JP2000270871A - Production of new physiologically active peptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a physiologically active peptide without the effect of protease by cleaving an amino group-side peptide bond of a cysteine residue of a fused protein obtained by linking a specific peptide to the N-terminus of a protein having cysteine at N-terminus. SOLUTION: This physiologically active peptide containing the amino acid sequence shown by the formula is obtained in a large amount without being hydrolyzed by the action of protease in the expressing microorganism cell by cleaving an amino group-side peptide bond of a cysteine residue of a fused protein or peptide obtained by linking a peptide having (substantially) the same amino acid sequence shown by the formula to the N-terminus of a protein or peptide having cysteine at the N-terminus, or by expressing a fused protein or peptide by culturing a transformant carrying a vector having a gene coding for the fused protein or peptide, followed by cleaving an amino group-side peptide bond of a cysteine residue of the expressed fused protein or peptide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for producing a fusion protein or polypeptide (hereinafter sometimes referred to simply as the fusion protein of the present invention), and then subjecting the fusion protein or polypeptide to a peptide bond cleavage reaction. By
A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 (hereinafter, referred to as “
Or simply referred to as the peptide of the present invention) or a salt thereof.

[0002]

2. Description of the Related Art In order to obtain a large amount of a physiologically active peptide, many attempts have been made to incorporate a gene encoding a target peptide into a vector using a gene recombination technique and to express the gene by transforming it into a microorganism. ing.

[0003]

However, peptides are susceptible to degradation by the action of proteases in the cells of the expressing bacteria, and the desired peptide is often not obtained.

Means for Solving the Problems The present inventors have enthusiastically studied a method for efficiently producing a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 or a salt thereof. Upon examination, a fusion protein or peptide in which a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 was linked to the C-terminal of the protein or peptide via methionine, Alternatively, a fusion protein or peptide in which a peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4 is linked to the N-terminus of the protein or peptide via cysteine, Is subjected to a reaction of cleaving a peptide bond, whereby the amino acid sequence is the same as the amino acid sequence represented by SEQ ID NO: 4. Properly is found to be able to efficiently produce a peptide containing substantially the same amino acid sequence, further research result, we have completed the present invention based on this.

That is, the present invention relates to (1) a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 at the N-terminal of a protein or peptide having a cysteine at the N-terminal. Is subjected to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue, wherein the fusion protein or peptide is linked to the amino acid sequence represented by SEQ ID NO: 4. (2) a peptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4 at the N-terminus of a protein or peptide having a cysteine at the N-terminus A transformant carrying a vector having a gene encoding a fusion protein or peptide linked to To express the protein or peptide,
An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4, wherein the expressed fusion protein or peptide is subjected to a cleavage reaction of a peptide bond on the amino group side of a cysteine residue. (3) wherein the cleavage of the peptide bond on the amino group side of the cysteine residue is an S-cyanation reaction and a hydrolysis reaction following the reaction (1) or (2). (4) A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4 is identical to or identical to the amino acid sequence represented by SEQ ID NO: 1, 2 or 3. The method according to the above (1) or (2), which is a peptide containing substantially the same amino acid sequence; (5) a protein or a peptide having methionine at the C-terminus; Cleavage of a peptide bond at the carboxyl side of a methionine residue with a fusion protein or peptide having a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 at the C-terminus A method for producing a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 or a salt thereof, (6) a protein having a methionine at the C-terminus, A transformant carrying a fusion protein or a peptide-encoding vector in which a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the C-terminus of the peptide To express the fusion protein or peptide, and express the fusion protein or peptide A method for producing a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof, which is subjected to a cleavage reaction of a peptide bond on the carboxyl group side of a nin residue. (7) The method according to the above (5) or (6), wherein cyanogen bromide is used for a cleavage reaction of a peptide bond on the carboxyl group side of a methionine residue, and (8) a sequence represented by SEQ ID NO: 4. The peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, 5, or 6 is a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, 5 or 6. (5) The production method according to (6), (9) a protein or a protein having a methine at the C-terminus or a cysteine at the N-terminus of a protein or peptide having a methionine at the C-terminus. A fusion protein or peptide or a salt thereof in which a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the N-terminus of white matter or a peptide, or (10) the above (9) And (11) a transformant containing the vector described in (10) above.

[0005] In the present specification, "substantially the same" means that the activity of a protein, for example, the agonist activity for a receptor, ie, the activity of activating a receptor possessed by a ligand, the binding activity of a ligand to a receptor, etc., is substantially the same. Mean the same thing. Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the peptide, in which case the substituted, deleted, added or inserted peptide is Would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic)
Amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. Examples of polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of (basic) amino acids having a positive charge include arginine, lysine, histidine and the like. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid. The peptide of the present invention is a peptide having a binding ability to a galanin receptor. Preferably, it is a known ligand peptide other than galanin which has an activating effect on a galanin receptor. The galanin receptor is as described below.

The peptide of the present invention includes, for example, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4 (eg, SEQ ID NO: 7, etc.)
, Specifically, (I) SEQ ID NO: 4
Containing the same or substantially the same amino acid sequence as the amino acid sequence represented by (for example, SEQ ID NO: 7, etc.), and SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO:
A peptide having an ability to bind to a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 10 (preferably the ability to activate the receptor protein, etc.);
0 to 10000, (II)
I) The peptide described in (I) having a molecular weight of 5,000 to 8,000, and the like. It should be noted that the peptide of the present invention is a protein or peptide having a cysteine at the N-terminal.
When the peptide of the present invention is produced from a fusion protein in which the peptide of the present invention is linked to the terminal, the peptide of the present invention does not include cysteine in the constituent amino acids. When the peptide of the present invention is produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide, the peptide of the present invention contains methionine as its constituent amino acid. Means nothing.

More specifically, as the peptide of the present invention,
N of a protein or peptide having a cysteine at the N-terminus
When produced from a fusion protein in which the peptide of the present invention is linked to the terminal, for example, SEQ ID NO: 1, SEQ ID NO:
2 or a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, and the peptide of the present invention is linked to the C-terminal of a protein or peptide having a methionine at the C-terminal. When the fusion protein is produced from the fused protein, for example, a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: 6, etc. can give. Although the origin of the peptide of the present invention is not particularly limited, for example, tissues (eg, pituitary gland, pancreas, brain, etc.) of humans and warm-blooded animals (eg, guinea pig, rat, mouse, pig, sheep, cow, monkey, etc.) Kidneys, liver, gonads, thyroid, gallbladder, bone marrow,
It may be a peptide derived from the adrenal gland, skin, muscle, lung, digestive tract, blood vessel, heart, testis, etc.) or cells (eg, mouse brain, rat brain, pig brain, bovine brain, pig hypothalamus, bovine hypothalamus) It is preferably derived from the hypothalamus, pig lung, bovine lung, bovine stomach, human hypothalamus, porcine testis, bovine testis, rat testis, human testis or human lung), or a synthetic peptide.

For example, the peptides of the present invention include SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5 or SEQ ID NO: 6 (preferably,
N of a protein or peptide having a cysteine at the N-terminus
SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 when produced from a fusion protein in which the peptide of the present invention is linked to the terminal; the present invention is applied to the C-terminal of a protein or peptide having a methionine at the C-terminal. When the peptide of SEQ ID NO: 1 is produced from a linked fusion protein, in addition to the peptide containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: 6), SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5 or SEQ ID NO: 6 (preferably, when produced from a protein having a cysteine at the N-terminus or a fusion protein in which the peptide of the present invention is linked to the N-terminus of the peptide, SEQ ID NO: 1 and SEQ ID NO: 2 Or SEQ ID NO: 3;
When produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide, the amino acid represented by SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: 6) Sequence and about 50-
99.9% (preferably 70 to 99.9%, more preferably 80 to 99.9%, and still more preferably 90 to 99.9%.
9%, most preferably 95 to 99.9%).
Excluding the sequence of galanin or its precursor represented by 1, 12, or 13).

"Substantially the same activity" includes, for example, an activity of binding to the galanin receptor GALR1, GALR2 or GALR3, a galanin receptor GALR1, GALR2 or GA
LR3 activating activity or associated arachidonic acid release, intracellular Ca ²⁺ release, inhibition of intracellular cAMP production, inositol phosphate production (inhibition), fluctuation of cell membrane potential, phosphorylation of intracellular protein, intracellular Shows homogeneity in the ability to activate signal transduction system such as pH change. Therefore, quantitative factors such as the intensity of these activities and the molecular weight of the peptide may be different.

Specific examples of the peptide of the present invention include the following (provided that SEQ ID NOs: 7, 8,
Galanin having an amino acid sequence represented by 9 or 10 or a precursor thereof). (I) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 (preferably, a protein or peptide having a cysteine at the N-terminus When the peptide of the invention is produced from a linked fusion protein, SEQ ID NO: 1, SEQ ID NO:
2 or SEQ ID NO: 3; SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: when produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide : A mouse brain, a rat brain, a pig brain, a bovine brain, a pig hypothalamus, a bovine hypothalamus, containing an amino acid sequence represented by an amino acid sequence identical or substantially identical to the amino acid sequence represented by 6) or a partial sequence thereof; A peptide derived from pig lung, bovine lung, bovine stomach, human hypothalamus, pig testis, bovine testis, rat testis, human testis or human lung.

(II) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 (preferably, N-terminal of a protein or peptide having a cysteine at the N-terminal) When produced from a fusion protein having a peptide of the present invention linked to the terminus, SEQ ID NO:
1, SEQ ID NO: 2 or SEQ ID NO: 3; when produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide, SEQ ID NO: 1, SEQ ID NO: : 5 or SEQ ID NO:
6) when one or more amino acids are substituted, deleted, added or inserted into a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by the above or a partial sequence thereof or a partial peptide thereof; Peptides containing the same amino acid sequence are mentioned as peptides containing substantially the same amino acid sequence.
For example, (1) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO:
6 (preferably, when produced from a protein having a cysteine at the N-terminus or a fusion protein in which the peptide of the present invention is linked to the N-terminus of the peptide, SEQ ID NO: 1;
SEQ ID NO: 2 or SEQ ID NO: 3; when produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide, SEQ ID NO: 1 and SEQ ID NO: 5 Or SEQ ID NO: 6)
1 in the amino acid sequence represented by
Amino acid sequence in which at least 1 and at most 7, preferably at least 1 and at most 5, and more preferably at least 1 and at most 3 amino acids have been deleted, (2) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 , SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO:
6 (preferably, when produced from a protein having a cysteine at the N-terminus or a fusion protein in which the peptide of the present invention is linked to the N-terminus of the peptide, SEQ ID NO: 1;
SEQ ID NO: 2 or SEQ ID NO: 3; when produced from a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide, SEQ ID NO: 1 and SEQ ID NO: 5 Or SEQ ID NO: 6)
An amino acid sequence in which 1 to 20 amino acids, preferably 1 to 15 amino acids, more preferably 1 to 10 amino acids have been added (or inserted) to the amino acid sequence represented by or a partial sequence thereof, 3) SEQ ID NO:
1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 (preferably, the peptide of the present invention is linked to the N-terminal of a protein or peptide having a cysteine at the N-terminal. SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 from a fusion protein in which the peptide of the present invention is linked to the C-terminus of a protein or peptide having a methionine at the C-terminus. When manufactured, SEQ ID NO: 1, SEQ ID NO:
5 or 1 to 7 or less, preferably 1 or less in the amino acid sequence represented by SEQ ID NO: 6) or a partial sequence thereof.
Peptides containing an amino acid sequence in which at least 5 and at most 5, more preferably at least 1 and at most 3 amino acids have been replaced with other amino acids.

The "substantially the same amino acid sequence" is 70 to 99.9%, more preferably 80%,
Amino acid sequences having a homology of ９９99.9%, more preferably 90-99.9%, and most preferably 95-99.9%. The molecular weight of the peptide of the present invention is about 50 when measured by gel filtration chromatography or the like.
00 to about 10,000 daltons, preferably about 5000 to
About 8000 daltons, more preferably about 5500 to about 8
000 daltons, more preferably about 6000 to about 70
00 Dalton.

In the present invention, as the galanin receptor, a human or a warm-blooded animal (eg, a mammal warm-blooded animal (eg,
Rabbits, sheep, goats, rats, mice, guinea pigs,
Cattle, horses, pigs), birds (eg, chickens, pigeons, ducks, geese, quail), etc.) (eg, pituitary, pancreas, brain, kidney, liver, gonads, thyroid,
Gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract, blood vessels,
A G protein-coupled receptor protein derived from a heart or the like) or a cell, wherein GALR1 is SEQ ID NO: 8, GALR2 is SEQ ID NO: 9, GALR3
May be any as long as it contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10. That is, as the receptor protein, in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 8, 9 or 10, and the amino acid sequence represented by SEQ ID NO: 8, 9 or 10 and about 90 to 99.9 And a protein having an amino acid sequence having a homology of% and having substantially the same activity as a protein having an amino acid sequence represented by SEQ ID NO: 8, 9 or 10. The activity exhibited by these proteins includes, for example, ligand binding activity, signal transduction activity and the like. Substantially the same indicates that their activities are the same in nature. Therefore, quantitative factors such as strength of ligand binding activity and signal transduction activity and molecular weight of receptor protein may be different.

Further, the receptor protein may be one wherein the N-terminal Met is protected by a protecting group (for example, a C _1-6 alkanoyl group such as a formyl group or an acetyl group);
N-terminal glutamine residue obtained by pyroglutamine oxidation wherein the side chain of the amino acid in the molecule is a suitable protecting group (for example, C _1-6 alkanoyl group such as formyl group, acetyl group, etc.)
Or a complex protein such as a so-called glycoprotein to which a sugar chain is bound. Examples of the salt of the receptor protein include those similar to the salts of the following peptides. The receptor protein or a salt thereof or a partial peptide thereof can be produced from a human or warm-blooded animal tissue or cell by a protein purification method known per se, or a DNA encoding the aforementioned peptide.
Can also be produced by the same method as that for culturing a transformant containing. Further, it can be produced according to the above-mentioned peptide synthesis method.

In the present specification, the peptide has the N-terminus (amino terminus) at the left end and the C-terminus at the right end according to the convention of peptide labeling.
Terminal (carboxyl terminal). SEQ ID NO: C-terminus of the peptide represented by 1, a carboxyl group (-COOH), a carboxylate (-COO ^-), amide (-CONH _2), met alkylamide (-CONHR) or an ester (-COOR) You may. Examples of R in the ester or alkylamide include a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, phenyl, α-naphthyl C _6-12 aryl groups such as benzyl, phenethyl, phenyl-C such as benzhydryl
_1-2 alkyl or α- such as α-naphthylmethyl
In addition to C _7-14 aralkyl groups such as naphthyl-C _1-2 alkyl and the like, pivaloyloxymethyl groups widely used as oral esters and the like can be mentioned. As a salt of the peptide of the present invention, a salt with a physiologically acceptable base (eg, an alkali metal or the like) or an acid (organic acid, inorganic acid) is used, and particularly, a physiologically acceptable acid addition salt is used. preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The protein or peptide having a methionine at the C-terminus or the protein or peptide having a cysteine at the N-terminus used in the method of the present invention is not limited to a specific protein or peptide. In the case of a protein or peptide having no methionine at the C-terminal, methionine may be added at the C-terminal by a method known per se. Also,
In the case of a protein or peptide having no cysteine at the N-terminus, cysteine may be incorporated at the N-terminus by a method known per se. The protein or peptide having a methionine at the C-terminus or the protein or peptide having a cysteine at the N-terminus has a molecular weight of 10
Those having a molecular weight of 0 to 100,000 are preferable, and those having a molecular weight of 300 to 50,000 are more preferable. The protein or peptide having a methionine at the C-terminus or the protein or peptide having a cysteine at the N-terminus is preferably one having 1 to 1000 amino acids, more preferably one having 3 to 500 amino acids. Examples of the protein or peptide include various growth factors such as interferons, interleukins, fibroblast growth factors (aFGF, bFGF, etc.), (pro) urokinases, lymphotoxin, Tumor Necrosisf
actor (TNF), enzyme proteins such as β-galatosidase, storage proteins, streptavicin, protein A, protein G, Tissue Plasminogen Activator
(TPA), thioredoxin (Trx), glutathione -S-tran
sferase (GST), chitinase's chitin-binding domain (C
BD), maltose binding protein, xylanase and cellulas
e cellulose-binding domains (CBDs), histidine 6
Peptide, biotin acceptor pe containing up to 10
ptide (BAP) and the like. Examples thereof include those having a cysteine at the N-terminus or those having a methionine at the C-terminus, such as these muteins or a part thereof (fragment). Among them, fibroblast growth factor (aFGF,
bFGF, etc.) or its mutein or a part (fragment) thereof (eg, bFGF CS23 mutein, etc.)
Those having a cysteine at the N-terminus or those having a methionine at the C-terminus are preferably used.

The bFGF CS23 mutein includes, for example, Pro-Ala-Leu-Pro-Glu-Asp-Gly-Gly-Ser-Gly-Ala-
Phe-Pro-Pro-Gly-His-Phe-Lys-Asp-Pro-Lys-Arg-Leu-Ty
r-Cys-Lys-Asn-Gly-Gly-Phe-Phe-Leu-Arg-Ile-His-Pro-
Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-Glu-Lys-Ser-Asp-Pr
o-His-Ile-Lys-Leu-Gln-Leu-Gln-Ala-Glu-Glu-Arg-Gly-
Val-Val-Ser-Ile-Lys-Gly-Val-Ser-Ala-Asn-Arg-Tyr-Le
u-Ala-Met-Lys-Glu-Asp-Gly-Arg-Leu-Leu-Ala-Ser-Lys-
Ser-Val-Thr-Asp-Glu-Cys-Phe-Phe-Phe-Glu-Arg-Leu-Gl
u-Ser-Asn-Asn-Tyr-Asn-Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-
Thr-Ser-Trp-Tyr-Val-Ala-Leu-Lys-Arg-Thr-Gly-Gln-Ty
r-Lys-Leu-Gly-Ser-Lys-Thr-Gly-Pro-Gly-Gln-Lys-Ala-
Ile-Leu-Phe-Leu-Pro-Met-Ser-Ala-Lys-Ser (SEQ ID NO:
And a protein containing the amino acid sequence represented by 14). In addition, in order to facilitate the purification of the peptide of the present invention, the 76th or 14th bFGF CS23 mutein was used.
The second methionine is converted to a known site-directed mutage
Those substituted with leucine or isoleucine by a method such as nesis may be used.

