JP2000191615A - Aromatic amine derivative, its production and agent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To produce a new compound which is a nonpeptidic compound having regulating actions on somatostatin receptor functions and useful as a preventing or a therapeutic agent for diabetes, obesity, diabetic complications, etc. SOLUTION: This compound is represented by formula I [ring A is a (substituted) aromatic ring; ring B is a (substituted) cyclic hydrocarbon; Z is a (substituted) cyclic group; R1 is H, a (substituted) hydrocarbon or the like; R2 is a (substituted) amino; D and G are each a direct bond or a bivalent group; E is CO or the like; L is a direct bond, a 1-6C alkyl or the like; X is O, an (oxidized) S or the like; Y is two H, O or S atoms; the dotted line may form a ring with R2 and an atom on the ring B], e.g. N-[2-(3-aminomethylphenoxy)-4- chlorophenyl]-N-'(4-biphenylmethyl)-N'-(2-fluorobenzyl)succinamide hydrochloride. Furthermore, the compound represented by formula I is produced by reacting a compound represented by formula II (R2a is a protecting group of R2 or the like) with a compound represented by formula III (Ra is H or a 1-6C alkyl).

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel aromatic amine derivative having a somatostatin receptor function regulating action,
The present invention relates to a method for producing the same and a medicament characterized by containing the same.

[0002]

2. Description of the Related Art Somatostatin has been isolated from sheep hypothalamus tissue as a peptide consisting of 14 amino acids (SST-14) having a growth hormone secretion inhibitory action. At present, somatostatin (SST-28) consisting of 28 amino acids has been isolated and identified. This somatostatin is not only the hypothalamus, for example, cerebrum, limbic system, spinal cord, vagus nerve, autonomic ganglion, gastrointestinal mucosa, pancreatic Langerhans islet, brain and intestinal peptide widely distributed, Suppresses the secretion of pituitary and gastrointestinal hormones such as growth hormone, thyroid stimulating hormone, gastrin, insulin and glucagon. Also, gastric acid secretion,
It also suppresses pancreatic exocrine secretion, gastrointestinal motility and blood flow. Somatostatin receptors have been type 1 to 5 (SSTR1, SSTR2, SSTR3, SSTR4,
SSTR5) is known, and it has been recognized that they exhibit different expression at central and peripheral sites. [1. Life Sciences, No. 57
Vol. 13, No. 1, p. 1249 (1995) Journal of Clinical Endocrinology and Metaboli
sm, Vol.80, No.6pp.1789-1793 3. The New England Journal of Medicine, Jan. 25, 1
996 4. 4. Eur J Clin Pharmacol, 1996, 51, 139-144. Exp. Opin. Ther. Patents (1998) 8 (7): 855-870]. Currently, clinically, peptidic somatostatin analogs that suppress secretion of specific hormones are being developed.

[0003]

At present, compounds that are being developed as somatostatin receptor function modulators are peptidic compounds, and have an action time, administration method, specificity, and the like.
There are many problems in terms of side effects. In terms of solving these problems, it is very significant to create and develop a compound that is a non-peptidic compound and has an excellent somatostatin receptor function regulating action.

[0004]

Means for Solving the Problems The present inventors have conducted various studies in view of the above-mentioned circumstances, and as a result, in the following formula (I), the cyclic hydrocarbon B has an amino group directly or via a divalent group. Formula (I) which has a chemical structural feature in being bonded:

Embedded image [In the formula, ring A is an aromatic ring which may have a substituent; ring B is a cyclic hydrocarbon group which may have a substituent; Z is a ring which may have a substituent R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent or an acyl group; R ² is an amino group which may be substituted D is a bond or a divalent group;
E is -CO-,-CON (R ^a )-,-COO-,-N (R ^a ) CON (R ^b )-,-N (R ^a ) COO
-,-N (R ^a ) SO ₂ -,-N (R ^a )-,-O-,-S-,-SO- or -SO _2- (R ^a , R
^b independently represents a hydrogen atom or a hydrocarbon group which may have a substituent); G represents a bond or a divalent group;
L has (1) a bond or (2) an i) C _1-6 alkyl group, ii) a halogeno-C _1-6 alkyl group, iii) a phenyl group, iv) a benzyl group, and v) a substituent. Vi) an optionally substituted hydroxy group, and vii) a C _1-6 alkyl group, an optionally substituted phenyl group or an optionally substituted substituent. It may have 1 to 5 substituents selected from a carbamoyl group or a thiocarbamoyl group, each of which may be substituted with a heterocyclic group, and may be via -O- or -S-.
X represents an oxygen atom, a sulfur atom which may be oxidized, a nitrogen atom which may have a substituent or a divalent hydrocarbon group which may have a substituent; Y is 2
Represents a hydrogen atom, an oxygen atom or a sulfur atom, and ‥‥‥ indicates that R ² and an atom on the B ring may form a ring. ] Or a salt thereof is synthesized for the first time, and based on its unique chemical structure, this compound has an excellent somatostatin receptor function regulating action,
They have found that they have excellent properties as pharmaceuticals, such as low toxicity and the like, and have completed the present invention based on these. That is, the present invention relates to (1) the compound (I) or a salt thereof; (2) the compound wherein L is an alkylene group which may be via -O- or may be substituted with a C _1-6 alkyl group. (3) The compound according to the above (1), wherein L is a C _1-6 alkylene group; (4) R ² is (1) an unsubstituted amino group, (2) a piperidyl group or ( 3) (i) benzyl, (ii) C _1-6 alkyl optionally substituted with amino or phenyl, (iii) (mono- or di-C _1-6 alkyl-carbamoyl) or -thiocarbamoyl, (iv ) C _1-6 alkoxy-carbonyl, (v) C
_It may have one or two substituents selected from _1-6 alkyl-sulfonyl, (vi) piperidylcarbonyl and (vii) C _1-6 alkyl-carbonyl optionally substituted with halogen or amino. (5) The compound according to (1), wherein R ² is an unsubstituted amino group; (6) a benzene ring wherein A may have a substituent. Or (7) the compound according to (1), wherein B is a benzene ring which may have a substituent; (8) E is -CON (R ^a ) (9) the compound according to (1), wherein X is an oxygen atom; (10) the compound according to (1), wherein D is a C _1-6 alkylene group; 11) wherein G is a C _1-6 alkylene group (1) the compound according; (12) There a hydrocarbon group which may have a substituent, and ring B compound of (1) described that do not form R ² and the nitrogen-containing heterocycle; (13) E is -CON (R ^a )-, G represents a divalent hydrocarbon group which may have a substituent, Y represents two hydrogen atoms, R ¹
Is a compound according to the above (1), wherein each represents an acyl group, and the ring B does not form a nitrogen-containing heterocyclic ring with R ² ; (14) A is a benzene ring or a pyridine ring, each of which may have a substituent; A benzene ring or a cyclohexane ring in which ring B may be substituted with C _1-6 alkoxy, or a tetrahydroisoquinoline ring or isoindoline ring formed by bonding to R ² ; Z is halogen, formyl, halogeno-C ₁ C _6-14 aryl group optionally having 1 to 3 substituents selected from C- ₆ alkyl, C _1-6 alkoxy, C _1-6 alkyl-carbonyl, oxo and pyrrolidinyl, C _3-10 cycloalkyl group, a piperidyl group, a thienyl group, a furyl group, a pyridyl group, a thiazolyl group, an indanyl group or indolyl group; D is C _1-6 alkylene group; G is binding Hand or phenylene may also contain, and a C _1-6 alkylene group optionally substituted by phenyl,; R ¹ there) hydrogen atom,
B) (1) halogen, (2) nitro, (3) C _1-6 alkyl - carbonyl, C _6-14 aryl - carbonyl, C _1-6 alkyl, C _1-6 alkyloxy - carbonyl, C _{7 - 14} Amino optionally having one or two substituents selected from aralkyloxy-carbonyl, C _1-6 alkyl-sulfonyl and C _6-14 aryl-sulfonyl, (4) (i) hydroxy, C _{1- 6} alkyl - carbonyl, C _6-14 aryl - carbonyl, carboxy or C _1-6 alkoxy - optionally substituted with a carbonyl C _1-6 alkyl, (ii)
Phenyl optionally substituted with hydroxy, (iii) benzoyl or (iv) hydroxy optionally substituted with mono- or di- _{Ci_6} alkylamino-carbonyl,
(5) C _3-6 cycloalkyl, (6) phenyl optionally substituted with hydroxy or halogeno-C _1-6 alkyl and (7) thienyl, furyl, thiazolyl, indanyl,
C which may be respectively substituted with a substituent selected from indolyl or benzyloxycarbonylpiperidyl
_1-6 alkyl groups, C _2-6 alkenyl group, C _6-14 aryl group, C _{7 - 14} aralkyl group, or c) an acyl group; R ² is (1)
Unsubstituted amino group, (2) piperidyl group or (3) (i) benzyl, (ii) C _1-6 alkyl optionally substituted with amino or phenyl, (iii) mono- or di-C _{1- 6} alkyl-carbamoyl or -thiocarbamoyl, (iv) C
1 or 2 selected from _1-6 alkoxy-carbonyl, (v) C _1-6 alkyl-sulfonyl, (vi) piperidylcarbonyl and (vii) C _1-6 alkyl-carbonyl optionally substituted with halogen or amino. An amino group optionally having three substituents; E is -CO-, -CON
( ^Ra )-, -N ( ^Ra ) CO- ( ^Ra is a hydrogen atom or C
_1-6 alkyl group) and L may be via -O-,
And the compound according to the above (1), which is a C _1-6 alkylene group _optionally substituted with C _1-6 alkyl; (15) a phenyl group wherein Z is optionally substituted with halogen; D is C _{1- 6 is an} alkylene group; G is a C _1-6 alkylene group;
R ¹ is a) (1) hydroxy, (2) phenyl, (3) thienyl,
Furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl and (4) C _1-6 alkyl-carbonyl, C _6-14 aryl-carbonyl, C
_A C _1-6 alkyl group or a C _7-14 aralkyl group which may be substituted with a substituent selected from an amino which may be substituted with a _1-6 alkyl-sulfonyl or a C _6-14 aryl-sulfonyl, or A) an acyl group; R ² is an unsubstituted amino group; E is —CON (R ^a ) —; the compound according to the above (1), wherein L is a C _1-6 alkylene group and Y is two hydrogen atoms; (16) a prodrug of the compound according to (1) or a salt thereof; (17) a formula (IIa)

Embedded image [In the formula, R ^2a may be protected, an amino group which may be substituted, and other symbols have the same meanings as described in the above (1). A compound represented by the formula (III):

Embedded image [The symbols in the formula have the same meanings as described in the above (1). By reacting the compound represented by the formula or a salt thereof,
Formula (Ia-a)

Embedded image [The symbols in the formula are as defined above. Wherein the compound represented by the formula (Ia) or a salt thereof is subjected to a deprotection reaction if desired.

Embedded image [The symbols in the formula are as defined above. (18) a pharmaceutical composition comprising the compound according to (1) or a salt thereof; (19) a pharmaceutical composition comprising a somatostatin receptor function modulator; (18) the pharmaceutical composition according to (19), wherein the somatostatin receptor function modulator is a somatostatin receptor agonist; (21) diabetes, obesity, diabetic complications or intractable diarrhea The pharmaceutical composition according to the above (18), which is a prophylactic or therapeutic agent for:

