a homologous, non-pathogenic (defective) replication-permissive virus. (Eg, 0verbaugh et al., Science 239: 906-910, 1988), and Nevertheless, it induces a cellular immune response, including CTL. 4. Non-viral gene delivery vehicle   In addition to the virus-based vectors described above, a number of non-viral gene delivery Vehicles may be utilized in the context of the present invention as well. Such gene delivery Representative examples of vehicles include nucleic acid expression vectors, naked DNA alone (W0 90/11092), dead Polycation-condensed DNA linked to or not linked to adenovirus (Curie l et al., Hum. Gene Ther. 3: 147-154, 1992), having one of the above high affinity binding pairs DNA ligands linked to ligands with or without (Wu et al., J. of Biol. Che. m 264: 16985-16987, 1989), nucleic acid-containing liposomes (eg, WO 95/24929 and W0 95/12387), and of certain eukaryotic cells (eg, producer cells). Including direct delivery.                             C. Heterologous nucleic acid molecule   A wide variety of nucleic acid molecules can be used for expression vectors or recombinant retroviruses of the invention. May be retained and / or expressed. Generally, the nuclei described herein The acid molecule is found in the expression vector or recombinant retrovirus carrying it. Not present, and has any desired benefit, typically a disease or other pathogen (p. Provides the ability to fight an athogenic agent) or condition.   Substances that can be encoded by the nucleic acid molecules described herein include proteins ( For example, antibodies including single-chain molecules), immunostimulatory molecules (eg, antigens), immunosuppressive molecules , Blocking agents, emollients (eg, toxins, antisense ribonucleic acids, ribozymes , Enzymes, and other substances that can inhibit the function of pathogens), cytokines, Repeptide or peptide hormones, their agonists or antagonists (Here, these hormones are found in tissues (eg, pituitary, hypothalamus, kidney, endothelial cells) Vesicles, liver, pancreas, bone, hemopoetic bone marrow, and adrenal glands) Including. Such polypeptides can be used for growth, tissue regression, suppression of the immune response, Cis, gene expression, blocking receptor-ligand interaction, triggering an immune response Can be used for induction, and certain anemia, diabetes, infection, high blood pressure, abnormal blood Chemistry (s) (eg, elevated blood cholesterol, blood clotting factors Deficiency, elevated LDL with decreased HDL), Alzheimer-related amyloid tan Protein levels, bone erosion / calcification, and various metabolites (eg, Steroid hormones, purines, and pyrimidines) possible.   In one aspect of the invention, an expression vector or set that directs the expression of a moderating agent Methods are provided for the administration of a recombinant retrovirus. It will inhibit cell growth A representative example of a directly acting moderating agent is lysine (Lamb et al., Eur. J. Bjochem. 1). 48: 265-270, 1985).   In another aspect of the invention, the expression vector or recombinant retrovirus is Substances that can activate otherwise inactive precursors into active inhibitors of pathogens Or a conditional toxicant that is a moderating agent that is toxic to cells expressing a pathogenic condition Directs the expression of Japanese medicine. As is evident according to the disclosure provided herein A wide variety of inactive precursors can be converted into active inhibitors of pathogens. Thus, for example, metabolizing an antiviral nucleoside analog to its active form To Supporting gene products (eg, proteins) (eg, herpes simplex virus Midine kinase (HSVTK) or varicella-zoster herpesvirus thymidine kinase (VZVT Expression vectors or recombinant retroviruses that direct the expression of K)) Activation of a prodrug analog (eg, AZT or ddC) to its active form And useful. Thereby, AZT or ddI treatment is more effective and lower Higher dose, less systemic toxicity, and higher potency against productive infections You. Additional nucleoside analogs (this nucleotide triphosphate form is retrograde Shows selectivity for irs reverse transcriptase, but shows cellular nucleosides and nucleotids. Is not phosphorylated as a result of the substrate specificity of dokinase) Can be done.   In yet another aspect, the RNA molecule corresponding to the pathogenic function is cleaved and One or more ribozymes (RNA enzymes) that inactivate (Haseloff and Gerlach, Na Expression 334: 585, 1989) having therapeutic effect by encoding And recombinant retroviruses are provided (Foster and Symons, CeIl 48: 211- 220, 1987; Haseloff and Gerlach, Nature 328: 596-600, 1988; Ruffner et al., B iochem 29: 10,695-10,702, 1990; and also see PCT Publication No. W093 / 23569. thing). In another aspect, the antisense sequence (the antisense sequence is also a nucleic acid Which can be encoded by a sequence and then produced in a host cell via transcription). Expression vectors and recombinant retroviruses containing biologically active nucleic acid molecules Is provided. In a preferred embodiment, the antisense sequence is influenza From the group consisting of sequences encoding the virus, HIV, HSV, HPV, CMV, and HBV Selected. Antisense sequences are also complementary to RNA sequences required for virulence Antisense RNA. Alternatively, the biologically active nucleic acid molecule is It can be sense RNA (or DNA) complementary to the RNA sequence required for sex.   