A fusion protein (including a fusion peptide) in which the peptide of the present invention is linked to the C-terminal of a protein or peptide having a methionine at the C-terminus used in the method of the present invention.
The gene encoding (1) may be obtained by chemically synthesizing (1) the entire nucleotide sequence, or (2) placing a methionine encoding nucleotide sequence at the C-terminal side of the protein encoding nucleotide sequence, The gene may be constructed by placing a nucleotide sequence encoding the peptide of the present invention on the C-terminal side. Also, (3) when the purpose is to obtain a fragment of the peptide, the gene may be constructed by replacing the amino acid residue immediately before the desired fragment with methionine by a technique such as site-directed mutagenesis.

A fusion protein (including a fusion peptide) in which the peptide of the present invention is linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus used in the method of the present invention.
The gene encoding (1) may be obtained by chemically synthesizing (1) the entire nucleotide sequence, or (2) locating a nucleotide sequence encoding cysteine on the N-terminal side of the nucleotide sequence encoding the protein, and The gene may be constructed by placing a nucleotide sequence encoding the peptide of the present invention on the N-terminal side. (3) -If the purpose is to obtain a fragment of the peptide, the gene may be constructed by replacing the amino acid residue immediately before the desired fragment with cysteine by a technique such as site-directed mutagenesis. above
As the production method in the case of (1)-or (1)-, for example, a known method such as a phosphoramidite method, a phosphoric acid triester method, a diester method, or a hydrogen phosphonate method may be used. It can be prepared by dividing and synthesizing and then ligating using T4 DNA ligase. As the production method in the case of the above (2)-, for example, the gene encoding the N-terminal protein is obtained by cutting the chromosome with an appropriate restriction enzyme and ligating it to a vector, or obtaining cDNA. . Thereafter, the C-terminus is cleaved with a restriction enzyme so that it becomes methionine, or the synthetic DNA is modified so that the C-terminus becomes methionine by binding to the 3′-end of the whole protein or a part of the gene. A method in which a gene encoding a target protein (either chemically synthesized or cloned from a living body) may be linked to the 3'-terminal. As the production method in the case of the above (2)-, for example, a gene encoding a protein at the C-terminal side is obtained by cutting the chromosome with an appropriate restriction enzyme and ligating it to a vector, or obtaining cDNA. . Thereafter, the N-terminus is cleaved with a restriction enzyme so as to become cysteine, or the synthetic DNA is modified so that the N-terminus becomes cysteine by binding to the 5′-end of the entire protein or a part of the gene. A method of linking a gene encoding a target protein (either chemically synthesized or cloned from a living body) to the 5′-end thereof may be used.

Specific examples of the thus obtained protein encoding a protein having a methionine at the C-terminus or a fusion protein in which the peptide of the present invention is linked to the C-terminus of the peptide include, for example, the formula R-ATG-GCTCCGGTCC ACAGGGGGCG AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGC ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC (I) (SEQ ID NO: 15) [wherein, R CCAGCATTGCCCGAGGATGGCGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCC AAGCGGCTGTACTGCAAAAACGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTT GACGGGGTCCGGGAGAAGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGA GGAGTTGTGTCTATCAAAGGAGTGAGCGCTAATCGTTACCTGGCTATGAAGGAAGATGGA AGATTACTAGCTTCTAAGTCTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCT AATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGA ACTGGGCAGTATAAACTTGGATCT (fragments of hbFGF mutein CS23; SEQ ID NO: 1 6) Base sequence consisting of Indicates a column. ], Etc.]. Specific examples of the gene encoding the fusion protein in which the peptide of the present invention is linked to the N-terminal of the protein or peptide having a cysteine at the N-terminus obtained as described above include, for example, the formula GCTCCGGTCC ACAGGGGGCG AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGC ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC-TGC or the TGT-R (II) (SEQ ID NO: 17, SEQ ID NO: 18) wherein, R represents a fragment of CCAGCATTGCCCGAGGATGGCGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCC AAGCGGCTGTACTGCAAAAACGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTT GACGGGGTCCGGGAGAAGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGA GGAGTTGTGTCTATCAAAGGAGTGAGCGCTAATCGTTACCTGGCTATGAAGGAAGATGGA AGATTACTAGCTTCTAAGTCTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCT AATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGA ACTGGGCAGTATAAACTTGGATCT (hbFGF mutein CS23 ; Distribution Number: This shows the base sequence consisting of 1 6). ], Etc.]. The above formula (I) indicates that the DNA sequence (SEQ ID NO: 19) encoding the peptide of the present invention is linked to the nucleotide sequence of the protein or peptide represented by R through the nucleotide sequence encoding methionine. Show. The above formula (II) indicates that the nucleotide sequence encoding cysteine is bonded to the nucleotide sequence of the protein or peptide represented by R based on the DNA nucleotide sequence encoding the peptide of the present invention (SEQ ID NO: 19). Show.

As specific examples of the fusion protein or peptide of the present invention in which the peptide of the present invention is linked to the C-terminal of the protein or peptide having a methionine at the C-terminus, or the above-mentioned protein or peptide having a methionine at the C-terminal Any fusion protein may be used as long as it is a fusion protein in which a peptide containing the amino acid sequence represented by SEQ ID NO: 4 is linked to the C-terminus. Fusion protein encoded by the gene (SEQ ID NO: 44; Pro-Ala-Leu-Pro-Glu-Asp-Gl
y-Gly-Ser-Gly-Ala-Phe-Pro-Pro-Gly-His-Phe-Lys-Asp-
Pro-Lys-Arg-Leu-Tyr-Cys-Lys-Asn-Gly-Gly-Phe-Phe-Le
u-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp-Gly-Val-Arg-
Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-Gln-Leu-Gln-Al
a-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys-Gly-Val-Ser-
Ala-Asn-Arg-Tyr-Leu-Ala-Met-Lys-Glu-Asp-Gly-Arg-Le
u-Leu-Ala-Ser-Lys-Ser-Val-Thr-Asp-Glu-Cys-Phe-Phe-
Phe-Glu-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-Asn-Thr-Tyr-Ar
g-Ser-Arg-Lys-Tyr-Thr-Ser-Trp-Tyr-Val-Ala-Leu-Lys-
Arg-Thr-Gly-Gln-Tyr-Lys-Leu-Gly-Ser-Met-Ala-Pro-Va
l-His-Arg-Gly-Arg-Gly-Gly-Trp-Thr-Leu-Asn-Ser-Ala-
Gly-Tyr-Leu-Leu-Gly-Pro-Val-Leu-His-Pro-Pro-Ser-Ar
g-Ala-Glu-Gly-Gly-Gly-Lys-Gly-Lys-Thr-Ala-Leu-Gly-
Ile-Leu-Asp-Leu-Trp-Lys-Ala-Ile-Asp-Gly-Leu-Pro-Ty
r-Pro-Gln-Ser-Gln-Leu-Ala-Ser) and the like.

Specific examples of the fusion protein or peptide of the present invention in which the peptide of the present invention is linked to the N-terminal of the protein or peptide having a cysteine at the N-terminus, or the above-mentioned protein or peptide having a cysteine at the N-terminal Any fusion protein may be used as long as it is a fusion protein in which a peptide containing the amino acid sequence represented by SEQ ID NO: 4 is linked to the N-terminus of SEQ ID NO: 4. Specifically, any of the above-mentioned SEQ ID NO: 17 or SEQ ID NO: Fusion protein encoded by the gene represented by SEQ ID NO: 18 (SEQ ID NO: 45; Ala-Pro
-Val-His-Arg-Gly-Arg-Gly-Gly-Trp-Thr-Leu-Asn-Ser-A
la-Gly-Tyr-Leu-Leu-Gly-Pro-Val-Leu-His-Pro-Pro-Ser
-Arg-Ala-Glu-Gly-Gly-Gly-Lys-Gly-Lys-Thr-Ala-Leu-G
ly-Ile-Leu-Asp-Leu-Trp-Lys-Ala-Ile-Asp-Gly-Leu-Pro
-Tyr-Pro-Gln-Ser-Gln-Leu-Ala-Ser-Cys-Pro-Ala-Leu-P
ro-Glu-Asp-Gly-Gly-Ser-Gly-Ala-Phe-Pro-Pro-Gly-His
-Phe-Lys-Asp-Pro-Lys-Arg-Leu-Tyr-Cys-Lys-Asn-Gly-G
ly-Phe-Phe-Leu-Arg-Ile-His-Pro-Asp-Gly-Arg-Val-Asp
-Gly-Val-Arg-Glu-Lys-Ser-Asp-Pro-His-Ile-Lys-Leu-G
ln-Leu-Gln-Ala-Glu-Glu-Arg-Gly-Val-Val-Ser-Ile-Lys
-Gly-Val-Ser-Ala-Asn-Arg-Tyr-Leu-Ala-Met-Lys-Glu-A
sp-Gly-Arg-Leu-Leu-Ala-Ser-Lys-Ser-Val-Thr-Asp-Glu
-Cys-Phe-Phe-Phe-Glu-Arg-Leu-Glu-Ser-Asn-Asn-Tyr-A
sn-Thr-Tyr-Arg-Ser-Arg-Lys-Tyr-Thr-Ser-Trp-Tyr-Val
-Ala-Leu-Lys-Arg-Thr-Gly-Gln-Tyr-Lys-Leu-Gly-Ser)
And so on. Examples of the “salt” of the above-mentioned fusion protein or peptide or a salt thereof include those similar to the above. A DNA (plasmid) having an ATG at the 5 'end and a region encoding the fusion protein downstream thereof, and a translation stop codon, is a cDNA of the known protein produced by chemical synthesis or genetic engineering. Alternatively, it can be produced by processing the DNA of the protein derived from the chromosome. A fusion protein or a peptide of the present invention having a methionine at the C-terminus and a peptide of the present invention linked to the C-terminus of the protein or peptide or a fusion protein of a protein or peptide having a cysteine at the N-terminus and N-terminal of the protein or peptide Alternatively, a gene encoding a peptide can be converted to a gene encoding a mutein of interest using conventional DNA techniques, for example, site-directed mutagenesis techniques. Site-directed mutagenesis techniques are well known and are available from R.F.
(Lather, RF) and J.P. Lecoq (lecoq, J.
P.), Genetic Eng
ineering), Academic Press (1983) 31
It is shown on page -50. Oligonucleotide-directed mutagenesis is described in M. Smith and M. Gillam, S., Genetic Engineering: Principles and Methods, Plenum Plums (1981), Volume 3.
It is shown on pages 1-32.

D having a region encoding the fusion protein
In producing a plasmid having NA, for example, pBR322 [Gene (Gen) derived from Escherichia coli] may be used as a vector.
e), 2 , 95 (1977)], pBR313 [Gene,
2 , 75 (1977)], pBR324, pBR325 [Gene, 4 , 124 (1978)], pBR327, pBR3
28 [Gene, 9 , 287 (1980)], pBR329
[Gene, 17 , 79 (1982)], pKY2289
[Gene, 3 , 1 (1978)], pKY 2700 [Biochemistry, 52 , 770 (1980)], pACYC177, pA
CYC184 [Journal of Bacteriology (J
ournal of Bacteriology), 134 , 1141 (197
8)], pRK248, pRK646, pDF [Methods in Enzymology,
68 , 268 (1979)], pUC18, pUC19 [Yanishuperon et al., Gene, 33 , 103 (19).
85)]. Also, a bacteriophage such as a λgt-based λgt · λC
[Proc. Nat. Acad. Sci. U.S.A. 71 , 4579 (1
974)], λgt · λB [Proc. Nat. Acad. Sci.
A. 72 , 3461 (1975)], λ Dam [Gene,
1 , 255 (1977)] and Sharon Vector [Science, 196 , 161 (1977); Journal of Virology, 2
9 , 555 (1979)], mp using filamentous phage.
Mp18, mp19 [Yanishuperon et al., Gene (Gen)
e), 33 , 103 (1985)]. The DNA preferably has a promoter upstream of ATG, and the promoter may be any promoter as long as it is appropriate for the host used for the production of the transformant. For example, Escherichia c
oli), the trp promoter, lac promoter, rec A promoter, λPL promoter, lpp promoter,
In Bacillus subtilis such as T7 promoter, SPO1 promoter, SPO2 promoter, pen
Yeast (Saccharomyces cerevisiae) such as P promoter
In the PHO5 promoter, PGK promoter, GA
SV40-derived promoters in animal cells such as the P promoter and the ADH promoter. If necessary, an SD (Shine and Dalgarno) sequence may be inserted downstream of the promoter.

When using the T7 promoter system,
As a T7 promoter, it is found on T7 DNA.
17 promoters [J. L. Oakley et al., Pro
c. Natl. Acad. Sci, USA,7 4: 4266-42
70 (1977), M. D. Rosa, Cell16: 815-82
5 (1979), N. Panayotatos et al., Nature,280:
35 (1979), J. J. Dunn et al., J. Mol. Biol.,16
6: 477-535 (1983)].
10 promoter [A. H. Rosenberg et al., Gene,56:
125-135 (1987)]. Transcription terminator
The terminator that operates in the E. coli system
-, Preferably a Tφ terminator [FW Studier
Et al., J. Mol. Biol.,189: 113-130 (198)
6)] is used. T7 RNA polymerase gene and
The T7 gene [F. W. Studier et al., J. Mol. Bio
l. ，189: 113-130 (1986)]
Can be done. The vector is a T7 promoter
-, It is preferable to construct by incorporating T7 terminator.
More preferably, such vectors include pET-1, pE
T-2, pET-3, pET-4, pET-5 [A. H. Ro
senberg, Gene56: 125-135 (1987)]
Can be given. The transformant of the present invention comprises
A plasmid for expression obtained by the method is known per se (e.g.,
Cohen S, N, et al, The Prossing of National
・ Academy of Science (Pro. Natl. Acad. Sc
i. U.S.A.),69, 2110 (1972)].
It can be produced by transformation. Transformation
As the host of the microorganism to be exchanged, for example, Escherichia
(Escherichia), Bacillus, yeast,
Animal cells and the like. Examples of the genus Escherichia
Examples include Escherichia coli (E. coli),
Specifically, Escherichia coli K1
2DH1 [Proceedings of National A
Academy of Sciences (Proc. Natl. Acad. Sci.
 U.S.A.),60, 160 (1968)], JM-10.
3 [Nucleic Acids Research, (Nucleic Aci
ds Research),9, 309 (1981)], JA221.
[Journal of Molecular Biology (Jou
rnal of Molecular Biology),120, 517 (197
8)], HB101 [Journal of Molecular
-Biology,41, 459 (1969)], C60
0 [Genetics,39, 440 (19
54)], N4830 [Cell,25, 713 (19
81)], K-12MM294 [Proceedings
Of National Academy of Sciences,
73, 4174 (1976)] BL-21 and the like.
You. Examples of the Bacillus genus include Bacillus sachi
Lus (Bacillus subtilis)
Russ Sutilus MI114 (Gene,24, 255 (19
83)), 207-21 [Journal of Biochem.
Street (Journal of Biochemistry),95, 87 (19
84)]. As the above yeast, for example,
Saccharomyces cerev
isiae), specifically, Saccharomyces
Leviciae AH22 [Proc. Natl. Acid. Sci. US
A,75, 1929 (1978)], XSB5 2-23
C [Proc. Natl. Acid. Sci. USA,77 2173
(1980)], BH-641A (ATCC 2833
9), 20B-12 [Genetics,85, 23 (1976)],
GM3C-2 [Proc. Natl. Acid. Sci. USA,78
 2258 (1981)]. With animal cells
For example, monkey cells COS-7 [Cell,2
3, 175 (1981)], Vero [(Japanese clinical practice)21, 1
209 (1963)], Chinese Hamster Cell CH
O [Journal of Experimental Medicine
(J. Exp. Med.),108, 945 (1985)], Mau
L cells [Journal of National Cancer
・ Institute (J. Nat. Cancer Inst.),4, 1
65 (1943)], human FL cells [Proceedings
Of the Society for Experimental
・ Biology and Medicine (Proc.Sco.Etp.
Biol. Med.),94, 532 (1957)], hamster
C cells and the like.

When using the T7 promoter system,
As a host of the transformant, T7 RNA polymerase gene (T7 gene 1) [FW Studier et al., J. Mol.
iol. 189 : 113-130 (1986)], for example, MM294, DH-1, C600, J
Any of M109, BL21, or an E. coli strain in which the T7 RNA polymerase gene (T7 gene 1) has been integrated together with another plasmid may be used. MM294 in which λ phage into which T7 gene 1 has been incorporated is preferably lysogenized
Strain and BL21 strain are used. In this case, the promoter of T7 gene 1 was isopropyl-1-thio-
A lac promoter whose expression is induced by β-D-galactopyranoside (may be abbreviated as IPTG) is used. In order to transform a Bacillus genus as a host, for example, Molecular and General Genetics, 168 , 111 (197
It can be carried out according to a known method such as 9). To transform yeast as a host, for example, Proc. Natl. Ac
ad. Sci. USA, 75 , 1929 (1978). In order to transform an animal cell as a host, for example, Virology ( 52 , 456 (1)
973). The fusion protein can be produced by culturing the above-mentioned transformant in a medium and collecting the produced fusion protein. The pH of the medium is preferably about 6-8. As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of
Journals of Experiments in Molecular Genetic
s), 431-433, Cold Spring Harbor Laboratory, New Yo
rk 1972)]. Here, in order to make the promoter work efficiently if necessary, for example, 3β-indolyl
Agents such as acrylic acid and isopropyl βD-thiogalactopyranoside can be added. When the host is a bacterium belonging to the genus Escherichia, culturing is usually performed at about 15 to 43 ° C for about 3 to 2 hours.
The reaction is performed for 4 hours, and if necessary, ventilation and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, the culture is usually about 30 to
The reaction is carried out at 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast, for example, a bark holder (Bur
kholder) minimal medium [Bostian, KL et al., Processings of National Academy of Sciences (Proc. Natl. Acad. Sci.) USA, 77 , 4505 (1980)]. The pH of the medium is preferably adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and stirring are added. When culturing a transformant whose animal host is an animal cell, the medium may be, for example, a MEM medium containing about 0.2 to 20%, preferably about 5 to 20% fetal bovine serum [Science, 122 , 501].
(1952)], DME medium [Virology, 8 , 3
96 (1959)], RPMI 1640 medium [Journal of the American Medical Association (T
he Journal of the American Medical Association), 1
99 , 519 (1967)], 199 medium [Proceeding of the Society for the Biological
Medicine (Proceeding of the Society for the Biolo
gcal Medicine), 73 , 1 (1950)]. p
H is preferably about 6-8. Culture is usually about 30 ~
Incubation is performed at 40 ° C. for about 15 to 60 hours, and aeration and stirring are added as necessary. The fusion protein can be produced by culturing the transformant, producing and accumulating the fusion protein in a culture, and collecting the fusion protein.
Examples of the culture medium include M containing glucose and casamino acid.
9 medium [Miller, J., Experiments in Molecular Getics
netics), 431-433 (Cold Spring Horbor Laborat
ort, New York 1972)], 2 × YT medium [Messing,
Methods in Enzymo
, 101 , 20 (1983)] LB medium. Culture is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. λcIts
When a recombinant having a repressor and an expression vector containing a λP _L -promoter is used, culturing is performed at a temperature of about 15 to 36 ° C, preferably about 30 to 36 ° C, and the λc Its repressor is used. Is inactivated at about 37 ° C to 42 ° C.
C. is preferably performed at a temperature of. In order to make the recA promoter work more efficiently, that is, to reduce the recA gene expression suppressing function, if necessary, a drug such as mitomycin C, naldixic acid or the like is added, ultraviolet rays are irradiated, or the pH of the culture solution is adjusted to alkaline. It may be changed to the side.