[0005] In the above formula, ring A represents an aromatic ring which may have a substituent. Examples of the aromatic ring include a 4- to 8-membered homocyclic or heterocyclic ring. It is preferably a 5- to 7-membered, more preferably 5- or 6-membered cyclic group. Examples of the homocyclic ring include aromatic hydrocarbons, and examples of the heterocyclic ring include those containing 1 to 4 nitrogen atoms, sulfur atoms, and oxygen atoms. Among them, the heterocyclic ring includes 1 to 3 nitrogen atoms. Is preferred. Specifically, a benzene ring, a pyridine ring, a pyridazine ring, a pyrimidine ring, a triazine ring, a furan ring, a pyran ring, a thiophene ring, and the like are used. Particularly, a benzene ring, a pyridine ring and the like are preferable. Examples of the substituent which the aromatic ring of the ring A may have include, for example, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), a C _1-6 alkyl group (eg, methyl, ethyl, propyl, butyl, sec
-Butyl, t-butyl, isopropyl, etc.), halogeno-
A C _1-6 alkyl group (eg, a C _1-6 alkyl group substituted with 1 to 5 of said “halogen atoms”; for example, trifluoromethyl, etc.), a phenyl group, a benzyl group, a C _1-6
Alkoxy groups (e.g., methoxy, ethoxy, propoxy, butoxy, sec-butoxy, t-butoxy, isopropoxy, etc.), halogeno- _C1-6 alkoxy groups (e.g.,
C _1-6 substituted by 1 to 5 said “halogen atoms”
Alkoxy group; for example, trifluoromethoxy, chloropropyloxy and the like), phenoxy group, C _7-14 aralkyloxy group (for example, benzyloxy, phenethyloxy, phenylpropyloxy, biphenylmethyloxy and the like), formyloxy group, C _{1 -6} alkyl - carbonyl group (e.g., acetyloxy, etc.), C _1-6 alkylthio group (e.g., methylthio, ethylthio, propylthio, butylthio, sec- butylthio, t-butylthio,
Isopropylthio, etc.), a halogeno-C _1-6 alkylthio group (eg, a C _1-6 alkylthio group substituted with 1 to 5 of said “halogen atoms”; eg, trifluoromethylthio, etc.), a hydroxy group, a mercapto group , A cyano group, a nitro group, a carboxyl group, a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, etc.), a benzoyl group, a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, Propoxycarbonyl, etc.), phenoxycarbonyl group, amino group, mono- or di-C _1-6 alkylamino group (eg, methylamino, ethylamino, dimethylamino, diethylamino, etc.), formylamino group, C _1-6
Alkyl-carbonylamino group (eg, acetylamino, propionylamino, butyrylamino, etc.), carbamoyl group, thiocarbamoyl group, mono- or di-C
_1-6 alkyl-carbamoyl group (for example, N-methylcarbamoyl, N-ethylcarbamoyl, N, N-dimethylcarbamoyl, N, N-diethylcarbamoyl and the like),
A mono- or di-C _1-6 alkyl-thiocarbamoyl group (eg, N-methylthiocarbamoyl, N-ethylthiocarbamoyl, N, N-dimethylthiocarbamoyl,
N, N-diethylthiocarbamoyl, etc.), sulfo group, C
_1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, etc.), benzoyl-C _1-6 alkoxy group (eg, benzoylmethyloxy, etc.), hydroxy-C _1-6 alkoxy group (eg, hydroxyethyl Oxy, etc.), C _1-6 alkoxy-
Carbonyl-C _1-6 alkoxy group (for example, methoxycarbonylmethyloxy and the like), C _3-14 cycloalkyl-C
_1-6 alkoxy group (for example, cyclohexylmethyloxy and the like), imidazol-1-yl-C _1-6 alkoxy group (for example, imidazol-1-ylpropyloxy and the like), C _7-14 aralkyloxy-carbonyl-C _{1 -6} alkoxy group (eg, benzyloxycarbonylmethyloxy, etc.), hydroxyphenyl-C _1-6 alkoxy group (eg, [3- (4-hydroxyphenyl) propyl] oxy, etc.), C _7-14 aralkyloxy-carbonyl Group (eg, benzyloxycarbonyl, etc.), mono- or di-C _1-6 alkylamino-C _1-6 alkoxy (eg, methylaminomethoxy, ethylaminoethoxy, dimethylaminomethoxy, etc.), mono- or di-C _{1- 6} alkylamino-carbonyloxy (for example, methylaminocarbonyloxy, ethylaminocar Bonyloxy, dimethylaminocarbonyloxy, etc.), and particularly the "halogen atom" is widely used. Further, the “aromatic ring” may have 1 to 4 substituents selected from these substituents.

When the ring A is a 6-membered ring, for example, the carbon atom bonded to X is 1-position, and the carbon atom bonded to N is 2
Position, the substitution position of the substituent on the ring A is 4
Or 5-position is preferred, and the number of substituents is 1 or 2
Are preferred. In particular, the ring A is preferably a benzene ring which may have a substituent, among which halogen,
Hydroxy, C _1-6 alkoxy, halogeno-C _1-6 alkoxy, C _7-14 aralkyloxy, benzoyl-C _1-6 alkoxy, hydroxy-C _1-6 alkoxy, C _1-6 alkoxy-carbonyl-C _{1- 6} alkoxy, C _3-14 cycloalkyl-C _1-6 alkoxy, imidazol-1-yl-
C _1-6 alkoxy, C _7-14 aralkyloxy-carbonyl-C _1-6 alkoxy or hydroxyphenyl-C _1-6
A benzene ring or the like which may be substituted with alkoxy is more preferred, and a benzene ring or an unsubstituted benzene ring substituted with halogen (preferably chlorine or the like), hydroxy or C _1-6 alkoxy (preferably methoxy or the like) is preferred. Most preferred.

In the above formula, the ring B represents a cyclic hydrocarbon group which may have a substituent. This cyclic hydrocarbon group is 3 to 1
A 4-membered member is preferred, a 5- to 8-membered member is preferred, and a 5- or 6-membered member is more preferred. As the ring B, an aromatic hydrocarbon group which may have a substituent is preferable, and a phenyl group which may have a substituent is particularly widely used. The "cyclic hydrocarbon group" represented by ring B includes, for example, an alicyclic hydrocarbon group composed of 3 to 14 carbon atoms or an aromatic hydrocarbon composed of 6 to 14 carbon atoms And the like. Examples of the “alicyclic hydrocarbon group” include a C _3-14 cycloalkyl group (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and a C _3-14 cycloalkenyl group (eg, cyclopentenyl, cyclohexenyl, etc.) ),
C _5-14 cycloalkadienyl groups (e.g., 2,4-cyclopentadienyl, 1,3-cyclohexadienyl, etc.), indanyl group and the like. Preferably, 5-
It is an 8-membered alicyclic hydrocarbon group. Examples of the “aromatic hydrocarbon group” include an aromatic hydrocarbon group composed of 6 to 14 carbon atoms (for example, C _6-14 aryl such as phenyl, naphthyl, anthranyl, and phenanthryl). , Preferably a 6 to 10-membered aromatic hydrocarbon group, particularly preferably a phenyl group. Examples of the substituent which the “alicyclic hydrocarbon group” and “aromatic hydrocarbon group” of the ring B may have include, for example, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C _{1 -6} alkyl group (for example, methyl, ethyl, propyl, butyl, sec-butyl, t-butyl, isopropyl, etc.), halogeno-C _1-6 alkyl group (for example, substituted with 1 to 5 of said "halogen atoms") C _1-6 alkyl group and the like; for example, trifluoromethyl and the like, phenyl group, benzyl group, C _1-6 alkoxy group (for example, methoxy, ethoxy, propoxy, butoxy, sec-butoxy, t-butoxy, isopropoxy) etc.), a halogeno -C _1-6 alkoxy group (e.g., 1 to 5 of the C _1-6 alkoxy group substituted with "halogen atom"; trifluoromethoxy, chloro propyloxy, etc.), off Phenoxy group, C _{7 - 14} aralkyloxy group (e.g., benzyloxy, phenethyloxy, phenylpropyloxy etc.), formyloxy, C _1-6 alkyl - carbonyl group (e.g., acetyloxy, etc.), C _1-6 Alkylthio groups (eg, methylthio, ethylthio, propylthio, butylthio, se
c-butylthio, t-butylthio, isopropylthio, etc.), a halogeno-C _1-6 alkylthio group (for example, a C _1-6 alkylthio group substituted with 1 to 5 of said “halogen atoms”; for example, trifluoromethylthio) ), A hydroxy group, a mercapto group, a cyano group, a nitro group, a carboxyl group, a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, etc.), a benzoyl group, a C _1-6 alkoxy-carbonyl group ( For example, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, etc.), phenoxycarbonyl group, amino group, mono-
Or a di-C _1-6 alkylamino group (eg, methylamino, ethylamino, dimethylamino, diethylamino, etc.), a formylamino group, a C _1-6 alkyl-carbonylamino group (eg, acetylamino, propionylamino, butyrylamino, etc.) ), A carbamoyl group, a thiocarbamoyl group, a mono- or di-C _1-6 alkyl-carbamoyl group (for example, N-methylcarbamoyl, N-ethylcarbamoyl, N, N-dimethylcarbamoyl, N, N
-Diethylcarbamoyl etc.), mono- or di-C _1-6
Alkyl-thiocarbamoyl groups (for example, N-methylthiocarbamoyl, N-ethylthiocarbamoyl, N, N
-Dimethylthiocarbamoyl, N, N-diethylthiocarbamoyl, etc.), a sulfo group, a C _1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, etc.), a benzoyl-C _1-6 alkoxy group (eg, Benzoylmethyloxy and the like), hydroxy-C _1-6 alkoxy group (for example, hydroxyethyloxy and the like), C _1-6 alkoxy-carbonyl-C _1-6 alkoxy group (for example, methoxycarbonylmethyloxy and the like),
C _3-14 cycloalkyl-C _1-6 alkoxy group (for example,
Cyclohexylmethyloxy, etc.), imidazole-1-
Yl-C _1-6 alkoxy group (for example, imidazole-1
-Ylpropyloxy, etc.), C _7-14 aralkyloxy-
Carbonyl-C _1-6 alkoxy group (for example, benzyloxycarbonylmethyloxy, etc.), hydroxyphenyl-C _1-6 alkoxy group (for example, [3- (4-hydroxyphenyl) propyl] oxy, etc.), C _7-14 Aralkyloxy-carbonyl groups (eg, benzyloxycarbonyl, phenethyloxycarbonyl, phenylpropyloxycarbonyl, etc.), mono- or di-C _1-6 alkylamino-C _1-6 alkoxy (eg, methylaminomethoxy, ethylaminoethoxy, Dimethylaminomethoxy), mono- or di-C _1-6 alkylamino-carbonyloxy (eg, methylaminocarbonyloxy, ethylaminocarbonyloxy, dimethylaminocarbonyloxy, etc.). The “alicyclic hydrocarbon group”
And the "aromatic hydrocarbon group" may have 1 to 4 substituents selected from these substituents.

[0008] Especially as the B ring, a benzene ring or a cycloalkane and the like are preferable have a substituent, respectively, among others C _1-6 alkoxy (preferably methoxy, etc.) is a benzene ring optionally or substituted with A cyclohexane ring or the like is more preferred, and an unsubstituted benzene ring or cyclohexane ring is most preferred. Also, R ² and B
May form a ring with the atoms on the ring, for example, ring B, L is adjacent to the atom that forms the B ring attached, the atoms forming the ring B, R ² May be combined with an amino group or a substituent of the amino group to form a nitrogen-containing heterocyclic ring which may have a substituent. When such a nitrogen-containing heterocyclic ring is formed, the nitrogen atom of the amino group of R ² may be directly bonded to the atom forming the B ring or may be bonded via a spacer. Good. This spacer means a part or all of the substituent of the amino group of R ² . The “nitrogen-containing heterocycle” formed by bonding L and R ² to an adjacent atom on the ring B is, for example, a cyclic hydrocarbon optionally having a substituent represented by the ring B (Eg, a benzene ring) and a 5- or 6-membered monocyclic ring having at least one nitrogen atom and optionally having one or two heteroatoms selected from a nitrogen atom, an oxygen atom and a sulfur atom A bicyclic fused nitrogen-containing heterocyclic ring (preferably 2
Cyclic non-aromatic condensed nitrogen-containing heterocycle) and the like, and specifically, for example, tetrahydroisoquinoline (eg, 1,2,
3,4-tetrahydroisoquinoline), tetrahydroquinoline (eg 1,2,3,4-tetrahydroquinoline), isoindoline, indoline, 2,3-dihydrobenzothiazole, 2,3-dihydrobenzoxazole, 3,4-dihydro -2H-1,4-benzothiazine,
3,4-dihydro-2H-1,4-benzoxazine,
1,2,3,4-tetrahydroquinoxaline, 2,3,4,5
-Tetrahydro-1,4-benzoxazepine and the like are used, and among them, tetrahydroisoquinoline is preferable. Examples of the substituent which the “nitrogen-containing heterocyclic ring optionally having” may have include, for example, the “alicyclic hydrocarbon group” and the “aromatic hydrocarbon group” in the ring B. Examples include the same substituents as the substituents that may be possessed. The “nitrogen-containing heterocycle optionally having substituent (s)” may have 1 to 4 substituents selected from these substituents.

