JP2000262285A - Preparation of frozen microbial cell body of ammonia oxidative bacterium and frozen microbial cell body - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain an ammonia oxidative bacterium which is increased in the shelf life of microbial cell body and the handling by lyophilizing an ammonia oxidative bacterium containing luciferase gene along with a protective agent for protecting bioluminescent ability and nitrification inhibitor respondent ability. SOLUTION: The objective frozen microbial cell body of an ammonia oxidative bacterium which permits the improvement in the shelf life of microbial cell body or the rapidness and convenience in handling and can maintain bioluminescent activity over a long period of time is obtained by lyophilizing the ammonia oxidative bacterium (e.g. Nitrosomonas europae or the like) with a luciferase gene (e.g. Vibrio harvey-derived luciferase gene or the like) in the presence of a protective agent containing a protein, e.g. albumin, globulin, skim milk or the like, which protects the bioluminescent ability of the above ammonia oxidative bacterium and the respondent ability to nitrification inhibitors, when the ammonia oxidative bacterium with luciferase gene is lyophilized.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for preparing frozen cells for storing ammonia-oxidizing bacteria having a luciferase gene, and to frozen cells of ammonia-oxidizing bacteria.

[0002]

2. Description of the Related Art Ammonia-oxidizing bacteria are autotrophic bacteria that obtain energy through a chemical reaction that oxidizes ammonia to produce nitrite, and the ammonia-oxidizing reaction by these bacteria plays an important role in the nitrogen cycle in the natural environment. I am carrying it. Bacteria belonging to the genus Nitrosomonas belong to such ammonia-oxidizing bacteria, and are known to widely inhabit the environment such as soil, water, and drainage plants.

[0003] In environmental purification, the removal of ammonia nitrogen from wastewater is carried out by a process simulating the circulation of nitrogen in the natural environment. In other words, ammonia in wastewater is oxidized to nitrite or nitric acid using ammonia-oxidizing bacteria and nitrite-oxidizing bacteria, and then nitric acid or nitrite is reduced to nitrogen gas by bacteria having nitrogen-respiring ability and released into the air. I do. However, compared with BOD removal, the nitrogen removal process is often somewhat unstable, and sometimes the treatment capacity is reduced and the quality of the treated water is deteriorated. It has become.

[0004] The main cause of this is that ammonia oxidizing bacteria contained in activated sludge are different from other heterotrophic microorganisms.
It is highly susceptible to environmental changes, and its biological activity is easily reduced by physical factors such as temperature and pH changes and low-concentration chemical substances present in wastewater. From the viewpoint of molecular microbiology, it has been pointed out that ammonia oxidase (ammonia monooxygenase), which acts as a catalyst in the first oxidation reaction of ammonia oxidation, is easily deactivated by various chemical substances and physical factors.

It is necessary to detect such a decrease in the biological activity of ammonia-oxidizing bacteria due to physical and chemical factors at an early stage and to take measures by quickly improving the treatment process. Desirably, the inhibitors present in the environment and the physical factors that affect them are so diverse that it is virtually impossible to separate and quantify individual factors using instrumental or chemical analysis. For this reason, a measurement method using nitrifying bacteria that can comprehensively evaluate factors inhibiting cells is required. Such a method must be easily handled by workers who are not familiar with special biochemical techniques so that the measurement results can be promptly applied to the operation management of the wastewater treatment plant. It must be quick and easy.

In the prior art, inhibition of ammonia-oxidizing bacteria can be estimated from comparison of ammonia oxidation rates under conditions simulating environmental conditions. That is, a group of organisms such as ammonia-oxidizing bacteria or activated sludge containing the bacteria is suspended in test water containing ammonia, and aerobically incubated under conditions simulating environmental conditions, and the ammonia concentration, dissolved oxygen concentration, The ammonia oxidation rate is measured using the nitric acid concentration or the like as an index, and the decrease in the rate can be measured. However, such a method has a problem that it lacks simplicity and quickness because the concentration of the indicator substance in the sample is measured over time and the ammonia oxidation rate is calculated from the increase or decrease.

As a simpler and quicker measuring method, there has been known a method of quantitatively measuring a decrease in the amount of luminescence to a nitrification inhibitor using a recombinant ammonia-oxidizing bacterium containing a luciferase gene. Luciferase is a luminescent enzyme that catalyzes an oxidation reaction and causes bioluminescence, and is roughly classified into those derived from animal cells such as fireflies and those derived from luminescent bacteria such as bacteria belonging to the genus Vibrio . The former emits light by catalyzing an oxidation reaction represented by the following reaction formula (1) and the latter by the following reaction formula (2).

[0008]

[Image Omitted] Luciferin + O ₂ + ATP → Oxyluciferin + CO ₂ + ADP + Pyrophosphate + light ... (1) Reduced flavin mononucleotide (FMNH ₂ ) + Long-chain aldehyde (RCHO) + O ₂ → FMN + RCOOH + H ₂ O + light ... (2)

In a bacterial luciferase reaction, FMNH ₂
Is generated from NADH or NADPH by the reaction of FMN reductase present in the cell. When a certain amount of luciferase and FMN reductase is present, the intensity of luminescence depends on the concentrations of NADH and NADPH. In ammonia oxidizing bacteria, NADH is produced using approximately 1/40 of the reducing power generated by hydroxylamine oxidoreductase. Therefore, when the ammonia monooxygenase or hydroxylamine oxidoreductase of the ammonia-oxidizing bacteria is inhibited by the nitrification inhibitor, a series of oxidation reactions starting from the ammonia oxidation reaction is stopped, and the NADH concentration sharply decreases. Therefore, by monitoring the concentration of NADH in cells using the degree of bioluminescence as an index, it is possible to measure the intensity of nitrification inhibition. Even in animal cell luciferase, when the ammonia oxidase is inhibited by a nitrification inhibitor,
Production of reducing substances stops, causing a sharp drop in ATP concentration. Therefore, by monitoring the concentration of ATP in cells using the degree of bioluminescence as an index, it is possible to measure the intensity of nitrification inhibition.

In the measurement of bioluminescence, luminescence can be quantitatively measured by using a measuring instrument such as a luminometer. Since the reaction occurs in a short time, the measurement time is short. In addition, since the amount of luminescence can be measured without destroying the bacterial cells, the operation is simple, and monitoring by automation can be expected. Specific examples of the above technology include Nitrosomonas
A known example using a recombinant obtained by introducing a luciferase gene derived from Vibrio fischeri into a genus bacterium (EP705904), and a vibrio harvey ( V ) from Nitrosomonas europaea.
ibrio harveyi ) using a recombinant into which a luciferase gene has been introduced (Japanese Patent Laid-Open No. 10-108697).
No.) are known.

In order to use such a bioluminescent ammonia-oxidizing bacterium at a site such as a human waste treatment plant or a factory wastewater treatment facility, cultivation and preparation at the site are economically and facility-inefficient. Because it is possible, culture in a fermentation facility,
It is necessary to carry the prepared microbial cells to the site while maintaining their activity and perform the measurement. Since it is technically difficult to store the culture solution itself while maintaining its activity for a long period of time, it is difficult to preserve frozen culture cells such as frozen cells and freeze-dried cells that can withstand long-term storage and can be easily restored in a short time. A method using bacterial cells is expected.

[0012] Frozen cells are generally used for long-term storage of microorganisms. For example, it is prepared by freezing rapidly quenched bacterial cells having high biological activity in the presence of a protective agent such as protein or saccharide. The prepared frozen cells can be reconstituted by thawing at room temperature or on ice. Alternatively, by inoculating the melted cell fluid in a fresh medium suitable for growth and culturing the cells, it is possible to restore the cells with sufficient biological activity.

However, the conventional freezing method is generally a method only for maintaining the growth of microorganisms, and does not consider maintaining characteristics such as luminescence activity after the storage period. That is, when the purpose is to measure a nitrification inhibitor using an ammonia-oxidizing bacterium containing a luciferase gene, the finally reconstituted bacterial cell suspension has sufficient luminescence activity at the end of culture (before freezing). And a rapid decrease in its bioluminescence upon addition of nitrification inhibitors is observed, and furthermore such properties need to be maintained without inactivation during long storage periods. A method for preparing frozen cells maintaining such characteristics high after restoration has not been studied at all.

Japanese Patent Publication No. 61-50594 discloses a polyurethane foam in which a peptide matrix composed of albumin is formed in a molecule, which is impregnated with a liquid medium, and the polyurethane foam is inoculated with microorganisms and statically cultured. A method for preserving seed microorganisms in which the obtained seed microorganisms are cryopreserved is described. However, in the above publication,
By adding albumin to bacteria and cryopreserving,
It is not described that the expression of the luminescent ability of bacteria having the luciferase gene can be protected, and the action of albumin on frozen cells is completely unknown. Furthermore, the above-mentioned publication also discloses that frozen cells can be obtained that can easily and quickly detect the presence or degree of inhibition of the nitrification activity of ammonia-oxidizing bacteria and that can be stored for a long period of time. Absent.