Still a further aspect of the invention relates to a recombinant retrovirus capable of immunostimulation. . In short, the ability to recognize and defend against foreign pathogens Essential for the functioning of the immune system. In particular, the immune system is the host defense mechanism "Self" and "non-self" ( That is, it must be possible to distinguish between outpatients). Cytotoxic T lymphocytes (CTL) Is Processed, bound to MHC class I or MHC class II cell surface proteins Presentation is typically achieved by presentation of cell surface recognition structures such as pathogen-specific peptides. Or you are stimulated.   In one embodiment, the invention provides an antigen or a modification thereof in a susceptible target cell. Using an expression vector or recombinant retrovirus that directs the expression of the variant To stimulate a specific immune response and to inhibit viral spread Provide a way to: Here, the antigen is (1) an immune response against a virus antigen. Can initiate or (2) occupy cell receptors required for viral interaction Either can prevent virus spread.   In another aspect of the present invention, the expression vector or the recombinant retrovirus of the present invention Can be constructed to express "immunomodulators," many of which are described above. You. An immunomodulator is produced by one or more cells involved in an immune response. Or in the absence of the factor when added externally to the cell Refers to an agent that elicits an immune response that differs in quality or potency from the immune response that is being performed. Responsive Quality or potency may be determined by various assays known to those of skill in the art (eg, measuring cell proliferation). In vitro assays (eg,^ThreeH-thymidine incorporation), and in vitro cells Toxicity assays (eg,⁵¹(Measuring Cr release)) arner et al., AIDS Res. and Human Retrovjruses 7: 645-655, 1991) . Immunomodulators can be active both in vivo and ex vivo.   Representative examples of such immunomodulators include cytokines or lymphokines, Interferons (eg, γ-IFN), tumor necrosis factor (TNF) (Jayaraman et al., J. Im. munology 144: 942-951, 1990), CD3 (Krissanen et al., Immunogenetics 26: 258-266, 1987), ICAM-I (Altman et al., Nature 338: 512-514, 1989; Simmons et al., Nature 331: 6). 24-627, 1988), ICAM-2, LFA-1, LFA-3 (Wallner et al., J. Exp. Med. 166 (4): 923-9). 32, 1987), MHC class I molecule, MHC class II molecule, B7.1-.3, β2-microglobulin (Parnes et al., PNAS 78: 2253-2257, 1981), chaperones such as calnexin, And MHC-coupled transporter proteins or analogs thereof (Powis et al., Nature 354: 528-531, 1991).   The present invention also provides a method for producing a desired antigen (e.g., a viral, bacterial or parasite antigen). Expression vectors and recombinant retroviruses encoding immunogenic portions of Including Ruth. Representative examples include hepatitis B and C virus antigens (eg, WO 93/1). 5207), feline leukemia virus, and / or immunodeficiency virus antigens (eg, , WO 94/06921). Still another example is ras (ras^*) Gene and p53 gene (WO (See 93/10814). The expression vector or the recombinant retrovirus. D.Cell culture enrichment and purification of recombinant retroviral particles.   As noted above, the present invention provides gene transfer suitable for administration to humans and other warm-blooded animals. Provide vehicles. For example, a wide variety of methods (eg, fermenters or Use of reactors, rotating bottles, cell hotels or cell factories, and hollow fiber cultures ) Can be used to produce a recombinant virus suitable for administration.   Briefly, for bioreactors or fermenters, cells are preferably Or microcarriers (ie, Cytodex 1 or Cytodex 2; Pharmacia, Pisca taway, NJ) at concentrations ranging from 3 to 15 g / L microcarriers. rotation For bottles, the appropriate conditions are that microcarrier beads are generally not preferred Except as noted, including those described above for bioreactors. like this Methods such as cell hold or cell factory and hollow linker culture Representative examples of other methods are described in WO 96/0926.   Following cultivation, a wide variety of media may be used to increase virus concentration and purity. Methods (eg, precipitation of recombinant retroviruses with ammonium sulfate, polyethylene Glycol ("PEG") concentration, concentration by centrifugation (Gradients such as PERC0LL) Or with or without a "cushion" like sucrose Including the use of a concentration filter (eg, Amicon filtration), and two-phase separation ) Can be used. Representative of retroviral particle enrichment and purification and designation Examples are described in WO 96/0926. E. FIG.Administration.   As noted above, the present invention provides several methods for administering a gene delivery vehicle. I will provide a. In one aspect of the invention, a selected cell type in a warm-blooded animal is inherited. Methods are provided for targeting a child delivery vehicle. This method is applied to the surface The gene delivery construct described above, having a fusion protein comprising a targeting ligand, is Administering to a blood animal. In one aspect of the invention, selection in warm-blooded animals Methods for targeting a gene delivery vehicle to a defined cell type are provided. This one The method comprises: (a) a fusion protein having one member of a high affinity binding pair on its surface; Administering to a warm-blooded animal a gene delivery vehicle having Administering to the animal a gene delivery vehicle conjugated to a second member of the sexually coupled pair Wherein the second member comprises a gene delivery vehicle for the selected cell type. Including the step of being able to specifically bind to the first high affinity molecule as targeted. 