In the above formula, Z represents a cyclic group which may have a substituent. Examples of the “cyclic group” represented by Z include a cyclic hydrocarbon group and a heterocyclic group. Z is preferably, for example, an aromatic hydrocarbon group which may have a substituent, an aromatic heterocyclic group which may have a substituent or the like, and particularly preferably a phenyl group which may have a substituent. Are preferred. Examples of the cyclic hydrocarbon group for Z include an alicyclic hydrocarbon group composed of 3 to 14 carbon atoms, an aromatic hydrocarbon group composed of 6 to 14 carbon atoms, and the like. Examples of the alicyclic hydrocarbon group for Z include a C _3-14 cycloalkyl group (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and a C _3-14 cycloalkenyl group (eg, cyclopentenyl, cyclohexenyl, etc.) A C _5-14 cycloalkadienyl group (for example, 2,4-cyclopentadienyl,
1,3-cyclohexadienyl), an indanyl group and the like. Preferably, it is a 5- to 8-membered alicyclic hydrocarbon group. Examples of the aromatic hydrocarbon group for Z include C _6-14
And aryl groups (for example, phenyl, naphthyl, anthranyl, phenanthryl and the like). Preferably,
It is a 6- to 10-membered aromatic hydrocarbon group. Examples of the heterocyclic group for Z include a monocyclic heterocyclic group and a polycyclic fused heterocyclic group. The "monocyclic heterocyclic group" includes, for example, 5 or 6 having 1 to 4 hetero atoms selected from nitrogen, oxygen and sulfur atoms in addition to carbon atoms.
And a monocyclic aromatic heterocyclic group (e.g., furyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, imidazolyl, pyrazolyl,
2,3-oxadiazolyl, 1,2,4-oxadiazolyl, furazanil, 1,2,3-thiadiazolyl, 1,
2,4-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, triazinyl, etc.), monocyclic non-aromatic heterocycle Groups such as oxiranyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, tetrahydrofuryl,
Thiolanyl, piperidyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl, piperazinyl, and the like). Examples of the “polycyclic fused heterocyclic group” include, for example, and a 2- or 3-cyclic aromatic fused heterocyclic group formed by condensing two or three of the “monocyclic aromatic heterocycle”; A condensed bicyclic or tricyclic aromatic heterocyclic group formed by condensing one or two monocyclic aromatic heterocycles with a benzene ring (preferably a monocyclic heteroaromatic ring) Bicyclic or tricyclic aromatic condensed heterocyclic group formed by condensing one or two benzene rings) and their partially reduced products, and the like. Fused heterocyclic groups (e.g., benzofuryl, isobenzofuryl, benzo [b] thienyl, indolyl, isoindolyl, 1H-indazolyl, benzimidazolyl, benzoxazolyl, 1,2-benzoisoxazolyl,
Benzothiazolyl, 1,2-benzisothiazolyl, 1
H-benzotriazolyl, quinolyl, isoquinolyl, cinnolyl, quinazolinyl, quinoxalinyl, phthalazinyl, naphthyridinyl, prenyl, pteridinyl, dibenzofuryl, carbazolyl, α-carbolinyl, β-carbolinyl, γ-carbolinyl, acridinyl, phenoxazinyl, phenothinyl , Phenoxathiinyl, thianthrenyl, phenatridinyl, phenatrolinyl, indolizinyl, pyrrolo [1,2-b]
Pyridazinyl, pyrazolo [1,5-a] pyridyl, imidazo [1,2-a] pyridyl, imidazo [1,5-a]
Pyridyl, imidazo [1,2-a] pyridazinyl, imidazo [1,2-a] pyrimidinyl, 1,2,4-triazolo [4,3-a] pyridyl, 1,2,4-triazolo [4,3- b] pyridazinyl, etc.), polycyclic non-aromatic condensed heterocycle (eg, isochromanyl, chromanyl, indolyl, isoindolyl, 1,2,3,4-tetrahydroisoquinolyl, 1,2,3,4-tetrahydroquinolyl) Etc.) are used.

Examples of the substituent which the cyclic group represented by Z may have include, for example, those similar to the substituents which the cyclic hydrocarbon in the ring B may have, an oxo group,
And a thioxo group. The “cyclic group” for Z may have 1 to 5 substituents selected from these substituents. Z has 1 to 3 substituents selected from, for example, halogen, formyl, halogeno-C _1-6 alkyl, C _1-6 alkoxy, C _1-6 alkyl-carbonyl, oxo and pyrrolidinyl. C _6-14 aryl group (preferably phenyl or the like), C _3-10 cycloalkyl group, piperidyl group, thienyl group, furyl group, pyridyl group, thiazolyl group, indanyl group, indolyl group and the like are preferable, and halogen ( A phenyl group or the like substituted with preferably fluorine or the like is preferable. As the substitution position of the substituent in the cyclic group represented by Z, when Z is a phenyl group, an ortho position is preferable, and the number of substituents is preferably one.

In the above formula, D represents a bond or a divalent group, and the divalent group may have, for example, a substituent;
O-, -S-, or -N ( ^Ra )-(Ra represents ^a hydrogen atom or ^a hydrocarbon group which may have a substituent.). Among them, a divalent group bonded to a ring via a carbon atom is preferable, and a divalent hydrocarbon group which may have a substituent is particularly preferable. 2 represented by D
As the valent group, for example, a linear divalent hydrocarbon group having 1 to 10 carbon atoms which may have a substituent is used, and specifically, for example, C _1-10 alkylene group (e.g., methylene, ethylene, propylene, butylene, pentamethylene, hexamethylene, Peputamechiren, octamethylene, etc.) and the like, particularly C _1-6 alkylene group (e.g., methylene, ethylene, propylene, butylene, pentamethylene, Hexamethylene and the like). In addition, these divalent groups may be, for example, C _3-6 cycloalkylene (eg, 1,4-cyclohexylene etc.), phenylene (eg 1,4-phenylene, 1,2-phenylene etc.) at any position. Etc. may be included. D
As a substituent which the divalent group represented by may have, for example, a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, etc.), a halogeno-C _1-6 alkyl group (eg, 1 to 5 said "halogen atoms"
In substituted C _1-6 alkyl group; e.g. trifluoromethyl, etc.), a phenyl group, a benzyl group, an optionally substituted amino group, hydroxy group optionally having a substituent, And a thiocarbamoyl group which may have a substituent. The “divalent group” is such that these substituents are 1 to 3
You may have one. In particular, D is preferably a C _1-6 alkylene group (eg, methylene, ethylene, propylene, etc., preferably methylene, etc.). In the above formula, G represents a bond or a divalent group. As the divalent group represented by G, for example, those similar to the aforementioned “divalent group” represented by D and the like are used. G is preferably a C _1-6 alkylene group which may contain, for example, a bond or phenylene and may be substituted with phenyl, and is, for example, a C _1-6 alkylene group (eg, methylene, ethylene, propylene) Etc.) are preferred. Here, the C _1-6 alkylene group represented by G may have phenylene interposed between the C _1-6 alkylene group and E or Z, or may have phenylene in the C _1-6 alkylene group. Is also good.

In the above formula, R ¹ represents a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent or an acyl group. R ¹ is preferably a hydrocarbon group or an acyl group which may have a substituent. Examples of the hydrocarbon group represented by R ¹ include an aliphatic hydrocarbon group, an alicyclic hydrocarbon group, an aryl group, an aralkyl group, a polycyclic condensed hydrocarbon group, and the like. Particularly, an aliphatic hydrocarbon group Are preferred. Examples of the aliphatic hydrocarbon group for R ¹ include an aliphatic hydrocarbon group having 1 to 10 carbon atoms (eg, a C _1-10 alkyl group, a C _2-10 alkenyl group, a C _2-10 alkynyl group, etc.). No. Examples of the “C _1-10 alkyl group” include, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, 1-methylpropyl, hexyl, isohexyl, , 1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 3,3-dimethylpropyl, 2-ethylbutyl, heptyl and the like, and preferably, for example, C _3-5
Examples include an alkyl group (for example, propyl, isopropyl, isobutyl, neopentyl and the like), and particularly preferred is isobutyl and neopentyl. Examples of the “C _2-10 alkenyl group” include vinyl, allyl, isopropenyl, 2-methylallyl, 1-propenyl, 2-methyl-
1-propenyl, 2-methyl-2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-ethyl-1
-Butenyl, 2-methyl-1-butenyl, 3-methyl-
2-butenyl, 1-pentenyl, 2-pentenyl, 3-
Pentenyl, 4-pentenyl, 4-methyl-3-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl and the like, and particularly a C _2-6 alkenyl group (for example, vinyl, Allyl, isopropenyl, 2-methylallyl, 2-methyl-1-propenyl, 2-methyl-2-propenyl, 3-methyl-2
-Butenyl and the like) and the like. As the “C _2-10 alkynyl group”, for example, ethynyl, 1-propynyl, 2-
Propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl and the like And a C _2-6 alkynyl group (eg, ethynyl, 1-propynyl, 2-propynyl, etc.) is particularly preferable.

The alicyclic hydrocarbon group for R ¹ is, for example, an alicyclic hydrocarbon group having 3 to 10 carbon atoms (for example, C
_3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C
_5-10 cycloalkadienyl group). Examples of the “C _3-10 cycloalkyl group” include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl and the like. The “C _3-10 cycloalkenyl group”
As 1-cyclobuten-1-yl, 1-cyclopenten-1-yl, 2-cyclopenten-1-yl, 3-cyclopenten-1-yl, 2-cyclohexen-1-yl, 3-cyclohexen-1- And the like. Examples of the “C _5-10 cycloalkadienyl group” include 2,4-cyclopentadien-1-yl,
2,5-cyclohexadien-1-yl and the like. Examples of the aryl group for R ¹ include a C _6-14 aryl group (eg, phenyl, naphthyl, anthryl, phenanthryl, acenaphthylenyl, etc.). R
Examples of the ¹ aralkyl group include a C _7-14 aralkyl group (for example, benzyl, phenethyl, 3-phenylpropyl, 4-phenylbutyl, 2-naphthylmethyl, and the like). Examples of the polycyclic fused hydrocarbon group for R ¹ include an indanyl group and a fluorenyl group. R
Examples of the substituent which the hydrocarbon group ¹ may have include, for example, a halogen atom, a nitro group, a cyano group, an imino group, an amino group which may have a substituent, A good hydroxy group, a carboxyl group which may be esterified, a carbamoyl group which may have a substituent, a thiocarbamoyl group which may have a substituent, a cycloalkyl group, a cycloalkenyl group, and a substituent. Examples include a heterocyclic group, an alkyl group, a halogenoalkyl group, an optionally substituted aryl group, an indanyl group, a fluorenyl group, and the like. These substituents may have 1 to 5 (preferably,
1 to 3) may be substituted. Examples of the halogen atom as a substituent of the hydrocarbon group for R ¹ include fluorine, chlorine, bromine, and iodine.

Examples of the above-mentioned "amino group which may have a substituent" which is a substituent of R ¹ , a substituent of D, G and L include (1) (i) 1 to 5 The “halogen atom” or a C _1-6 alkyl group optionally substituted with a C _1-6 alkoxy group (eg, methyl,
Ethyl, propyl, isopropyl, trifluoromethyl, etc.), C _6-10 aryl group (eg, phenyl group), C
_7-14 aralkyl group (eg, benzyl group), (ii) formyl group, C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, butyryl, etc.), C _6-14 aryl-carbonyl group (eg, benzoyl group, etc.) ), (Iii) a C _1-6 alkoxy-carbonyl group (for example, methoxycarbonyl,
Ethoxycarbonyl, propoxycarbonyl, sec-propoxycarbonyl, butoxycarbonyl, etc.), C _7-14
Aralkyloxy-carbonyl groups (e.g., benzyloxycarbonyl, phenethyloxycarbonyl, phenylpropyloxycarbonyl, etc.), (iv) sulfo group, C
_1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, sec-propylsulfonyl, butylsulfonyl, t-butylsulfonyl, etc.), C _6-14 arylsulfonyl (eg, benzenesulfonyl, naphthalenesulfonyl, anthracene sulfonyl) And (v) one or two substituents selected from C _1-6 alkylamino-carbonyl groups (eg, methylaminocarbonyl, ethylaminocarbonyl, propylaminocarbonyl, butylaminocarbonyl, dimethylaminocarbonyl, etc.) And (2) a 5- or 6-membered substituted group such as a pyrrolidinyl group, a piperidyl group, a morpholinyl group, a thiomorpholinyl group, a 4-methylpiperidyl group, or a 4-phenylpiperidyl group. Cyclic And the like. Examples of the substituent which the hydrocarbon group of R ¹ and the “hydroxy group optionally having” which are substituents of D, G and L may have include (i) substituted A C _1-6 alkyl group which may have a group, (ii) a C _6-10 aryl group which may have a substituent, and (iii) C _7-14 which may have a substituent. Aralkyl groups and (iv) acyl groups.