Japanese Patent Publication No. 5-503850 describes a microorganism culture in the form of dry solid particles containing a microorganism, an antioxidant, a monocarboxy α-amino acid and skim skim milk powder. However, in the above publication,
It is not described that the addition of skim milk to bacteria and cryopreservation can protect the luminescence of bacteria having a luciferase gene, and the effect of skim milk on frozen cells is completely unknown. Furthermore, the above-mentioned publication also discloses that frozen cells can be obtained that can easily and quickly detect the presence or degree of inhibition of the nitrification activity of ammonia-oxidizing bacteria and that can be stored for a long period of time. Absent.

[0016]

SUMMARY OF THE INVENTION An object of the present invention is to provide an ammonia-oxidizing bacterium capable of improving the preservability of cells, speeding up and simplifying handling, and maintaining bioluminescence activity for a long period of time. Of the present invention is to propose a method for preparing frozen cells. Another object of the present invention is to provide a frozen ammonia-oxidizing bacterial cell which can improve the preservability of the cell, speed up and simplify the handling thereof, and maintain the bioluminescence activity for a long period of time. .

[0017]

The present invention relates to the following method for preparing frozen cells of ammonia-oxidizing bacteria and the frozen cells. (1) Freezing of an ammonia-oxidizing bacterium in which an ammonia-oxidizing bacterium having a luciferase gene is frozen in the presence of a protective agent containing a protein that protects the bioluminescence ability of the ammonia-oxidizing bacterium and protects the response ability to a nitrification inhibitor A method for preparing cells. (2) The method according to the above (1), wherein the protective agent is at least one selected from the group consisting of albumin, globulin and skim milk. (3) An ammonia-oxidizing bacterium obtained by freezing an ammonia-oxidizing bacterium having a luciferase gene in the presence of a protective agent containing a protein that protects the bioluminescence ability of the ammonia-oxidizing bacterium and protects the response ability to a nitrification inhibitor. Frozen cells.

In the present invention, the ammonia-oxidizing bacterium used for the preparation of frozen cells is not particularly limited as long as it has a luciferase gene in the cell and has bioluminescence ability. Or a recombinant into which the luciferase gene has been introduced, but a recombinant is preferred. As a cell that can be particularly preferably used in the present invention, a recombinant ammonia-oxidizing bacterium transformed by introducing a luciferase gene into an ammonia-oxidizing bacterium is preferable.

The ammonia-oxidizing bacterium used as a host of the above recombinants oxidizes ammonia to produce nitrite,
It is an autotrophic bacterium that assimilates carbon dioxide using the energy obtained at this time, and specifically, bacteria of the genus Nitrosomonas and Nitrosospi
ra ) bacteria, Nitrosovibrio bacteria and the like. More specifically, Nitrosomonas e
uropaea IFO14298 strain and the like. These ammonia oxidizing bacteria are ATCC (American Type CultureCollectio)
n) and can be obtained from public microbial preservation institutions such as the IFO (Institute for Fermentation, Osaka), and those obtained from these institutions can be used. Nitrosomonas bacteria and the like separated from biological sludge of a nitrification and denitrification treatment system can also be used.

As the ammonia-oxidizing bacterium to be transformed by introducing the luciferase gene, an ammonia-oxidizing bacterium whose growth in the natural environment is restricted can also be used. For example, it can grow under artificially protected culture conditions due to the inactivation of the function of a gene involved in the restriction of growth, but lacks the growth ability under other environmental conditions or has a higher ability than wild-type strains. Ammonia-oxidizing bacteria whose growth capacity has been significantly reduced can be used.

When the ammonia oxidizing bacterium into which the luciferase gene has been introduced is used to detect inhibition of the nitrification activity of the ammonia oxidizing bacterium in a wastewater treatment plant, the ammonia oxidizing bacterium whose growth is restricted in a natural environment is used. By using the compound, it is expected that growth in the external environment (natural environment) is restricted, and safety can be improved from the viewpoint of biological containment.

The gene involved in growth is a gene encoding an enzyme necessary for a microorganism to synthesize a nutrient necessary for growth from an inorganic substance or a precursor; and acts on DNA damage repair when irradiated with ultraviolet rays. Genes: regulatory genes that control the expression of these genes and expression control regions such as promoters. As an ammonia-oxidizing bacterium whose growth is restricted in the natural environment, the phenotype can be relatively easily distinguished by the difference in growth between when a nutrient is added and when it is not added. Preferred is an ammonia-oxidizing bacterium having a deactivated gene.

The nutrients necessary for the growth of microorganisms include amino acids which are components of proteins such as tryptophan and aspartic acid; purines and pyrimidines which are components of nucleic acids such as adenine and guanine; thiamine (vitamin B ₁ ); Examples thereof include vitamins such as pantothenic acid. Specific examples of genes whose functions have been inactivated include, for example, thiamine synthetase (thiamine synthetase).
e) Gene, tryptophan synthetase
synthetase) gene. Inactivation can be performed by a method such as base substitution, base insertion, or deletion.

The following method is used to clone genes involved in the restriction of growth from ammonia-oxidizing bacteria. That is, first, the ammonia-oxidizing bacterial chromosomal DNA is partially or completely digested with an appropriate commercially available restriction enzyme, and the obtained digested DNA fragment is used for E. coli,
It is ligated to a cloning vector capable of autonomous replication in a host microorganism such as yeast, for example, a plasmid such as pUC19, pBR322, or YEp24. Next, host cells are transformed with the recombinant DNA molecule to construct a gene library comprising transformants containing various DNA fragments derived from chromosomal DNA of ammonia-oxidizing bacteria.

To screen a transformant containing a gene involved in growth restriction from a gene library, various known techniques are used. For example, 1) a method of screening by a technique such as hybridization using a DNA fragment complementary to the relevant gene of a heterologous organism as a probe 2) Purifying the relevant gene product of an ammonia-oxidizing bacterium and corresponding to a partial amino acid sequence thereof Screening by a technique such as hybridization using a synthetic gene based on the genetic code as a probe 3) Producing an antibody of the purified relevant gene product and screening by an antigen-antibody reaction against a foreign protein produced by the transformant Method 4) A method of screening for a gene capable of complementing the trait using a microorganism showing a phenotype as a host as the relevant gene-deficient mutant.

In general, many genes involved in growth restriction are known to exist in a wide range of organisms, both eukaryotic and prokaryotic, and the primary structure and function of proteins are highly conserved across species. Therefore, the method 1) above, which uses a homologous gene of a heterologous organism whose base sequence has already been determined as a DNA probe, is simple and suitable.
Also, in host microorganisms frequently used in genetic recombination experiments such as Escherichia coli and yeast, many mutants have been isolated so far, and if such microorganisms are available, the complementation using the phenotypic trait as an index is described above. The method 4) is also simple.

The DNA screened in this way
The fragment can be amplified using host microorganisms such as Escherichia coli and yeast. Amplification can also be performed in a test tube by PCR (polymerase chain reaction) or the like. Using the amplified DNA fragment, a restriction enzyme map can be created to identify the gene structure. Furthermore, the nucleotide sequence is determined using a known method such as the Sanger method, and an open reading frame presumed to be a gene involved in the restriction of proliferation can be identified. Whether the identified open reading frame is a gene involved in growth restriction is determined, for example, by homology between the primary structure of the encoded peptide and the protein of interest from a heterologous organism, or the primary structure and purification of the encoded peptide. It can be confirmed by examining the homology with the partial amino acid sequence of the selected protein.

The cloned gene fragment can be mutated by base substitution, base insertion, deletion, or the like, and a function-inactivated gene in which the function of the gene has been artificially inactivated can be obtained. For example, the catalytic activity (enzyme activity) of the encoded protein can be inactivated, and the promoter activity of the gene can be inactivated. As a specific method for obtaining a function-inactivated gene whose function has been inactivated, 5) a method in which a cloned gene fragment is subjected to a mutation treatment in a living body or a test tube with an ultraviolet ray or a mutagen, and the relevant portion is mutated 6). A method of causing a mutation at a corresponding site by a known site-specific mutagenesis method 7) Cleaving the cloned gene fragment with a DNA degrading enzyme such as a restriction enzyme, inserting and / or deleting the cleavage point, and religating 8) A method of synthesizing a mutant gene (function-inactivating gene) based on the sequence of the target gene.

By exchanging the function-inactivated gene obtained by the above method with a normal gene on the chromosomal DNA of the original ammonia-oxidizing bacterium, the ammonia-oxidizing bacterium whose growth is restricted in the natural environment is reduced. Can be made. The gene can be exchanged by introducing a functionally inactivated gene fragment into an ammonia-oxidizing bacterium and causing in vivo homologous recombination in a homologous region. Then, by selecting a recombinant having a trait of a function-inactivating gene, an ammonia-oxidizing bacterium whose growth is restricted in a natural environment can be obtained.

As a form of the gene to be introduced into the ammonia-oxidizing bacterium, a DNA fragment encoding a function-inactivating gene or a DNA fragment ligated to a vector such as a phage or a plasmid can be used. At this time, it is desirable that the vector cannot replicate autonomously in the ammonia-oxidizing bacterium or lacks replication ability by being digested with a restriction enzyme or the like. These inactivated genes can be introduced into ammonia-oxidizing bacteria using known methods such as electroporation and conjugation transfer.