1 In one embodiment, such a method involves adding a second member of a high affinity binding pair. Administer the clarifying agent to the animal prior to administering the conjugated gene delivery vehicle. Further comprising the step of:   In the above method, a warm-blooded animal (eg, human, macaque, horse, cow, pig) , Sheep, dogs, cats, chickens, rats, and mice) Nevertheless, such methods are also readily applicable to a variety of other animals, including, for example, fish. Note that this can be applied to   Utilizing such methods, the gene delivery vehicle of the present invention can be used in a wide variety of locations. Placement (eg, site (eg, cerebrospinal fluid, bone marrow, joint, arterial endothelial cell, rectum, cheek / Sublingual, vaginal, lymphatic), lung, liver, spleen, skin, blood, and brain Including selected organs or sites selected from the group consisting of tumors and gaps) Can be administered. In other embodiments, the gene delivery vehicle is intraocular, intranasal , Sublingually, oral, topical, intravesical, intrathecal, topical, intravenous, membrane It can be administered intracavity, intracranial, intramuscular, or subcutaneous. Other typical routes of administration are: Includes gastroscopy, ECRP, and colonoscopy, which requires complete surgical procedures and hospitalization Not required, but may require the presence of a medical practitioner.   The above methods can be readily utilized for various therapeutic (and prophylactic) treatments. You. For example, in one embodiment of the present invention, the above method comprises treating a disease in a warm-blooded animal. It can be achieved to inhibit or destroy the drug substance. Such pathogens are "Foreign" to the host as well as the body (eg, parasites, bacteria, and viruses) (Eg, cancer or tumor cells), or other cells that have been "modified". including. In a preferred embodiment of the present invention, the above composition is a disease such as a tumor. The drug substance is directly injected, e.g., by direct injection into several different locations within the tumor body. Can be used to treat. Alternatively, the arteries supplying the tumor can be identified and The composition can be injected into such arteries to deliver the composition directly to the tumor You. In another embodiment, a tumor having a necrotic center can be aspirated, and the composition Can then be injected directly into the hollow tumor center. In still another embodiment, the above The composition is, for example, a retrovector construct or, preferably, a recombinant retrovirus. Is applied directly to the surface of the tumor by the application of a topical pharmaceutical composition comprising irs particles obtain.   In another aspect of the invention, transplant rejection is suppressed to prevent or treat disease. To control, to suppress the immune response, and to suppress the autoimmune response, Utilizing the above composition to generate an immune response against the immunogenic portion of the antigen A method is provided.   The following examples are provided by way of illustration, and not by way of limitation. is not.                                   Example                                 Example 1                  Preparation of retroviral vector backbone   Suitable retroviral backbones for use in the present invention will be It can be easily prepared. For such backbones (eg, KT-1 and KT-3) Tabular examples are described in WO 91/02805 and WO 95/05789. Example 2 MHC class I based targeting A.Construction of expression backbone pSC6.   To form the backbone for both gag / pol and env expression cassettes , First construct the vector. Briefly, pBluescript SK-phagemid (S tratagene, San Diego, Calif .; GenBank access number 52324; hereinafter referred to as "SK-" ) Is digested with Spel and blunt-ended with Klenow. Then SV 40 (Fiers et al., Nature 273: 113-120, 1978) with a blunt-ended DraI fragment (Dral (b p2366) to DraI (bp 2729)) were inserted into SK- and SV40 late polyadenylate. Constructs in which the ligation signal is in the opposite direction to the SKZ lacZ gene are isolated. This structure The structure is named SK-SV40A.   Human cytomegalovirus major immediate early promoter ("HCMV-IE"; Boshart et al.) , Cell 41: 521-530,1985) (HincII (bp 140) to EagI (bp814)). And after digestion with EagI, and blunting the EagI site. 674 flat The blunt-ended fragment is ligated to SK-SV40A. This final construct (pSC6 and No.) (see FIG. 1). This construct is opposite the lacZ gene. The HCMV promoter in the orientation and upstream of the SV40 late polyadenylation signal. Including. B.MHC Cloning of class I, specifically human HLA-A2.   The human HLA-A2 gene was transformed with a 4 kb HindIII-ApaLI fragment (Koller and Orr, Jr. .Immun. 134 (4): 2727-2733, 1985), and the polylinker H of pSC6. Insert into expression construct pSC6 (Invitrogen) using indIII and EcoRV sites ( (Fig. 1). This expression construct is a human CMV immediate-early promoter that drives the human HLA-A2 gene. Data included. The ApaLI site is treated with T4 DNA polymerase to create blunt ends, The fragment is then ligated to pSC6 cut with HindIII and EcoRV (FIG. 2). . This construct is named pSC6 / HLA-A2. C.Fusion of human HLA-A2 with peptide derived from EBV GP350 / 220: mature amino-terminal EDP GFFNVE   PCR primers were used to fuse the gp350 / 220 sequence to the HLA-A2 template at the mature amino terminus. To match, the synthesis was performed using the sequence shown in Table I and the PCR reaction was performed using the GeneAmp PCR Perform as shown in Table II using the kit (Perkin / Elmer) according to the manufacturer's instructions ( Figures 3 and 4). PCR products containing the gp350 / 220 peptide sequence at the amino terminus of HLA-A2 Using TA cloning kit (Invitrogen, SanDiego, CA) Therefore, it is cloned into the vector pCRII (FIG. 5). Use standard PCR product sequences Confirm by various DNA sequencing methods. Fragments are ligated with Eco47III and BspEI sites From pCRII by digestion with pSC6 / HLA-A2 at Eco47III and BspEI sites. And the fusion vector pSC6 / 350-A2 is produced. Table I Primer sequence for fusing gp350 / 220 peptide to HLA-A2 amino terminusTable II Insertion of EBV gp350 / 220 peptide with HLA-A2 amino terminus by single overlapping PCR D.Construction of a packaging cell line possessing a Moloney allotrope envelope.   