When the T7 promoter system is used, (1) T7 linked downstream of the lac promoter
When expressing a gene (RNA polymerase gene)
Adding such PTG, or (2) when the expression of T7 gene linked downstream of .lambda.P _L promoter (RNA polymerase gene) such as by raising the temperature of the culture, the T7 phage RNA polymerase 1 to produce Activate the T7 promoter specifically.
After culturing, the cells are collected by a known method, suspended in a buffer, for example, and then treated with a protein denaturant, an ultrasonic treatment, an enzyme treatment such as lysozyme, a glass bead treatment, a French press treatment, a freeze-thaw treatment, or the like. To disrupt the cells, and obtain a supernatant by a known method such as centrifugation. In order to isolate the fusion protein from the supernatant obtained as described above, a generally known protein purification method may be used. For example, gel filtration, ion exchange chromatography, adsorption chromatography, high performance liquid chromatography, affinity chromatography, hydrophobic chromatography, electrophoresis and the like can be appropriately combined. Also,
The fusion protein may proceed to the next reaction step without purification or in a partially purified state.

Next, a fusion protein or peptide obtained by linking the peptide of the present invention to the C-terminus of a protein or peptide having a methionine at the C-terminus thus obtained is cleaved by a peptide bond on the carboxyl group side of a methionine residue. Attached to Further, a fusion protein or peptide obtained by linking the peptide of the present invention to the N-terminus of the protein or peptide having cysteine at the N-terminus thus obtained is subjected to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue. (I) Cleavage of a protein or peptide having a methionine at the C-terminus to a fusion protein or peptide having the peptide of the present invention linked to the C-terminus of a peptide bond on the carboxyl group side of a methionine residue: This is performed by applying cyan. The amount of the reagent may be about 3 to 400 times the amount of all methionine residues. More preferably, the amount is about 30 to 100 times. The reaction is preferably performed under acidic conditions. The acidic solvent is not particularly limited, and is about 0.01 to 0.3 N for hydrochloric acid, about 0.1 to 9 N for acetic acid,
In the case of formic acid, about 17 to 80% can be used, and in the case of trifluoroacetic acid, about 70 to 80% can be used. For example, about 50 to 80% of formic acid can be used.
The reaction temperature may be any as long as it is between about 0 and 40 ° C., and is preferably about room temperature. The reaction time may be about 4 to 48 hours, preferably about 24 to 48 hours.

(Ii) Cleavage of a fusion protein or peptide having the peptide of the present invention linked to the N-terminus of a protein or peptide having a cysteine at the N-terminus at the peptide bond on the amino group side of the cysteine residue: Is, for example, an S-cyanoation reaction followed by a hydrolysis reaction. When the amide of the peptide of the present invention or a salt thereof is obtained as the final product, the cleavage reaction includes, for example, S-cyanoation reaction followed by ammonolysis. The S-cyanoation reaction is carried out by adding
The reaction is carried out by reacting with an S-cyanation reagent. S-
Examples of the cyanating reagent include 2-nitro-5-thiocyanobenzoic acid (NTCB), 1-cyano-4-dimethylaminopyridium salt (DMAP-CN), and CN ^- ion. The amount of the S-cyanation reagent may be about 2 to 50 times the total thiol group. More preferably, the amount is about 5 to 10 times. Reaction temperature is about 0-80 ° C
And any temperature between about 0 and 50 ° C. is more preferable. As a solvent to be used, any buffer may be used as long as it does not react with the S-cyanation reagent.
For example, Tris-HCl buffer, Tris-Acetate buffer, Phosphate buffer, Borate buffer and the like can be mentioned. Also,
The organic solvent may be present as long as it does not react with the S-cyanation reagent. The reaction is preferably carried out at a pH between 1 and 12. In particular, when NTCB is used, p
When H7 to 10 and DMAP-CN are used, the pH is preferably between 2 and 7 in order to prevent the SS exchange reaction. Further, a denaturant such as guanidine hydrochloride may be present in the reaction solution. The hydrolysis reaction may be, for example, an alkali treatment. As the alkali treatment, the pH of the aqueous solution containing the starting compound is adjusted to 7-14.
The adjustment is performed in the following manner. The adjustment of the pH
For example, sodium hydroxide, ammonia, amino compounds,
A solution of trizuma base (tris [hydroxymethyl] -aminomethane), dibasic sodium phosphate, potassium hydroxide, barium hydroxide or the like is added to an aqueous solution containing the starting compound in an appropriate amount, and sodium hydroxide is particularly preferred.

The concentration of the solution in the above reaction is, for example, about 0.01 to 2N, preferably about 0.1 to 1N in the case of sodium hydroxide, and about 0.01 to 15N in the case of ammonia or an amino compound. Is about 0.1 to 3 N, and about 1 mM to 1 M, preferably about 20 m for Trizuma base.
M-200 mM, about 1 mM in the case of dibasic sodium phosphate
１1 M, preferably about 10 mM to 100 mM, in the case of potassium hydroxide about 0.01 to 4 N, preferably about 0.1 to 2 N
In the case of potassium hydroxide, about 0.01 to 0.2M, preferably about 0.1 to 0.2M can be mentioned. Reaction temperature is about -20
C. to 80.degree.
More preferably between 50 ° C. The reaction time is preferably
The S-cyanoation reaction is carried out for about 1 to 60 minutes, preferably for about 15 to 3 minutes.
0 minutes, the hydrolysis reaction is about 5 minutes to 100 hours, preferably 10 minutes to 15 hours, and the ammonolysis is about 5 minutes to 24 hours, preferably about 10 to 180 minutes. S above
It is believed that the reaction shown in FIG. 1 occurs by cyanation or hydrolysis. In FIG. 1, X is R
^1- (NR ² )-(wherein R ¹ and R ² are the same or different and are (i) hydrogen, (ii) C _1-20 alkyl, C _3-8 cycloalkyl, C _6-14 aryl (aryl ) Or C _6-14 aryl-C
_1-3 alkyl (which may have no substituent or may have 1 to 3 amino groups, hydroxyl groups, etc. on a carbon atom), (iii) optionally substituted amino, (i
v) represents a hydroxyl group or a C _1-6 alkoxy group. ) Or O
H is shown. Examples of the above C _1-20 alkyl include, for example,
Methyl, ethyl, propyl, isopropyl, butyl, se
c-butyl, pentyl, isopentyl, neopentyl, 1
-Ethylpentyl, hexyl, isohexyl, heptyl, octyl, nonanyl, decanyl, undecanyl, dodecanyl, tetradecanyl, pentadecanyl, hexadecanyl, heptadecanyl, octadecanyl, nonadecanyl and eicosanyl. Examples of the above C _3-8 cycloalkyl include, for example, cyclopropyl,
Cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl and the like can be mentioned. The above C
Examples of _6-14 aryl include phenyl, naphthyl, anthryl, phenanthryl, acenaphthylenyl and the like. Examples of the above C _6-14 aryl-C _1-3 alkyl include benzyl, phenethyl, 3-phenylpropyl, (1-naphthyl) methyl, (2-naphthyl) methyl and the like. Examples of the above C _1-6 alkoxy include:
For example, methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy and the like can be mentioned. the above
Examples of the amino substituent which may be substituted in (iii) include, for example, amino acids, peptides consisting of 2 to 10 amino acids, and the like. The above amino acids include L
Or D-form, examples of which include, for example, Al
a, Arg, Asp, Asn, Glu, Gln, Gly, His, Ile, Met, Le
u, Phe, Pro, Ser, Thr, Trp, Tyr, Val, etc. Examples of the peptide include, for example, HD-Leu-Leu-
Arg-Pro-NH-C ₂ H ₅ , H-Val-Ala-Leu-D-Ala-Ala-Pro-Leu-A
la-Pro-Arg-OH and the like.

When ammonia or an amino compound is used in the reaction, a corresponding amide is obtained. The isolated target peptide may be isolated according to a generally known peptide purification method. For example,
Gel filtration, ion exchange chromatography, high performance liquid chromatography, affinity chromatography, hydrophobic chromatography, thin layer chromatography, electrophoresis and the like can be appropriately combined. Further, the obtained peptide of the present invention can be converted into a powder by freeze-drying as necessary. For lyophilization, sorbitol, mannitol, dextrose,
Stabilizers such as maltose, trehalose and glycerol can be added. The peptide of the present invention can be used for synthesizing a part of the ligand of the galanin receptor protein, or for synthesizing the full length thereof, searching for the physiological action of the peptide of the present invention, or using a synthetic oligonucleotide probe or PC.
Preparation of R primers, acquisition of DNAs encoding G protein-coupled receptor protein ligands and precursor proteins, development of receptor binding assay system using recombinant receptor protein expression system and screening of drug candidate compounds, antibodies And availability of antiserum, DNA, R
Development of diagnostic agents using NA, antibodies or antisera, memory function improvers (cognitive enhancers), appetite regulators, antidiabetic drugs,
Pituitary function improver, uterine function regulator, kidney function regulator,
Prostate function regulator, testis function regulator or skeletal muscle function regulator (preferably, memory function improver (cognitive agent), appetite regulator, uterine function regulator, renal function regulator, prostate function regulator, testis function Regulator or skeletal muscle function regulator). Furthermore, with respect to the above, the peptide of the present invention or DN encoding the same
A is hippocampus, hypothalamus, uterus, kidney, prostate, skeletal muscle,
Galanin receptor (GALR) protein expressed in pancreas, testis, spleen, heart, pituitary gland, etc. is recognized as a ligand, so it is useful as a safe and low-toxic pharmaceutical, and for example, a memory function improving agent (Cognitive drugs), appetite regulators, antidiabetic drugs, pituitary function improvers, appetite regulators, uterine function regulators, renal function regulators, prostate function regulators or skeletal muscle function regulators (preferably memory functions) Improvers (cognitive enhancers), appetite regulators, uterine function regulators, kidney function regulators, prostate function regulators or skeletal muscle function regulators)
It can be used as such.

When the peptide of the present invention is used as the above-mentioned medicament, it can be carried out in a conventional manner. For example, a sugar-coated or enteric-coated tablet as required, a capsule, a elixir, orally as a microcapsule, or a sterile solution with water or another pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound or a salt thereof is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. Examples of additives that can be incorporated into tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Swelling agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as fats and oils can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80 (TM),
HCO-50) and the like. The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.

In addition, a buffer (for example, a phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, and are therefore suitable for humans and mammals (eg, mice, rats, guinea pigs, rabbits, sheep, pigs, cows, cats, dogs, monkeys,
Etc.). The dosage of the peptide of the present invention or a salt thereof may vary depending on the symptoms and the like. However, when the peptide is orally administered, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg per day, Preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. When the peptide is administered parenterally (for example, by intravenous injection), the single dose depends on the administration target, target organ, symptom,
For example, in the form of an injection, for an adult (with a body weight of 60 kg), it is about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day in the form of an injection. 1 to 10mg
It is about. In the case of other animals, the above dose per 60 kg can be administered in terms of the weight of the animal.

In the present specification and drawings, amino acids,
When peptides, protecting groups, active groups, etc. are indicated by abbreviations, they are referred to as IUPAC-IUB (Commission on B
Abbreviations based on iochemical nomenclature) or conventional abbreviations in the art. When amino acids and the like can have optical isomers, L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid EDTA: ethylenediaminetetraacetic acid Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thrin: Thrine : Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine For ATP and Adenosine triphosphate Substituents, protecting groups and reagents are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene-2,3
- dicarboximide Bzl: benzyl Cl ₂ -Bzl: di-chlorobenzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chloro benzyloxycarbonyl Boc: t-butyloxycarbonyl HOBt: 1 -Hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tert-butoxymethyl Trt: trityl PAM: phenylacetamidomethyl BHA: benz Hydrylamine Bom: benzyloxymethyl OcHex: cyclohexyl ester MeBzl: 4-methylbenzyl CHO: formyl NMP: N-methylpyrrolidone

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the peptide of the present invention obtained in Reference Example 6 below. [SEQ ID NO: 2] This shows the amino acid sequence of the peptide of the present invention obtained in Reference Example 7 below. [SEQ ID NO: 3] This shows the amino acid sequence of the peptide of the present invention obtained in Reference Example 7 below. [SEQ ID NO: 4] This shows the 1st to 21st amino acid sequence from the N-terminal of the amino acid sequence represented by SEQ ID NO: 2 and / or SEQ ID NO: 3. [SEQ ID NO: 5] This shows the 1-58th amino acid sequence from the N-terminal of the amino acid sequence represented by SEQ ID NO: 2. [SEQ ID NO: 6] This shows the 1-27th amino acid sequence from the N-terminal of the amino acid sequence represented by SEQ ID NO: 3. [SEQ ID NO: 7] This shows the 1st to 21st amino acid sequence from the N-terminal of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 8] This shows the amino acid sequence of GALR-1. [SEQ ID NO: 9] This shows the amino acid sequence of GALR-2. [SEQ ID NO: 10] This shows the amino acid sequence of GALR-3. [SEQ ID NO: 11] This shows the entire amino acid sequence (29 residues) of porcine galanin. [SEQ ID NO: 12] Pig-type galanin precursor preprogal
The amino acid sequence of anin (1-123) is shown. [SEQ ID NO: 13] Pig-type galanin precursor preprogal
Fig. 3 shows the amino acid sequence of anin (24-61). [SEQ ID NO: 14] This shows the amino acid sequence of bFGF CS23 mutein. [SEQ ID NO: 15] bFGF CS23 mutein fragment-
Met—A nucleotide sequence encoding a fusion protein represented by a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 16] This shows the base sequence encoding bFGF CS23 mutein fragment peptide. [SEQ ID NO: 17] This shows the base sequence encoding the fusion protein represented by the peptide-Cys-bFGFCS23 mutein fragment consisting of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 18] This shows the base sequence encoding the fusion protein represented by the peptide-Cys-bFGFCS23 mutein fragment consisting of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 19] This shows the base sequence of DNA encoding the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 20] This shows the base sequence of DNA encoding the peptide consisting of the amino acid sequence represented by SEQ ID NO: 2. [SEQ ID NO: 21] This shows the base sequence of DNA encoding the peptide consisting of the amino acid sequence represented by SEQ ID NO: 3. [SEQ ID NO: 22] This shows the base sequence of primer 1 used in Reference Example 1 described later. [SEQ ID NO: 23] This shows the base sequence of primer 2 used in Reference Example 1 described later. [SEQ ID NO: 24] This shows the amino acid sequence of the peptide analyzed in Reference Example 4 described later. [SEQ ID NO: 25] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 26] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 27] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 28] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 29] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 30] This shows the amino acid sequence of the peptide used in Reference Example 4 described later. [SEQ ID NO: 31] This shows the base sequence of a primer used in Reference Example 5 described later. [SEQ ID NO: 32] This shows the base sequence of the primer used in Reference Example 5 described later. [SEQ ID NO: 33] This shows the base sequence of a primer used in Reference Example 5 described later. [SEQ ID NO: 34] This shows the base sequence of a primer used in Reference Example 5 described later. [SEQ ID NO: 35] This shows the base sequence of the primer used in Reference Example 5 described later. [SEQ ID NO: 36] This shows the base sequence of a primer used in Reference Example 5 described later. [SEQ ID NO: 37] This shows the base sequence of a primer used in Reference Example 5 described later. [SEQ ID NO: 38] This shows the base sequence of a primer used in EXAMPLE 1, which will be described later. [SEQ ID NO: 39] This shows the base sequence of a primer used in EXAMPLE 1, which will be described later. [SEQ ID NO: 40] This shows the base sequence of the primer used in EXAMPLE 1, which will be described later. [SEQ ID NO: 41] This shows the base sequence of a primer used in EXAMPLE 1, which will be described later. [SEQ ID NO: 42] This shows the base sequence of a primer used in EXAMPLE 2, which will be described later. [SEQ ID NO: 43] This shows the base sequence of a primer used in EXAMPLE 2, which will be described later. [SEQ ID NO: 44] This shows the amino acid sequence encoded by the nucleotide sequence represented by SEQ ID NO: 15. [SEQ ID NO: 45] SEQ ID NO: 17 and SEQ ID NO: 1
The amino acid sequence encoded by the nucleotide sequence represented by 8 is shown.

The transformant Esc obtained in Reference Example 5 described later
herichia coli TOP10 / pGR2PL6 has been deposited with the Fermentation Research Institute (IFO) on August 21, 1998 as deposit number IFO 16201.
Also, the deposit number FERM BP-648 from September 4, 1998 at the Institute of Biotechnology and Industrial Technology (NIBH, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan)
Deposited as 6. The transformant Escherichia coli MM294 (DE3) / pTFCGAL obtained in Example 2 described below was deposited at the Fermentation Research Institute (IFO) on February 26, 1999 under accession number IFO 16260, and It has been deposited with the National Institute of Bioscience and Human Technology (NIBH, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan) under the deposit number FERM BP-6678 from March 10, 1999. The transformant Escherichia coli MM294 (DE
3) / pTB960-11 is provided to the Institute of Fermentation (IFO) by 199
From June 25, 2007, the deposit number was IFO 16100, and the Ministry of International Trade and Industry of Japan
BH, 1-3-1-3 Higashi, Tsukuba, Ibaraki, Japan) 1998
Deposit No. FERMBP-6388 since June 15, 2016.