In some of the cells into which the gene has been introduced, recombination occurs between a homologous region of the introduced gene and the normal gene on the chromosomal DNA, and the gene is lost on the chromosome. It is an existing trait. By selecting a transformant having such a trait, an ammonia-oxidizing bacterium mutant whose growth is restricted in the natural environment can be obtained. In order to facilitate the selection operation, it is possible to carry out transformation using a vector containing a marker gene such as a drug resistance gene or a function-inactivating gene. In order to confirm the gene form of the obtained transformant, the length of the relevant region should be checked by a known method such as PCR or Southern blotting, or by cloning again and checking the nucleotide sequence. Can be.

Ammonia-oxidizing bacteria obtain all the energy required for their growth through the oxidation reaction of ammonia. A series of oxidation reactions starting with ammonia oxidation is performed by a nitrifying enzyme, namely, ammonia monooxygenase (AMO).
And catalyzed by hydroxylamine oxidoreductase. Ammonia monooxygenase catalyzes a reaction represented by the following reaction formula (3).

Embedded image NH ₃ + O ₂ + 2H ⁺ + 2e ⁻ → NH ₂ OH + H ₂ O (3) Hydroxylamine oxidoreductase catalyzes a reaction represented by the following reaction formula (4).

[Formula 3] _{NH 2 OH + H 2 O →} NO 2 - + 5H + + 4e - ... (4)

The latter reaction is an energy generation reaction,
Four electrons are generated per ammonia molecule. The electrons are passed to cytochrome C ₅₅₄ and then to an unidentified electron acceptor. About half of this is used for ATP generation across the electron transport system. The other half is used as reducing power for the oxidation reaction by ammonia monooxygenase. Also, a small amount of electrons are used for the reduction of NAD or NADP.

Although these nitrifying enzymes are a group of enzymes that play a central role in the growth of ammonia-oxidizing bacteria, they are easily inactivated by physical factors such as extremely low concentrations of chemical substances and pH changes. In particular, ammonia monooxygenase has high sensitivity and is considered to be a main cause of nitrification inhibition.

Luciferase is a luminescent enzyme that catalyzes an oxidation reaction to cause bioluminescence, and is roughly classified into those derived from animal cells such as fireflies and those derived from luminescent bacteria such as bacteria of the genus Vibrio . The former emits light by catalyzing the oxidation reaction represented by the above reaction formula (1) and the latter by the above reaction formula (2).

In the bacterial luciferase reaction, FMNH ₂
Is generated from NADH or NADPH by the reaction of FMN reductase present in the cell. When a certain amount of luciferase and FMN reductase is present, the intensity of luminescence depends on the concentrations of NADH and NADPH. In ammonia oxidizing bacteria, NADH is produced using approximately 1/40 of the reducing power generated by hydroxylamine oxidoreductase. Therefore, when the ammonia monooxygenase or hydroxylamine oxidoreductase of the ammonia-oxidizing bacteria is inhibited by the nitrification inhibitor, a series of oxidation reactions starting from the ammonia oxidation reaction is stopped, and the NADH concentration sharply decreases. Therefore, by monitoring the concentration of NADH in cells using the degree of bioluminescence as an index, it is possible to measure the intensity of nitrification inhibition. Even in animal cell luciferase, when the ammonia oxidase is inhibited by a nitrification inhibitor,
Production of reducing substances stops, causing a sharp drop in ATP concentration. Therefore, by monitoring the concentration of ATP in cells using the degree of bioluminescence as an index, it is possible to measure the intensity of nitrification inhibition.

The luciferase gene introduced into the ammonia-oxidizing bacterium is a gene encoding a luciferase protein that causes bioluminescence by an oxidation reaction, as described above. As described above, animal cells such as fireflies and vibrio ( Vibrio ) Light-emitting bacteria of the genus such as genus can be used, but those that originate from various biological cells can be used, but cell culture is easy and there is no need for a substrate (luciferin) that does not exist in normal microbial cells. from, Vibrio (Vibr
It is preferable to use a luciferase gene derived from a bacterial cell of the genus io ) or the genus Photobactrerium . Specific examples of the luciferase gene include lux genes such as luxAB, and DNA fragments containing these genes. The nucleotide sequences of luciferase genes from several bacteria are known,
As such a gene, the luxAB gene derived from P. leiognathi PL741 strain (Reference: J. Biolumin. Chemilumin. ,
4,326-341 (1989)), lu from V. harveyi ATCC33843 strain.
xAB gene (Reference: J. Biol. Chem. , 260, 6139-6146
(1985), J. Biol. Chem. , 261, 4805-4811 (1986)). Microorganisms such as the genus Vibrio and Photobactrerium can be separated from nature and used, but those obtained from public microbial preservation institutions such as ATCC and IFO must be used. Can also.

The luciferase gene can be cloned from DNA extracted and purified from the above-mentioned biological cells by a known method. For example, using a relatively easy-to-handle bacterial cell such as E. coli as a host, a gene library is constructed using a host-vector system using a plasmid or the like as a vector, a DNA probe corresponding to the amino acid sequence of a luciferase protein, a transformant, It is possible to screen for a transformant containing the target gene by utilizing the expression of the above-mentioned expression. More simply, PCR (Polymerase) is performed using the amino acid sequence of the target luciferase protein or a DNA sequence corresponding to an amino acid region highly conserved among heterologous luciferases whose primary structure has already been elucidated. It can be cloned using Chain Reaction).

Upstream of the luciferase gene, a promoter region for expressing the luciferase gene in ammonia-oxidizing bacteria is required. Such a promoter region needs to contain a transcription initiation region recognized by an RNA polymerase derived from an ammonia-oxidizing bacterium. Since no common recognition sequence has been reported for RNA polymerases derived from ammonia-oxidizing bacteria, the structure and function of known promoters of ammonia-oxidizing bacteria have been clarified as promoter regions for expression in ammonia-oxidizing bacteria. 5 'of a known promoter or a known gene for which the presence of a promoter is presumed
Side upstream area is easy to use. Specifically, N. europaea
Derived hydroxylamine oxidoreductase gene ( hao ) promoter (Reference: J. Bacteriol. , 176,
3148-3153 (1994)), a promoter of unknown function derived from N. europaea (Reference: FEMS Microbiol. Lett., 137,
9-12 (1996)), and DNA fragments containing this promoter. In addition, a promoter region derived from a heterologous organism can also be used as long as it functions in an ammonia-oxidizing bacterium.

By introducing a fusion gene obtained by linking the luciferase gene downstream of such a promoter region into a host ammonia-oxidizing bacterium, a desired recombinant ammonia-oxidizing bacterium can be obtained. The fusion gene can be obtained by ligating the promoter region and the luciferase gene by a known method. In addition, the fusion gene can be introduced into the host in the form of satellite DNA by using a vector such as a plasmid or a phage that is autonomously replicable in the ammonia-oxidizing bacterium serving as the host. Further, the target fusion gene can be introduced in a state integrated into the host chromosome by a technique such as transposon or homologous recombination.

The recombinant ammonia-oxidizing bacteria obtained as described above can be grown by culture.
The cultivation is preferably carried out under conditions suitable for the recombinant. For example, the cultivation can be carried out using a nutrient medium generally used for culturing ammonia-oxidizing bacteria under a temperature control of 20 to 30 ° C. As the nutrient medium, an inorganic medium containing ammonium salts such as ammonium chloride and ammonium sulfate and inorganic salts necessary for growth, for example, a P medium (Lewis,
RF & Pramer, D., J. Bacteriol., 76, 524-528 (19
58)) and the like. PH during culture
Is gradually reduced by nitrous acid generated along with the growth of ammonia-oxidizing bacteria. Therefore, the pH is preferably maintained at 7.5 to 8 by appropriately adding an alkaline aqueous solution such as NaOH. During the culture, the culture is preferably performed in a dark place to prevent irradiation with ultraviolet light and visible light. The medium may be a liquid medium or a solid medium, but a liquid medium is preferred. In the case of a recombinant ammonia-oxidizing bacterium containing a plasmid, it is preferable to add an appropriate amount of an antibiotic or the like necessary for stabilizing the plasmid.

The cells of the recombinant ammonia-oxidizing bacteria grown by the above method can be collected by centrifugation or membrane concentration. Temperature condition at the time of collecting bacteria is 0
It is preferred to operate at low temperatures of ~ 4 ° C. The state of the cells at the time of collection is preferably a cell in a logarithmic growth phase that is dividing at the maximum growth rate. Although it depends on the initial inoculum, the logarithmic growth phase is usually reached in a culture time of 3 to 7 days. For example,
In the case of culturing using the P medium, in the logarithmic growth phase, the bacterial cell concentration is 1 × 10 ⁶ to 1 × 10 ⁷ cells / ml, and the nitrite concentration of the culture solution reaches approximately 1 to 10 mM.

The method of the present invention is a method for coexisting a protein-containing protective agent when freezing ammonia-oxidizing bacteria having a luciferase gene such as recombinant ammonia-oxidizing bacteria cultured and collected by the above method. It is. The freezing process itself can be performed by a known method, and usually a suspension in which cells are suspended in water such as sterilized water; a buffer such as a phosphate buffer; or an aqueous medium such as a physiological saline is frozen. .