The homotrophic envelope expression vector pSC6 / eco was transferred to the Xbal-NheI fragment of MoMLV. Insert (MoMLV bp5766 to bp7845) into the pSC6 expression vector (Example 2A) It is produced from Briefly, the XbaI-NheI envelope fragment was converted to pMLV -K (Miller et al., J. Vir. 49: 214-222, 1988). The fragment is then blunt-ended with T4 polymerase using standard methods. Ligated into pSC6c and digested with EcoRV and SmaI sites. The product in the correct direction is the HCMV Followed by a complete homo-directional envelope coding sequence and polyadenylation. Le Has an activation signal.   Allotropic packaging cell line 293E was transformed with 293 gag-pol (`` 2932-3 ''; WO 91/028). 05; Burns et al., PNAS 90: 8033-8037, 1993) using the pSC6 / eco vector and pSV2gpt ( Co-transfection with Mulligan and Berg, Scjence 209: 1422, 1980) Prepared by After selection for gpt positive cells in the presence of selection medium Next, individual resistant colonies were isolated by dilution cloning and Goat polyclonal antibody (NCI / BCB storage serum No. 79S000842, 1667 Davis St, Camde n, NJ 08104) to analyze for expression by Western blot analysis. E. FIG.Transfer pSC6 / 350-A2 to 293E or 2932-3 for packaging cell line generation Transfection.   gag / pol and MoMLV allotropic envelope cell line 293E, or gag / pol cells Strain 2932-3, caPO_FourBy precipitation (Wigler, M. et al., Cell 11: 223, 1977), 10 μg of pSC 6 / 350-A2 and 1 ug phleomycin resistance vector pUT507 (Mulsant et al., Somat.Cel l Mol. Genet. 14: 243-52, 1988). l0μg / ml freo After selecting transfected cells in the presence of medium containing mycin, individual Expand drug-resistant cell colonies and use monoclonal antibodies against HLA-A2 Analyze for expression by Western blot. F.Production of producer cell line using thymidine kinase vector 1.Retroviral vector construct   Herpes simplex virus type 1 thymidine kinase (ATP: thymidine 5 'phosphotran Spherase, EC 2.7.1.21), the plasmid p322TK (Enquist Gene 7: 335-342, 1979: Wagner et al., P.N.A.S. 78: 1441-1445, 1981) . The promoter and polyadenylation signal are removed and the 5 'XhoI site and And the gene is further modified to create a 3 'ClaI site. Then, this modified remains The gene fragment was cloned into the XhoI and ClaI sites of the KT-3 backbone. To make the BH-1 vector. In the BH-1 (N2 / tk) vector, expression of MoMLV gag was ATG methionine start codon has been mutated to ATT to inhibit gag expression (Chada et al., J. Vir. 67 (6): 3409-3417, 1993). MoMLV long terminal repeat (LTR) , Controls expression of the HSV-tk gene, and the internal SV40 promoter is neomycin resistant Drives expression of sex markers. 2.Vector production   Retrovirus packaging cell line DA (Irwin et al., J. Vir. 68 (8): 5036-5044, 1994; Laube et al., Hum. Gene. Ther. 5: 853-862, 1994) to the canine sarcoma cell line D17. To express mouse leukemia virus gag / pol and heterotrophic env sequence Manipulate. Vesicular stomatitis virus G pseudotyped DA / N2 / tk / producer cell line Vector (Burns et al., P.N.A.S. 90: 8033-8037, 1993) to the DA packaging cell line. , Followed by selection on G4l8 (800 μg / ml). Dilution claw Individual clones were isolated by^RTest for titer. Power The best producer clones DA / BH-l # 9A and # 18A based on Choose for use. Transfer these DA / N2 / tk producer cells to confluent The supernatant containing the replication defective vector N2 / tk is collected and filtered (pores Size 0.45 μm) and store at −80 ° C. Vector titers were determined by serial dilution and HT-1080 indicator cells in medium containing G4 and G4l8 (800 μg / ml). CFU assay (Irwin et al., 1994). The titer is generally l0^Fivecfu / ml And 10⁶between cfu / ml. The DA / β-gal producer cell line was previously described (Irwin et al., 1994).   In a similar fashion, using the packaging cell line 293E / 350-A2 (Example 2E) Vesicular stomatitis virus G pseudotyped vector (Burns et al., P.N.A.S. 90: 8033-8037, 199). 3) Transduction of 293E / 350-A2 packaging cell line followed by G418 (400 μg / ml) Producer cell lines are generated by selection in the above. By dilution cloning Individual clones were isolated and G4l8^RTest for titer. Based on titer The best producer clone is selected for subsequent use. These programs Reducer cells are grown to confluence and replication defective N2 / tk vector Collect the supernatant containing the filter, filter (pore size 0.45 μm) and store at -80 ° C . Vector titers were determined using HT-1080 indices selected in media containing G418 (800 μg / ml). Determined by serial dilutions (Irwin et al.) In the rotor cells.   