[0035]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in more detail with reference to the following examples and reference examples, but the present invention is not limited thereto.

[0036]

EXAMPLES Reference Example 1 Galanin receptor (GALR1, G
ALR2) Activating action detection (1-1) Rat-type galanin receptor (GALR1, GAL
R2) Construction of expression cells In order to obtain rat GALR2 gene, rat hypothalamus cD
2 μl of NA (CLONTECH), 1 μl of 10 μM of primer 1 (5′-GTCGACATGAATGGCTCCGGCAGCCAG-3 ′, SEQ ID NO: 22) and 1 μl of primer 2 (5′-ACTAGTTTAACAAGCCGGATCCAGGGTTCTAC-3 ′, 10 times) Concentration buffer (CLONTECH Klen Taq Po
5 μl), 1 μl of 10 mM deoxynucleotide mixture (Invitrogen), Klen Taq
1 μl of DNA polymerase (CLONTECH) and 39 μl of distilled water for injection (Otsuka Pharmaceutical) were mixed to prepare a PCR reaction solution. The PCR reaction was performed using Gene Amp PCR System 9700 (PERKI
NELMER) for 1 cycle (95 ° C, 5 minutes)
(95 ° C, 30 seconds; 76 ° C, 15 seconds; 72 ° C, 2 minutes) 3 cycles; (95 ° C, 30 seconds; 72 ° C, 15 seconds; 72 ° C, 2 minutes) 3 cycles; (30 seconds; 68 ° C, 15 seconds; 72 ° C, 2 minutes)
For 3 cycles, (95 ° C, 30 seconds; 64 ° C, 15 seconds; 72 ° C, 2
Min) for 3 cycles, (95 ° C, 30 seconds; 60 ° C, 15 seconds; 72)
3 cycles (95 ° C, 30 seconds; 56 ° C, 15 minutes)
(Second; 72 ° C., 2 minutes) as 20 cycles. 10 μl of the solution after the PCR reaction was subjected to electrophoresis on a 1% low melting point agarose gel (Sea Plaque GTG: FTN), and the PCR reaction product was confirmed by ethidium bromide staining. A DNA band around 1.2 kbp obtained as the PCR reaction product was recovered from the agarose gel by a known method. That is, the agarose gel fragment was transferred to a 0.5 ml sampling tube, heated to 70 ° C., melted, equilibrated to 40 ° C., and 0.5 μl of beta agarase (Nippon Gene) was added to decompose agarose, followed by reaction for 60 minutes. Was. A target DNA fragment is recovered from the reaction solution by a known ethanol precipitation method, and then PCR-SCRIPT (STRATAGENE)
A ligation reaction was performed with the plasmid vector. The reaction solution was added to Competent High (JM109: TOYOBO), transformed, and cultured overnight on LB agar medium (Wako Pure Chemical Industries) containing 100 μg / ml ampicillin. Colonies on the medium were checked for the insertion of the target DNA fragment by colony-PCR. Colonies with the inserted DNA fragment
LB medium containing 100 μg / ml ampicillin (Wako Pure Chemical Industries)
And cultured overnight in a Plasmid Mini Kit (QI
The plasmid having the inserted DNA fragment was recovered using AGEN. The reaction for base sequence analysis is Dye prim
er cycle sequencing ready reaction (ABI), and the nucleotide sequence analysis using a fluorescent automatic sequencer revealed that the inserted DNA fragment in the plasmid was 1119 bp.
Was confirmed to be DNA encoding GALR2. An expression vector pAKKO-1.11 for animal cells was prepared by the method described in Example 4 of JP-A-7-304797.
A DNA fragment encoding GALR2 was recovered from the plasmid by a known method, ligated to the vector pAKKO-1.11, and introduced into Escherichia coli DH5α to obtain a transformant. This transformant was cultured to prepare a plasmid containing DNA encoding GALR2. Transfer the plasmid to CellPhect Transfection kit
(Pharmacia) was used to transduce CHO cells by the following procedure to obtain the desired GALR2-expressing cells. First, 240 distilled water
Buffer A for 9.6 mg of plasmid DNA dissolved in μl
Add 240 μl (attached to the CellPhect Transfection Kit), stir and let stand for 10 minutes.
480 μl) was added thereto, and the mixture was stirred vigorously to form liposomes containing the DNA. 4 x 10 ⁵
CHO / dhfr ^- cells (obtained from ATCC) were seeded on a 60 mm Petri dish and placed in a Ham's F-12 medium (Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum (BIO WHITTAKER) at 37 ° C.
After culturing for 2 days in 5% carbon dioxide, the liposome 480
μl was dropped on the cells of the petri dish. This is 37
After culturing at 5 ° C. in 5% carbon dioxide for 6 hours, the cells were washed twice with a serum-free Ham's F-12 medium, and 3 ml of 15% glycerol was added to the cells in a Petri dish for 2 minutes. This was again washed twice with a serum-free Ham's F-12 medium, followed by Ham's F-12 containing 10% fetal bovine serum.
The cells were cultured in a medium at 37 ° C. in 5% carbon dioxide for 15 hours.
The cells were dispersed by trypsin treatment, collected from a Petri dish, and seeded on a 6-well plate at 1.25 × 10 ⁴ cells each. Dulb containing dialyzed 10% fetal bovine serum (JRH BIOSCIENCES) was used.
Culture was started in ecco's modified Eagle medium (DMEM) medium (Nissui Pharmaceutical Co., Ltd.) at 37 ° C. in 5% carbon dioxide gas. The transformed CHO cells into which the plasmid was introduced grow in the medium, but the non-transfected cells gradually died. Therefore, the medium was replaced on the first day and the second day of the culture to remove dead cells. Eight days after the start of the culture, 20 colonies of transformed CHO cells (20 CHO cell clones) were selected. The selected cells (20 types of CHO cell clones) were collected, and a membrane fraction was prepared by the method described in Example (1-2) described later. Porcine ¹²⁵ I-gala for membrane fraction
The binding amount of nin (New England Nuclear) was measured by a known method (for example, the method described in the example of EP-0711830A), and a cell line having a high expression level of GALR2 was selected and used in subsequent experiments. . The cDNA encoding GALR1 was obtained in the same manner as the method for obtaining the cDNA encoding GALR2 described above. Using primers 3 and 4 rats, brain
From the cDNA library (CLONTECH), rat GALR1 cDNA consisting of 1486 bp was obtained by PCR and
(TAKARA SHUZO CORPORATION) and the plasmid pRGR
Named 2. This plasmid is replaced with the restriction enzymes EcoRI and
The cDNA fragment obtained by double digestion with PstI was incorporated into a double-digested portion of an expression plasmid vector pcDNAI for animal cells (Invitrogen) with restriction enzymes EcoRI and NsiI, and named plasmid pRGRPC. This plasmid p
A cDNA fragment obtained by double digestion of RGRPC with restriction enzymes Hind III and Xba I was incorporated into a vector double-digested with Hind III and Xba I of animal cell expression plasmid vector pRc / CMV (Invitrogen). G
ALR1 cDNA expression plasmid pRGR1 was obtained. CellPhect T
The rat GALR1 cDNA expression plasmid pRGR1 was introduced into CHO-K1 cells (obtained from ATCC) cultured in Ham's F12 medium (Nissui Pharmaceutical Co., Ltd.) by the known calcium phosphate method using a ransfection Kit (Pharmacia). Twenty-four clones resistant to 500 μg / ml G-418 were isolated using a stainless steel cylinder. Thus isolated 24 clones with a portion of the cells were plated in 6-well plates were cultured until saturated, 100 pM porcine · ¹²⁵ I
-A binding experiment with galanin (New England Nuclear) (for example, the method described in the example of EP-0711830A) was performed to examine the expression level of rat galanin receptor in 24 clones. As a result, it was considered that the No. 3 cell had the highest binding activity to porcine ¹²⁵ I-galanin and the highest GALR1 expression level. Therefore, the No. 3
Cells in 2 wells of a 96-well microplate 1
And spread from one cell. Twelve cloned cells were isolated from the singulated cells, and a similar binding experiment was performed again using a part of the cells. as a result,
Since the cloned cells of Nos. 3 to 10 were considered to have the highest binding activity to ¹²⁵ I-porcine galanin and the highest expression of GALR1, this clone was used as a GALR1-expressing cell.

(1-2) Galanin receptor (GALR)
1. Preparation of GALR2) -expressing cell membrane fraction The GALR2-expressing cells obtained in (1-1) above were subconfluent (80- (90% confluence). After culturing the cells, 2.7 mM ethylenediamine-N, N, N ', N'-
Phosphate buffer containing tetraacetic acid (EDTA) (2.7 mM EDTA / Pho
sphate-buffer saline (138 mM NaCl, 2.7 mM KCl, 8 mM N
a ₂ HPO ₄ , 1 mM KH ₂ PO ₄ )] was added and suspended to release from the incubator, and the cells were recovered by centrifugation. The cells were treated with protease inhibitor mixture (final concentrations of 0.5 mM phenylmethylsulfonyl fluoride, 20 μg / ml leupeptin, 4 μg / ml, respectively).
Homogenized in a 10 mM sodium bicarbonate, 5 mM EDTA (pH 7.3) buffer containing E-64 (10 μg / ml pepstatin) using a Polytron homogenizer. The homogenate is centrifuged at 2500 rpm for 10 minutes using a high-speed centrifuge (CR26H, RR24A type rotor: Hitachi, Ltd.), and the obtained supernatant is subjected to an ultracentrifuge (SCP70H, RP42 type rotor: Hitachi, Ltd.). And centrifuged at 30,000 rpm for 1 hour to obtain a precipitate. This precipitate was again mixed with protease inhibitor mixture (0.5 mM phenylmethylsulfonyl fluoride, 20 μg / ml leupeptin, 4 μg / ml).
The suspension was suspended in 10 mM sodium bicarbonate and 5 mM EDTA (pH 7.3) buffer containing 10 ml / ml E-64, 10 μg / ml pepstatin, and used as a membrane fraction for detecting galanin receptor activation (-70 C).

(1-3) Detection of Galanin Receptor Activating Activity by [ ³⁵ S] GTPγS Binding Test The membrane fraction prepared in the above (1-2) was used at a concentration of 40 μg / ml.
(For GALR1 membrane fraction) or 1 μM guanosine-5'-diphosphate to 32 μg / ml (for GALR2 membrane fraction)
(GDP), 0.1% bovine serum albumin (BSA), 5 mM MgC
l ₂ , suspended in 50 mM Tris buffer (pH 7.4) containing 150 mM NaCl, add 0.2 ml each to a small polypropylene test tube (Falco
n 2053). 50 nM [ ³⁵ S] G in the dispensed membrane fraction
2 μl of TPγS (NewEngland Nuclear) and porcine galanin (100 μM, 10 μM, 1 μM) as an agonist
2 μl (at each concentration of M, 100 nM, 10 nM, 1 nM, 100 pM, or 10 pM) was added and reacted at 25 ° C. for 60 minutes. 1.5 ml of 0.05% 3-[(3-cholamidopropyl) dimethylmonio] propanesulfonic acid (CHAPS), 0.1% BS
A, 50 mM Tris buffer containing 5 mM MgCl ₂ , 1 mM EDTA
(pH 7.4) and GF / F glass fiber filter paper (Whatman)
And filtered. After the filter paper was washed with 1.5 ml of the same buffer and dried, the radioactivity was measured by a liquid scintillation counter. As a result, depending on the galanin concentration
An increase in the amount of [ ³⁵ S] GTPγS binding was observed (FIG. 2).
It was revealed that the galanin receptor agonist activity can be measured by this method. EC _{50 of} rat galanin
The value (concentration that gives half the maximum binding) is GALR
The value was about 3 nM for 1 and about 10 nM for GALR2.

Reference Example 2 Screening for a compound activating GALR2 (galanin receptor type 2) (2-1) Preparation of porcine hypothalamus extract The porcine hypothalamus was purchased from Tokyo Shibaura Organ Co., Ltd. for 3 hours The following operation was performed within the above to prepare an extract. First, 35 pig hypothalamus (about 500 g) were cut into small pieces using a kitchen knife, placed in a 3000 ml beaker containing 1250 ml of boiling distilled water, and boiled for 10 minutes. After boiling, the hypothalamus was water-bathed together with the beaker and then ice-bathed to lower the temperature to about 4 ° C. The hypothalamus was homogenized with distilled water used for boiling for 10 minutes using a Polytron homogenizer. 90 ml of acetic acid was added dropwise to the obtained homogenate so that the final concentration became 1 M, and the mixture was stirred for 1 hour. The homogenate was centrifuged at 10,000 rpm for 30 minutes using a high-speed centrifuge (CR26H, RR10A rotor: Hitachi, Ltd.) to obtain a supernatant (1). On the other hand, the precipitate obtained after centrifugation
2000 ml of M acetic acid was added and homogenized for 10 minutes using a Polytron homogenizer. The homogenate was stirred overnight (about 16 hours) using a stirring blade, and then homogenized using a Polytron homogenizer for 10 minutes to obtain a supernatant (2). The supernatant (1) and the supernatant (2) are mixed, twice the volume of acetone is added, and the mixture is stirred at 4 ° C. for 1 hour.
The mixture was centrifuged at 10,000 rpm for 15 minutes using Hitachi, Ltd.) to obtain a supernatant. The obtained supernatant was subjected to a rotary evaporator to remove acetone, and finally concentrated to 4000 ml. This concentrate was centrifuged at 35,000 rpm for 1 hour using an ultracentrifuge (SCP70H, Hitachi RPZ35T rotor: Hitachi, Ltd.) to obtain a clear supernatant. 1000 ml of the obtained supernatant
Each was mixed with 500 ml of diethyl ether, mixed vigorously in a separating funnel, and an aqueous phase was obtained after two-phase separation. 1000 ml of the obtained aqueous phase using a rotary evaporator.
To obtain the final extract.

(2-2) Purification of porcine hypothalamus extract by octadodecyl reverse phase chromatography Silica gel ODS-AM 120-S50 having octadodecyl groups fixed
(YMC) was swollen with methanol, packed in a 5 cm diameter glass column to a volume of 130 ml, and equilibrated with 1 M acetic acid. The extract (500 g under the thalamus) prepared in (2-1) was applied to this column at a flow rate of 400 ml / h. Subsequently, about 500 ml of 1 M acetic acid was added to the column, followed by about 500 ml.
ml of 20% acetonitrile / 0.1% trifluoroacetic acid
The gel was washed at a flow rate of 400 ml / h. Finally, about 500 ml of 50% acetonitrile / 0.1% trifluoroacetic acid was passed through the column at a flow rate of 400 ml / h to elute the crude peptide component of interest. The obtained eluate was concentrated using an evaporator and then freeze-dried (12EL; VirTis
Lyophilized.

(2-3) TSKgel O of porcine hypothalamus extract
Purification by DS80TM reversed-phase high-performance liquid chromatography TSKgel ODS80TM reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 22.5 mm x 30 cm) at 40 ° C at a flow rate of 8 ml / min. Acetic acid / distilled water) was flowed in to equilibrate. The freeze-dried product obtained in the above (2-2) was dissolved in 40 ml of 1 M acetic acid, and each 10 ml was subjected to four chromatographic operations. That is, after 10 ml of lyophilized acetic acid solution was applied to the column, the flow rate was 8 ml / mi.
n, the solution A (0.1% trifluoroacetic acid / distilled water) volume 80% / solution B (0.1% trifluoroacetic acid / 100% acetonitrile) volume 20% and the solution A (0.1% trifluoroacetic acid / The volume was increased by a linear gradient to a volume of distilled water (40%) / solution B (0.1% trifluoroacetic acid / 100% acetonitrile) to 60%. The eluate was fractionated in 8 ml portions.
Nos. Were collected, dispensed into 1 ml portions, and concentrated and dried using a vacuum concentrator (Servant). To this dried product, add 0.03 ml of dimethyl sulfoxide and dissolve.
Samples for assay were used to measure 1 and GALR2 activation.

(2-4) Isolation and Purification of Compound Activating GALR2 (Galanin Receptor Type 2) by [ ³⁵ S] GTPγS Binding Test The assay sample obtained in the above (2-3) was The galanin receptor activating action was measured by a [ ³⁵ S] GTPγS binding test using the GALR1 or GALR2 membrane fraction described in (1-3) above. In the [ ³⁵ S] GTPγS binding test using the GALR1-expressing cell membrane fraction, fraction No. 36-
[ ³⁵ S] GTPγS binding promoting activity was observed in 39 and Nos. 42-43, while [ ³⁵ S] was determined using a GALR2-expressing cell membrane fraction.
In the GTPγS binding test, fractions No. 36-39, No. 4
2-35 and Nos. 46-49 showed [ ³⁵ S] GTPγS binding promoting activity [FIG. 3]. Furthermore, the assay sample was diluted 100-fold with dimethyl sulfoxide, and 3 ml of the diluted sample was analyzed using a porcine galanin radioimmunoassay kit (Peninsula).
Galanin immunoreactivity was detected at o.36-38 (FIG. 4). From the above results, GALR1 and GAL of fraction Nos. 36-39
The component having the R2 activating effect was determined to be porcine galanin. On the other hand, the components having a GALR2 activating effect of fractions Nos. 46-49 were expected to be compounds different from galanin.

(2-5) Measurement of molecular weight of compound activating GALR2 (galanin receptor type 2) By a known gel filtration high performance liquid chromatography method,
The molecular weight of the GALR2 activating component (fraction Nos. 46-49) obtained in the above (2-4) was measured. Fraction No.4
Dilute 0.02 ml of the sample mixture of 6-49 in 0.08 ml of 0.1% trifluoroacetic acid / distilled water, and dilute 0.05 ml of G2000SWXL.
(Tosoh Corporation) The column was attached, 0.1% trifluoroacetic acid / 10% acetonitrile was flowed at a flow rate of 0.5 ml / min, and the eluate was collected in 0.25 ml (every 0.5 minutes). The fractions collected are concentrated and dried (SpeedVac Plus SC210A; Savan
t company), and directly dissolved in the membrane fraction suspension.
2 μL of [ ³⁵ S] GTPγS (New England Nuclear) was added, and [ ³⁵ S] GT was prepared by the method described in (1-3) below.
The amount of PγS binding was measured. As a result, the component having a GALR2 activating action ([ ³⁵ S] GTPγS binding promoting activity) is contained in fraction No. 35 (retention time 17 to 17.5 minutes).
[Fig. 5]. Known peptides analyzed under the same conditions (Adrenomedulin, Gastric inhibitory peptide, P
ACAP38, Neuropeptide Y, β-endorphine, Galanin, SR
IF28 (Somatostatin 28), Bovine Serum Albumin, Tryps
Inhibitor, Lysozyme) (FIG. 6), the molecular weight of the component having a GALR2 activating effect in fraction Nos. 46-49 was estimated to be about 5,000 to about 7,000. On the other hand, the molecular weight of known porcine galanin (Peptide Research Institute) is 3157.4 (retention time 18.858 minutes).
Therefore, GALR obtained as fraction Nos. 46-49
2 It was suggested that the compound having an activating effect was a substance different from known galanin.