The above "C optionally having substituent (s)"_1-6A
Ruquil group ”_1-6Examples of the "alkyl group" include, for example,
Chill, ethyl, propyl, isopropyl, butyl, pen
Chill and the like. In addition, this "C_1-6Alkyl group "
Is, for example, a halogen atom (eg, fluorine, chlorine, odor
, Iodine, etc.), hydroxy group, C_1-6Alkoxy group
(Eg, methoxy, ethoxy, propoxy, isopro
Etc.), formyl group, C_1-6Alkyl-carbonyl
Groups (eg, acetyl, propionyl, butyryl, etc.),
Carboxy group, C_1-6Alkoxy-carbonyl group (eg,
For example, methoxycarbonyl, ethoxycarbonyl, propo
Xycarbonyl, sec-propoxycarbonyl, butoki
Cyclocarbonyl, etc.), amino group, mono- or di-C_1-6
Alkylamino group (for example, methylamino, ethylamino
, Dimethylamino, diethylamino, etc.), pyrrolidyl
Group, piperidyl group, morpholinyl group, thiomorpholinyl
Group, 4-methylpiperidyl group, 4-phenylpiperidyl
Group, carbamoyl group, thiocarbamoyl group, mono- or
Is Di-C_1-6Alkyl-carbamoyl group (for example, N-
Methylcarbamoyl, N-ethylcarbamoyl, N, N
-Dimethylcarbamoyl, N, N-diethylcarbamoy
Mono- or di-C)_1-6Alkyl-thiocarba
Moyl groups (eg, N-methylthiocarbamoyl, N-
Ethylthiocarbamoyl, N, N-dimethylthiocarba
Moyl, N, N-diethylthiocarbamoyl, etc.)
Nonoxy group, mono- or di-C_1-6Alkyl-carbamo
An yloxy group (for example, N-methylcarbamoyloxy)
Si, N-ethylcarbamoyloxy, N, N-dimethyl
Carbamoyloxy, N, N-diethylcarbamoylo
Xy, etc.), mono- or di-C_1-6Alkyl-thiocal
Bamoyloxy group (for example, N-methylthiocarbamoy)
Ruoxy, N-ethylthiocarbamoyloxy, N, N
-Dimethylthiocarbamoyloxy, N, N-diethyl
Thiocarbamoyloxy, etc.), formylamino group, C
_1-6Alkyl-carbonylamino group (for example, acetyl
Amino, propionylamino, butyrylamino, etc.), e
A rumiloxy group and C _1-6Alkyl-carbonyloxy
1 to 1 selected from groups (eg, acetoxy)
It may have three substituents.

[0016] Examples of the "C _6-10 aryl group" of the "optionally having substituent optionally C _6-10 aryl group", for example, phenyl, naphthyl and the like. The “C _6-10 aryl group” includes, for example, a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, etc.) in addition to the substituents that the “C _1-6 alkyl group” may have. ) And a halogeno-C _1-6 alkyl group (for example, C 1 -C 5 substituted with 1 to 5 such “halogen atoms” such as trifluoromethyl)
_1-6 alkyl groups, etc.). As the "C _7-14 aralkyl group" of the "optionally C _7-14 aralkyl group optionally having a substituent", for example, benzyl, phenethyl, phenylpropyl, and the like. Examples of the substituent that the “C _7-14 aralkyl group” may have include the same substituents as those that the “C _6-10 aryl group” may have, and the like. The radix is 1 to 5. In addition, examples of the substituent that the “phenyl group optionally having” of L may have include the above “C _6-10 aryl group _optionally having a substituent”. And the like substituents which may be substituted.

The "acyl group" is represented by the following formula. _{^{-COR 3, -COOR 4, -SO 2}} R 5, -CONR
^{6 R 7, -CSNR 8 R 9} , -SOR 10 or -PO ₃ R ¹¹
R ¹² [where R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R
¹⁰ , R ¹¹ and R ¹² are the same or different and each represents a hydrogen atom, an optionally substituted hydrocarbon group or an optionally substituted heterocyclic group. "Optionally substituted hydrocarbon group" represented by R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ and R ¹²
Examples of the “hydrocarbon group” include “hydrocarbon group of R ¹ ”
R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R
^9, as the R ^10, R ¹¹ and hydrocarbon group substituent which may be possessed by the R ^12, a halogen atom, a nitro group, a cyano group, an imino group, an amino group which may have a substituent An optionally substituted hydroxy group, an optionally esterified carboxyl group, an optionally substituted carbamoyl group, an optionally substituted thiocarbamoyl group, cycloalkyl Groups, a cycloalkenyl group, a heterocyclic group which may have a substituent, an alkyl group, a halogenoalkyl group, an aryl group which may have a substituent, an indanyl group, and a fluorenyl group. Here, "amino group which may have a substituent",
"Optionally esterified carboxyl group", "optionally substituted carbamoyl group", "optionally substituted thiocarbamoyl group", "cycloalkyl group", "cycloalkenyl" group "," optionally substituted heterocyclic group "," alkyl group ", the" halogenoalkyl group "and" optionally substituted aryl group ", the R ¹ hydrocarbon `` Amino group optionally having a substituent '' as a substituent that the group may have,
"Optionally esterified carboxyl group", "optionally substituted carbamoyl group", "optionally substituted thiocarbamoyl group", "cycloalkyl group", "cycloalkenyl" Groups "," optionally substituted heterocyclic groups "," alkyl groups "," halogenoalkyl groups ", and the same as" optionally substituted aryl groups ", and the like. However, the “hydroxy group optionally having a substituent” includes (i) a C _1-6 alkyl group, (ii) a C _6-10 aryl group, (iii) a C _7-14 aralkyl group, and (iv) ) Formyl group, (v) C _1-6 alkyl-carbonyl group (for example, acetyl, propionyl, butyryl, t
-Butylcarbonyl, etc.), (vi) C _6-14 aryl-carbonyl group (for example, benzoyl, naphthalenecarbonyl,
Anthracene carbonyl, etc.), (vii) C _1-6 alkoxy-
Carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, sec-propoxycarbonyl, butoxycarbonyl, t-butoxycarbonyl, etc.), (viii) C _7-14 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl, phenethyloxy) Carbonyl, phenylpropyloxycarbonyl, etc.), (ix) C _6-14 cyclic hydrocarbon-carbonyl (for example,
Benzenecarbonyl, fluorenecarbonyl, etc.), (x)
Heterocycle-carbonyl (e.g., furancarbonyl, thiophenecarbonyl, pyridinecarbonyl, benzofurancarbonyl, benzothiophenecarbonyl, carbazolecarbonyl, dibenzofurancarbonyl, etc.), (xi) C
_1-6 alkylsulfonyl group (for example, methylsulfonyl, ethylsulfonyl, propylsulfonyl, sec-propylsulfonyl, butylsulfonyl, t-butylsulfonyl, etc.), (xii) _C6-14 aryl-sulfonyl group (for example, benzenesulfonyl, Naphthalenesulfonyl, anthracene sulfonyl, etc.), (xiii) carbamoyl group, (x
iv) thiocarbamoyl group, (xv) mono- or di-C _1-6 alkyl-carbamoyl group (for example, N-methylcarbamoyl, N-ethylcarbamoyl, N, N-dimethylcarbamoyl, N, N-diethylcarbamoyl and the like) , (Xvi)
A mono- or di-C _1-6 alkyl-thiocarbamoyl group (eg, N-methylthiocarbamoyl, N-ethylthiocarbamoyl, N, N-dimethylthiocarbamoyl,
N, N-diethylthiocarbamoyl) and the like,
These (i) to (xvi) further include, for example, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), a hydroxy group, a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy, isopropoxy, etc.) , Formyl group, C
_1-6 alkyl-carbonyl group (eg, acetyl, propionyl, butyryl, etc.), carboxyl group, C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl,
Ethoxycarbonyl, propoxycarbonyl, sec-propoxycarbonyl, butoxycarbonyl, etc.), amino group, mono- or di-C _1-6 alkylamino group (eg, methylamino, ethylamino, dimethylamino, diethylamino, etc.), pyrrolidinyl group, Piperidyl group, morpholinyl group, thiomorpholinyl group, 4-methylpiperidyl group, 4-phenylpiperidyl group, 4-benzyloxycarbonylpiperidyl group, carbamoyl group, thiocarbamoyl group, mono- or di-C _1-6 alkyl-carbamoyl group ( For example, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, etc.), mono - or di -C _1-6 alkyl - thiocarbamoyl group (e.g., methyl thiocarbamoyl, ethyl thiocarbamoyl, Jimechiruchi Carbamoyl, such as diethyl thiocarbamoyl), a phenoxy group, a mono - or di -
A C _1-6 alkyl-carbamoyloxy group (eg, methylcarbamoyloxy, ethylcarbamoyloxy, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), a mono- or di-C _1-6 alkyl-thiocarbamoyloxy group (eg, methylthiocarbamoyl) Oxy, ethylthiocarbamoyloxy, dimethylthiocarbamoyloxy, diethylthiocarbamoyloxy, etc.), formylamino group, C _1-6 alkyl-carbonylamino group (eg, acetylamino, propionylamino, butyrylamino, etc.), formyloxy group and C
_It may have 1 to 3 substituents selected from _1-6 alkyl-carbonyloxy groups (for example, acetoxy and the like) and the like. R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ⁹ ,
Examples of "heterocyclic group" of R ^10, R ¹¹ and "optionally substituted heterocyclic group" represented by R ¹² is, like those similar to the "heterocyclic group Z", R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ ,
The substituents that the heterocyclic group of R ⁸ , R ⁹ , R ¹⁰ , R ¹¹ and R ¹² may have are the same as the substituents that the cyclic group represented by Z may have, and And pyrrolidinyl groups.

Specifically, for example, a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, butyryl, t-butylcarbonyl, etc.), a C _6-14 aryl-carbonyl group (eg, benzoyl, naphthalene) Carbonyl, anthracene carbonyl, etc.), C _1-6 alkoxy-carbonyl group (for example, methoxycarbonyl,
Ethoxycarbonyl, propoxycarbonyl, sec-propoxycarbonyl, butoxycarbonyl, t-butoxycarbonyl, etc., C _7-14 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl, phenethyloxycarbonyl, phenylpropyloxycarbonyl, etc.), C _{6 -14} cyclic hydrocarbon-carbonyl (eg, benzenecarbonyl, fluorenecarbonyl, etc.), heterocyclic-
Carbonyl (e.g., furan carbonyl, thiophene carbonyl, pyridine carbonyl, benzofuran carbonyl, benzothiophene-carbonyl, carbazole carbonyl, dibenzofuran carbonyl, etc.), C _1-6 alkylsulfonyl group (e.g., methylsulfonyl, ethylsulfonyl, propylsulfonyl, sec- propyl Sulfonyl, butylsulfonyl, t-butylsulfonyl, etc.), C
_6-14 aryl-sulfonyl group (for example, benzenesulfonyl, naphthalenesulfonyl, anthracensulfonyl, etc.), carbamoyl group, thiocarbamoyl group, mono- or di-C _1-6 alkyl-carbamoyl group (for example, N
-Methylcarbamoyl, N-ethylcarbamoyl, N,
N-dimethylcarbamoyl, N, N-diethylcarbamoyl, etc.), mono- or di-C _1-6 alkyl-thiocarbamoyl group (for example, N-methylthiocarbamoyl, N
-Ethylthiocarbamoyl, N, N-dimethylthiocarbamoyl, N, N-diethylthiocarbamoyl, etc.), and further include, for example, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), a hydroxy group,
C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy, isopropoxy, etc.), formyl group, C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, butyryl, etc.), carboxyl group, C _1-6 alkoxy A carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, sec-propoxycarbonyl, butoxycarbonyl, etc.), an amino group, a mono- or di-C _1-6 alkylamino group (eg, methylamino, ethylamino, dimethyl Amino, diethylamino, etc.), pyrrolidinyl group, piperidyl group, morpholinyl group, thiomorpholinyl group, 4-methylpiperidyl group,
4-phenylpiperidyl group, 4-benzyloxycarbonylpiperidyl group, carbamoyl group, thiocarbamoyl group, mono- or di-C _1-6 alkyl-carbamoyl group (for example, methylcarbamoyl, ethylcarbamoyl,
Dimethylcarbamoyl, diethylcarbamoyl and the like), mono- or di-C _1-6 alkyl-thiocarbamoyl group (for example, methylthiocarbamoyl, ethylthiocarbamoyl, dimethylthiocarbamoyl, diethylthiocarbamoyl and the like), phenoxy group, mono- and di- C _1-6
An alkyl-carbamoyloxy group (eg, methylcarbamoyloxy, ethylcarbamoyloxy, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), a mono- or di-C _1-6 alkyl-thiocarbamoyloxy group (eg, methylthiocarbamoyloxy, ethylthio) Carbamoyloxy, dimethylthiocarbamoyloxy, diethylthiocarbamoyloxy, etc.), formylamino group, C _1-6 alkyl-carbonylamino group (eg, acetylamino, propionylamino, butyrylamino, etc.), formyloxy group and C
_It may have 1 to 3 substituents selected from _1-6 alkyl-carbonyloxy groups (for example, acetoxy and the like) and the like.