Vectors can be introduced into other cell lines as described above to select clones as well . G. FIG.Targeting Raji cells using thymidine kinase vector   This experiment was performed using the B lymphoblastoid cell line Raji (ATCC) expressing the complement C3d receptor CD21. CCL 56) was used as a target for transduction with HLA fusion protein / thymidine kinase vector. Monocyte-like cell line (CD21 minus) U937 (ATC C CRL 1593) is used.   1x10 in 5 wells of 2 6-well dishes⁶Raji cells or U937 Set up any of the cells. Wells, (l) bi-directional packaging Thymidine kinase vector produced in cell line DA, (2) HLA-A2 fusion vector package Thymidine kinase vector produced in a caging cell line, (3) packaging Thymidine kinase vector produced in cell lines 293E or 293 2-3, (4) irrelevant Vector-DA / βgal, (5) Exposure without vector. Thymidine kinase Stain for zease production and submit to FACS analysis for thymidine kinase production You. The other half were treated with 3, 6, or 9 μg / ml ganciclovir for 3-5 days, Then, counting is performed to determine the ratio of remaining viable cells. Or ganciclo The effect of the building^ThreeRelative levels of H-thymidine incorporation (Bradley, L.M.,Selected Me thods inCellularImmunology , Pp. 156-161, (ed. By B. Mishell and S. Shiigi), Fr eeman & Co., N.Y. (1980)).                                 Example 3                         Targeting based on MHC class II A.MHC Cloning and expression of class IIDR, DQ, and DP genes 1. Expression M of MHC class II protein in retrovirus producer cells There are a number of different vectors for expression of HC class II gene products. For example Wilkinson, D et al. Exp. Med. 167: 1442-1458, 1988 from the DR2Dw2 cell line PGF Construction of DR2βa and DR2βb expressing vectors is described.   Expression vectors encoding different class II genes (both α and β chains Can be combined in the same construct or transfected separately)_Four Transfect DA / βgal cells using the procedure (above) and Selected cells by FACS sorting for cell surface expression of appropriate class II molecules. (See below for details). The first experiment was for all three class II pairs Determine whether the progene can be expressed in dog DA cells. Selected details The vesicle pool is expanded and β-gal (V) is isolated from the confluent culture. 2.Detection of HLA class II molecules bound to virions   HLA class II specific monoclonal antibody obtained from Pharmingen (SanDiego, CA) I do. These monoclonal antibodies include H143 (anti-DP), Tul69 (anti-DQ1, DQ2) , Tu36 (anti-DR), or Caltag IIb3 (anti-Dqwl; Caltag, San Francisco, CA), 7.3.19.1 (anti-DRw52) or HL-37 (anti-DQ1, DQ3). Antibody, manufacturer's finger Binding to magnetic beads (Dynal Inc., New Hyde Park, New York) as indicated. Used to purify β-gal (V) from different producer cell lines. Bi Vectors bound to the dose are quantified by ELISA using an anti-p30 detection antibody.   Alternatively, amino-linked keys may be used according to the manufacturer's instructions (Pierce, Rockford Illinois). To bind an anti-class II monoclonal antibody to cephalose Thus, an affinity column can be prepared. Pass the vector supernatant through the column, The bound vector was eluted with 1M NaCl and removed from HT1080 cells. To determine β-gal activity. This assay contains only one functional β-g al virions can be detected. Vectors derived from DA / β-gal-DR cells were used for DR, DP, and Pass through a DQ column and evaluate the specificity of the binding. A similar experiment was performed DA / βgal cell-derived vectors and DA / βgal-DP and DA / βgal-DQ cells Perform on the incoming vector.   To assess the preferred selection of class II molecules on virion surfaces, DP, DQ , And DR into DA / βgal cells and the resulting vector Test for binding activity to class II specific column as described above. B.IgG Anti-transferrin receptor monoclonal antibody 454Al2 Rowing   The variable region of Mab 454Al2 (U.S. Pat.No. 4,938,948) was transferred to a hybridoma cell line (AT Clone from CC HB 10804). The variable regions of the heavy and light chains are Mixed oligonucleotide primers corresponding to the It is obtained by the PCR used (Larrick et al., BioTechniques 7: 934-838 (1989)). PCR The product was cloned into pCRII using the TA Cloning kit (Invitrogen) and Sequence determined by the anger dideoxynucleotide method. Complete 3 clones The DNA sequence of each V region is confirmed by sequencing. The sequences are shown in Tables III and IV. C.Construction of anti-transferrin receptor antibody 454Al2 single chain Fv fragment   Assemble the variable regions of the heavy and light chains and insert Gly-Gly-Gly-Gly- Form a single-chain Fv fragment with a synthetic linker sequence consisting of three Ser repeats . Primers and templates for assembly of the 454A12 sFv are listed in Tables III-V Put together. The products of the two PCR reactions were analyzed by duplicate PCR (Horton, R.M.) as shown in Table VI. Et al., Biotechniques 8: 528-535 (1990)). The duplicate PCR products were then transferred to the TA cloning kit (Invitrogen) as described above. From the vector pCRII. The PCR product is a single-chain Fv file about 750 bp long. Equivalent to ragment. Some clones were converted to Sanger dideoxynucleotides Subject to sequencing to obtain a clone of the exact deduced DNA sequence. D.MHC antibody fusion with anti-transferrin receptor 454A12 single chain Fv fragment Construction of expression vectors for proteins   The DR gene was inserted at the EcoRV and EcoRI sites of the polylinker from ScaI to PstI (4 Kb Fragment) and HLA DR cut from PstI to EcoRI (1700 bp fragment) The gene is inserted into the pSC6 vector as a three fragment ligation. ScaI is the polylinker Ec This creates a blunt end that connects to the oRV site. Signal peptide and mature amino terminus Using the primers listed in Table VII and the PCR reaction described in Table VIII. SFv (described in the above section) was subjected to two overlapping PCRs from NdeI to BglII Add to the end. The final product is cloned into pCRII for sequence confirmation. Ami The non-terminal NdeI to BglII fragment was cloned into pSC6 / HLA-DR, pSC6 / DR-aTfR Is prepared. Table III Sequence of 454A12 heavy chain V region template SEQ ID NO: 9 Table IV Sequence of 454A12 light chain V region template SEQ ID NO: 10 Table V 454A12 Primer sequence for PC duplication in sFv construction Table VI Assembly of 454A12 sFv by overlapping PCR Table VII Anti-transferrin receptor antibody 454A12 sFv was fused to HLA-DR amino terminus Primer sequenceTable VIII Insertion of the 454A12 sFv fusion at the HLA-DR amino terminus by double overlapping PCR E. FIG.Transfer of pSC6 / DR-aTfR to 293E or 293 2-3 for generation of packaging cell lines Transfection.   