Reference Example 3 Purification of Compound Having GALR2 (Galanin Receptor Type 2) Activating Action (3-1) Preparation of Pig Hypothalamic Extract The above-mentioned (2) ―
The method of 1) was simplified as follows. 50 pig hypothalamus frozen products (Tokyo Shibaura Organ Co., Ltd.) (about 1 kg)
Sliced into thin slices using a kitchen knife and boiled 2500m
Add to a 5000 ml beaker containing 1 liter of distilled water and boil for 10 minutes. The boiled hypothalamus was placed in a water bath and ice bath together with the beaker to lower the temperature to about 4 ° C., and the hypothalamus was homogenized with distilled water used for boiling for 10 minutes using a Polytron homogenizer. 150 ml of acetic acid and 8 ml of 6N hydrochloric acid were added dropwise to the obtained homogenate,
The final concentration of each was 1 M and 20 mM, and then the mixture was stirred overnight (about 16 hours) using a stirring blade. The homogenate was centrifuged at 8000 rpm for 30 minutes using a high-speed centrifuge (CR26H, Hitachi RR10A rotor: Hitachi, Ltd.), and the obtained supernatant was filtered with gauze to remove lipid fragments. By repeating the above operation four times, an extract was prepared from the hypothalamus of about 4 kg.

(3-2) Concentration and crude fractionation of porcine hypothalamus extract (3-2-1) Purification by octadodecyl reverse phase chromatography
DS-AM 120-S50) was swollen with methanol, packed in a 5 cm diameter glass column so that the volume became 400 ml, and 1 M
Equilibrated with acetic acid. After half the amount of the extract prepared in (3-1) (for 2 kg of the hypothalamus) was applied to the column at a flow rate of 400 ml / h, at a flow rate of 400 ml / h, about 1000 ml of 1 M acetic acid was added, and then about 1200 ml. The gel was washed by flowing 20% acetonitrile / 0.1% trifluoroacetic acid. Finally, a flow rate of 400 ml / h
Then, about 2000 ml of 60% acetonitrile / 0.1% trifluoroacetic acid was passed through the column to elute the crude peptide fraction of interest. The obtained eluate was concentrated using an evaporator, and then lyophilized with a freeze dryer (12EL; VirTis). The above operation was performed twice, and about 4 kg (200
Lyophilized powder of the hypothalamus extract was prepared. (3-2-2) Purification by SP-Sephadex ion exchange chromatography S swelled in 10 mM hydrochloric acid on a 5 cm diameter glass column
P-Sephadex C25 (Pharmacia Biotech) with a capacity of 12
Fill to 0 ml, wash with 100 mM hydrochloric acid, then add 1 M
Equilibrated with acetic acid. The freeze-dried powder of the hypothalamus extract obtained in (3-2-1) was dissolved in about 800 ml of 1 M acetic acid, and applied to an equilibrated SP-Sephadex C25 column at a flow rate of 400 ml / ml.
h attached. About 600 ml of 1 M acetic acid, about 600 ml of 1 M pyridine, and about 600 ml of 1 M pyridine / acetic acid (pH 5.0)
The solution was sequentially passed through the column at 400 ml / h, and the eluate was collected in 40 ml aliquots, dispensed in 0.2 ml aliquots, and concentrated and dried with a vacuum concentrator (Servant). To this dried product, 0.04 ml of dimethyl sulfoxide was added and dissolved, and the above (1-
The GALR2 activating effect was measured by the test method 3). As a result, the component having the desired GALR2 activating action is 1
It was found that it was eluted by M pyridine · acetic acid (pH 5.0). From these results, it was considered that the component (compound) having GALR2 activating action was a strongly basic substance. (3-2-3) Purification by Sephadex G50 gel filtration chromatography 1M pyridine · acetic acid (pH
5.0) Use evaporator to collect 100 ml of the eluate sample.
Sephadex G50 concentrated to 1% and equilibrated with 1 M acetic acid
(Pharmacia Biotech) column (diameter 6 cm, capacity 3000 m
l) at a flow rate of 400 ml / h and then 1 M at a flow rate of 400 ml / h.
The acetic acid is applied to the column, and 33 ml of the eluate is collected in fraction N
Each sample was dispensed in 0.25 ml portions and concentrated and dried with a vacuum concentrator (Savant). In this dried product,
0.03 ml of dimethyl sulfoxide was added and dissolved, and the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, it was found that the target component having the GALR2 activating action was mainly eluted in the fractionated fraction No. 66-80. Weak activity was also detected in fractions No. 55-65 and No. 45-54. Fractions No. 66-80, 55-65 and 45-54 were mixed and freeze-dried.

(3-3) Purification of Compound Having GALR2 Activating Activity Using HPLC (3-3-1) Purification by TSKgel ODS80TM Reversed-Phase High-Performance Liquid Chromatography TSKgel ODS80TM Reversed-Phase High-Performance Liquid Chromatography Column (Tosoh, 22.5 mm x 30 cm) at 40 ° C, flow rate 4 ml
Flow solution A (0.1% trifluoroacetic acid / distilled water) at / min,
Equilibrated. Sephadex G obtained in the above (3-2-3)
Each lyophilized product of the 50-fraction was dissolved in 1 M acetic acid and applied to the column.
From 0% solution A (0.1% trifluoroacetic acid / distilled water) volume 67% / solution B (0.1% trifluoroacetic acid / 60% acetonitrile) volume 33% to solution B (0.1% trifluoroacetic acid)
/ 60% acetonitrile) The eluate was recovered with a linear gradient up to 100% volume. The eluate was fractionated with a fraction No. for each 8 ml. The fraction N
The freeze-dried product of o.66-80 was chromatographed twice, and fraction Nos. 55-65 and 45-54 were separated by one chromatography each. Using 4 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, three types of activity peaks were mainly observed in all the chromatographys. The elution position of the component having an activating effect found in fraction Nos. 35-38 almost coincided with the elution position of galanin described in Example 2. In addition, fraction No. 47-
The activating component found in 50 is almost at the elution position of the component having GALR2 activating action described in Reference Example 2 (which does not activate GALR1 and is not detected by the aforementioned porcine galanin radioimmunoassay kit). Matched. Therefore, it was decided to purify components having GALR2 activating action using fraction Nos. 47-50, and these fractions were mixed and freeze-dried.

(3-3-2) Purification by TSKgel CM-2SW Ion Exchange High Performance Liquid Chromatography A column for TSKgel CM-2SW ion exchange high performance liquid chromatography (Tosoh, 0.46 cm × 25 cm) was added at 20 ° C. Solution A at a flow rate of 1 ml / min (10 mM ammonium formate / 40%
(Acetonitrile) at a flow rate of 1 ml / min to equilibrate.
The lyophilized product of the preparative fraction of reversed-phase high-performance liquid chromatography obtained in (3-3-1) was dissolved in solution A, applied to the column, and subjected to A at a flow rate of 1 ml / min for 60 minutes.
The eluate was collected from a solution (10 mM ammonium formate / 40% acetonitrile) with a linear gradient from 100% volume to 100% solution B (500 mM ammonium formate / 40% acetonitrile). The eluate was fractionated with a 0.5 ml fraction number. Using 1 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, a main activity peak was detected in fractions No. 89-92. These fractions were combined and used for subsequent purification.

(3-3-3) Purification by Diphenyl Reversed-Phase High-Performance Liquid Chromatography A column for diphenyl reversed-phase high-performance liquid chromatography (Vydak 219TP54, 0.46 cm × 25 cm) was placed at 40 ° C.
Solution A at a flow rate of 1 ml / min (0.1% trifluoroacetic acid / distilled water)
And allowed to equilibrate. After directly applying the preparative fraction obtained by the ion exchange high performance liquid chromatography obtained in the above (3-3-2) to the column, the volume of the solution A (0.1% trifluoroacetic acid / distilled water) in 1 minute at a flow rate of 1 ml / min. From 100%, the volume of solution B (0.1% trifluoroacetic acid / 60% acetonitrile) was rapidly increased to 50%, and this was followed by a flow rate of 1%.
The eluate was collected by increasing the concentration of solution B to 100% in a linear gradient over 60 minutes at ml / min. Eluate 1
Fraction No. was added to each ml and fractionated. Using 1 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, the main activity peak was detected in fraction Nos. 24-26. These fractions were combined and used for subsequent purification. (3-3-4) Purification by Super Phenyl Reversed-Phase High-Performance Liquid Chromatography A TSKgel Super Phenyl Reversed-Phase High-Performance Liquid Chromatography column (Tosoh, 0.46 cm x 10 cm) was used at 40 ° C at a flow rate of 1 ml / min. Solution A (0.1% trifluoroacetic acid / distilled water) was flowed to equilibrate. The diphenyl reversed-phase high-performance liquid chromatography fraction obtained in (3-3-3) was directly applied to the column, and the volume of solution A (0.1% trifluoroacetic acid / distilled water) was applied at a flow rate of 1 ml / min for 1 minute. 100
% Solution (0.1% trifluoroacetic acid / 60% acetonitrile) to a volume of 45%.
The eluate was collected by increasing the solution B concentration to 55% with a linear gradient at 80 ml / min over 80 minutes. Eluate 1 ml
Each fraction was numbered and fractionated. Using 1 μl of the fractionated fraction directly, according to the test method of (1-3) above,
GALR2 activating effect was measured. As a result, the main activity peaks were detected in fractions No.44-45 and No.50-52. Fraction Nos. 44-45 were mixed, and re-chromatography was performed under the same conditions. On the other hand, for Nos. 50, 51 and 52, re-chromatography was performed separately under the same conditions, and eluted fractions of 0.5 ml each were collected. 2 μl of each fraction was directly used, and the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, N
Fractions No. 93-95 obtained by re-chromatography operation of o.44-45, and fraction Nos. 105-107 obtained by re-chromatography operation of fraction No. 50
An activity peak was detected. Fraction No. 105-1 obtained by re-chromatography of fraction No. 51
A major activity peak was detected at 07, and a weak activity peak was detected at fractions Nos. 108-109. Furthermore, fraction No.5
Fraction N obtained by re-chromatography operation of 2
In o.106-110, a major activity peak was broadly detected.

(3-3-5) Purification by Super ODS Reversed-Phase High Performance Liquid Chromatography (3-3-5-1) Purification of GALR2 Activated Main Component (3-3-5-1-1) Trifluoroacetic Acid Chromatography in the presence of TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 0.46 cm x 10 cm) at 40 ° C
At, solution A (0.1% trifluoroacetic acid / distilled water) was flowed at a flow rate of 1 ml / min to equilibrate. Obtained in (3-3-4)
Super Phenyl Reversed-Phase High Performance Liquid Chromatography Preparative Fraction No93-95 was directly applied to the column, and the flow rate was 1 ml.
/ min, solution A (0.1% trifluoroacetic acid / distilled water) volume 100% to solution B (0.1% trifluoroacetic acid / 6
0% acetonitrile) volume was increased in a linear gradient to 50%, which was then added at a flow rate of 1 ml / min for 84 minutes.
The eluate was recovered by elevating the concentration of solution B to 62.5% with a linear gradient. Eluate 0.5 ml fraction N
o. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, the activity peak was fraction No. 9
6-97 detected. The obtained fraction Nos. 96-97 were mixed and re-chromatography was performed under the same conditions.
Fractions were collected in 0.5 ml portions. 210 nm UV (U
V) Although a single peak was detected by absorption, a shoulder of a peak suggesting contamination was found. Using 2 μl of each fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, activity peaks were detected in fractions No. 98-100,
The peak coincided with the portion excluding the shoulder of the peak detected by 10 nm ultraviolet absorption. In order to remove impurities contained in the shoulder portion of the peak, further purification was performed by the method described in (3-3-5-1-2). (3-3-5-1-2) Chromatography in the presence of heptafluorobutyric acid A TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 0.46 cm x 10 cm) was subjected to 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid /
(Distilled water) was allowed to flow to equilibrate. (3-3-5-1-1)
After the fraction No. 98-100 obtained in step 1 was directly applied to the column, the flow rate was 1 ml / min, and the volume of solution A (0.1% heptafluorobutyric acid / distilled water) from 100% to solution B (0.1% heptafluorobutyric acid / 100%) for 1 minute. % Acetonitrile) volume was rapidly increased to 35%, which was then increased at a flow rate of 1 ml / min with a linear gradient to a 50% solution B concentration over 60 minutes to collect the eluate. The eluate was fractionated with a 0.5 ml fraction number. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions No. 67-69. This activity peak completely coincided with the earlier-eluted ultraviolet absorption peak of the 210 nm ultraviolet absorption peak separated into two lines, and it was determined that the single peptide had been purified. The component having this activating effect is referred to as GALR2 activating main component.

(3-3-5-2) Purification of GALR2 Activating Secondary Component (1) A column for TSKgel Super ODS reversed-phase high-performance liquid chromatography (0.46 cm × 10 cm, Tosoh Corporation) was heated at 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid)
/ Distilled water) and allowed to equilibrate. Super Phenyl Reversed-Phase High Performance Liquid Chromatography Preparative Fraction No. 105-107 (from Fraction No. 50), Fraction No. 105-107 (from Fraction No. 51), Fraction Obtained in (3-3-4) No. 106-107 (from fraction No. 52) was mixed and directly applied to the column, and then the flow rate was 1 ml / min for 1 minute, and the volume of solution A (0.1% trifluoroacetic acid / distilled water) was 1
From 00%, the volume of solution B (0.1% trifluoroacetic acid / 60% acetonitrile) is rapidly increased to 52.5%, which is then linearly increased to 65% at a flow rate of 1 ml / min over 84 minutes. The eluate was collected by raising the gradient. The eluate was fractionated with a 0.5 ml fraction number. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. as a result,
The activity peak was detected in fractions No. 75-76. The obtained fraction Nos. 75 to 76 were mixed, and the same chromatography was performed again under the same conditions. The eluate was detected as a single peak at 210 nm UV absorption. Preparative fraction
Using 3 μl directly, the test method described in (1-3) above
The LR2 activating effect was measured. As a result, an activity peak was detected in fractions Nos. 76-78. This activity peak is 21
It coincided with the ultraviolet absorption peak at 0 nm, and it was judged that the active ingredient had been purified to a single peptide. The component having this activating effect is referred to as GALR2 activation subcomponent (1).

(3-3-5-3) Purification of GALR2 Activating Secondary Component (2) A column for TSKgel Super ODS reverse phase high performance liquid chromatography (Tosoh Corporation, 0.46 cm × 10 cm) was heated at 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid)
/ Distilled water) and allowed to equilibrate. Super phenyl reversed-phase high-performance liquid chromatography fractions No.108-109 (from fraction No.51) and fraction No.108-110 (from fraction No.52) obtained in (3-3-4) are mixed. After direct application to the column, the flow rate was 1 ml / min and the volume of solution A (0.1% trifluoroacetic acid / 60% acetonitrile) was rapidly increased from 100% to 52.5% in 1 minute. Next, at a flow rate of 1 ml / min, the solution B concentration was raised to 65% with a linear gradient over a period of 84 minutes, and the eluate was collected. The eluate was fractionated with a 0.5 ml fraction number. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions No. 79-80. The obtained fraction No. 79-80 was mixed, and the same chromatography was performed again under the same conditions.
Each fraction was detected as a single peak by ultraviolet absorption at 210 nm. Using 3 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, the activity peak was the fraction No. 79-81. This activity peak is 21
It coincided with the ultraviolet absorption peak at 0 nm, and it was determined that the active ingredient had been purified to a single peptide. The component having this activating action is referred to as GALR2 activation accessory component (2).

Reference Example 4 Analysis of Amino Acid Sequence (4-1) Analysis of N-terminal amino acid sequence of main component having GALR2 activating action Fraction N obtained in (3-3-5-1-2) above
The GALR2-activated main component of O.67-69 was dissolved in 20 μl of 0.1% trifluoroacetic acid / 30% acetonitrile, dropped on a peptide support disk (Beckman), and dried with nitrogen gas. This was set in a protein sequencer (Beckman, LF3400DT) and subjected to an automatic Edman degradation reaction by a standard analysis method (procedure 40) to perform amino acid sequence analysis. The PTH amino acids identified for each cycle are shown in [Table 1].

[0053]

[Table 1]

From Table 1, the amino acid sequence from the N-terminus to the 34th residue of the main component of GALR2 activation could be determined as follows (residue X at the 28th position is unidentified). . APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGGGK (N-terminal amino acid sequence of GALR2 activating main component, SEQ ID NO: 24) A sequence consisting of 13 residues from the 9th to 21st residues from the N-terminus in the obtained amino acid sequence is a known pig galanin. N-terminal amino acid sequence. However, the amino acid sequence before and after that did not match any sequence of porcine galanin and its precursor. In addition, since no known peptide corresponding to the present amino acid sequence was found, the obtained GA
It was speculated that the LR2 activating main component was a novel peptide.

(4-2) Analysis of N-terminal amino acid sequence of accessory component (1) having GALR2 activating action Fraction No. 76- obtained in (3-3-5-2) above
78 GALR2 activation accessory components were analyzed in the same manner as in (4-1). The amino acids identified in each cycle are shown in [Table 2].

[0056]

[Table 2]

From Table 2, it is found that N of GALR2 activation accessory component (1)
The amino acid sequence from the terminal to the 32nd residue could be determined as follows (residue X at the 28th position is unidentified). APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGG (N-terminal sequence of GALR2 activation subcomponent (1), SEQ ID NO: 25) This amino acid sequence completely corresponds to 32 residues of the N-terminal amino acid sequence of GALR2 activation main component obtained in (4-1) above. Matched.