The protective agent coexisting when freezing the ammonia-oxidizing bacteria is a protective agent for protecting the cell and biological activity of the ammonia-oxidizing bacteria, particularly the bioluminescence ability. A protective agent that can protect and protect the response ability to a nitrification inhibitor, and is a protective agent containing a protein. As such a protective agent, a protein that is soluble in a suspension of ammonia-oxidizing bacteria and does not harm the cells, or a protein mixture rich in such proteins can be used. The concentration of the protective agent coexisting in the suspension of the ammonia-oxidizing bacteria to be frozen is desirably 1 to 30% (w / v), preferably 5 to 20% (w / v).

Specific examples of the protein-containing protective agent used in the present invention include water-soluble proteins such as bovine serum albumin and γ-globulin; and protein mixtures rich in proteins such as skim milk. Among these, bovine serum albumin and skim milk are preferred. The protective agent can be used alone, or 2
More than one species can be used in combination.

As a protein used as a protective agent, a protein that is toxic to bacterial cells, such as bacteriocin, or a protein that causes damage such as lysis, such as lysozyme, is not preferred because it harms the bacterial cells. In addition, water-insoluble or poorly soluble proteins such as gelatin and keratin are not preferred because they have a small effect as a protective agent for bioluminescence ability.

Examples of the medium for dispersing the ammonia-oxidizing bacteria and the medium for dissolving the protective agent upon freezing include water such as sterilized water; buffers such as a phosphate buffer; and physiological saline.

The suspension of ammonia-oxidizing bacteria to be frozen can be prepared, for example, by the following method. 1) The cells collected by the above method are added and suspended in a solution in which a protective agent containing a protein is dissolved. 2) The cells collected by the above method are suspended in the medium, and a protective agent containing a protein is added to the suspension and dissolved.

The cell concentration of the cell suspension to be subjected to freezing is preferably maintained at a high level, and the absorbance at 600 nm is preferably 0.5 or more (about 3 × 10 ⁸ cells / ml or more). It is desirable that the pH of the suspension is maintained at 7.5 to 8. Preparation of the suspension is 0-10 ° C,
Preferably, it is performed at 0 to 4 ° C.

The prepared cell suspension can be subdivided into glass or plastic containers and then frozen in a refrigerant such as methanol cooled with liquid nitrogen or dry ice.

By freezing the ammonia-oxidizing bacteria in this manner, the finally reconstituted cell suspension (suspension obtained by reconstituting the frozen cells) has a luminescence activity at the end of culture (before freezing). , And a rapid decrease in the bioluminescence is observed when a nitrification inhibitor is added, and furthermore, such a cryopreserved bacterial cell that maintains such properties without being inactivated during a long storage period. Obtainable.

The frozen cells of the ammonia-oxidizing bacteria of the present invention are frozen cells obtained by freezing ammonia-oxidizing bacteria by the preparation method of the present invention. The frozen cells of the present invention,
The finally reconstituted cell suspension (suspension reconstituted from frozen cells) maintains sufficient luminescence activity at the end of culture (before freezing), and when the nitrification inhibitor is added, the organism A rapid decrease in luminescence is observed, and such properties are maintained without loss during prolonged storage.

When the frozen cells obtained by the method of the present invention or the frozen cells of the present invention are stored, the cells may be stored at -80 to -20 ° C.
It is preferable to store in the above temperature range.

The recombinant ammonia-oxidizing bacterium prepared and frozen by the method of the present invention (ie, the frozen bacterial cell of the present invention) can be suitably used for measuring the inhibition of nitrification activity of the ammonia-oxidizing bacterium. In order to measure nitrification activity inhibition, the frozen cells of the present invention were reconstituted, a sample for which the presence or absence of nitrification activity inhibition was to be determined was added to the reconstituted solution, and further culturing was continued. Can be performed by measuring the emission intensity indicated by Reconstitution of the frozen cells can be performed, for example, by thawing at room temperature or on ice and then adding a reconstitution solution. Alternatively, the cells can be reconstituted by thawing the frozen cells in a reconstitution solution.

The reconstitution solution used for reconstitution preferably contains ammonia or ammonium salt as a substrate, and is desirably prepared so that the pH of the reconstituted suspension is 7.5 to 8. Specific examples of the reconstitution solution used for reconstitution include a phosphate buffer solution containing ammonium sulfate. The time from restoration to measurement is
The time required for the cells to regain biological activity may be sufficient, with approximately 5 to 30 minutes being appropriate. The temperature is 20-30 ° C
Is preferred. The culture time after the addition of the sample may be a time during which a change in luminescence intensity is observed, and is appropriately about 1 minute to 1 hour. The culture temperature is preferably 20 to 30C.

The luminescence can be measured quantitatively by using a measuring instrument such as a luminometer. Since the reaction occurs in a short time, the measurement time is short. In addition, since the amount of luminescence can be measured without destroying the recombinant cells of the ammonia-oxidizing bacteria, the operation can be performed easily and quickly, and monitoring by automation is also possible.
Furthermore, since the ammonia-oxidized bacterial recombinant that has been frozen and stored can be restored and used for the measurement,
Reagent handling is also easy. Since the recombinant ammonia-oxidizing bacterium that has been frozen and stored maintains the bioluminescence activity for a long period of time, it is possible to obtain the amount of luminescence necessary for evaluating the degree of inhibition.

The luminescence is preferably measured under conditions in which the activity of luciferase and the biological activity of the ammonia-oxidizing bacteria are maintained at a high level, usually at a temperature of 20 to 30 ° C. and a pH of 7.5.
It is preferable to measure under the conditions of ~ 8.

When a substrate for luciferase is required, the substrate must be added, for example, a long-chain aldehyde, to proceed with the luminescence reaction. Specific examples of the substrate to be added include long-chain aldehydes such as n-decylaldehyde and n-nonylaldehyde. Genes involved in substrate production, for example Vibrio , aldehyde synthesis genes such as Photobactrerium , and more specifically Vibrio h
For recombinants containing the luxCDE gene of arveyi , no substrate needs to be added.

In a control test in which the nitrification activity of the ammonia-oxidizing bacteria is not inhibited, for example, a control test using water or a buffer as a sample, the ammonia oxidation reaction proceeds normally. The presence of ATP results in relatively strong luminescence. On the other hand, if the sample contains an inhibitor of the nitrification activity of ammonia-oxidizing bacteria, the ammonia oxidation reaction is inhibited, so that the concentration of NADH or ATP necessary for sufficient luminescence is contained in the cells. It will be absent, resulting in relatively weak or no emission. The greater the degree of inhibition, the greater the decrease in luminescence intensity relative to the control. Therefore, the presence or absence or the degree of inhibition of the nitrification activity of the ammonia-oxidizing bacterium can be determined by the presence or absence of luminescence or the decrease in luminescence intensity.

The type of the nitrification inhibitor detected by such a method is not limited. For example, allylthiourea, nitrapyrin (Nitrapyrin, 2-chloro-6-trichloromethyl p
yridine) or a mixture thereof, or a nitrification inhibitor unknown so far. In addition to the nitrification inhibitor, physical inhibition such as pH can also be measured.

[0061]

According to the method for preparing frozen cells of ammonia-oxidizing bacteria of the present invention, when the ammonia-oxidizing bacteria having the luciferase gene is frozen, a protecting agent capable of protecting the bioluminescence ability of the ammonia-oxidizing bacteria is used. ,
It is possible to easily obtain cryopreserved cells which can improve the preservability of the cells, speed up and simplify the handling thereof, and maintain the bioluminescence activity for a long period of time. Then, by using the frozen cells obtained by the method of the present invention to measure nitrification activity inhibition using a decrease in luminescence intensity as an index, the presence and extent of nitrification activity inhibition of ammonia-oxidizing bacteria can be measured quickly and easily. it can.

The frozen cells of the ammonia-oxidizing bacteria of the present invention are obtained by freezing ammonia-oxidizing bacteria having a luciferase gene in the presence of a protective agent, so that the preservability of the cells and the handling of the cells can be improved. Speeding up and simplification can be achieved, and bioluminescence activity can be maintained for a long period of time. By using the frozen bacterial cells of the present invention to measure nitrification activity inhibition using a decrease in luminescence intensity as an index, the presence and extent of inhibition of nitrification activity of ammonia-oxidizing bacteria can be measured quickly and easily.

[0063]

Next, an embodiment of the present invention will be described. The plasmids, microorganisms, and the like used in Production Examples and Examples are as follows.

<< Nitrosomonas europaea IFO14298 strain >> IF
O's `` List of Cultures 1992 Microorganisms 9th
Edition ". << pUC19 >> Plasmid vector for E. coli. Commercially available from Toyobo Co., Ltd. << Escherichia coli DH5 strain >> It is commercially available from Toyobo Co., Ltd. as a competent cell. << Escherichia coli ATCC23803 strain >> Tryptophan requirement. Available from ATCC (Catalogue of Bacteria & P
hages 17th edition, 1991). << pCH110 >> A plasmid vector for Escherichia coli containing the β-galactosidase gene. Commercially available from Pharmacia Biotech.

<< pHSG299 >> A plasmid vector for Escherichia coli using a kanamycin resistance gene as a marker. Commercially available from Takara Shuzo Co., Ltd. << Vibrio harveyi ATCC33843 strain >> Available from ATCC.
ATCC No.33843 (Catalogue of Bacteria & Phages 17th
edition, 1991). << Escherichia coli HB101 strain >> It is commercially available from Toyobo Co., Ltd. as a competent cell.