gag / pol and MoMLV allotropic envelope cell line 293E or cell line 293 2-3 , CaPO_FourBy precipitation (Wigler, M. et al., Cell 11: 223, 1977), 10 μg of pSC6 / DR-aTf R and 1 μg of the phleomycin resistance vector pUT507 (Mulsant et al., Somat. Cell Mo. l. Genet. 14: 243-52, 1988). 10μg / ml free After selection for transfected cells in the presence of medium containing omycin, Expand individual drug-resistant cell colonies and HLA class IIDR specific monochrome Western block using null antibody Tu36 (obtained from Pharmingen (SanDlego, CA)) And analyze for expression. F.β-galactosidase vector   Bacteria encoding β-galactosidase (“βgal; Price, PNAS 84: 156, 1987”) The acZ gene was cloned into the N2 backbone as described (Irwin et al., 1994). To make the N2βgal provector plasmid. Using N2βgal provector To produce a stable producer-one cell clone called DA / βgal. Purified Vector supernatant was produced from this cell line and 1 × 10⁸Titers greater than cfu / ml Concentrate until: G. FIG.Characterization of HLA DR antibody fusion protein PCL using β-galactosidase vector Introduction   Using the packaging cell line 293E / DR-aTfR or 293 2-3 / DR-aTfR, Stomatitis virus G pseudotyped vector (Burns et al., P.N.A.S. 90: 8033-8037, 1993) Transduce 3E / DR-aTfR packaging cell line, followed by G418 (400 pg / ml) By selection, a producer cell line is created. Individual clones can be G418^RTest for titer. Best based on titer Producer clones are selected for subsequent use. These prode Tumor cells are grown to confluence and the replication defective N2-βGal vector The supernatant containing the-is collected, filtered (pore size 0.45 μm) and stored at -80 ° C. Vector titers were determined using HT-1080 indices selected in medium containing G4l8 (800 μg / ml). Determined by serial dilutions in protein cells (Irwin et al., 1994). H.Targeting transferrin receptors on cells   This experiment was performed as a target for transduction with the HLA DR anti-TfR / βGal vector, The cell line Molt4 (ATCCCRL1582) expressing the transferrin receptor is used. Briefly, 1x10 in 4 wells of two 6-well dishes^FiveM0LT4 Set up cells. Wells were prepared using (1) amphotropic packaging cell line DA ( Βgal vector produced in Example 3E), (2) HLA-A2 fusion vector package (3) Packaging cell line 293E (Example 2) Exposure without the βgalb vector produced in D), (4) vector. Half of the cells Stain for βgal production. The other half is 10% with 1000 μg / ml geneticin Subject to treatment for one day and viable cells are counted (Irwin et al., 1994 supra). Targeting Was described above in (2) by the presence of either blue cells or G4l8 resistant colonies. To demonstrate. Example 4 β2 microglobulin (β2M) based targeting A.Cloning of human erythropoietin (EPO) and with human .BETA.2M fusion EPO Construction of expression vector.   The basic strategy used to generate the EPO-b2m fusion protein is Using PCR with primers and template, EPO and b2m fragments ( These can then be ligated into the appropriately digested eukaryotic expression vector pSC6) Is to produce.   Specifically, ClaI-AatI EPO fragment, AatI-EcoRI b2m fragment and C A three-way ligation is achieved using the laI-EcoRI digested pSC6 expression vector.   Plasmid EPOenv-D5923 (Kasahara et al., Science 266: 1373, 1994) was replaced with human EPO Use as a source of genes. This clone contains the restriction enzymes BstEII and BamHI. A complete 166 amino acid long mature E that can be intactly excised from the vector using Includes cDNA encoding p0 protein. BstEII site is created using T7 polymerase To create blunt ends, then ligate the fragment to EcoRV and BamHI digested plasmids. Link to Smid SK + (Stratagene, La Jolla, CA). This plasmid construct is called SK + / EPO, and Cl on the 5 'side of the EcoRV site in the multiple cloning site of SK + The presence of the aI site indicates that the EPO gene was converted as a ClaI-AatI fragment into the SK + / EPO Allows removal from Rasmid. The AatI site is located at the fifth position of the EPO gene. A unique restriction site located near the end of the exon, and before the stop codon To position.   