(4-3) Analysis of N-terminal amino acid sequence of subcomponent (2) having GALR2 activating action Fraction No. 79- obtained in (3-3-5-3) above
81 GALR2 activation accessory component (2) was dissolved in 20 μl of 0.1% trifluoroacetic acid / 30% acetonitrile, ammonium bicarbonate (final concentration 1%), TLCK-chymotrypsin (final concentration)
(10 pmol Sigma) and distilled water to make 50 μl, and reacted at 37 ° C. for 1 hour. A Spheri-5 RP-18 reversed-phase high-performance liquid chromatography column (Brownley, 2.1 mm x 30 mm) was applied at 25 ° C at a flow rate of 300 µl / mi
Solution A (0.1% trifluoroacetic acid) was flowed in n to equilibrate. After attaching the entire amount of the enzyme reaction solution to the column, the flow rate was 300 μl.
/ min, increasing the volume of solution A (0.1% trifluoroacetic acid) from 100% to the volume of solution B (0.1% trifluoroacetic acid / 70% acetonitrile) to 70% over 30 minutes, and eluted peak showing ultraviolet absorption at 210 nm 4 (CHY-1, CHY-2, CHY-3 and C
HY-4) was collected as the elution fraction. Sorted 4
After concentrating the two fractions (fragments digested with chymotrypsin) under a nitrogen stream to 50 μl or less, (4-1)
The N-terminal amino acid sequence was analyzed using a protein sequencer in the same manner as described above. For CHY-3,
Beckman LF3400DT protein sequencer, CHY
For -1, CHY-2 and CHY-4, an Applied Biosystems 477A protein sequencer was used. The following sequence was obtained by N-terminal amino acid sequence analysis. CHY-1: APVHRGRGG (SEQ ID NO: 26) CHY-2: XAIDGLPYPQS (X unidentified) (SEQ ID NO: 27) CHY-3: LLGPVLHPPSXAEGGGKTALGILDL (X unidentified) (SEQ ID NO: 28) CHY-4: TLNSAG (SEQ ID NO: 29) N of the GALR2 activation main component obtained in (4-1) or the GALR2 activation subcomponent (1) obtained in (4-2) above
With reference to the terminal amino acid sequence results, it was inferred that the GALR2 activation accessory component (2) had the following N-terminal amino acid sequence. APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGGGKTALGILDL (SEQ ID NO: 30)

Reference Example 5 cDNA encoding a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 1) Cloning of porcine GALR2 activator gene fragment by Degenerated PCR (Degenerated PCR) TRIZOL reagent (Gibco BRL)
Total according to the method described in the attached manual
RNA was extracted. Then an oligo dT cellulose column (mRN
A (Purification Kit, Pharmacia) was used to prepare poly (A) ⁺ RNA from the total RNA according to the method described in the attached manual. Furthermore, 3'RACE System fo
r rapid amplification of cDNA ends (Gibco BRL)
Was used to synthesize a first strand cDNA from the Poly (A) ⁺ RNA according to the method described in the attached manual. In addition, the following degenerate primer designed based on the partial amino acid sequence of the porcine GALR2 activating component was synthesized. pGAL4-7F: 5'-CAYMGNGGIMGNGGIGGSTGGAC-3 '(SEQ ID NO: 31) pGAL9-3F: 5'-GGHTGGACNCTNAAYAGYGC-3' (SEQ ID NO: 32) pGAL34-1R: 5'-ATICCNAGIGCNGTYTTICCYTT-3 '(SEQ ID NO: 33) Using the first strand cDNA described above as a template, pGAL4-7
First-stage PCR using F and pGAL34-1R as primers
The reaction was performed. The reaction solution in the PCR reaction was Taq pol
0.5 μl of ymerase (Takara Shuzo Co., Ltd.)
10x PCR buffer (500 mM KCl-100 mM Tris-HCl, pH 8.
3) 10 μl, 25 mM MgCl ₂ 6 μl, 2.5 mM dNTP mixture
8 μl, primers pGAL4-7F and primer pGAL34-
1R (10 μM each), 10 μl each, and the template cDNA
8μl (first strand cDNA described above) and 47.5 distilled water
μl was prepared by mixing. As the PCR, 1) initial denaturation (94 ° C., 30 seconds), 2) 32 cycle reactions (94 ° C., 20 seconds)
-55 ° C for 30 seconds -72 ° C for 30 seconds) followed by 3) final extension reaction (72 ° C for 4 minutes) to obtain a first-stage PCR product. Second-stage PCR reaction (nested PCR) using the obtained first-stage PCR product as a template
Was done. The reaction solution was 0.5 μl of Taq polymerase (Takara Shuzo Co., Ltd.) and the attached 10x PCR buffer (500 mM KCl-100).
mM TrisHCl, pH 8.3) 10 μl, 25 mM MgCl ₂ 6 μl
l, 2.5 μm dNTP mixture, 8 μl, primer pGAL9-3F
And 10 μl each of pGAL34-1R (both 10 μM), 5 μl of the template cDNA (first-stage PCR product), and 50.5 μl of distilled water
Were mixed. As the PCR, 1) initial denaturation (94
℃ ・ 30sec) 2) 32 cycles (94 ℃ ・ 20sec)
-55 ° C for 30 seconds -72 ° C for 30 seconds) 3) Final elongation reaction (72
℃ 10 minutes) to obtain a nested PCR product.

Further, the nested PCR product was subjected to 2.0% agarose gel electrophoresis, and was subjected to cyber green staining for about 10 minutes.
The gel piece containing the 0 bp band was cut out with a razor. A DNA fragment as a nested PCR product was recovered from the gel piece using a Gene Clean DNA extraction kit (BIO 101). This DN
The A fragment was ligated to a plasmid vector pCRII attached to the kit using a TOPO TA Cloning Kit (Invitrogen) according to the method described in the attached manual. Transfer the resulting plasmid to QIAwell 8 Ultra plasmid purifica
Purification was carried out using an tion kit (QIAGEN). The reaction for sequencing the nested PCR product in the plasmid
ye Terminator Cycle Sequencing Kit (Applied Biosys
tems, PerkinElmer) and a fluorescent automatic sequencer (DNA sequencer Prism 377: Applied B)
iosystems, PerkinElmer)
The nucleotide sequence of the product was decoded. As a result, several types of plasmids having a 98 bp DNA fragment encoding a partial peptide of porcine GALR2 activator could be obtained. Because degenerate primers were used in the PCR reaction, differences in the nucleotide sequences of the DNAs in these several types of plasmids were found in the portions corresponding to the primers. The base sequences of nested PCR products in two representative clones, pCR100-6 and pCR100-7, are shown below. pCR100-6: GGCTGGACTT TAAATAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG GCTGAAGGAG GCGGGAAGGG CAAAACAGCC CTGGGCAT (SEQ ID NO: 34)

2) Cloning of cDNA encoding a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 From the above-mentioned poly (A) ⁺ RNA obtained from whole pig brain, ZAP-
cDNA Gigapack III Gold cloning kit (STRATAGENE)
Was used to prepare a porcine whole brain cDNA phage library. The method followed the manual attached to the kit. The obtained phage (2,200,000 plaque forming units) was transformed into E. coli XL1-Blue MRF '(STRATAGENE
Was spread on 120 NZY medium agar plates and cultured at 37 ° C. for 8 hours. The phage was copied from the obtained E. coli plaque onto a Hybond-N + nylon membrane (Amersham). This nylon membrane
It was immersed in a 0.5 N sodium hydroxide solution containing 1.5 M sodium chloride, a 0.5 M tris buffer solution (pH 7.0) containing 1.5 M sodium chloride, and a 2 × SSC solution, and then air-dried. The obtained nylon membrane was mixed with a hybridization buffer (5x SSPE, 5x Denhardt's solution, 0.5% SDS, 0.1%
mg / ml salmon sperm DNA) at 60 ° C. for 24 hours, followed by a hybridization probe (5 × 10 ⁵ cpm / ml).
In a hybridization buffer (same as above) containing
It was kept at 60 ° C. for 24 hours. The hybridization probe was prepared by using the above-mentioned 1: 1 mixture of plasmids pCR100-6 and pCR100-7 as a template and the following two primers pGAL9-3F
And a DNA fragment amplified by pGAL34-8R. pGAL9-3F: 5'-GGHTGGACNCTNAAYAGYGC-3 '(SEQ ID NO: 36) pGAL34-8R: 5'-ATDCCBAGGGCDGTTTTGCCCTT-3' (SEQ ID NO: 37) That is, the amplification reaction [The reaction solution composition was ExTaq (Takara Shuzo Co., Ltd.) ), 5 μl of the attached 10x Ex Taq buffer (containing 20 mM MgCl ₂ ), 4 μl of 2.5 mM dNTP mixture, [α- ³²
P] dCTP (6000 Ci / mmol) 10 μl, primer pGAL9-3F
And pGAL34-8R (10 μM each)
0.5 μl, 1 μl of template cDNA and 29 μl of distilled water were mixed), and after initial denaturation at 96 ° C for 30 seconds,
A cycle reaction of -55 ° C for 20 seconds, -72 ° C for 30 seconds and 30 seconds is performed 32 times.
Twice and a final extension reaction at 72 ° C for 4 minutes were performed to obtain an amplified DNA fragment. The nylon membrane after the hybridization reaction was washed with 0.2x SSC buffer containing 0.1% SDS.
After washing at 50 ° C for 30 minutes, X-ray film (Kodak, Bi
oMax MS) in the presence of an intensifying screen (exposure conditions: -70 ° C, 3 days).
Positive plaques detected from the results of the autoradiography were isolated, and SM buffer containing 100 ml of chloroform (100 mM NaCl, 8 mM MgSO ₄ , 0.01% gelatin, 50 mM T
The phage was extracted into 5 ml of ris.HCl, pH 7.5. The obtained phage was again infected into Escherichia coli XL1-Blue MRF ', spread on an NZY medium agar plate, and cultured at 37 ° C. for 8 hours. Transfer the phage from the obtained E. coli plaque onto a nylon membrane (Amersham, Hybond-N +),
Hybridization was performed in the same manner as described above. A single positive clone was isolated by autoradiography, and the same series of operations as described above was repeated once again to obtain a completely single phage clone.
Next, a plasmid was isolated and purified from the phage clone by the following method. Transfer the phage solution (1 μl) to E. coli XPORT (5
0 μl), helper phage (10 μl), E. coli XLOLR (5 μl)
l), spread on an NZY agar plate, and cultured at 37 ° C for 8 hours. Escherichia coli XLO generated in Escherichia coli XPORT plaque
A small LR colony was picked up with a toothpick and cultured overnight at 37 ° C. on an LB medium agar plate containing ampicillin and tetracycline. E. coli XLOL from a single colony
R was picked up and liquid cultured in LB medium. After completion of the culture, Escherichia coli XLOLR was collected, and the plasmid was purified using a plasmid purification kit (Qiagen, QIAwell 8 Ultra). The reaction for sequencing the cDNA encoding the porcine GALR2 activator in the plasmid was performed by Dye
Terminator Cycle Sequencing Kit (Applied Biosystem
s, Perkin Elmer) and a fluorescent automatic sequencer (DNA sequencer Prism 377: Applied Bios)
ystems (PerkinElmer) was used to decode the nucleotide sequence of the cDNA encoding the porcine GALR2 activator. As a result, 9 encoding the full-length peptide of porcine GALR2 activator
Plasmid pGR2PL6 with a 74 bp DNA fragment, and 100
Plasmid pGR2PL3 having a 7 bp DNA fragment was obtained. Although there were large differences in the chain length and amino acid sequence of the precursor of the GALR2 activator encoded by both DNA sequences, the mature activator (mature peptide) portion expected to be produced by processing was found. The sequences were identical. The resulting two plasmids were introduced into E. coli TOP10 by a known method, and each of the transformants was TOP10 / p.
GR2PL6 and TOP10 / pGR2PL3 were obtained.

Reference Example 6 Peptide having the amino acid sequence represented by SEQ ID NO: 1: Ala-Pro-Val-His-Arg-Gly-Ar
g-Gly-Gly-Trp-Thr-Leu-Asn-Ser-Ala-Gly-Tyr-Leu-Leu-
Gly-Pro-Val-Leu-His-Pro-Pro-Ser-Arg-Ala-Glu-Gly-Gl
y-Gly-Lys-Gly-Lys-Thr-Ala-Leu-Gly-Ile-Leu-Asp-Leu-
Trp-Lys-Ala-Ile-Asp-Gly-Leu-Pro-Tyr-Pro-Gln-Ser-Gl
Production of n-Leu-Ala-Ser (SEQ ID NO: 1) Commercial Boc-Ser (Bzl) 1-OCH ₂ -PAM resin (0.73 mole / g
n) Place 0.5 m moles in the reaction solution of the peptide synthesizer ABI 430A, and use the Boc-strategy (NMP-HOBt) peptide synthesis method for Boc.
-Ala, Boc-Leu, Boc-Gln, Boc-Ser (Bzl), Boc-Pro, Boc
-Tyr (Br-Z), Boc-Gly, Boc-Asp (OcHex), Boc-Ile, Boc-
Lys (Cl-Z), Boc-Trp (CHO), Boc-Thr (Bzl), Boc-Glu (OcH
ex), Boc-Arg (Tos), Boc-His (Bom), Boc-Val, Boc-Asn,
Were introduced in the desired amino acid sequence in order to obtain the desired protected peptide resin. 0.105 g of this resin is 1.1 g of p-cresol,
10 ml of anhydrous hydrogen fluoride with 1.2 ml of 1,4-butanedithiol
After stirring at 0 ° C. for 60 minutes, hydrogen fluoride was distilled off under reduced pressure.
Diethyl ether was added to the residue, and the precipitate was filtered. 50% acetic acid aqueous solution was added to this precipitate for extraction, and the insoluble portion was removed.
After fully concentrating the extract, the extract was applied to a Sephadexho G-25 column (2.0 x 80 cm) packed with 50% aqueous acetic acid, developed with the same solvent, and the main fractions were collected and reverse phase packed with LiChroprep RP-18. 0.1% TFA water on a chromatographic column (2.6 x 60 cm) 200
The mixture was washed with 0.1 ml of TFA and 300 ml of 0.1% TFA in water and 300 ml of 50% acetonitrile in water was subjected to linear gradient elution. The main fractions were collected, concentrated and lyophilized to obtain 39 mg of a white powder. This was further applied to an ion-exchange chromatography column packed with CM-cellulofine, and a linear gradient elution was performed at a concentration of 50 mM to 200 mM ammonium acetate. The main fraction was collected and freeze-dried repeatedly to obtain 10 mg of a white powder. (M + H) by mass spectrometry ⁺ 6204.7 (calculated value 6205.2) HPLC elution time 21.8 min Column conditions Column Wakosil 5C18T 4.6 x 100mm Eluent: A solution-0.1% TFA water, B solution-0.1% TFA containing acetonitrile A / B: 95/5 to 45/55 linear gradient elution (25 min) Flow rate: 1.0 ml / min

Reference Example 7 A peptide having the amino acid sequence represented by SEQ ID NO: 2: Ala-Pro-Ala-His-Arg-Gly-Ar
g-Gly-Gly-Trp-Thr-Leu-Asn-Ser-Ala-Gly-Tyr-Leu-Leu-
Gly-Pro-Val-Leu-His-Leu-Ser-Ser-Lys-Ala-Asn-Gln-Gl
y-Arg-Lys-Thr-Asp-Ser-Ala-Leu-Glu-Ile-Leu-Asp-Leu-
Trp-Lys-Ala-Ile-Asp-Gly-Leu-Pro-Tyr-Ser-Arg-Ser-Pr
A peptide consisting of o-Arg-Met-Thr (SEQ ID NO: 2) and an amino acid sequence represented by SEQ ID NO: 3: Ala-Pro-Ala
-His-Arg-Gly-Arg-Gly-Gly-Trp-Thr-Leu-Asn-Ser-Ala-G
ly-Tyr-Leu-Leu-Gly-Pro-Val-Leu-His-Leu-Pro-Gln-Met
-Gly-Asp-Gln-Asp-Gly-Lys-Arg-Glu-Thr-Ala-Leu-Glu-I
le-Leu-Asp-Leu-Trp-Lys-Ala-Ile-Asp-Gly-Leu-Pro-Tyr
Production of -Ser-His-Pro-Pro-Gln-Pro-Ser (SEQ ID NO: 34) Synthesizing and purifying in the same manner as in Reference Example 6 using a commercially available Boc-Thr (Bzl) 1-OCH ₂ -PAM resin and obtaining it can.

Example 1 Preparation of Structural Gene of Peptide Consisting of Amino Acid Sequence Represented by SEQ ID NO: 1 (See FIG. 7) The structural gene of the peptide of the present invention was obtained from plasmid pGR2PL6 obtained in Reference Example 5 N adjacent to the upstream of the gene
Primer 1: 5'-A with de I cleavage site and methionine
GCATATGGCTCCGGTCCACAGG-3 ′ (SEQ ID NO: 38, manufactured by Kikkotec), a stop codon and BamHI adjacent downstream.
Primer 2 with cleavage site: 5'-CTGGATCCTCAGGAGGCCA
It was amplified by PCR using ACTGAGAC-3 '(SEQ ID NO: 39, manufactured by Greiner Japan). TOPO TA
PCRI using Cloning Kit (Invitrogen)
It was ligated to the I-TOPO vector to create pCRII / GAL. This plasmid was transformed into TOP10 One Shot competent cells, and X-gal (5-Bromo-4-Chloro-3-Indolyl-bD-Galacto
se) was spread on an LB agar medium (1% peptone, 0.5% yeast extract, 0.5% sodium chloride, 2% agar) containing 50 μg / mL ampicillin, and cultured at 37 ° C. for 1 day. -Transformants were selected using galactosidase activity as an index. LB medium containing 50 μg / mL ampicillin (1% peptone, 0.5% yeast extract,
(0.5% sodium chloride) overnight.
The plasmid was recovered using p Kit (Qiagen).
Further, site-specific using primer 3: 5'-CAGCCCTCGGCATCCTGGACC-3 '(SEQ ID NO: 40 manufactured by Greiner Japan) and primer 4: 5'-GGTCCAGGATGCCGAGGGCTG-3' (SEQ ID NO: 41 manufactured by Greiner Japan) Existing adjacent to BamH I in the peptide structural gene consisting of the amino acid sequence represented by SEQ ID NO: 1 of the present invention by means of a mutagenesis (Quick Change, manufactured by STRATAGENE)
pCRII / GALdesBam lacking the aI recognition site was created.
The nucleotide sequence of the structural gene portion of the peptide comprising the amino acid sequence represented by SEQ ID NO: 1 of the present invention in the plasmid was confirmed using an Applied Biosystems model 377 DNA sequencer. P whose nucleotide sequence was confirmed
2 μg of CRII / GALdesBam was cut with NdeI, and the ends were blunt-ended with T4 DNA polymerase (DNA Blunting Kit, manufactured by Takara Shuzo). Next, after digestion with EcoR V, 3% agarose gel electrophoresis was performed.
Extraction was carried out using n Kit (manufactured by Qiagen) and dissolved in 25 μL of TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA).