<< pHSG296 >> Plasmid vector for E. coli. Commercially available from Takara Shuzo Co., Ltd. << pKK223-3 >> Plasmid vector for E. coli. Commercially available from Pharmacia Biotech. << pKT240 >> IncQ plasmid. Available from ATCC.
ATCC No. 37258 (Catalogue of Recombinabt DNA Materi
als 2nd edition, 1991)

Production Example 1 A tryptophan-requiring ammonia-oxidizing bacterium was obtained by the following method. (1) Cloning of tryptophan synthase gene derived from N. europaea 1 μg of chromosomal DNA of N. europaea IFO14298 strain was ligated with restriction enzyme Eco.
Complete digestion with RI. The digested DNA solution contains phenol
After the chloroform treatment, it was recovered by ethanol precipitation. About 0.1 μg of the obtained DNA fragment was mixed with 0.05 μg of pUC19 plasmid, which had been completely digested with Eco RI and treated with alkaline phosphatase to remove the phosphate group at the 5 ′ end, and ligated.

Using the obtained ligation product, competent cells of Escherichia coli DH5 strain were transformed and inoculated into a sterilized 100 ml LB liquid medium containing 50 μg / ml ampicillin. The cells were shake-cultured at 37 ° C for 16 hours, and a plasmid mixture was extracted from the obtained culture solution by a known alkaline lysis method.

Using this plasmid mixture, E. coli
The ATCC23803 strain was transformed and spread on an M9 plate medium containing 50 μg / ml ampicillin and 10 ng / ml thiamine hydrochloride. After culturing at 37 ° C for 3 days, the formed colonies were
The cells were inoculated into 5 ml of sterilized LB liquid medium containing μg / ml of ampicillin. After culturing with shaking at 37 ° C. for 16 hours, a plasmid was extracted from the obtained culture solution by a known alkaline lysis method, treated with various restriction enzymes, and analyzed by agarose gel electrophoresis. As a result, all 1.3 kb Eco RI DN
A fragment was retained. One clone was selected from these, and this plasmid was named pNTRP1. FIG. 1 shows a restriction map of this fragment.

The entire nucleotide sequence of this fragment was determined by the dideoxy method. As a result, it was revealed that this fragment was a DNA composed of 1,296 base pairs. When a major open reading frame (ORF) was searched, 921 bp starting 29 bases downstream from the Eco RI site
ORF was found.

As a result of searching for a protein having homology with the amino acid sequence deduced from the ORF from a known database, this gene product was found to be indole 3-glycerol phosphate sy, which is one of the enzymes of the tryptophan synthesis system of heterologous microorganisms.
nthetase activity and phosphoribosyl-anthranilate isome
Bifunctional protein (TrpC protein in Escherichia coli) having rase activity was found to have homology.

This gene is a gene encoding the same protein of N. europaea , and was named trpX . SEQ ID NO: 1 shows the nucleotide sequence of the trpX gene. In addition, SEQ ID NO: 2 shows the entire nucleotide sequence of the 1296 bp Eco RI fragment and tr
1 shows the coding region and deduced amino acid sequence of the pX gene.

(2) Introduction of Mutation into Tryptophan Synthase Gene and Construction of Vector Containing this Gene Mutation was introduced into the tryptophan synthase gene and the vector pNHR4 containing this gene was constructed in the following procedure. The outline is shown in FIGS.

The pNTRP1 obtained in the above (1) was completely digested with Mfe I and Msc I and then treated with T4 DNA polymerase to blunt the ends. The reaction product was subjected to agarose gel electrophoresis, a 3.9 kb fragment was separated and recovered, and after self-ligation, it was transformed into E. coli DH5 strain. From the resulting ampicillin-resistant colonies, a plasmid pNTRP19 lacking the Msc I- Mfe I region of 0.13 kp was obtained (see FIG. 2).

[0075] Also was completely decompose pCH110 plasmid Hin dIII, after phenol-chloroform treatment, and recovered by ethanol precipitation. Linear pCH110 is blunt-ended by T4 DNA polymerase (polymerase),
After the treatment with phenol / chloroform, it was recovered by ethanol precipitation. The recovered DNA was treated with alkaline phosphatase to remove the terminal phosphate group. After phenol / chloroform treatment, the precipitate was recovered by ethanol precipitation.

The obtained DNA was combined with Takara Shuzo's Bgl II-linker.
DNA (pCAGATCTG) was mixed and ligated. The resulting ligation product was transformed into competent cells of Escherichia coli DH5 strain, and spread on an LB plate medium containing 50 μg / ml ampicillin. After 24 hours at 37 ° C., the resulting colonies were cultured in LB medium containing 50 [mu] g / ml of ampicillin, Hin dIII sites of pCH110 from the culture broth to obtain a plasmid pCH110-1 converted into Bgl II site (See FIG. 3).

[0077] Next, 106 from pHSG299 plasmid bp Sma I
- to remove the Pvu II, and self-ligation After partially digested with Sma I and Pvu II, to construct pHSG299-106 deleting the 106 bp Sma I- Pvu II (see Figure 3). PHSG299-10 completely digested with Bam HI and treated with alkaline phosphatase
6, the pCH110-1 Bgl II, Bam HI, and ligated to 3.7 kb Bgl II- Bam HI fragment containing the lacZ gene obtained by complete digestion with Pst I, was constructed PHRlac1 (see FIG. 4).

Next, the pNTRP19 wasSalCompletely disassemble with I
The resulting 1.1 kb fragment was ligated with the pHRlac1 obtained above.SalI rhino
To construct pNHR4 (see FIG. 4).
Note that △ in the above pNHR4trpXWas obtained in (1) above.trpX
0.13 kb of (tryptophan synthase gene)MscI-Mf
eI region, shown in SEQ ID NO:trpXSequence 617-739
Machine that has deleted the region of
Inactivation gene.

(3) Tryptophan by homologous recombination
Production of requested strainN. europaea IFO14298 strain was added to 100 ml of P medium (2.5 g / l (N
H_Four)_TwoSO_Four), 0.7 g / l KH _TwoPO_Four, 19.5 g / l Na_TwoHPO_Four, 0.5 g /
l NaHCO_Three, 0.1 g / l MgSO_Four・ 7H_TwoO, 5 mg / l CaCl_Two・ 2H_TwoO,
Inoculate a culture flask containing 1 mg / l Fe-EDTA, pH 8.0)
Perform shaking culture at 30 ° C in the dark for 10 days.
Nourishment. 30 ml of this preculture contains 3 liters of P medium
 Planted in 5 liter fermenter, aeration 0.5 vvm, agitation
The cells were cultured in the dark at 250 rpm and 30 ° C. for 10 days. Medium pH
Adjusts the pH electrode and the addition of NaOH to maintain 7.8.
Saved.

After cooling 2 liters of the above culture solution in ice, GVHP
04700 filter (trademark, Japan Millipore Limited)
The cells were harvested using 10% of the collected cells were ice-cooled
After suspending in 50 ml of a glycerin aqueous solution and washing, it was collected by centrifugation (8000 × g, 15 minutes). The recovered cells were further suspended in 1 ml of ice-cold 10% glycerin aqueous solution,
Placed on ice for 10 minutes. After dispensing 50 μl of the suspension into a 1.5 ml microcentrifuge tube previously cooled with ice, 1 μg of the pNHR4 obtained in the above (2) was mixed, and the mixture was further ice-cooled for 1 minute.

The mixture was transferred to a Bio-Rad cuvette (electrode spacing: 0.2 cm), immediately mounted in a Gene Pulser cuvette chamber and subjected to an electric pulse (12.5 kV / cm, 5.0
msec). After the pulse, the mixture in the cuvette is
Transfer 100 ml of the P medium to the flask into which the medium has been dispensed,
With shaking. 24 hours after the start of culture, kanamycin
It was added to a concentration of 25 μg / ml, and the culture was continued for another two weeks. A part of the culture solution was spread on a gellan plate medium (P medium solidified with 1.2% gellan) containing 25 μg / ml kanamycin, and cultured at 30 ° C. for 3 weeks.

After the completion of the culture, 200 μg / ml X-gal aqueous solution was sprayed uniformly on the plate surface. As a result, a blue-green colony was obtained, and this strain was transformed into Nitrosomonas europaea TRPA-1.
The strain was named. The TRPA-1 strain colony was inoculated into a flask into which 100 ml of P medium containing 50 μg / ml tryptophan had been dispensed, and cultured with shaking for 3 weeks. Further, a part of the culture solution was applied to a gellan plate medium containing 50 μg / ml tryptophan, and cultured at 30 ° C. for 3 weeks. As a result, a blue-green colony and a pale orange-red colony were obtained. After the completion of the culture, 200 μg / ml X-gal aqueous solution sterilized with a filter was sprayed uniformly on the plate surface. As a result, most of the colonies showed a blue-green color, but an orange color that did not change color at a frequency of about 1 in 10 ⁴ A red colony was obtained.

As a result of examining the requirement of tryptophan for the orange-red colonies, all the colonies grew on P medium containing 50 μg / ml tryptophan, but were divided into those that could grow on P medium containing no tryptophan and those that could not. Was. A strain that cannot grow on P medium containing no tryptophan is designated as a tryptophan-requiring strain by Nitrosomonas.
It was named europaea TRPA-2 strain.