The human b2m gene fragment was then engineered to have an AatI restriction site at its 5 'end. And an EcoRI restriction site at the 3 'end. Contains cDNA encoding human b2m Plasmid p714 (Parker and Wiley, Gene 83: 117, 1989) Fragment containing no signal peptide), and EPO gene The 3 'end of the offspring (without its stop codon) is fused in frame to the b2m gene PCR template for a set of primers that amplifies all sequences required for Serve as a plate. Specifically, the primer set is designed as follows : Primer 1: 5'GGGAGGCCTGCAGGACAGGGGACAGACAGCGTACTCCAAAGATTCAGGTT 3 '(SEQ ID NO: 17) and this is the AatI restriction site, the last few Includes codons and the first few codons of the b2m gene. Primer 2 is E An antisense sequence containing the coRI restriction site and the last 9 codons of the b2m gene (5'GGG AATTCTACCTGGCGCTGTTACATGTCTCGGTC 3 '(SEQ ID NO: 18)). PCR reaction, Ge Perform using neAmp PCR kit (Perkin / Elmer) according to manufacturer's instructions and The amplified gene product using the TA Cloning Kit (Invitrogen, San Diego, CA). And clone into the vector pCRII according to the manufacturer's instructions. Amplified PCR product The sequence of the product is confirmed using standard DNA sequencing methods. Then, the fragment First digestion with AatI, then partial digestion with EcoRI (20 An additional EcoRI site located just before the termination codon of the b2m gene exists at 9 bp 5 ' To remove from pCRII. Set up a pilot digestion and set up another EcoRI Determine the optimal conditions for digesting the terminal EcoRI site without disturbing the site. Once the correct AatI-EcoRI b2m fragment was isolated, it was converted to ClaI-AatI EPO Simultaneous ligation with gene fragment and ClaI-EcoRI digested pSC6 vector DNA . The resulting fusion construct pSC6 / EPO-b2 was sequenced to ensure that the EPO-b2m gene fusion was accurate. To verify that. B.Transfer of pSC6 / EPO-b2m to 293E or 293 2-3 for packaging cell line generation Transfection.   gag / pol and MoMLV allotropic envelope cell line 293E (Example 2D) or cells Cell strain 293 2-3, CaPo_FourBy precipitation (Wigler et al., Cell 11: 223, 1977), 10 μg of pSC6 / EPO-b2m plasmid DNA and 1 μg phleomycin resistance vector pUT507 (Mulsa nt et al., Somat. Cell Mol. Genet. 14: 243-52, 1988) To After selection for transfected cells in the presence of phleomycin Expand individual drug-resistant cell colonies, and Western Blotty using monoclonal antibodies to human and human b2m Analyze for expression by staining and fluorescent staining. Or high level EPO- Cells expressing b2m can be selected using a fluorescence activated cell sorter (FACS). Details Specifically, for EPO detection, polyclonal antisera against EPO (AB-286-NA; R & D Systems, Minneapolis, MN), and for b2m detection, Antibody mAb BBM-1 (P) that binds to epitopes present on both native and denatured b2m arham et al. Biol. Chem. 258: 6179-6186, 1983). C.Production of producer cell line using β-galactosidase vector   Using the packaging cell line 293E / EPO-b2m or 293 2-3 / EPO-b2m, The stomatitis virus G pseudotyped vector (Burns et al., P.N.A.S. 90: 8033-8037, 1993). Transducing the cell line, followed by selection on G4l8 (400 μg / ml). This creates a producer cell line. Individual clones can be diluted And isolated by G418^RTest for titer. Best based on titer Producer clones are selected for subsequent use. These producers Cells are grown to confluence, and the replication-defective N2-βGal vector Is collected, filtered (0.45 μm pore size) and stored at -80 ° C. Vector titers were determined using the HT-1080 indicator selected in media containing G4l8 (800 μg / ml). It is determined by serial dilutions in tar cells (Irwin et al., 1994). D.EPO Targeting to the receptor.   In this experiment, NIH 3T3 cells were tested for complementary DNA (cDNA) (cDNA The source is A. D'Andrea et al., Cell, 57: 277, 1989) Use a cell line that has been cloned. Standard transfection and selection Using methodology, NIH 3T3 cells stably expressing the EPO receptor (NIH 3T3-EPOR) Isolate and use FACS analysis to express the expression of the EPO receptor on these cells. Confirm. 1x10 in 4 wells of 2 6-well dishes^FiveNIH 3T3-EP0 Set up R cells or NIH 3T3 cells (without EPO receptor). Next Wells were then plated with (1) the βgal vector produced in the amphotropic packaging cell line DA. (2) βgal vector produced in the EPO-b2m fusion vector packaging cell line. (3) βgal vector produced in packaging cell line 293E, (4) vector Exposure without Half of the cells are stained for βgal production. The other half, 600 Subject to 10 days of treatment with μg / ml geneticin and count viable cells (Irwin et al., 1994). Example 5 Targeting based on (b2m) by subunit exchange A.EPO-b2m Cloning of fusion protein into prokaryotic expression vector   The recombinant EPO-b2m fusion protein was transferred to the prokaryotic expression vector pSE280 (Invitrogen, S an Diego, CA). The EPO-b2m gene is first digested with ClaI, ow to create blunt ends, followed by EcoRI partial digestion And excised from pSC6 / EPO-b2m as a ClaI-EcRI fragment. Next, Fragment with the NcoI-EcoRI digested pSE280 vector DNA (the NcoI end is also Smoothing before setting up concatenation). This recombinant plasmid is called pSE280 / E It is called PO-b2m. B.Expression of EPO-b2m fusion protein for expansion and purification.   In short, EPO-b2_mPSE280 plasmid containing the fusion protein (pSE280 / EPO -b2m). E. coli strain XA90, and then clone The DNA sequence is confirmed and its DNA sequence is confirmed. Then, apply the positive clone Grown to a sharp density and isopropyl b-D-thiogalactopyranoside (IPTG; (1 mM). Cell is OD₆₅₀When the culture reaches a density of 1.8-2.0 at Collect by centrifugation (1 liter aliquot) followed by lysozyme at 100 μg / m l, 50 μg / ml of protease inhibitor PMSF, 20 μg / ml of DNase, 20 μg of RNase g / ml and a solution of 10 mM Tris-HCl (pH 8) containing 1 mM EDTA (20 ml / 1 liter Lysed cells using lettocytes. Incubate the cells in this mixture for 20 minutes at room temperature. And then sonicate before another round of centrifugation at 10,000 xg for 20 minutes. You. The resulting pellet containing the recombinant protein is washed with 20 ml of 10 mM Tris-HCl (pH 8). And then to a solution of 10 mM Tris-HCl (pH 8) and 8 M urea (total 10 ml). Resuspend. Following resuspension, the lysate was centrifuged at 150,000 xg for 1 hour at 4 ° C I do. Then, the recombinant fusion protein in urea was reacted against 10 mM Tris-HCl (pH 7). Dialyze and 10 mM Tris-HCl (pH 7) with a linear gradient of 0-100 mM NaCl In Q Sepharose. Collect fractions and use Centricon filter (Amico Concentrate by ultrafiltration using n). C.EPO-b2m Exchange of fusion protein with native b2m on virus surface.   