Example 2 Preparation of a Peptide Expression Plasmid Consisting of the Amino Acid Sequence Represented by SEQ ID NO: 1 a) Preparation of a Fusion Protein Expression Vector (See FIG. 8) From June 15, 1998, Ministry of International Trade and Industry FERM BP-6 was added to NIBH.
Escherichia coli M which has been deposited as 388 and deposited on June 25, 1997 with the Institute of Fermentation (IFO) as IFO 16100.
After cutting 1 μg of the plasmid pTB960-11 carried in M294 (DE3) / pTB960-11 with XbaI and AvaI
1% agarose gel electrophoresis was performed, and a DNA fragment of about 4.4 kbp was extracted using a QIAquick Gel Extraction Kit (Qiagen) and dissolved in 50 μL of TE buffer. hFGF mutein C
S23 structural gene deletion and Nde I
Both synthetic DNA (5′-CTAGACATATGCCAGCATTGC-3 ′ (SEQ ID NO: 42) and 5′-TCGGGCAATGCTGGCATATGT-3 ′ (SEQ ID NO: 43)) designed to insert a cleavage site and an initiation codon are manufactured by Greiner Japan. 1) each
To 100 μL of a phosphorylation reaction solution [50 mM Tris-HCl (pH 7.6), 10
mM MgCl ₂ , 5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM EDTA, 1 mM ATP, 10 units T4 polynucleotide kinase (manufactured by Nippon Gene)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. went. After completion of the reaction, phenol / chloroform extraction and ethanol precipitation were performed.
The precipitate was dissolved in 50 μL of a TE buffer, and the solution was kept at 80 ° C. for 10 minutes, and then gradually cooled at room temperature for annealing. Xba I-
Ava I DNA fragment and annealing solution were obtained from Takara DNA Ligati
Ligation was performed using on Kit Ver2 (Takara Shuzo). That is, 3 μL of distilled water and 5 μL of Ligation I solution were added to 1 μL of the Xba I-Ava I DNA fragment and 1 μL of the annealing solution, and reacted at 16 ° C. for 30 minutes. This ligation solution 10
E. coli JM109 competent cell (Toyobo) using μL
Was transformed and seeded on an LB agar medium containing 10 μg / mL tetracycline, and the resulting tetracycline-resistant colonies were selected. This transformant was cultured overnight in LB medium,
Plasmids were prepared using QIAprep8 Miniprep Kit (Qiagen). After cutting this plasmid with Nde I, 1%
Agarose gel electrophoresis was performed to confirm that a Nde I cleavage site was newly generated, and the plasmid was designated as plasmid pTBNde. Next, 1 μg of plasmid pTBNde was digested with PstI, and T4
After blunt-ending with DNA polymerase (DNA Blunting Kit, Takara Shuzo), phenol / chloroform extraction and ethanol precipitation were performed. The obtained precipitate is diluted with 10 μL of TE buffer.
After digestion with NdeI, 3% agarose gel electrophoresis was performed, and a DNA fragment of about 470 bp was extracted with QIAquick Gel Extraction.
Extraction was performed using Kit (manufactured by Qiagen) and dissolved in 25 μL of TE buffer. pBR322 was digested with NdeI, the ends were blunted with T4 DNA polymerase (DNA Blunting kit, manufactured by Takara Shuzo Co., Ltd.), and ligated again to prepare pBRdesNde lacking the NdeI recognition site. pET3c to Bgl II-Eco R
After cutting with V and recovering a fragment of about 0.26 kbp, the end was blunted with T4 DNA polymerase and ligated with the ScaI fragment of pBRdesNde to prepare pBR / T7 desNde. In addition, pBR was introduced by site-directed mutagenesis (Quick Change, STRATAGENE).
PBR322desBam was prepared in which 322 lacked the Bam HI recognition site. pBR322desBam Sph I-Eco RV fragment into pBR / T7 des
This was ligated with the SphI-EcoRV fragment of Nde to prepare a tetracycline resistance expression vector pTCII. Plasmid pTCII 1
After cutting μg with Bsm I and Pvu II, 1% agarose gel electrophoresis was performed.
Extraction was performed using the tion Kit and dissolved in 25 μL of TE buffer. This DNA fragment was blunt-ended with T4 DNA polymerase using a DNA Blunting Kit, and then ligated. After the ligation-finished solution was extracted with phenol / chloroform, ethanol precipitation was carried out and dissolved in 10 μL of TE buffer. This solution was digested with BamHI, blunt-ended with T4 DNA polymerase, further digested with NdeI, and subjected to 1% agarose gel electrophoresis.
Extracted using k Gel Extraction Kit and dissolved in 50 μL of TE buffer. 4 μL of the above 470 bp Nde I-Blunt DNA fragment
5 μL of Ligation I solution was added to 1 μL of the Nde I-Blunt DNA fragment of about 3.7 kbp and reacted at 16 ° C. for 30 minutes. Escherichia coli JM109 competent cells (manufactured by Toyobo Co., Ltd.) were transformed with 10 μL of the ligation solution, seeded on an LB agar medium containing 10 μg / mL tetracycline, and the resulting tetracycline-resistant colonies were selected. After culturing the transformant overnight in an LB medium, a plasmid was prepared using QIAprep8 Miniprep Kit to obtain a fusion protein expression vector pTFC.

B) Construction of a peptide expression strain consisting of the amino acid sequence represented by SEQ ID NO: 1 (see FIG. 9) 1 μg of the fusion protein expression vector pTFC was digested with BamHI and T4 DNA polymerase (DNA Blunting Kit, Takara Shuzo) After blunting the ends with 1% agarose gel electrophoresis.
It was extracted using on Kit (Qiagen) and dissolved in 50 μL of TE buffer. This fragment and the structural gene of the peptide of the present invention prepared in Example 1 were combined with Takara DNA Ligation Kit Ve.
Ligation was performed using r2 (Takara Shuzo). That is, 1 μL of a BamHI-cut blunting solution of pTFC and 4 μL of a structural gene solution of the peptide of the present invention were mixed, and 5 μL of Ligation I solution was added, followed by reaction at 16 ° C. for 30 minutes. E. coli JM109 competent cells (manufactured by Toyobo Co., Ltd.) were transformed with 10 μL of the ligation solution, seeded on an LB agar medium containing 10 μg / mL tetracycline, cultured at 37 ° C. for 1 day, and the resulting tetracycline-resistant colonies were isolated. Selected. This transformant was cultured overnight in an LB medium, and QIAprep8 Miniprep
The plasmid was recovered using Kit (manufactured by Qiagen), and was used as the peptide expression plasmid pTFCGAL of the present invention. The nucleotide sequence of the structural gene portion of the fusion protein of this plasmid is
Confirmation was performed using an Applied Biosystems model 377 DNA sequencer. This expression plasmid pTFCGA
L was transformed into E. coli MM294 (DE3), seeded on an LB agar medium containing 10 μg / mL tetracycline, cultured at 37 ° C. for 1 day, and a tetracycline-resistant transformant was selected, and the peptide expression strain of the present invention was selected. MM294 (DE3) / pTFCGAL was obtained.
This transformed E. coli MM294 (DE3) / pTFCGAL has the accession number FERM
BP-6678 was deposited on March 10, 1999 at the Research Institute of Microorganisms, Ministry of International Trade and Industry of Japan. It was deposited with the Fermentation Research Institute (IFO) under the accession number IFO 16260 on February 26, 1999.

Example 3 Culture of a Peptide-Expressing Strain Consisting of the Amino Acid Sequence Represented by SEQ ID NO: 1 The Peptide-Expressing Strain MM294 (DE3) / pTFCGAL Obtained in Example 2 Comprising the Amino Acid Sequence Represented by SEQ ID NO: 1 Was cultured in 1 L of LB medium containing 5 mg / L tetracycline at 37 ° C. for 16 hours with shaking. The obtained culture solution was 20 L of a main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1%).
1% ammonium chloride, 0.05% sodium chloride, 0.05% magnesium sulfate, 0.0005% thiamine hydrochloride, 1.5% glucose, 1.0% casamino acid, 1.0% yeast extract)
The cells were transplanted into a 50-L fermenter and cultured under aeration and agitation at 37 ° C., at an aeration rate of 20 L / min, and at a rotation speed of 200 rpm. The turbidity of the culture solution is about
At 1200 klet units, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 23.8 mg / L. At 30 minutes and 150 minutes after the addition of IPTG, 0.75% glucose was added, and culture was performed until 10 hours after the start of culture. The culture solution is centrifuged at 5000 rpm for 30 minutes,
About 830 g of bacterial cells were obtained.

Example 4 Purification of a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 In 200 g of the cells obtained in Example 3, 600 ml of 150 mM sodium chloride and 0.1 mM p-amidinophenylmethanesulfonyl fluoride hydrochloride ( APMSF), add 50 mM phosphate buffer (pH 7.0) containing 0.1 mM EDTA, suspend, and sonicate (BRANSON SON
After performing IFIER MODEL450), centrifugation (10,000 rpm, 10 minutes) was performed, and the supernatant was discarded to obtain an inclusion body. This inclusion
After suspending in 60 mL of distilled water and adding and dissolving 140 mL of formic acid, a peptide bond at the C-terminal side of methionine connecting the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 with the fusion protein CS23 was obtained. To perform the cleavage reaction, 2 g of cyanogen bromide was added, and the mixture was treated at room temperature for 24 hours. After completion of the reaction, the solution was dialyzed overnight against distilled water and centrifuged (10,000 rpm, 10 minutes). The supernatant was dialyzed again overnight against 50 mM Tris-HCl (pH 7.5), adjusted to pH 6.0 with hydrochloric acid, and centrifuged (10,000 rpm · 10
), About 400 mL of the centrifuged supernatant was obtained. This centrifuged supernatant was CM-equilibrated with 50 mM sodium acetate buffer (pH 6.0).
10mL in TOYOPEARL 650M (3.0cmID × 10cmL, manufactured by Tosoh Corporation)
/ min, and washed well with the buffer used for equilibration, followed by elution with a step gradient of 0-100% B (B = 50 mM sodium acetate buffer + 1 M sodium chloride, pH 6.0).
A fraction containing the peptide having the amino acid sequence represented by SEQ ID NO: 1 of the present invention was obtained. One-third of this fraction was equilibrated with 0.1% trifluoroacetic acid in C4P-50 (2.15 cm ID × 30 cm
L, manufactured by Showa Denko KK) at 5 mL / min, then 33-43% B
(B = 80% acetonitrile / 0.1% trifluoroacetic acid)
Elution was performed with a step gradient. Perform the same operation for 2/3
The amount was determined, and the fraction containing the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 was collected and freeze-dried to obtain 67 mg of a purified peptide product consisting of the amino acid sequence represented by SEQ ID NO: 1. . a) Analysis using SDS-polyacrylamide gel electrophoresis The purified peptide of the present invention consisting of the amino acid sequence represented by SEQ ID NO: 1 was purified from 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.001% bromide. 0.0625 Tris-HCl (pH 6.8) containing phenol blue [Laemmli, UK: N
, 227, 680 (1979)], boiled for 3 minutes, and electrophoresed on Multigel 15/25 (Daiichi Pure Chemicals). When the gel after electrophoresis was stained with Rapid CBB KANTO (Kanto Chemical), it was a single band (see FIG. 10). b) Amino acid composition analysis The purified peptide having the amino acid sequence represented by SEQ ID NO: 1 of the present invention was purified at 6 ° C. with 6N hydrochloric acid containing 1% phenol at 110 ° C.
Gas phase hydrolysis was performed for 24 and 48 hours, and the amino acid composition was determined using an amino acid analyzer (Hitachi L-8500A Amino Acid Analyzer). As a result, as shown in Table 3, the amino acid composition was consistent with the amino acid composition predicted from the cDNA base sequence.

[0069]

[Table 3]

C) N-terminal amino acid sequence analysis The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems model 477A). As a result, as shown in Table 4, the amino acid composition was consistent with the amino acid composition predicted from the cDNA base sequence.

[0071]

[Table 4]

D) Analysis of C-terminal amino acid The purified peptide having an amino acid sequence represented by SEQ ID NO: 1 of the present invention was subjected to gas-phase hydrolysis with anhydrous hydrazine at 100 ° C. for 3.5 hours to obtain an amino acid analyzer (Hitachi L. -8500A Amino
Acid Terminal) was used to determine the C-terminus. As a result,
As shown in Table 5, it coincided with the amino acid predicted from the cDNA base sequence.

[Table 5] e) Receptor binding activity Using the purified peptide product of the present invention, WO97-2443
As a result of measuring the receptor binding activity according to the method described in Japanese Patent Publication No. 6, the IC ₅₀ for [ ¹²⁵ I] -rat galanin
GALR1: 5.4 nM, rat GALR2: 2.4 nM.

[0073]