The "acyl group" may have a substituent (1) a 5- to 6-membered aromatic ring such as a benzene ring, a furan ring, a thiophene ring and a pyridine ring; Bicyclic or tricyclic fused ring containing one or two 5- or 6-membered aromatic rings such as a ring, a furan ring, a thiophene ring, and a pyridine ring (eg, benzofuran, benzothiophene, quinoline, carbazole, dibenzofuran ,
Fluorene, etc.), or a group formed by bonding to carbonyl via a linear or branched C _1-6 alkylene is preferred. Examples of the “carboxyl group which may be esterified” as a substituent of the “hydrocarbon group” of R ¹ include, for example, a group represented by the formula —COOR ^e (where R ^e is a hydrogen atom, a C _1-6 alkyl group (E.g., methyl, ethyl, propyl, isopropyl, butyl, t-butyl, etc.), a benzyl group, etc.
And the like. Examples of the substituent which the “carbamoyl group optionally having” which is the “hydrocarbon group” of R ¹ and the substituent of D, G and L may have, for example, C _1-6 An alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, t-butyl, etc.), a benzyl group, and a phenyl group which may have a substituent (eg, a substituent of the “hydrocarbon group” of R ¹ ; A certain “aryl group which may have a substituent (s)” may be the same as a substituent which may have a phenyl group which may have a substituent, etc.), a hetero group which may have a substituent (s) Ring group (eg, R ¹
And the same as the "heterocyclic group which may have a substituent" which is a substituent of the "hydrocarbon group"). R
"Hydrocarbon group" of ^1, D, as the G and L which is a substituent wherein the may have a "good thiocarbamoyl group optionally having a substituent" substituents, the "substituent And the same as "carbamoyl group which may be possessed". Examples of the “cycloalkyl group” which is a substituent of the hydrocarbon group for R ¹ include cyclopropyl, cyclobutyl,
And C _3-6 cycloalkyl groups such as cyclopentyl and cyclohexyl. Examples of the “cycloalkenyl group” which is a substituent of the hydrocarbon group for R ¹ include 1-cyclobuten-1-yl, 1-cyclopenten-1-yl,
-Cyclopenten-1-yl, 3-cyclopenten-1
- yl, 2-cyclohexen-1-yl, and the like C _3-6 cycloalkenyl groups such as 3-cyclohexen-1-yl.

The "heterocyclic group" of the "optionally substituted heterocyclic group" which is the hydrocarbon group for R ¹ and the substituent for L is, for example, a nitrogen atom or an oxygen atom other than a carbon atom. And a 5- or 6-membered monocyclic heterocyclic group having 1 to 4 heteroatoms selected from sulfur atoms (for example, furyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, imidazolyl,
Pyrazolyl, 1,2,3-oxadiazolyl, 1,2,
4-oxadiazolyl, furazanyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,3,4
Thiadiazolyl, 1,2,3-triazolyl, 1,
2,4-triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, triazinyl, oxiranyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, tetrahydrofuranyl, thiolanyl, piperidyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl, piperazinyl, and the like; 6
Or a fused bicyclic or heterocyclic group formed by condensing a “membered monocyclic heterocycle” or the above “5 or 6”.
Or a 3-membered fused heterocyclic group formed by condensing a "membered monocyclic heterocycle" with a benzene ring (preferably a 2- or 3-cyclic fused heterocyclic group containing a benzene ring)
(For example, benzofuryl, isobenzofuryl, benzo [b] thienyl, indolyl, isoindolyl, 1H-
Indazolyl, benzimidazolyl, benzoxazolyl, 1,2-benzisoxazolyl, benzothiazolyl, 1,2-benzoisothiazolyl, 1H-benzotriazolyl, quinolyl, isoquinolyl, cinnolyl, quinazolinyl, quinoxalinyl, phthalazinyl, Naphthyridinyl, purinyl, pteridinyl, dibenzofuryl, carbazolyl, α-carbolinyl, β-carbolinyl, γ-
Carbolinyl, acridinyl, phenoxazinyl, phenothiazinyl, phenazinyl, phenoxathiinyl, thianthrenyl, phenathridinyl, phenatrolinyl,
Indolidinyl, pyrrolo [1,2-b] pyridazinyl,
Pyrazolo [1,5-a] pyridyl, imidazo [1,2-
a] pyridyl, imidazo [1,5-a] pyridyl, imidazo [1,2-a] pyridazinyl, imidazo [1,2-
a] pyrimidinyl, 1,2,4-triazolo [4,3-
a] Pyridyl, 1,2,4-triazolo [4,3-b]
Pyridazinyl, isochromanyl, chromanyl, indolinyl, isoindolinyl, etc.). Examples of the substituent which the “heterocyclic group” may have include, for example, A
Other than the same substituents as the “aromatic ring” in the ring may have, an oxy group, a pyrrolidinyl group and the like can be mentioned. Further, the “heterocyclic group” may have 1 to 5 substituents selected from these substituents.

The "alkyl group" which is a substituent of the hydrocarbon group for R ¹ includes, for example, a C _1-6 alkyl group such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl and the like. Is mentioned. As the “halogenoalkyl group” which is a substituent of the hydrocarbon group for R ¹ ,
1 to 5 halogen atoms (eg, fluorine, chlorine,
A C _1-6 alkyl group substituted with bromine and iodine (eg, trifluoromethyl, trichloromethyl, etc.). Examples of the “aryl group” of the “aryl group optionally having substituent (s)” which is a substituent of the hydrocarbon group for R ¹ include, for example, phenyl, naphthyl, 2-biphenyl,
And C _6-14 aryl groups such as 3-biphenyl, 4-biphenyl, anthryl, phenanthryl and acenaphthylenyl. The “aryl group” is, for example, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C
_1-6 alkyl groups (eg, methyl, ethyl, propyl,
Isopropyl, butyl, t-butyl, etc.), halogeno-C
_{A 1-6} alkyl group (for example, a C _1-6 alkyl group substituted with 1 to 5 of said “halogen atoms”; for example, trifluoromethyl and the like), a C _1-6 alkoxy group (for example, methoxy, ethoxy, propoxy) , Isopropoxy, t-butoxy, etc.), C _7-14 aralkyloxy groups (eg, benzyloxy, etc.), hydroxy groups, amino groups, mono- or di-C _1-6 alkylamino groups (eg, methylamino, ethyl Amino, dimethylamino, diethylamino, etc.), carboxyl group, C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl, butyryl, etc.), C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl) , Sec
-Propoxycarbonyl, butoxycarbonyl, etc.), a nitro group and a cyano group. The "optionally substituted heterocyclic group" represented by R ^1, have exemplified "substituent as a substituent on the" hydrocarbon group "represented by R ¹ And the like as the “heterocyclic group”.

Examples of the acyl group R ^1, the may have exemplified "substituent as a substituent on" optionally substituted hydrocarbon group "represented by R ¹ hydroxy And the same as the acyl group which the group may have. R ¹ is, for example, a) a hydrogen atom, a) (1)
Halogen, (2) nitro, (3) C _1-6 alkyl-carbonyl, C _6-14 aryl-carbonyl, C _1-6 alkyl, C
Amino optionally having one or two substituents selected from _1-6 alkyloxy-carbonyl, C _7-14 aralkyloxy-carbonyl, C _1-6 alkyl-sulfonyl and C _6-14 aryl-sulfonyl , (4) (i) hydroxy, C _1-6 alkyl - carbonyl, C _6-14 aryl - carbonyl, carboxy or C _1-6 alkoxy - optionally substituted with a carbonyl C _1-6 alkyl, (ii) Phenyl optionally substituted with hydroxy, (iii) benzoyl or (iv) hydroxy optionally substituted with mono- or di- _{Ci_6} alkylamino-carbonyl, (5)
C _3-6 cycloalkyl, (6) hydroxy or halogeno-
Phenyl optionally substituted with C _1-6 alkyl and
(7) C _1-6 each optionally substituted with a substituent selected from thienyl, furyl, thiazolyl, indanyl, indolyl and benzyloxycarbonylpiperidyl
Alkyl group, C _2-6 alkenyl group, C _6-14 aryl group,
C _7-14 aralkyl or u) acyl is preferred,
Among them are a) (1) hydroxy, (2) phenyl, (3) thienyl, furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl and (4) _C1-6.
Alkyl-carbonyl, C _6-14 aryl-carbonyl,
C _1-6 alkyl - sulfonyl or C _6-14 aryl - sulfonyl substituted by C _1-6 optionally substituted respectively with selected substituents from an amino optionally alkyl or C _7-14 aralkyl group Or a) an acyl group or the like is preferable. The substitution position of the substituent in the aralkyl group represented by R ¹ is preferably the para position.

In the above formula, R ² represents an amino group which may be substituted. Examples of the “optionally substituted amino group” include (i) an unsubstituted amino group, (ii) a hydrocarbon group optionally having a substituent, and a heterocyclic group optionally having a substituent. Examples include an amino group having one or two substituents selected from a ring group and an acyl group, and (iii) a nitrogen-containing heterocyclic group which may have a substituent. "Hydrocarbon group optionally having substituent (s)" which is a substituent of R ²
And the same as the “hydrocarbon group which may have a substituent” represented by R ¹ and the like. As the “heterocyclic group optionally having substituent (s)” as the substituent of R ² , those similar to the “heterocyclic group optionally having substituent (s)” represented by R ¹ and the like can be mentioned. Is used. The acyl group which is a substituent of R ² is the same as the “optionally substituted hydroxy” exemplified as the substituent on the “optionally substituted hydrocarbon group” for R ^1. And the same as the acyl group which the group may have. The “nitrogen-containing heterocyclic group” of the “nitrogen-containing heterocyclic group optionally having substituent (s)” for R ² is, for example, selected from a nitrogen atom, an oxygen atom and a sulfur atom other than the nitrogen atom having a bond. A 5- to 7-membered nitrogen-containing heterocyclic group optionally having 1 to 4 heteroatoms (for example, 1-imidazolyl,
-Pyrazolyl, 1-pyrrolyl, 1-pyrrolidinyl, 1-
Rings such as piperazinyl, 1-piperidyl, morpholinyl, thiomorpholinyl) or a 5- to 7-membered nitrogen-containing heterocyclic group condensed with benzene, pyridine or the like (for example, 1
-Benzimidazolyl, 1,2,3,4-tetrahydroisoquinolin-2-yl, 1,2,3,4-tetrahydroquinolin-1-yl, 1-indolyl and the like. Examples of the substituent which the “nitrogen-containing heterocyclic group” of R ² may have include, for example, the “cyclic hydrocarbon” in the ring B
The same as the substituents that may have, and the like are used,
Preferably, a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), a C _1-6 alkyl group (eg, methyl,
Ethyl, propyl, butyl, sec-butyl, t-butyl,
Isopropyl, etc.) and a C _1-6 alkoxy group (for example, methoxy, ethoxy, propoxy, butoxy, sec-butoxy, t-butoxy, isopropoxy, etc.), and the number of substituents is 1 to 5. R ² includes, for example, (1) an unsubstituted amino group, (2) piperidyl group or (3) (i)
Benzyl, (ii) C _1-6 alkyl optionally substituted with amino or phenyl, (iii) mono- or di-C _1-6 alkyl-carbamoyl, (iv) mono- or di-C _1-6 alkyl - thiocarbamoyl, (v) C _1-6 alkoxy - carbonyl, (vi) C _1-6 alkyl - sulfonyl, (vii) piperidylcarbonyl and (viii) halogen or C _1-6 alkyl optionally substituted by amino An amino group which may have one or two substituents selected from -carbonyl is preferable, and an unsubstituted amino group is particularly preferable.

In the above formula, E is -CO-, -CON (R ^a )-, -CO
O-,-N (R ^a ) CON (R ^b )-,-N (R ^a ) COO-,-N (R ^a ) SO ₂ -,-N (R ^a )-,-O
-, -S-, -SO- or -SO _2- (R ^a and R ^b independently represent a hydrogen atom or a hydrocarbon group which may have a substituent).
Preferably -CON (R ^a )-, -N (R ^a ) CON (R ^b )-is used, and R ^a ,
R ^b is preferably a hydrogen atom. Among them, -CONH- is widely used.
R ^a or R ^b "optionally substituted hydrocarbon group"
For example, those similar to the aforementioned “hydrocarbon group which may have a substituent” represented by R ¹ and the like are used. In the above formula, L represents (1) a bond or (2) i) a C _1-6 alkyl group, ii) a halogeno-C _1-6 alkyl group, iii) a phenyl group, iv) a benzyl group, and v) a substituent. An amino group optionally having, vi) a hydroxy group optionally having a substituent, and vii) a C _1-6 alkyl group, a phenyl group optionally having a substituent or a substituent May have from 1 to 5 substituents selected from a carbamoyl group or a thiocarbamoyl group each of which may be substituted with an optionally substituted heterocyclic group, Good 2
Represents a monovalent hydrocarbon group. L is preferably a C _1-6 alkylene group which may have a substituent represented by, for example, i) to vii). As the “divalent hydrocarbon group” for L, for example, those similar to the divalent hydrocarbon groups exemplified by the aforementioned “divalent group” represented by D and the like are used. As the "C _1-6 alkylene group" of the "optionally having a substituent a C _1-6 alkylene group", for example, methylene, ethylene, propylene, butylene, etc.) and the like. In addition, this "C
“ _1-6 alkylene group” is, for example, 1 to 5
C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, etc.) and the like.
L is preferably, for example, a C _1-6 alkylene group which may be intervened with —O— or may be substituted with a C _1-6 alkyl, among which a C _1-6 alkylene group (preferably methylene or the like) is preferred. Is preferred. In the above formula, X represents an oxygen atom, a sulfur atom which may be oxidized, a nitrogen atom which may have a substituent, or a divalent hydrocarbon group which may have a substituent. Preferred is an oxygen atom or a nitrogen atom which may have a substituent. Examples of the substituent that the nitrogen atom may have include the same substituents as those that the ring A may have. As the “divalent hydrocarbon group” for X, for example, those similar to the divalent hydrocarbon groups exemplified by the aforementioned “divalent group” represented by D and the like are used. Also,
Examples of the substituent which the divalent hydrocarbon group may have include the same substituents as those which R ¹ may have. In the above formula, Y represents two hydrogen atoms, or an oxygen atom or a sulfur atom. Preferably it is two hydrogen atoms or oxygen atoms. When Y is two hydrogen atoms, R ¹
Is generally an acyl group, and when Y is an oxygen atom, R ¹ is generally a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent.