(4) Confirmation of Chromosome Structure of Tryptophan-Requiring Strains Chromosomal DNA was recovered from N. europaea IFO14298, TRPA-1, and TRPA-2 strains, and PCR was performed using the recovered DNA as a template. The combinations of the primer DNAs were as follows.

Reaction system 1: amplification of trpX gene on chromosome TrpF7 x TrpR1288 Reaction system 2: amplification of kanamycin resistance gene derived from pNHR2 LacF295 x LacR3375 Reaction system 3: amplification of trpX gene and kanamycin resistance gene on chromosome TrpF7 x LacF295

The sequences of the above primers are as follows. ThiF7: 5'-CCAATCAGGTAAGTGCTTAATATG-3 '(corresponding to sequence 8-31 of SEQ ID NO: 2) ThiR1288: 5'-CGGTTTTTTTCCAGTGAGCATAGC-3' (corresponding to sequence 1288-1265 of SEQ ID NO: 2) LacF295: 5'-CCGTCGTTTTACAACGTCG-3 LacR3375: 5'-ATACGGGCAGACATGGCCTGCCCGG-3 '(corresponds to base sequence 295-313 of the base sequence of pCH110)
(Corresponding to the sequence of base numbers 3375-3351 in the base sequence)

The PCR reagent was Takara PCR manufactured by Takara Shuzo Co., Ltd.
An amplification kit was used. That is, 0.5 μg of N.
europaea chromosomal DNA, 20 pmol of each primer, 5 μl
10 x PCR buffer, 5 μl of 2.5 mM dNTP mixture, 0.5
Add 5 μl of 5 U / μl Takara Taq polymerase to PerkinElmer Micro Amp Tube (trademark) and add 5 μl of distilled water.
Adjusted to 0 μl. This is a PerkinElmer Gen
After transfer to eAmp PCR System 2400, pretreatment at 94 ° C. for 30 seconds, 25 cycles of one cycle consisting of a continuous reaction of 94 ° C. for 30 seconds, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes were repeated. Further, post-treatment was performed at 72 ° C. for 7 minutes.

The obtained PCR product was subjected to 1% agarose gel electrophoresis. After the electrophoresis, the gel was transferred to a 10 μg / ml ethidium bromide solution, and left at room temperature for 30 minutes. After sufficiently washing the gel with water, DNA bands were detected by ultraviolet irradiation. As a result, when the total DNA of the N. europaea IFO14298 strain was used as a template, an amplification product of 1.3 kb was observed in the reaction system 1, but no product was obtained in the reaction systems 2 and 3.

When the total DNA of the N. europaea TRPA-1 strain was used as a template, it was reduced to 1.3 kb in reaction system 1 and 3.1 kb in reaction system 2.
In the reaction system 3, an amplification product was observed at 5.1 kb. N. euro
When total DNA of paea TRPA-2 strain was used as a template,
Although an amplification product of 1.1 kb was observed, no product was obtained in reaction systems 2 and 3.

[0090] From the above results, N. europaea TRPA-1 strain, as shown in FIGS. 5 and 6 are those in which a pNHR4 on trpX gene on the chromosome is integrated by homologous recombination, N In europaea TRPA-2 strain
It was found that homologous recombination occurred again between the two copies of the trpX gene on the chromosome of the TRPA-1 strain, the normal trpX gene was deleted, and the mutant gene remained.

Examples 1 to 3 and Comparative Examples 1 to 7 (1) Construction of Recombinant Ammonia-Oxidizing Bacterium A luciferase gene derived from V. harveyi ATCC33843 was placed downstream of the region showing promoter activity in N. europaea IFO14298 cells. Plasmid p encoding ( luxAB gene)
HLUX20 was constructed as follows. Figure 7 is a schematic diagram
Shown in The obtained plasmid was introduced into the tryptophan-requiring ammonia-oxidizing bacterium obtained in Production Example 1 by the method described below to obtain a recombinant ammonia-oxidizing bacterium.

[0092] V. has been reported so far "Cloning of V. harveyi from luxAB gene" harveyi ATCC33843
From the luxAB gene sequence derived from the strain, oligonucleotide primers LX117 and LX2268 corresponding to the 5′-flanking region and the 3′-flanking region were synthesized. The sequences of these oligonucleotides are shown in Table 1.

[0093]

[Table 1]

Next, the chromosome D of the V. harveyi ATCC33843 strain was used as primers with the two synthesized oligonucleotides.
PCR using NA as a template was performed. As a PCR reagent, Takara PCR amplification kit manufactured by Takara Shuzo Co., Ltd. was used. That is, 0.5 μg of V. harveyi chromosomal DNA, 20 pmol of each primer, 5 μl of 10 × PCR buffer, 5 μl of 2.5 mM dNTP mixt
ure, 0.5 μl of 5U / μl Takara Taq polymerase was added to PerkinElmer Micro Amp Tube (trademark), and the volume was adjusted to 50 μl with distilled water. This was transferred to PerkinElmer Gene Amp PCR System 2400, and after pretreatment at 94 ° C for 30 seconds, one cycle was 94 ° C for 30 seconds, 55 ° C for 1 minute, 72 ° C.
A reaction consisting of a continuous reaction for 1 minute was repeated for 25 cycles. Further post-treatment was performed at 72 ° C. for 10 minutes.

The amplified PCR product was treated with phenol-chloroform and recovered by ethanol precipitation. That is, the reaction-terminated liquid was mixed with a TE-saturated phenol: chloroform: isoamyl alcohol mixture at a volume ratio of 25: 24: 1, and centrifuged at 10,000 × g for 5 minutes to obtain a supernatant. 3 M sodium acetate corresponding to 1/10 volume of the supernatant was added and mixed well, and then ethanol corresponding to 2.5 volumes was added. After mixing, the mixture was allowed to stand at -80 ° C for 15 minutes. 10,000 x
PCR obtained as precipitate by centrifugation at g for 10 minutes
The product was rinsed with 70% ethanol and dried under reduced pressure.

The obtained PCR product was prepared in a TE buffer (10 mM Tris-C).
(pH 8.0), 1 mM EDTA) and subjected to 1% agarose gel electrophoresis. After completion of the electrophoresis, the gel was transferred to a 10 μg / ml ethidium bromide solution and left at room temperature for 30 minutes. After sufficiently washing the gel with water, DNA bands were detected by ultraviolet irradiation. As a result, a clear DNA band was detected at a position corresponding to 2.2 kb. The gel containing this DNA band is cut out and DNA C
The DNA contained in the gel was extracted using ELL (trademark, manufactured by Kusano Scientific Instruments) to obtain a 2.2 kb DNA fragment containing the luxAB gene encoding luciferase. This DNA fragment was treated with phenol-chloroform in the same manner as above, recovered by ethanol precipitation, dissolved in TE buffer, and used for the construction of a plasmid described later.

<< Cloning of N. europaea- derived Promoter Region >> From the chromosomal DNA of N. europaea IFO14298 strain,
PCR cloning of a promoter region derived from the hao gene, a promoter whose function and structure was reported, was performed using the primers shown in Table 2. As a result, a 0.35 kb PCR product was obtained as the hao gene promoter region.

[0098]

[Table 2]

<< Preparation of pKTK40 >> pKTK40 in FIG. 7 was prepared according to FIG. First Tn903 kanamycin acetyltransferase gene from PCR was performed cloning (kanamycin resistance gene, if there is referred to as less Km ^R). That is, PCR was performed using the pHSG296 plasmid as a template DNA and the two types of oligonucleotides shown in Table 3 as primers.

[0100]

[Table 3]

As a result of the PCR, an amplification product of 1.2 kb was obtained. The amplification products Pst I, digested with Pvu II, the advance PKT240 P
st I, and ligated with the 5.8kb fragment was digested with Pvu II. The ligation product was transformed into Escherichia coli strain HB101, and pKKM712 was obtained from the resulting transformant (see FIG. 8).

Next, PCR cloning of the terminator region of the Escherichia coli 5S RNA gene (hereinafter, sometimes referred to as rrnB T1T2) was performed. That is, pKK223-3 plasmid DNA
Was used as a template DNA, and two types of oligonucleotides shown in Table 4 were used as primers for PCR.

[0103]

[Table 4]

As a result of the PCR, an amplification product of 0.3 kb was obtained. The amplified product Eco T22I, was digested with Pst I, and ligated with pKKM712 was alkaline phosphatase treated previously digested with Pst I. Ligation product is Escherichia coli HB101
The strain was transformed and pKTK40 was obtained from the resulting transformant (see FIG. 8).

<< Construction of Plasmid and Introduction into Ammonia-Oxidizing Bacteria >> Using pKTK40 thus prepared,
The plasmid was constructed according to the procedure described in the above. First, V. harveyi A
The DNA fragment of the 2.2kb including luxAB were PCR cloned from TCC33843 strain chromosomal DNA was digested with Bam HI and Bgl II, and ligated with pKTK40 was alkaline phosphatase treated previously digested with Bam HI. The ligation product was transformed into Escherichia coli HB101, and pKLUX27 was obtained from the resulting transformant (see FIG. 7). The PCR product encoding the hao gene promoter region was analyzed using Bam HI and Bgl II.
In after digestion were ligated into the digested pKLUX27 was alkaline phosphatase treated, respectively Bam HI. The ligation product was transformed into Escherichia coli HB101 strain, and the desired transformant was used to obtain the desired pHLUX20 ( hao-luxAB ) (see FIG. 7). The resulting pHLUX20 contains the luxAB gene transcriptionally regulated by the hao gene promoter.