[Sequence Listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Production Method of Novel Physiological Active Peptide <160> 46 <210> 1 <211> 60 <212> PRT <213> Porcine <400> 1 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu Ala Ser 50 55 60 <210> 2 <211> 60 <212> PRT <213> Rat <400> 2 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Ser Ser Lys Ala Asn Gln Gly 20 25 30 Arg Lys Thr Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser Arg Ser Pro Arg Met Thr 50 55 60 <210> 3 <211> 60 <212> PRT <213> Human <400> 3 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Pro Gln Met Gly Asp Gln Asp 20 25 30 Gly Lys Arg Glu Thr Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser His Pro Pro Gln Pro Ser 50 55 60 <210> 4 <211> 21 <212> PRT <213> Rat, Human < 400> 4 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro 20 <210> 5 <211> 58 <212> PRT <213> Rat <400> 5 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Ser Ser Lys Ala Asn Gln Gly 20 25 30 Arg Lys Thr Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser Arg Ser Pro Arg 50 55 <210> 6 <211> 27 <212> PRT <213> Human <400> 6 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Pro Gln 20 25 <210> 7 <211> 21 <212> PRT <213> Porcine <400> 7 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro 20 <210> 8 <211> 346 <212> PRT <213> Rat <400> 8 Met Glu Leu Ala Pro Val Asn Leu Ser Glu Gly Asn Gly Ser Asp Pro 1 5 10 15 Glu Pro Pro Ala Glu Pro Arg Pro Leu Phe Gly Ile Gly Val Glu Asn 20 25 30 Phe Ile Thr Leu Val Val Phe Gly Leu Ile Phe Ala Met Gly Val Leu 35 40 45 Gly Asn Ser Leu Val Ile Thr Val Leu Ala Arg Ser Lys Pro Gly Lys 50 55 60 Pro Arg Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Ser Ile Ala Asp 65 70 75 80 Leu Ala Tyr Leu Leu Phe Cys Ile Pro Phe Gln Ala Thr Val Tyr Ala 85 90 95 Leu Pro Thr Trp Val Leu Gly Ala Phe Ile Cys Lys Phe Ile His Tyr 100 105 110 Phe Phe Thr Val Ser Met Leu Val Ser Ile Phe Thr Leu Ala Ala Met 115 120 125 Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg Ser Ser Ser 130 135 140 Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Phe Ile Trp Ala 145 150 155 160 Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr Tyr Gln Arg Leu Phe 165 170 175 His Arg Asp Ser Asn Gln Thr Phe Cys Trp Glu His Trp Pro Asn Gln 180 185 190 Leu His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe Gly Tyr Leu 195 200 205 Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val Leu Asn His 210 215 220 Leu H is Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu Ala Ser Lys 225 230 235 240 Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val Phe Gly Ile 245 250 255 Ser Trp Leu Pro His His Val Ile His Leu Trp Ala Glu Phe Gly Ala 260 265 270 Phe Pro Leu Thr Pro Ala Ser Phe Phe Phe Arg Ile Thr Ala His Cys 275 280 285 Leu Ala Tyr Ser Asn Ser Ser Val Asn Pro Ile Ile Tyr Ala Phe Leu 290 295 300 Ser Glu Asn Phe Arg Lys Ala Tyr Lys Gln Val Phe Lys Cys Arg Val 305 310 315 320 Cys Asn Glu Ser Pro His Gly Asp Ala Lys Glu Lys Asn Arg Ile Asp 325 330 335 Thr Pro Pro Ser Thr Asn Cys Thr His Val 340 345 <210> 9 <211> 372 <212> PRT <213> Rat <400> 9 Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly 1 5 10 15 Gly Ser Gly Gly Trp Gln Pro Glu Ala Val Leu Val Pro Leu Phe Phe 20 25 30 Ala Leu Ile Phe Leu Val Gly Thr Val Gly Asn Ala Leu Val Leu Ala 35 40 45 Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile 50 55 60 Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro 65 70 75 80 Ph e Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu 85 90 95 Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser 100 105 110 Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg 115 120 125 Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala 130 135 140 Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr 145 150 155 160 Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His 165 170 175 Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe 180 185 190 Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala 195 200 205 Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly 210 215 220 Ser Gly Ser Gln Arg Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile 225 230 235 240 Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile 245 250 255 Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala 260 265 270 Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn 275 280 285 Pro Ile V al Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg 290 295 300 Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly 305 310 315 320 Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu 325 330 335 Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu 340 345 350 Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu 355 360 365 365 Asp Pro Ala Cys 370 < 210> 10 <211> 370 <212> PRT <213> Rat <400> 10 Met Ala Asp Ile Gln Asn Ile Ser Leu Asp Ser Pro Gly Ser Val Gly 1 5 10 15 Ala Val Ala Val Pro Val Ile Phe Ala Leu Ile Phe Leu Leu Gly Met 20 25 30 Val Gly Asn Gly Leu Val Leu Ala Val Leu Leu Gln Pro Gly Pro Ser 35 40 45 Ala Trp Gln Glu Pro Ser Ser Thr Thr Asp Leu Phe Ile Leu Asn Leu 50 55 60 Ala Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala 65 70 75 80 Ala Ile Tyr Thr Leu Asp Ala Trp Leu Phe Gly Ala Phe Val Cys Lys 85 90 95 Thr Val His Leu Leu Ile Tyr Leu Thr Met Tyr Ala Ser Ser Phe Thr 100 105 110 Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Val Arg His Pro Leu 115 120 125 Arg Ser Arg Ala Leu Arg Thr Pro Arg Asn Ala Arg Ala Ala Val Gly 130 135 140 Leu Val Trp Leu Leu Ala Ala Leu Phe Ser Ala Pro Tyr Leu Ser Tyr 145 150 155 160 Tyr Gly Thr Val Arg Tyr Gly Ala Leu Glu Leu Cys Val Pro Ala Trp 165 170 175 Glu Asp Ala Arg Arg Arg Ala Leu Asp Val Ala Thr Phe Ala Ala Gly 180 185 190 Tyr Leu Leu Pro Val Ala Val Val Ser Leu Ala Tyr Gly Arg Thr Leu 195 200 205 Cys Phe Leu Trp Ala Ala Val Gly Pro Ala Gly Ala Ala Ala Ala Glu 210 215 220 Ala Arg Arg Arg Ala Thr Gly Arg Ala Gly Arg Ala Met Leu Ala Val 225 230 230 235 240 Ala Ala Leu Tyr Ala Leu Cys Trp Gly Pro His His Ala Leu Ile Leu 245 250 255 Cys Phe Trp Tyr Gly Arg Phe Ala Phe Ser Pro Ala Thr Tyr Ala Cys 260 265 270 270 Arg Leu Ala Ser His Cys Leu Ala Tyr Ala Asn Ser Cys Leu Asn Pro 275 280 285 Leu Val Tyr Ser Leu Ala Ser Arg His Phe Arg Ala Arg Phe Arg Arg 290 295 300 Leu Trp Pro Cys Gly Arg Arg Arg His Arg His His His Arg Ala His 305 310 315 320 Arg Ala Leu Arg Arg Val Gln Pro Ala Ser Ser Gly Pro Ala Gly Tyr 325 330 335 Pro Gly Asp Ala Arg Pro Arg Gly Trp Ser Met Glu Pro Arg Gly Asp 340 345 350 Ala Leu Arg Gly Gly Gly Gly Glu Thr Arg Leu Thr Leu Ser Pro Arg Gly 355 360 365 Pro Gln 370 <210> 11 <211> 29 <212> PRT <213> Porcine <400> 11 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile 1 5 10 15 Asp Asn His Arg Ser Phe His Asp Lys Tyr Gly Leu Ala 20 25 <210> 12 <211> 123 <212> PRT <213> Porcine <400> 12 Met Pro Arg Gly Cys Ala Leu Leu Leu Ala Ser Leu Leu Leu Ala Ser 1 5 10 15 Ala Leu Ser Ala Thr Leu Gly Leu Gly Ser Pro Val Lys Glu Lys Arg 20 25 30 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile 35 40 45 Asp Asn His Arg Ser Phe His Asp Lys Tyr Gly Leu Ala Gly Lys Arg 50 55 60 Glu Leu Glu Pro Glu Asp Glu Ala Arg Pro Gly Gly Phe Asp Arg Leu 65 70 75 80 Gln Ser Glu Asp Lys Ala Ile Arg Thr Ile Met Glu Phe Leu Ala Phe 85 90 95 Leu His Leu Lys Glu Ala Gly Ala Leu Gly Arg Leu Pro Gly Leu Pro 100 105 110 Ser Ala Ala Ser Ser Glu Asp Ala Gly Gln Ser 11 5 120 <210> 13 <211> 38 <212> PRT <213> Porcine <400> 13 Leu Gly Ser Pro Val Lys Glu Lys Arg Gly Trp Thr Leu Asn Ser Ala 1 5 10 15 Gly Tyr Leu Leu Gly Pro His Ala Ile Asp Asn His Arg Ser Phe His 20 25 30 Asp Lys Tyr Gly Leu Ala 35 <210> 14 <211> 146 <212> PRT <213> Human <400> 14 Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His 1 5 10 15 Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu 20 25 30 Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp 35 40 45 Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser 50 55 60 Ile Lys Gly Val Ser Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly 65 70 75 80 Arg Leu Leu Ala Ser Lys Ser Val Thr Asp Glu Cys Phe Phe Phe Glu 85 90 95 Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr 100 105 110 Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser 115 120 125 Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala 130 135 140 Lys Ser 145 <210> 15 <211> 567 <212> DNA <213> Ar tificial Sequence <400> 15 CCAGCATTGC CCGAGGATGG CGGCAGCGGC GCCTTCCCGC CCGGCCACTT CAAGGACCCC 60 AAGCGGCTGT ACTGCAAAAA CGGGGGCTTC TTCCTGCGCA TCCACCCCGA CGGCCGAGTT 120 GACGGGGTCC GGGAGAAGAG CGACCCTCAC ATCAAGCTAC AACTTCAAGC AGAAGAGAGA 180 GGAGTTGTGT CTATCAAAGG AGTGAGCGCT AATCGTTACC TGGCTATGAA GGAAGATGGA 240 AGATTACTAG CTTCTAAGTC TGTTACGGAT GAGTGTTTCT TTTTTGAACG ATTGGAATCT 300 AATAACTACA ATACTTACCG GTCAAGGAAA TACACCAGTT GGTATGTGGC ACTGAAACGA 360 ACTGGGCAGT ATAAACTTGG ATCTATGGCT CCGGTCCACA GGGGGCGAGG AGGCTGGACC 420 CTCAACAGTG CTGGTTACCT CCTGGGTCCC GTACTCCATC CGCCCTCCAG GGCTGAAGGA 480 GGCGGGAAGG GGAAGACAGC CCTCGGCATC CTGGACCTGT GGAAGGCCAT TGATGGGCTC 540 CCCTATCCCC AGTCTCAGTT GGCCTCC 567 <210> 16 <211> 384 <212> DNA <213> Human <400> 16 CCAGCATTGC CCGAGGATGG CGGCAGCGGC GCCTTCCCGC CCGGCCACTT CAAGGACCCC 60 AAGCGGCTGT ACTGCAAAAA CGGGGGCTTC TTCCTGCGCA TCCACCCCGA CGGCCGAGTT 120 GACGGGGTCC GGGAGAAGAG CGACCCTCAC ATCAAGCTAC AACTTCAAGC AGAAGAGAGA 180 GGAGTTGTGT CTATCAAAGG AGTGAGCGCT AATCGTTACC TGGCTAT GAA GGAAGATGGA 240 AGATTACTAG CTTCTAAGTC TGTTACGGAT GAGTGTTTCT TTTTTGAACG ATTGGAATCT 300 AATAACTACA ATACTTACCG GTCAAGGAAA TACACCAGTT GGTATGTGGC ACTGAAACGA 360 ACTGGGTC <GC> CGCTCT <CC> CT <CC> CT <CC> CT <GC> ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGC 120 ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC 180 TGCCCAGCAT TGCCCGAGGA TGGCGGCAGC GGCGCCTTCC CGCCCGGCCA CTTCAAGGAC 240 CCCAAGCGGC TGTACTGCAA AAACGGGGGC TTCTTCCTGC GCATCCACCC CGACGGCCGA 300 GTTGACGGGG TCCGGGAGAA GAGCGACCCT CACATCAAGC TACAACTTCA AGCAGAAGAG 360 AGAGGAGTTG TGTCTATCAA AGGAGTGAGC GCTAATCGTT ACCTGGCTAT GAAGGAAGAT 420 GGAAGATTAC TAGCTTCTAA GTCTGTTACG GATGAGTGTT TCTTTTTTGA ACGATTGGAA 480 TCTAATAACT ACAATACTTA CCGGTCAAGG AAATACACCA GTTGGTATGT GGCACTGAAA 540 CGAACTGGGC AGTATAAACT TGGATCT 567 <210> 18 <211> 567 <212> DNA <213> Artificial Sequence <400> 18 GCTCCGGTCC ACAGGGGG CG AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT 60 CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGC 120 ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC 180 TGTCCAGCAT TGCCCGAGGA TGGCGGCAGC GGCGCCTTCC CGCCCGGCCA CTTCAAGGAC 240 CCCAAGCGGC TGTACTGCAA AAACGGGGGC TTCTTCCTGC GCATCCACCC CGACGGCCGA 300 GTTGACGGGG TCCGGGAGAA GAGCGACCCT CACATCAAGC TACAACTTCA AGCAGAAGAG 360 AGAGGAGTTG TGTCTATCAA AGGAGTGAGC GCTAATCGTT ACCTGGCTAT GAAGGAAGAT 420 GGAAGATTAC TAGCTTCTAA GTCTGTTACG GATGAGTGTT TCTTTTTTGA ACGATTGGAA 480 TCTAATAACT ACAATACTTA CCGGTCAAGG AAATACACCA GTTGGTATGT GGCACTGAAA 540 CGAACTGGGC AGTATAAACT TGGATCT 567 <210> 19 <211> 180 <212> DNA <213> Porcine <400> 19 GCTCCGGTCC ACAGGGGGCG AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT 60 CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGG 120 ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC 180 <210> 20 <211> 180 <212> DNA <213> Rat <400> 20 GCACCTGCTC ACAGGGGACG AGGAGGCTGG ACCCTCAATA GTG CTGGTTA CCTCCTGGGT 60 CCTGTCCTCC ACCTTTCCTC AAAGGCCAAC CAGGGCAGGA AGACAGACTC AGCTCTTGAG 120 ATCCTAGACC TGTGGAAGGC CATAGATGGG CTCCCTTATT CCCGCTCTCC AAGGATGACC 180 <210> 21 <211> 180 <212> DNA <213> Human <400> 21 GCACCTGCCC ACCGGGGACG AGGAGGCTGG ACCCTCAATA GTGCTGGCTA CCTTCTGGGT 60 CCCGTCCTCC ACCTTCCCCA AATGGGTGAC CAAGACGGAA AGAGGGAGAC AGCCCTTGAG 120 ATCCTAGACC TGTGGAAGGC CATCGATGGG CTCCCCTACT CCCACCCTCC ACAGCCCTCC 180 <210> 22 <211> 27 <212> DNA <213> Artifical Sequence <220> <223> <400> 22 GTCGACATGA ATGGCTCCGG CAGCCAG 27 <210> 23 <211> 32 <212> DNA <213> Artifical Sequence <220> <223> <400> 23 ACTAGTTTAA CAAGCCGGAT CCAGGGTTCT AC 32 <210> 24 <211> 34 <212> PRT <213> Porcine <400> 24 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 Gly Lys <210> 25 <211> 32 <212> PRT <213> Porcine <400 > 25 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 <210> 26 <211> 9 <212> PRT <213> Porcine <400> 26 Ala Pro Val His Arg Gly Arg Gly Gly 1 5 <210> 27 <211> 11 <212> PRT <213> Porcine <400> 27 Xaa Ala Ile Asp Gly Leu Pro Tyr Pro Gln Ser 1 5 10 <210> 28 <211> 27 <212> PRT <213> Porcine <400> 28 Leu Leu Gly Pro Val Leu His Pro Pro Ser Xaa Ala Glu Gly Gly Gly 1 5 10 15 Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu 20 25 <210> 29 <211> 6 <212> PRT <213> Porcine <400> 29 Thr Leu Asn Ser Ala Gly 1 5 <210> 30 <211> 44 <212> PRT <213> Porcine <400> 30 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu 35 40 <210> 31 <211> 23 <212> DNA <213> Artifical Sequence <220 > <223> <400> 31 CAYMGNGGIM GNGGIGGSTG GAC 23 <210> 32 <211> 20 <212> DNA <213> Artifical Sequence <220> <223> <400> 32 GGHTGGACNC TNAAYAGYBC 20 <210> 33 <211> 23 <212> DNA <213> Artifical Sequence <22 0> <223> <400> 33 ATICCNAGIG CNGTYTTICC YTT 23 <210> 34 <211> 98 <212> DNA <213> Porcine <400> 34 GGCTGGACTT TAAATAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG 60 GCTGAAGGAG GCGGGAAGGG CAAAACAGCC CTGGGCAT 98 211> 98 <212> DNA <213> Porcine <400> 35 GGTTGGACTT TGAACAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG 60 GCTGAAGGAG GCGGGAAGGG CAAAACCGCC CTAGGCAT 98 <210> 36 <211> 20 <212> DNA <213> Artifical Sequence <220> <223> <400> 36 GGHTGGACNC TNAAYAGYGC 20 <210> 37 <211> 23 <212> DNA <213> Artifical Sequence <220> <223> <400> 37 ATDCCBAGGG CDGTTTTGCC CTT 23 <210> 38 <211> 23 <212> DNA <213> Artifical Sequence <220> <223> <400> 38 AGCATATGGC TCCGGTCCAC AGG 23 <210> 39 <211> 27 <212> DNA <213> Artifical Sequence <220> <223> <400> 39 CTGGATCCTC AGGAGGCCAA CTGAGAC 27 <210> 40 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 40 CAGCCCTCGG CATCCTGGAC C 21 <210> 41 <211> 21 <212> DNA <213> Artifical Sequence <220 > <223> <400> 41 GGTCCAGGAT GCCGAGGGCT G 21 <210> 42 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 42 CTAGACATAT GCCAGCATTG C 21 <210> 43 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 43 TCGGGCAATG CTGGCATATG T 21 <210> 44 <211> 189 <212> PRT <213> Artifical Sequence <220> <223> <400> 44 Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His 1 5 10 15 Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu 20 25 30 Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp 35 40 45 Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser 50 55 60 Ile Lys Gly Val Ser Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly 65 70 75 80 Arg Leu Leu Ala Ser Lys Ser Val Thr Asp Glu Cys Phe Phe Phe Glu 85 90 95 Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr 100 105 110 Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser 115 120 125 Met Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala 130 135 140 Gly Tyr Leu Leu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu Gl y 145 150 155 160 Gly Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu Trp Lys Ala 165 170 175 Ile Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu Ala Ser 180 185 <210> 45 <211> 189 <212> PRT <213> Artifical Sequence <220> <223> <400> 45 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu Ala Ser Cys Pro Ala Leu 50 55 60 Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp 65 70 75 80 Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His 85 90 95 Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile 100 105 110 Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly 115 120 125 Val Ser Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu 130 135 140 Ala Ser Lys Ser Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu 145 150 155 160 Ser Asn Asn Tyr Asn T hr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr 165 170 175 Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser 180 185

[0074]

[Brief description of the drawings]

FIG. 1 shows the reaction mechanism of the present invention by S-cyanoation or hydrolysis.

Galanin by [Figure 2] ^[35 S] GTPγS binding test,
4 shows the results of detection of the receptor activating action.

[FIG. 3] [ ³⁵ S] GT using the GALR2-expressing cell membrane fraction of the sample fraction obtained in Reference Example 2 (2-3)
4 shows the results of a PγS binding test.

FIG. 4 shows the results of analysis of a sample fraction obtained in Reference Example 2 (2-3) using a pig galanin radioimmunoassay kit (Peninsula).

FIG. 5 shows the results of molecular weight analysis of components having GALR2 activating action ([ ³⁵ S] GTPγS binding promoting activity) obtained in Reference Example 2 (2-4) by gel filtration high performance liquid chromatography.

FIG. 6 shows the results of molecular weight analysis of known peptides by gel filtration high performance liquid chromatography in Reference Example 2 (2-4).

FIG. 7 shows a diagram relating to a method for preparing the structural gene of the porcine ligand peptide described in Example 1.

FIG. 8 shows a construction diagram of a vector for expressing a fusion protein described in Example 2.

FIG. 9 shows a construction diagram of the pig-type ligand peptide expression strain described in Example 2.

FIG. 10 shows an analysis result (electropherogram) using SDS-polyacrylamide gel electrophoresis described in Example 4.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/21 C12N 1/21 5/10 C12P 21/02 C C12P 21/02 C12N 5/00 A // (C12P 21/02 C12R 1:19) F term (reference) 4B024 AA03 AA20 BA21 BA63 CA04 CA07 DA06 HA03 HA06 HA20 4B064 AG01 AG20 BA12 CA02 CA10 CA19 CB30 CC24 CE10 DA01 DA16 4B065 AA26X AA90Y AB01 BA02 BD03 BD32 CA24 AA4A10A AA50 BA20 CA40 DA50 FA74 GA21 HA04

Claims (11)

[Claims] 1. A fusion protein or peptide in which a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the N-terminal of a protein or peptide having a cysteine at the N-terminal. To a peptide bond containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4, wherein the peptide bond is subjected to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue. Law. 2. A fusion protein or peptide in which a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the N-terminal of a protein or peptide having a cysteine at the N-terminal. Culturing a transformant carrying a vector having a gene encoding the same, expressing the fusion protein or peptide, and subjecting the expressed fusion protein or peptide to a cleavage reaction of the peptide bond on the amino group side of the cysteine residue. A method for producing a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 or a salt thereof. 3. The method according to claim 1, wherein the cleavage reaction of the peptide bond on the amino group side of the cysteine residue is an S-cyanylation reaction and a hydrolysis reaction following the reaction. 4. A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is identical or substantially identical with the amino acid sequence represented by SEQ ID NO: 1, 2 or 3. The method according to claim 1 or 2, wherein the peptides have the same amino acid sequence. 5. A fusion protein or peptide in which a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the C-terminal of a protein or peptide having methionine at the C-terminus. To
A method for producing a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof, which is subjected to a cleavage reaction of a peptide bond on the carboxyl group side of a methionine residue. . 6. A fusion protein or peptide in which a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is linked to the C-terminal of a protein or peptide having methionine at the C-terminus. Culturing a transformant carrying a vector having a gene encoding the same, expressing the fusion protein or peptide, and subjecting the expressed fusion protein or peptide to a cleavage reaction of a peptide bond on the carboxyl group side of a methionine residue. A method for producing a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 or a salt thereof. 7. The method according to claim 5, wherein cyanogen bromide is used for the cleavage reaction of the peptide bond on the carboxyl group side of the methionine residue. 8. A peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 is the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, 5 or 6. The method according to claim 5 or 6, wherein the peptides have the same amino acid sequence. 9. An amino acid sequence represented by SEQ ID NO: 4 at the C-terminus of a protein or peptide having a methionine at the C-terminus or at the N-terminus of a protein or peptide having a cysteine at the N-terminus A fusion protein or peptide or a salt thereof, in which a peptide comprising the amino acid sequence of 10. A vector having a gene encoding the fusion protein or peptide according to claim 9. 11. A transformant containing the vector according to claim 10.