To determine b2 exchange, purified EPO-b2m fusion protein was purified by the chloramine T method (Hu nter, W.M., (1973), Handbook of Experimental Immunology, Weir, D.M. well, Oxford), Vol. 1, pp. 17.1-17.36), or using the Bolton-Hunter reagent (Bo lton and Hunter Biochem. J. 133: 529-539, 1973). Previous 10^Threecpm / ng specific activity, the latter method being 2-5 x 10^Fouryields cpm / ng . Briefly, contains 1 mg / ml gelatin and 50 μg / ml puromycin 5x10 in 1 ml RPMI medium^FiveHT1080 cells were incubated at 37 ° C with 20ug of labeled b2m for 4 hours. Incubate for hours. Wash cells three times with Hanks buffered saline (HBSS) And lysing the final cell pellet using a lysis buffer commonly used for immunoprecipitation You. The immunoprecipitation reaction is an epitope present in both native and denatured b2m. A BBM-1 monoclonal antibody is used against the strain. After immunoprecipitation of labeled cells, radiation Detect active label. This is because the labeled b2m binds natively to these cells. Indicates that the b2m was replaced.   The purified EPO-b2m fusion protein was combined with b2m present on the vector surface as described above. Exchange. Following the exchange reaction, the "exchanged" vector is Test for targeting to expressing cells (as described in Example 4D). Amicon filtration The vector is purified from contaminants using excess (300 k molecular weight cutoff). D.EPO Targeting to the receptor.   1x10 in 4 wells of 2 6-well dishes^FiveNIH 3T3-EPOR cells Or set up NIH 3T3 cells (without EPO receptor). Then, c (1) βgal vector produced in amphotropic packaging cell line DA, (2 ) (3) produced as in (1) but after the exchange of the EPO-b2m fusion protein, (3 ) Βgal vector produced in packaging cell line 293E, (4) Dew. Half of the cells are stained for βgal production. The other half is 600 μg / ml Subject to 10 days of treatment with neticin and count viable cells (Irwin et al., 1994).   From the foregoing description, certain embodiments of the present invention are described herein for purposes of illustration. Nevertheless, various modifications may be made without departing from the spirit and scope of the invention. It is clear that this can be done indefinitely. Therefore, the present invention is defined by the appended claims. Is not limited.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 14/805 C07K 14/805 19/00 19/00 C12N 5/10 C12N 5/00 B (81) designation Country EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), CA, JP (72) Inventor Moore, Margaret Dee. United States of America 92117, San Diego, Jennifer Street 3616 (72) Inventor Chan, Stephen M. W. California USA 92064, Poway, Camino del Vale 12912

Claims (1)

[Claims] 1. A fusion tag comprising a non-virally encoded cell membrane molecule and a targeting ligand. Protein. 2. A fusion protein comprising an MHC class I molecule and a targeting ligand. 3. A fusion protein comprising an MHC class II molecule and a targeting ligand. 4. A fusion protein comprising β2 microglobulin and a targeting ligand. 5. The targeting ligand according to any one of claims 1 to 3, wherein the targeting ligand is an antibody variable region. A fusion protein as described. 6. A fusion tag comprising an MHC class I molecule and one member of a high affinity binding pair Protein. 7. A fusion tag comprising an MHC class II molecule and one member of a high affinity binding pair Protein. 8. Fusion comprising β2 microglobulin and one member of a high affinity binding pair protein. 9. 9. The method of claim 7, wherein one member of the high affinity binding pair is avidin. A fusion protein according to any one of the preceding claims. 10. A nucleic acid molecule encoding the protein according to any one of claims 1 to 9. . 11. An expression cassette that directs the expression of the nucleic acid molecule of claim 10. 12. A host cell comprising the expression cassette according to claim 11. 13. The surface has the fusion protein according to any one of claims 1 to 5. , Gene delivery vehicle. 14． It has the fusion protein according to any one of claims 6 to 9 on its surface. , Gene delivery vehicle. 15. Replication-deficient with proteins containing heterologous MHC class II molecules on its surface Retroviral vector particles. 16. A package comprising a gag / pol expression cassette and an expression cassette according to claim 11. Packaging cell line. 17． 17. A packaging cell line and a recombinant retroviral vector according to claim 16. A vector producing cell line comprising a vector. 18. Methods for targeting gene delivery vehicles to selected cell types in warm-blooded animals 14. A method of administering the gene delivery vehicle of claim 13 to a warm-blooded animal. A method comprising: 19. Methods for targeting gene delivery vehicles to selected cell types in warm-blooded animals The method comprises the following steps: (a) administering the gene delivery vehicle of claim 14 to a warm-blooded animal; and (b) linking the targeting element bound to the second member of the high affinity binding pair to the warm-blooded animal Administering the bound targeting element to the selection in the warm-blooded animal. Wherein the second member is capable of binding specifically to the cell type And the gene delivery vehicle can thus specifically bind to the selected cells. A method comprising the step of being targeted to a mold.