The compound represented by the formula (I) includes A
Ring a benzene ring which may have a substituent or a pyridine ring; B ring C _1-6 benzene ring or a cyclohexane ring optionally substituted with an alkoxy or bonded to R ² tetrahydroisoquinoline ring or iso, An indoline ring is formed; Z is 1 to 3 substituents selected from halogen, formyl, halogeno-C _1-6 alkyl, C _1-6 alkoxy, C _1-6 alkyl-carbonyl, oxo and pyrrolidinyl, respectively C that you may have
_6-14 aryl group, C _3-10 cycloalkyl group, piperidyl group, thienyl group, furyl group, pyridyl group, thiazolyl group, indanyl group, or indolyl group; D is a C _1-6 alkylene group; G is a bond; Or C which may contain phenylene and may be substituted by phenyl
_1-6 alkylene group; R ¹ is a) hydrogen atom, a) (1) halogen, (2) nitro, (3) C _1-6 alkyl-carbonyl, C
_{1 selected from 6-14} aryl-carbonyl, C _1-6 alkyl, C _1-6 alkyloxy-carbonyl, C _7-14 aralkyloxy-carbonyl, C _1-6 alkyl-sulfonyl and C _6-14 aryl-sulfonyl Or an amino optionally having two substituents, (4) (i) hydroxy, C _1-6
Alkyl-carbonyl, C _6-14 aryl-carbonyl,
Carboxy or C _1-6 alkoxy - C _1-6 alkyl optionally substituted with carbonyl, optionally substituted by (ii) hydroxyphenyl, (iii) benzoyl or
(iv) hydroxy optionally substituted with mono- or di- _Ci - ₆ alkylamino-carbonyl, (5) _C3-6 cycloalkyl, (6) hydroxy or halogeno- _Ci-6 alkyl. Optionally substituted phenyl and (7) thienyl, furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl each optionally substituted with a substituent selected from a C _1-6 alkyl group and a C _2-6 alkenyl group , C _6-14 aryl group, C _{7 - 14} aralkyl group, or c) an acyl group; R ² is (1) unsubstituted amino group, (2) a piperidyl group or (3) (i) benzyl, (ii) amino Or C _1-6 alkyl optionally substituted with phenyl, (iii) mono- or di-C _1-6 alkyl-carbamoyl or mono- or di-C _1-6 alkyl-thiocarbamoyl, (iv) C _{1 -6} alkoxy-carbonyl, (v ) C
_It may have one or two substituents selected from _1-6 alkyl-sulfonyl, (vi) piperidylcarbonyl and (vii) C _1-6 alkyl-carbonyl optionally substituted with halogen or amino. Amino group; E is -CO
—, —CON (R ^a ) —, —N (R ^a ) CO—, (R ^a is a hydrogen atom or a C _1-6 alkyl group), L may be via —O—, and C _1- Preferred is a C _1-6 alkylene group which may be substituted with ₆ alkyl. More preferably, Z is a phenyl group optionally substituted with halogen; D is a C _1-6 alkylene group; G is a C _1-6 alkylene group;
R ¹ is a) (1) hydroxy, (2) phenyl, (3) thienyl,
Furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl and (4) C _1-6 alkyl-carbonyl, C _6-14 aryl-carbonyl, C
_A C _1-6 alkyl group or a C _7-14 aralkyl group which may be substituted with a substituent selected from an amino which may be substituted with a _1-6 alkyl-sulfonyl or a C _6-14 aryl-sulfonyl, or A) an acyl group; R ² is an unsubstituted amino group; E is —CON (R ^a ) —; L is a C _1-6 alkylene group and Y is two hydrogen atoms.

Among the compounds represented by the formula (I), the compounds represented by the formula (Ia
The compound represented by -a) or a salt thereof is, for example, as exemplified in Scheme 1 below, a compound represented by the formula (IIa), a reactive derivative thereof or a salt thereof as a production intermediate, and It can be produced by, for example, a method of reacting the compound represented by the formula (III) or a salt thereof.

Embedded image [In the scheme 1, R ^2a is a group which may have a protecting group (for example, t-butoxycarbonyl, benzyloxycarbonyl, trityl and the like) in the above R ² , and other symbols have the same meanings as described above. The compound represented by the formula (Ia-a) or a salt thereof is represented by the formula (II)
The compound represented by a) or a salt thereof and the compound represented by the formula (III) or a salt thereof can be produced by using a condensing agent in a solvent, if necessary, in the presence of a base. Examples of the reactive derivative of the compound represented by the formula (IIa) include, for example, acid anhydride, acid halide (acid chloride,
Acid bromide), imidazolide or mixed acid anhydrides (eg, anhydrides with methyl carbonate, anhydrides with ethyl carbonate, etc.), and specific examples thereof include, for example, those represented by Formula (IIa). COOH of the compound is COQ [wherein Q is a leaving group: a halogen atom {fluorine, chlorine, bromine, iodine, etc.}, methanesulfonyloxy, benzenesulfonyloxy, p-toluenesulfonyloxy and the like. And the like. Examples of the solvent used in the reaction of Scheme 1 include ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), hydrocarbon solvents (eg, benzene, toluene, hexane, heptane, etc.), halogen solvents (eg, dichloromethane) , Dichloroethane, chloroform, carbon tetrachloride, etc.), acetonitrile, dimethylformamide and the like. Examples of the base used include triethylamine, 4-dimethylaminopyridine, triethylenediamine, tetramethylethylenediamine and the like. Examples of the condensing agent to be used include condensing agents used for peptide synthesis, and specifically, for example, dicyclohexylcarbodiimide, diethyl cyanophosphate,
-Ethyl-3- (3-dimethylaminopropyl) carbodiimide and the like are used. At this time, the compound represented by the formula (III) or a salt thereof is 0.5 to 2 molar equivalents, preferably 1 to 1.2 mol, per 1 mol of the compound represented by the formula (IIa) or 1 mol thereof. The condensing agent is used in an amount of 0.5 to 5 molar equivalents, preferably 1 to 2 molar equivalents. The reaction temperature at this time is 0 to 1
The temperature is 00 ° C, preferably 20 to 50 ° C, and the reaction time is 0.5 to 24 hours, preferably 1 to 5 hours.

Among the compounds represented by the formula (IIa), the compound wherein Y is an oxygen atom or a salt thereof (IIa-7) can be produced by the method shown in Scheme 2. A compound or a salt thereof wherein Y is two hydrogen atoms (IIa-1);
0) can be produced, for example, by the method shown in Scheme 3.

Embedded image

Embedded image

Embedded image [In Scheme 2 and Scheme 3, X ′ is a halogen atom (eg, fluorine, chlorine, bromine, iodine), and Le is a leaving group (eg,
Chlorine, bromine, iodine, methanesulfonyloxy, toluenesulfonyloxy, etc.), and R ¹ ′ or R ¹ ″ is a hydrocarbon group optionally having a substituent represented by R ¹ , in which a methylene chain is excluded. The group and R each represent a C _1-6 alkyl, C _7-14 aralkyl, phenyl group and the like which may be substituted with a halogen atom or C _1-6 alkoxy, and other symbols have the same meanings as described above. ]

In the reaction from the compound represented by the formula (IIa-1) or a salt thereof to the compound represented by the formula (IIa-3) or a salt thereof in the scheme 2, the compound represented by the formula (IIa-
It can be produced by reacting the compound represented by 1) or a salt thereof with the compound represented by the formula (IIa-2). This reaction is carried out, for example, without solvent, or an ether solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), a halogen solvent (eg, dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), a hydrocarbon solvent (eg, Benzene, toluene,
Hexane, heptane, etc.), dimethylformamide, dimethylsulfoxide, ester solvents (ethyl acetate, methyl acetate, etc.), and other solvents, if necessary, a base (eg, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium carbonate,
Potassium carbonate, sodium hydride, potassium hydride, etc.)
Can be performed in the presence of The compound represented by the formula (IIa-2) is used in an amount of 0.5 to 5 molar equivalents, preferably 0.8 to 2 molar equivalents, per 1 mol of the compound represented by the formula (IIa-1) or a salt thereof. Can be The reaction temperature at this time is 0 to 200 ° C, preferably 80 to 150 ° C.
° C. The base used is 0.5 to 5 molar equivalents, preferably 1 to 1.5 molar equivalents, per 1 mol of the compound represented by the formula (IIa-2). The reaction time is between 0.5 and 48 hours. Preferably, it is 0.5 to 24 hours. The reaction from the compound represented by the formula (IIa-3) or a salt thereof to the compound represented by the formula (IIa-4) or a salt thereof in the scheme 2 is performed, for example, using an ether solvent (eg, diethyl ether, tetrahydrofuran, Hydrogen and a palladium-based catalyst (e.g., dioxane, etc.), hydrocarbon solvents (e.g., benzene, toluene, hexane, heptane, etc.), alcohol solvents (e.g., methanol, ethanol, propanol, etc.), acetone, dimethylformamide, etc. For example, metal palladium,
It can be produced by catalytic reduction using a metal catalyst such as palladium on carbon), Raney nickel, platinum or the like, or reduction reaction using a metal or metal salt such as iron chloride or tin chloride. The hydrogen pressure is 1 to 100 atm, preferably 1 to 10 atm, and the reaction temperature is 0 to 200 ° C, preferably 10 to 50 ° C. Reaction time is 0.5 to 1
00 hours. Preferably, it is 0.5 to 24 hours.

The reaction from the compound represented by the formula (IIa-4) or a salt thereof to the compound represented by the formula (IIa-5) or a salt thereof in the scheme 2 is represented by the formula (IIa-4) The compound can be produced by a nitrogen-carbon bond reaction between a compound or a salt thereof and a halogenated hydrocarbon, sulfonic acid ester, or the like, or a reductive alkylation reaction with an aldehyde or ketone. In the nitrogen-carbon bonding reaction, for example, ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), halogen solvents (eg, dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), hydrocarbon solvents (eg,
Benzene, toluene, hexane, heptane, etc.), alcohol solvents (eg, methanol, ethanol, propanol, butanol, etc.), solvents such as acetonitrile, dimethylformamide, dimethyl sulfoxide, ester solvents (ethyl acetate, methyl acetate, etc.) and the like If necessary, a phase transfer catalyst (for example, quaternary ammonium salts such as tetrabutylammonium bromide and benzyltriethylammonium chloride and 18-
crown ethers such as wn-6) or a base (for example, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium carbonate, potassium carbonate, sodium hydride, potassium hydride, etc.), optionally in the presence of a phase transfer catalyst and a base. Can be done. The compound represented by the formula R ¹ -Le is 0.5 to 5 molar equivalents, preferably 0.1 to 5 mol, per 1 mol of the compound represented by the formula (IIa-4) or a salt thereof.
8 to 2 molar equivalents are used. The reaction temperature at this time is 0 ° C to 200 ° C, preferably 20 to 80 ° C.
It is. The base used is 0.5 to 5 molar equivalents, preferably 1 to 1.5 molar equivalents, per 1 mol of the compound represented by the formula (IIa-4). The reaction time is between 0.5 and 24 hours.