The pHLUX20 obtained as described above was obtained by electroporation using the N. europaea obtained in Production Example 1.
Introduced into TRPA-2 strain, recombinant (transformant) N. europae
a TRPA-2 (pHLUX20) was obtained. The apparatus used was a Gene Pulser and a cuvette manufactured by Bio-Rad. That is, pHLUX20 and N. europaea TRPA-2
Cuvette with ice-cooled mixture (electrode spacing 0.2c
m) and immediately attached to the Gene Pulser cuvette chamber and subjected to an electric pulse. The pulse setting conditions were 5 to 12.5 kV / cm and 5.0 msec.

The transformants were 25 μg / ml kanamycin,
The strain was selected as having a colony forming ability on a P plate medium containing 5 μg / ml of tetracycline and 1.2% gellan gum.

(2) Preparation of cryopreserved cells of recombinant ammonia-oxidizing bacteria The N. europaea TRPA-2 (pHLUX20) strain was prepared from a P medium containing 25 μg / ml kanamycin and 50 μg / ml L-tryptophan. (2.5 g / l (NH ₄ ) ₂ SO ₄ ), 0.7 g / l KH ₂ PO ₄ , 19.5
g / l Na ₂ HPO ₄ , 0.5 g / l NaHCO ₃ , 0.1 g / l MgSO ₄・ 7H ₂ O,
5 mg / l CaCl ₂ · 2H ₂ O, 1 mg / l Fe-EDTA, pH 8.0) 100 ml
In a 500 ml flask, use a
The cells were cultured aerobically with shaking at 30 ° C. in the dark until they reached M.

Then, 35 ml of the obtained culture was added to 25 μg /
The cells were inoculated in 3.5 liters of P medium containing 100 ml of kanamycin and 50 μg / ml of L-tryptophan.
Cultured aerobically at ℃. The culture was performed in a 5 liter fermenter (M
D300-5L, trade name, manufactured by Marubishi Bioengineering Co., Ltd.). pH
Was maintained at 7.8 with 2N NaOH. The aeration rate was set at 0.5 vvm, and the stirring conditions were set at 250 rpm.

After culturing for 5 days, the nitrite concentration was reduced to about 10 mM.
The culture was terminated at the time when. 2 liter of culture
The bacterial cells were trapped in a membrane by filtration through a 0.22 μm cellulose acetate membrane, and suspended in 5 ml of 50 mM phosphate buffer (pH 7.8) which had been kept at 4 ° C. in advance. The suspension was collected again by centrifugation (10000 × g, 10 minutes, 4 ° C.). The same suspension operation and centrifugation operation were further repeated twice to wash the cells.

The harvested cells were suspended in a cooled 50 mM phosphate buffer (pH 7.8) to a final volume of 2 ml. 50 μl of the suspension was placed in a 2.0 ml serum tube, and 150 μl of various protective agent aqueous solutions shown in Table 5 were added to make a final volume of 0.2 ml. After stirring well, the cells were immersed in liquid nitrogen for 1 minute to completely freeze the bacterial suspension. The tube containing the frozen suspension was immediately stored in a -20 ° C freezer.

[0112]

[Table 5] * 1 Skim milk: manufactured by Snow Brand Milk Products Co., Ltd. * 2 Bovine serum albumin: Fraction V * 3 γ-globulin: Derived from cattle * 4 Dimethyl sulfoxide: sometimes abbreviated as DMSO

(3) Restoration of cryopreserved cells of recombinant ammonia-oxidizing bacteria and response test to nitrification inhibitors The frozen cells cryopreserved at -20 ° C for 7 to 56 days were thawed at room temperature, and then 0.8 ml of A reconstituted solution (20 mM (NH ₄ ) ₂ SO ₄ , 50 mM phosphate buffer (pH 7.8)) was added. After mixing well,
Leave at room temperature for 15 minutes. 0.45 ml of the reconstituted solution was dispensed into two test tubes, and 50 μl each of water or 100 μM allylthiourea aqueous solution was added thereto, and mixed well. Then, it was left at room temperature for 1 minute, and the luminescence was measured.

The luminescence was started by adding 0.1 ml of the above reaction solution to a luminescence measurement cuvette into which 2.5 μl of n-decylaldehyde diluted 10-fold with ethanol was previously dispensed. The luminescence amount was measured using a luminometer Model20e manufactured by Turner Design, delay time 5 seconds, int
egrate time 10 seconds. The amount of luminescence before freezing was determined by reconstituting 50 μl of the suspension
The amount of luminescence was measured beforehand and the volume of l was displayed.

As a result, as shown in FIG. 9, when the skim milk or bovine serum albumin of the example was used as a protective agent, the luminescence of 60 to 90% of that before freezing was maintained even after cryopreservation for 56 days. Was. In the case of γ-globulin, the amount of luminescence tended to decrease with the passage of time, but approximately 20% of the remaining luminescence was maintained after cryopreservation for 56 days. On the other hand, in the case of the comparative examples, the luminescence activity was almost inactivated after 56 days in any of the protective agents.

Table 6 shows, as relative values, changes in the amount of luminescence before and after addition of allylthiourea after frozen storage for 56 days. When skim milk, bovine serum albumin or γ-globulin is used as a protective agent, the addition of allylthiourea, a typical nitrification inhibitor, reduces the luminescence amount to 5.7 to 9.4% compared to the luminescence amount before addition. Admitted.

[0117]

[Table 6] The frozen cells after cryopreservation for 56 days were used. Respectively,
The light emission amount before adding allylthiourea was set to 100%.

[0118]

[Sequence list] SEQ ID NO: 1 Sequence length: 921 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence characteristics Characteristic symbol: peptide Location: 1..921 Other information: tryptophan synthase gene Method for determining the characteristics: E sequence ATGTCAGACA TTCTCGATCG CATCCTTGCC GTGAAAAAAC AGGAGGTCGC GGCCGCCCGG 60 GCACGAAAAT CCCTGGAAGG AATCCGTATC CAGGCATGCATCCGTCGATCGATCTGCGTCGATCGATC AAACGGGCCA GCCCAAGCAA GGGTGTATTA CGCGGGCGAT CAGAAGCACC CAATCCGCAG 240 GGATCAGGGC ATGCGGAAAA CTCATCCGGG AAAAATCTGA TTCCGCAAGA TTTCATCCCG 300 GCAGAAATTG CGGCCAGTTA TGCCCGAAAT GGTGCTGCCT GCCTGTCAGT CCTGACAGAT 360 GAACAGTTTT TCATGGGCAG TGCCGATTTC TTGCGGCAAG CACGTGCTGC TTGTGATTTA 420 CCGGTATTGC GCAAGGATTT CATACTGGAC GAATATCAGG TCTACGAAGC ACGCGCGATG 480 GGAGCGGATT GCATACTGTT GATCGTCGCA GCATTTCTTT CACCGGTTTT CCA GCAGGAT 540 GCCTCTGTCA ATCAGGGCGA CAGTGCACTC GAACGGATGC GCATATTGGA AACCACGGCA 600 CAAGCACTGG GAATGGCCAT ACTGGTAGAA GTACACGATG CAGATGAGCT CGATCTCGCG 660 CTGCAATTGA CTACTCCGCT CATCGGGATC AACAACCGCA ACCTGCGAAC TTTCGAGACT 720 ACGCTGGATA CCACCGTTCA ATTGGTCAGA CGCATACCAT CCGAACGCAT CGTCGTCACC 780 GAAAGCGGTA TCCGTATCCC TGCCGATGTG GAAATGATGC TATCTCATCA TATTTACGCT 840 TTTCTGATCG GGGAAACATT CATGCGGGCA CCGGATCCGG GCGCCGCACT GGCAAGCCTG 900 TTTACGACAA ACCTGACGTA A 921

SEQ ID NO: 2 Sequence length: 1296 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence characteristics Features Symbol indicating peptide: Location of peptide: 29..949 Other information: Tryptophan synthase gene Characterization method: E sequence GAATTCTCCA ATCAGGTAAG TGCTTAAT ATG TCA GAC ATT CTC GAT CGC ATC 52 Met Ser Asp Ile Leu Asp Arg Ile 1 5 CTT GCC GTG AAA AAA CAG GAG GTC GCG GCC GCC CGG GCA CGA AAA TCC 100 Leu Ala Val Lys Lys Gln Glu Val Ala Ala Ala Arg Ala Arg Lys Ser 10 15 20 CTG GAA GGA ATC CGT AAG CAG GCA GAA GAA ATG CCT GCT CCG CGT GAT 148 Leu Glu Gly Ile Arg Lys Gln Ala Glu Glu Met Pro Ala Pro Arg Asp 25 30 35 40 TTT CTC CAG GCG ATA CGC GGC CGG ATC AGT CAG CAT CGT GCC GCT GTA 196 Phe Leu Gln Ala Ile Arg Gly Arg Ile Ser Gln His Arg Ala Ala Val 45 50 55 ATT GCA GAG ATC AAA CGG GCC AGC CCA AGC AAG GGT GTA TTA CGC GGG 244 Ile Ala Glu Ile Lys Arg Ala Ser Pro Ser Lys Gly Val Leu Arg Gly 60 65 70 CGA TCA GAA GCA CCC AAT CCG CAG GGA TCA GGG CAT GCG GAA AAC TCA 292 Arg Ser Glu Ala Pro Asn Pro Gln Gly Ser Gly His Ala Glu Asn Ser 75 80 85 TCC GGG AAA AAT CTG ATT CCG CAA GAT TTC ATC CCG GCA GAA ATT GCG 340 Ser Gly Lys Asn Leu Ile Pro Gln Asp Phe Ile Pro Ala Glu Ile Ala 90 95 100 GCC AGT TAT GCC CGA AAT GGT GCT GCC TGC CTG TCA GTC CTG ACA GAT 388 Ala Ser Tyr Ala Arg Asn Gly Ala Ala Cys Leu Ser Val Leu Thr Asp 105 110 115 120 GAA CAG TTT TTC ATG GGC AGT GCC GAT TTC TTG CGG CAA GCA CGT GCT 436 Glu Gln Phe Phe Met Gly Ser Ala Asp Phe Leu Arg Gln Ala Arg Ala 125 130 135 GCT TGT GAT TTA CCG GTA TTG CGC AAG GAT TTC ATA CTG GAC GAA TAT 484 Ala Cys Asp Leu Pro Val Leu Arg Lys Asp Phe Ile Leu Asp Glu Tyr 140 145 150 CAG GTC TAC GAA GCA CGC GCG ATG GGA GCG GAT TGC ATA CTG TTG ATC 532 Gln Val Tyr Glu Ala Arg Ala Met Gly Ala Asp Cys Ile Leu Leu Ile 155 160 165 GTC GCA GCA TTT CTT TCA CCG GTT TTC CAG CAG GAT GCC TCT GTC AAT 580 Val Ala Ala Phe Leu Ser Pro Val Phe Gln Gln Asp Ala Ser Val Asn 170 175 180 CAG GGC GAC AGT GCA CTC GAA CGG ATG CGC ATA TTG GAA ACC ACG GCA 628 Gln Gly Asp Ser Ala Leu Glu Arg Met Arg Ile Leu Glu Thr Thr Ala 185 190 195 200 CAA GCA CTG GGA ATG GCC ATA CTG GTA GAA GTA CAC GAT GCA GAT GAG 676 Gln Ala Leu Gly Met Ala Ile Leu Val Glu Val His Asp Ala Asp Glu 205 210 215 CTC GAT CTC GCG CTG CAA TTG ACT ACT CCG CTC ATC GGG ATC AAC AAC 724 Leu Asp Leu Ala Leu Gln Leu Thr Thr Pro Leu Ile Gly Ile Asn Asn 220 225 230 CGC AAC CTG CGA ACT TTC GAG ACT ACG CTG GAT ACC ACC GTT CAA TTG 772 Arg Asn Leu Arg Thr Phe Glu Thr Thr Leu Asp Thr Thr Val Gln Leu 235 240 245 GTC AGA CGC ATA CCA TCC GAA CGC ATC GTC GTC ACC GAA AGC GGT ATC 820 Val Arg Arg Ile Pro Ser Glu Arg Ile Val Val Thr Glu Ser Gly Ile 250 255 260 CGT ATC CCT GCC GAT GTG GAA ATG ATG CTA TCT CAT CAT ATT TAC GCT 868 Arg Ile Pro Ala Asp Val Glu Met Met Leu Ser His His Ile Tyr Ala 265 270 275 280 TTT CTG ATC GGG GAA ACA TTC ATG CGG GCA CCG GAT CCG GGC GCC GCA 916 Phe Leu Ile Gly Glu Thr Phe Met Arg Ala Pro Asp Pro Gly Ala Ala 285 290 295 CTG GCA AGC CTG TTT ACG ACA AAC CTG ACG TAA GCTGCGCTCT ACCATCAGTC 969 Leu Ala Ser Leu Phe Thr Thr Asn Leu Thr 300 305 GGGTAACTATTCACTCTCACTCTCTCCC CAATCAACCA AAAGGAGACC 1029 TTTATGAACT TCAGGAAACA ACTGACAGGC GGTTTGAGCA GCCTGATTCT TTCAGCAGTC 1089 ATGTCCGGCA GCCTGCTGGC AGCAGGTGTG GCAGAGTTTA ACGACAAGGG AGAACTGCTG 1149 CTGCCGAAAA ATTACCGTGA ATGGGTGATG GTCGGTACCC AGGTAACACC TAACGAATTG 1209 AACGATGGCA AAGCACCCTT CACCGAAATC AGAACAGTCT ATGTCGACCC GGAAAGCTAT 1269 GCTCACTGGA AAAAAACCGG TGAATTC 1296

SEQ ID NO: 3 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic primer DNA sequence CCAATCAGGT AAGTGCTTAA TATG 24

SEQ ID NO: 4 Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic primer DNA sequence CGGTTTTTTT CCAGTGAGCA TAGC 24

SEQ ID NO: 5 Sequence length: 19 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence CCGTCGTTTT ACAACGTCG 19

SEQ ID NO: 6 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence ATACGGGCAG ACATGGCCTG CCCGG 25

SEQ ID NO: 7 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence CGGGATCCAA CAAATAAGGA AATGTTATG 29

SEQ ID NO: 8 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic primer DNA sequence CCAGATCTTC CATATAAATG CCTCTATTAG 30

SEQ ID NO: 9 Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic primer DNA sequence CGAGATCTTC GAAATATTGA TGAGCAGC 28

SEQ ID NO: 10 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence CGGGATCCGT AAATATGCGG GTCAG 25

SEQ ID NO: 11 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic primer DNA sequence GGCTGCAGGA TCCAGCCAGA AAGTGAGGG 29

SEQ ID NO: 12 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GGCAGCTGCC GTCCCGTCAA GTCAGCG 27

SEQ ID NO: 13 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence GGATGCATGC GAGAGTAGGG AACTGCC 27

SEQ ID NO: 14 Sequence length: 37 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GGCTGCAGCA TGCGACAGGA AGAGTTTGTA GAAACGC 37

[Brief description of the drawings]

FIG. 1 is a restriction map of a 1.3 kb Eco RI fragment obtained in Production Example 1 (1). In the figure, the black line indicates the foreign DNA derived from N. europaea , and the white line indicates the coding region of the trpX gene.

FIG. 2 is a diagram showing the introduction of a mutation into the trpX gene in (2) of Production Example 1 and the construction of a vector containing this gene. In the figure, Δ trpX indicates a trpX gene which has been deleted, and Amp ^R indicates an ampicillin resistance gene.

FIG. 3 is a diagram showing the introduction of a mutation into a thiX synthetic gene and the construction of a vector pNHR2 containing this gene in (2) of Production Example 1. In the figure, Amp ^R represents an ampicillin resistance gene, and Km ^R represents a kanamycin resistance gene. lacZ indicates the β-galactosidase gene.

FIG. 4 is a diagram showing the introduction of a mutation into the trpX gene and the construction of a vector containing this gene in Production Example 1 (2). In the figure, Δ trpX indicates a trpX gene which has been deleted, Km ^R indicates a kanamycin resistance gene, and lacZ indicates a β-galactosidase gene.

FIG. 5 is a conceptual diagram of production of a tryptophan-requiring strain by homologous recombination in Production Example 1. In the figure, Km ^R indicates a kanamycin resistance gene, and lacZ indicates a β-galactosidase gene. Δ trpX indicates a trpX gene that was deleted. TrpF
7. TrpR1288, LacF295 and LacR3375 indicate the primers used for PCR, and the arrow indicates the direction.

FIG. 6 is a conceptual diagram of preparation of a tryptophan-requiring strain by homologous recombination in Production Example 1. In the figure, Km ^R indicates a kanamycin resistance gene, and lacZ indicates a β-galactosidase gene. Δ trpX indicates a trpX gene that was deleted. TrpF7
And TrpR1288 indicate the primers used for PCR, and the arrow indicates the direction.

FIG. 7 is a schematic diagram showing a construction process of pHLUX20 in Examples. Km ^R is the kanamycin resistance gene, rrnB T1T2
Indicates a terminator of the Escherichia coli ribosomal RNA gene.

FIG. 8 is a schematic diagram showing the construction process of pKTK40 used in the examples.

FIG. 9 is a graph showing the amount of residual luminescence when frozen cells are stored at −20 ° C. The amount of luminescence during freezing was set to 100%.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) (C12N 1/21 C12R 1:01)

Claims (3)

[Claims] 1. An ammonia-oxidizing bacterium that protects the bioluminescent ability of the ammonia-oxidizing bacterium and freezes the ammonia-oxidizing bacterium having a luciferase gene, and that coexists with a protective agent containing a protein that protects the response ability to a nitrification inhibitor. Preparation method of frozen cells of 2. The method according to claim 1, wherein the protective agent is at least one selected from the group consisting of albumin, globulin and skim milk. 3. Ammonia obtained by freezing ammonia-oxidizing bacteria having a luciferase gene in the presence of a protective agent containing a protein that protects the bioluminescence ability of the ammonia-oxidizing bacteria and also protects the ability to respond to nitrification inhibitors. Frozen cells of oxidizing bacteria.