In the reductive alkylation reaction, for example, ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), halogen solvents (eg, dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), hydrocarbon solvents (eg, , Benzene, toluene,
Hexane, heptane, etc.), alcoholic solvents (for example,
In a solvent such as methanol, ethanol, propanol, butanol or the like or in a mixed solvent thereof, the compound represented by the formula (IIa-
4) or a salt thereof and a compound of the formula (R ¹ ′ -CH
O) or a compound represented by (R ¹ ′ —CO—R ¹ ″) or a salt thereof, for example, by catalytic reduction or a metal hydride complex compound (eg, sodium borohydride, sodium cyanoborohydride, etc.) ) Can be produced by reacting in the presence of In this case, the compound represented by the formula (R ¹ ′ -CH) is added to 1 mol of the compound represented by the formula (IIa-4) or a salt thereof.
O) or the compound represented by (R ¹ ′ —CO—R ¹ ″) or a salt thereof is 1 to 10 molar equivalents, preferably 1 to 2 molar equivalents, the reducing agent is 0.3 to 5 molar equivalents, Preferably, 0.5 to 1.5 molar equivalents are used. At this time, the reaction temperature is 0 to 100 ° C., preferably 10 to 70 ° C., and the reaction time is 1 to 24 hours, preferably 3 to 15 hours. The reaction from the compound represented by the formula (IIa-5) or a salt thereof to the compound represented by the formula (IIa-6) or a salt thereof in the scheme 2 is performed, for example, by using an ether solvent (eg, diethyl ether, tetrahydrofuran, Dioxane, etc.), halogen-based solvents (eg, dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), hydrocarbon-based solvents (eg,
Benzene, toluene, hexane, heptane, etc.), dimethylformamide, dimethylsulfoxide, ester solvents (ethyl acetate, methyl acetate, etc.), acetonitrile, water and other solvents in a solvent such as dicarboxylic acid monoester acid chloride (for example, ethyl malonyl chloride, (E.g., ethyl succinyl chloride, ethyl glutaryl chloride). 1 to 10 molar equivalents, preferably 1 to 2 molar equivalents, of the acid chloride of dicarboxylic acid monoester are used per 1 mol of the compound represented by the formula (IIa-5), and the reaction temperature is -20 to 100 ° C, preferably 0 to 0. To 50 ° C., and the reaction time is 0.5 to 24 hours, preferably 1 to 3 hours.

The reaction from the compound represented by the formula (IIa-4) or a salt thereof to the compound represented by the formula (IIa-8) or a salt thereof in the above scheme 3 is represented by the formula (IIa-4) The compound can be produced by a nitrogen-carbon bond reaction between a compound or a salt thereof and a halogenated hydrocarbon, a sulfonic acid ester, or the like, or a reductive alkylation reaction with an aldehyde. In the nitrogen-carbon bonding reaction, for example, an ether-based solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), a halogen-based solvent (eg,
Dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), hydrocarbon solvents (eg, benzene, toluene, hexane, heptane, etc.), alcohol solvents (eg, methanol, ethanol, propanol, butanol, etc.), acetonitrile, dimethylformamide, In a solvent such as dimethyl sulfoxide or an ester solvent (ethyl acetate, methyl acetate, etc.) or a mixed solvent thereof, a phase transfer catalyst or a base (for example, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium carbonate, potassium carbonate, hydrogenation) Sodium, potassium hydride and the like), and optionally a phase transfer catalyst (for example, quaternary ammonium salts such as tetrabutylammonium bromide and benzyltriethylammonium chloride and crown ethers such as 18-Crown-6) It can be carried out in the presence of an equal) and a base. The compound represented by the formula (Le-CH ₂ -D-COOR) is used in an amount of 0.5 to 5 molar equivalents, preferably 0.8 mol per 1 mol of the compound represented by the formula (IIa-4) or a salt thereof. Or 2 molar equivalents. The reaction temperature at this time is 0 to 200 ° C, preferably 20 to 80 ° C. The base to be used is 0.5 to 5 mole equivalent, preferably 1 to 1 mole, per 1 mole of the compound represented by the formula (IIa-4).
5 molar equivalents. The reaction time is between 0.5 and 48 hours. Preferably, it is 0.5 to 24 hours.

In the reductive alkylation reaction, for example, ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), hydrocarbon solvents (eg, benzene, toluene, hexane, heptane, etc.), alcohol solvents (eg, methanol) , Ethanol, propanol, butanol, etc.) or a mixture thereof in a solvent such as a compound represented by the formula (IIa-4) or a salt thereof and a compound represented by the formula (OHC-D-COOR) or a salt thereof Can be produced by, for example, catalytic reduction or reaction in the presence of sodium borohydride or sodium cyanoborohydride. At this time, the formula (II
a-4) per 1 mol of the compound or a salt thereof,
The compound represented by the formula (OHC-D-COOR) or a salt thereof is represented by 1
To 10 molar equivalents, preferably 1 to 2 molar equivalents,
The reducing agent is used in an amount of 0.3 to 5 molar equivalents, preferably 0.5 to 1.5 molar equivalents. The reaction temperature at this time is 0
To 100 ° C, preferably 10 to 70 ° C,
The reaction time is 1 to 24 hours, preferably 3 to 1 hour.
5 hours. Formula (IIa-8) in the above Scheme 2
In the reaction from the compound represented by or a salt thereof to the compound represented by the formula (IIa-9) or a salt thereof, for example, an ether solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), a halogen solvent (eg, Dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), hydrocarbon solvents (for example, benzene, toluene,
Hexane, heptane, etc.), dimethylformamide, dimethylsulfoxide, ester solvents (ethyl acetate, methyl acetate, etc.), acetonitrile, water and other solvents, acyl chlorides (eg, carboxylic acid chloride, sulfonic acid chloride, etc.), isocyanate Alternatively, it can be produced by reacting a carboxylic acid or the like. Formula (II
a-8) 1 to 10 mol equivalents of acyl chloride or isocyanate ester to 1 mol of compound represented by the formula:
The reaction temperature is preferably from -20 to 100 ° C, preferably from 0 to 50 ° C, and the reaction time is from 0.5 to 24 hours, preferably from 1 to 3 hours. If necessary, the reaction may be performed in the presence of a base.
The compound represented by the formula (IIa-7) in the scheme 2 or a salt thereof, and the compound represented by the formula (IIa) in the scheme 3
a-10) The method for producing the compound or a salt thereof represented by the following formula:
A compound represented by the formula (IIa-6) or a salt thereof, and
The compound can be produced by treating the compound represented by (IIa-9) or a salt thereof with an acid or a base, respectively. That is, these compounds are obtained by converting the compound represented by the formula (IIa-6) or (IIa-9) or a salt thereof into, for example, a mineral acid (eg, nitric acid, hydrochloric acid, hydrobromic acid, iodic acid,
In an aqueous solution such as sulfuric acid or an alkali metal hydroxide (eg, sodium hydroxide, potassium hydroxide, barium hydroxide, lithium hydroxide, etc.) at 0 to 150 ° C., preferably 20 to 50 ° C. can do. At this time, the strength of the acid and the base is preferably about 1 to 10 N, and more preferably 4 to 10 N. The reaction time at this time is 1 to 24 hours, preferably 2 to 10 hours.

The compound represented by the formula (IIa-9) or a salt thereof in the above scheme 3 can be obtained by converting the compound represented by the formula (IIa-4) or a salt thereof into a compound represented by the formula (IIa-4) as shown in the following scheme 4. A compound represented by the formula (IIa-5) or a salt thereof is produced, and then a compound represented by the formula (IIa-9) or a salt thereof is produced from the compound represented by the formula (IIa-5) or a salt thereof. You can also. The reaction of the compound represented by the formula (IIa-4) or a salt thereof to the compound represented by the formula (IIa-5) or the salt thereof is performed by reacting the compound represented by the formula (IIa-8) in the scheme 3 or The salt can be carried out under the same conditions as in the reaction with the compound represented by the formula (IIa-9) or a salt thereof. The reaction between the compound represented by the formula (IIa-5) or a salt thereof and the formula (Le-CH ₂ -D-COOR) is performed by the compound represented by the formula (IIa-4) in the scheme 3 or a compound thereof. The reaction can be performed under the same conditions as in the case of the reaction of the salt with the formula (Le-CH ₂ -D-COOR).

Embedded image [The symbols in the formula are as defined above. The compound represented by the formula (I) or a salt thereof,
The compounds represented by ab), (Ia-c), (Ia-d), and (Ia-e) or salts thereof can be produced by the method exemplified in the following Scheme 5, and the like.

Embedded image [The symbols in Scheme 5 are as defined above. ]

The compound represented by the formula (Ia-b) or a salt thereof in the above scheme 5 includes a compound represented by the formula (IV) or a salt thereof and a compound represented by the formula (III-1) or a salt thereof Can be produced by reacting This reaction is carried out according to the formula (Ia) illustrated in Scheme 1 above.
Formula for the production of the compound represented by -a) or a salt thereof
The same conditions as in the condensation reaction of the compound represented by (IIa) or a salt thereof with the compound represented by the formula (III) or a salt thereof are used. The compound represented by the formula (Ia-c) or a salt thereof in the scheme 5 is a compound represented by the formula (IV) or a salt thereof, a compound represented by the formula (III) or a salt thereof and DSC
(N, N'-disuccinimidyl carbonate) or a compound represented by (III-2) or a salt thereof. Examples of the solvent used in this reaction include ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), halogen solvents (eg, dichloromethane, dichloroethane, chloroform, etc.), acetonitrile, dimethylformamide, etc. (E.g., triethylamine, 4-dimethylaminopyridine, triethylenediamine, tetramethylethylenediamine, etc.). This reaction is carried out by reacting the compound represented by the formula (III) with a reagent such as N, N'-disuccinimidyl carbonate or the compound represented by the formula (III- The compound represented by 2) or a salt thereof is used in an amount of 1 to 10 molar equivalents, preferably 1 to 2
Use molar equivalents. The reaction temperature at this time is 0 to 10
The temperature is 0 ° C., preferably 20 to 50 ° C., and the reaction time is 1 to 24 hours, preferably 3 to 10 hours. The compound represented by the formula (Ia-d) or a salt thereof in the scheme 5 is obtained by reacting the compound represented by the formula (IV) or a salt thereof with the compound represented by the formula (III-3) or a salt thereof It can be manufactured by doing.
In this reaction, as a solvent used, for example, an ether solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), a halogen solvent (eg,
Dichloromethane, dichloroethane, chloroform, etc.),
Acetonitrile, dimethylformamide and the like,
If necessary, a base (for example, triethylamine, 4-dimethylaminopyridine, triethylenediamine, tetramethylethylenediamine, etc.) is used. This reaction is
For 1 mol of the compound represented by the formula (IV) or a salt thereof,
The compound represented by the formula (III-3) or a salt thereof is used in an amount of 1 to 10 molar equivalents, preferably 1 to 2 molar equivalents. The reaction temperature at this time is 0 to 100 ° C., preferably 20 to 50 ° C., and the reaction time is 1 to 2
4 hours, preferably 3 to 10 hours. The compound represented by the formula (Ia-e) or a salt thereof in the scheme 5 is obtained by reacting the compound represented by the formula (IV) or a salt thereof with the compound represented by the formula (III-4) or a salt thereof It can be manufactured by doing. This reaction is carried out, for example, in a solvent such as an ether solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), an alcohol solvent (eg, methanol, ethanol, propanol, butanol, etc.), acetone, dimethylformamide, etc. ,sodium hydrogen carbonate,
(Potassium hydrogen carbonate, sodium carbonate, potassium carbonate, sodium hydride, potassium hydride, triethylamine, etc.). The reaction is of the formula (I
V) The compound represented by the formula (I)
The compound represented by II-4) or a salt thereof is treated with 1 to 1
0 molar equivalents, preferably 1-2 molar equivalents are used. The reaction temperature at this time is 0 to 100 ° C., preferably 2 to 100 ° C.
0 to 50 ° C., and the reaction time is 1 to 24 hours, preferably 3 to 10 hours.

The compound represented by the formula (IV) in the above scheme 5 or a salt thereof can be produced by the method of the following scheme 6. After reacting the compound represented by the formula (IIa) or a salt thereof with diphenylphosphoryl azide or the like in a solvent in the presence of a base, the obtained acyl azide product is isocyanate is subjected to Curtius transfer reaction in a solvent. It can be produced by treating the acid derivative (V) as a production intermediate and treating it with an acid. Equation (IV)
Is a compound represented by the following scheme 7:
After the isocyanic acid derivative (V) is converted into the carbamate derivative (VI) as shown in the above, the compound represented by the formula (IV) or a salt thereof can also be produced.

Embedded image

Embedded image [The symbols in Schemes 6 and 7 are as defined above. Examples of the solvent used in the reaction of the compound represented by the formula (IIa) or a salt thereof with diphenylphosphoryl azide include ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.) and halogen solvents (eg, dichloromethane) , Dichloroethane, chloroform and the like), dimethylformamide and the like. Examples of the base used at this time include triethylamine, 4-dimethylaminopyridine, triethylenediamine, tetramethylethylenediamine and the like. In this reaction, 1 to 10 molar equivalents, preferably 1.5 to 3 molar equivalents of diphenylphosphoryl azide are used per 1 mol of the compound represented by the formula (IIa) or a salt thereof. The reaction temperature at this time is -20 to 50 ° C,
It is preferably 0 to 20 ° C, and the reaction time is 0.5
To 5 hours, preferably 1 to 2 hours. When the product obtained by the above reaction is subjected to a Curtius rearrangement reaction, examples of the solvent used include hydrocarbon solvents (eg, benzene, toluene, xylene, etc.) and ether solvents (eg, diethyl ether, tetrahydrofuran,
Dioxane), halogenated solvents (eg, dichloromethane, dichloroethane, chloroform, etc.), dimethylformamide and the like. The reaction temperature is 50 to 20
The temperature is 0 ° C., preferably 80 to 150 ° C., and the reaction time is 0.5 to 12 hours, preferably 1 to 3 hours. When treating the product obtained by the above reaction with an acid, examples of the solvent to be used include water, dioxane, dimethylformamide and the like.
For example, mineral acids such as sulfuric acid, hydrochloric acid, nitric acid, and hydrobromic acid are exemplified. The reaction temperature at this time is 20 to 200 ° C., preferably 50 to 100 ° C., and the reaction time is 0.5
To 5 hours, preferably 1 to 2 hours.

The compound represented by the formula (Ia-c) or the formula (Ia-d) or a salt thereof in the above scheme 5 can be prepared as shown in scheme 8 below.
In which the isocyanic acid derivative (V) represented by the formula (V) is reacted with a compound represented by the formula (III) or the formula (VII). In this case, the isocyanic acid derivative (V) represented by the formula (V) and the formula (III)
Alternatively, the reaction with the compound represented by the formula (VII) is the same as the reaction between the compound represented by the formula (IV) or a salt thereof and the compound represented by the formula (III-2) in the aforementioned scheme 5. It can be done on condition.

Embedded image [The symbols in Scheme 8 are as defined above. The compound represented by the formula (I) or a salt thereof,
The compound represented by af) or a salt thereof is prepared by a method exemplified in the following scheme 9 by a method represented by the following formula 9: Can be produced by reacting

Embedded image [The symbols in Scheme 9 are as defined above. The compound represented by the formula (Ia-f) or a salt thereof is, for example, a compound represented by the formula (IIa) or a salt thereof and a compound represented by the formula (VII):
Or a salt thereof in a solvent, if necessary, in the presence of a base, by using a condensing agent. Examples of the solvent used include ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), halogen solvents (eg, dichloromethane, dichloroethane, chloroform, carbon tetrachloride, etc.), acetonitrile, dimethylformamide and the like. Examples of the base used include triethylamine, 4-dimethylaminopyridine, triethylenediamine, tetramethylethylenediamine and the like.
Examples of the condensing agent used include condensing agents used for peptide synthesis, and specifically, for example, dicyclohexylcarbodiimide, diethyl cyanophosphate,
-Ethyl-3- (3-dimethylaminopropyl) carbodiimide and the like. In this reaction, the compound represented by the formula (VII) or a salt thereof is added in an amount of 0.5 to 2 molar equivalents, preferably 1 to 1.2 mol per mol of the compound represented by the formula (IIa) or 1 mol thereof. A molar equivalent is used, and a condensing agent is used in an amount of 0.5 to 5 molar equivalents, preferably 1 to 2 molar equivalents. The reaction temperature at this time is 0 to 100
C., preferably 20 to 50 ° C., and the reaction time is:
It is 0.5 to 24 hours, preferably 1 to 5 hours.

Among the compounds of the formula (I) or salts thereof, the compounds of the formula (Ia-g) or salts thereof are
It can be produced by reacting a compound represented by the formula (VIII) or a salt thereof with a compound represented by the formula (IX) or a salt thereof by the method shown in the following scheme 10.

Embedded image [The symbols in Scheme 10 are as defined above. The compound represented by the formula (VIII) or a salt thereof is represented by the formula (II)
The compound represented by a) or a salt thereof is converted to a mixed acid anhydride by reaction with ethyl chlorocarbonate or the like, for example, a protic solvent (eg, methanol, ethanol, propanol, butanol, etc.) or an aprotic solvent (eg, , Ethyl ether, tetrahydrofuran, dioxane, etc.) in a solvent, for example, with a metal hydride complex compound (eg, lithium aluminum hydride, sodium aluminum hydride, sodium borohydride, etc.). The metal hydride complex is used in an amount of 0.3 to 5 molar equivalents, preferably 0.5 to 2 molar equivalents, per 1 mol of the compound represented by the formula (IIa) or a salt thereof. The reaction temperature at this time is -20
To 100 ° C, preferably 0 to 20 ° C, and the reaction time is 0.5 to 10 hours, preferably 1 to 3 hours. In the reaction between the compound represented by the formula (VIII) or a salt thereof and the compound represented by the formula (IX) or a salt thereof, the solvent used includes, for example, an aprotic solvent (eg, ethyl ether, tetrahydrofuran,
Dioxane, acetonitrile, dimethylformamide, etc.), and if necessary, for example, an inorganic base (eg, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium carbonate, potassium carbonate, etc.), an organic base (eg, triethylamine, 4-dimethylamino) For example, pyridine, triethylenediamine, tetramethylethylenediamine, sodium hydride, cesium fluoride, or the like may be used. This reaction is carried out by reacting the compound represented by the formula (VIII) or a salt thereof 1
The compound represented by the formula (IX) or a salt thereof is used in 0.5 to 5 molar equivalents, preferably 1 to 2 molar equivalents, per 1 mol. The reaction temperature at this time is 0 to 200
C., preferably 20 to 100 ° C., and the reaction time is 10 minutes to 5 hours, preferably 30 minutes to 2 hours.

Among the compounds represented by the formula (I) or salts thereof, the compounds represented by the formulas (Ia-h) or (Ia-i) or the salts thereof are prepared by the method shown in the following scheme 11, etc. By the compound represented by the formula (X) or a salt thereof and the formula (V
It can be produced by reacting the compound represented by II) or formula (XI) or a salt thereof.

Embedded image [In the formula, Le ² is a halogen (eg, chlorine, bromine, iodine, etc.), and other symbols have the same meanings as described above. The compound represented by the formula (X) or a salt thereof is obtained by converting the compound represented by the formula (IV) or a salt thereof into a compound represented by the formula (IV) in, for example, hydrochloric acid, hydrobromic acid or hydroiodic acid. The compound or its salt is subjected to diazotization using 1 to 5 molar equivalents, preferably 1 to 3 molar equivalents of sodium nitrite, followed by heating. At this time, the reaction temperature is 20 to 200 ° C, preferably 50 to 100 ° C, and the reaction time is 5 minutes to 2 minutes.
The time is preferably about 15 to 30 minutes. The reaction between the compound represented by the formula (X) or a salt thereof and the compound represented by the formula (VII) or the formula (XI) or a salt thereof is as follows.
When producing the compound represented by the formula (Ia-g) or a salt thereof, the same as the reaction of the compound represented by the formula (VIII) or the salt thereof with the compound represented by the formula (IX) or the salt thereof Under the following conditions.

Among the compounds represented by the formula (I) or salts thereof, the compounds represented by the formula (Ia-j) or the salts thereof are represented by the formula (Ia-i) as shown in the following Scheme 12.
Can be produced by oxidizing the compound represented by or a salt thereof.

Embedded image [The symbols in Scheme 12 are as defined above. In this reaction, for example, ether solvents (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), hydrocarbon solvents (eg, benzene, toluene, hexane,
A compound represented by the formula (Ia-i) or a salt thereof in a solvent such as heptane, a halogen-based solvent (eg, dichloromethane, dichloroethane, chloroform, etc.), acetonitrile, dimethylformamide, etc.
It is used in 1 to 5 molar equivalents, preferably 2 to 3 molar equivalents, per mol. The reaction temperature at this time is 0 to 1
The reaction temperature is 00 ° C., preferably 0 to 30 ° C., and the reaction time is 1 to 10 hours, preferably 1 to 2 hours.

The compound represented by the formula (I) or a salt thereof and the compound represented by the formula (Ib) or a salt thereof are represented by the following formula (Ia) or the compound represented by the formula (Ia): The salt can be produced by removing the protecting group of the salt by a method known per se. Further, the compound represented by the formula (I) or a salt thereof is a compound represented by the formula (Ib) or a salt thereof, and a compound represented by the formula (XII) or
It can be produced by reacting the compound represented by I) or a salt thereof.

Embedded image [In Scheme 13, R ^2b is a deprotected R ^2a , R ^2c and R ^2d is a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, hydrogen or The acyl group and other symbols have the same meanings as described above. ]

In the removal of the protecting group, when the protecting group is a t-butoxycarbonyl group, a trityl group, or a benzyloxycarbonyl group, for example, an ether solvent (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), an alcohol solvent (eg, In a solvent such as methanol, ethanol, propanol, etc.), a halogen-based solvent (eg, dichloromethane, dichloroethane, chloroform, etc.),
For example, hydrogen chloride, hydrogen bromide, hydrochloric acid, bromic acid, nitric acid, sulfuric acid,
The protecting group can be removed by treating with an acid such as trifluoroacetic acid. When the protecting group is a benzyloxycarbonyl group, for example, an ether solvent (for example,
In a solvent such as diethyl ether, tetrahydrofuran, dioxane, etc., an alcohol solvent (eg, methanol, ethanol, propanol, etc.), dimethylformamide, ethyl acetate, acetic acid, etc., for example, a palladium catalyst (eg, metal palladium, palladium / carbon catalyst) ) To remove the protecting group. In this reaction, when an acid treatment is performed,
The reaction temperature is -20 to 100 ° C, preferably 0 to 30 ° C, and the reaction time is 0.1 to 5 hours, preferably 0.5 to 1 hour. In this reaction, when hydrolysis is performed, the reaction temperature is -20 to 15
0 ° C., preferably 0 to 50 ° C., and the reaction time is:
The time is 0.1 to 10 hours, preferably 0.5 to 3 hours, and the hydrogen pressure is 1 to 100 atm, preferably 1 to 3 atm. The catalyst used at this time has the formula (Ia)
0.001 mol of the compound represented by the formula
It is 1 to 0.5 molar equivalent, preferably 0.01 to 0.1 molar equivalent. The reaction between the compound represented by the formula (Ib) or a salt thereof and the compound represented by the formula (XII) or a salt thereof is performed by reacting the compound represented by the formula (IIa-4)
Can be carried out under the same conditions as in the reaction of the compound represented by the formula or a salt thereof with the compound represented by the formula R ¹ -Le or the salt thereof. In addition, the reaction between the compound represented by the formula (Ib) or a salt thereof and the compound represented by the formula (XIII) or the salt thereof is carried out by reacting the compound represented by the formula (IV) or the salt thereof in Scheme 5 described above. The compound represented by the formula (III-2) or a salt thereof can be reacted to produce the compound represented by the formula (Ia-c) or a salt thereof under the same conditions as those described above.

Among the compounds of formula (I) or salts thereof, of formula (Ik):

Embedded image [The symbols in the formula are as defined above. In the formula (I), the compound represented by the formula (I) or a salt thereof includes a compound represented by the formula (I) wherein X is an oxygen atom or a salt thereof, for example: For example, benzene, toluene, hexane, heptane, etc.), alcohol solvents (eg, methanol, ethanol, propanol, etc.), halogen solvents (eg, dichloromethane, chloroform, etc.), solvents such as hexamethylphosphoric triamide, dimethyl sulfoxide, etc. It can be produced by reacting Lawson's reagent or phosphorus pentasulfide. The Lawesson's reagent or phosphorus pentasulfide used at this time is 1 to 10 molar equivalents, preferably 1 to 3 molar equivalents per mole of the compound or a salt thereof in which X is an oxygen atom in the formula (I).
It is a molar equivalent. The reaction temperature at this time is 0 to 15
The temperature is 0 ° C., preferably 50 to 100 ° C., and the reaction time is 1 to 24 hours, preferably 3 to 10 hours.

The compound represented by the formula (IIa-2) or its salt in the above scheme 2 can be prepared by organically synthesizing the compound represented by the formula (IIb-1) or its salt as illustrated in the following scheme 14. Prepared by attaching a protecting group by a method known in the art, or by substituting ^a substituent Xa from a compound represented by the formula (IIb-4) or a salt thereof by a method known in the field of organic synthesis. It can be produced by converting to a group HX. Further, the compound represented by the formula (IIb-1) or a salt thereof can be obtained by converting ^a substituent Xa from a compound represented by the formula (IIb-2) or a salt thereof by a known method in the field of organic synthesis. It can be manufactured by converting to The compound represented by the formula (IIb-2) or a salt thereof is represented by the formula (I
The compound represented by Ib-3) or a salt thereof can be produced by converting a substituent R ^2e into a substituent R ^2b by a method known in the field of organic synthesis. The compound represented by the formula (IIb-4) or a salt thereof is obtained by converting the substituent R ^2e to a substituent R ^2a from the compound represented by the formula (IIb-3) or a salt thereof by a method known in the field of organic synthesis. Can be manufactured.

Embedded image Wherein R ^2b is a deprotected R ^2a , R ^2e is a substituent convertible to R ^2a or R ^2b , X ^a is a substituent convertible to H—X, and other symbols are as defined above. Is shown. ]

The raw material compound and the production intermediate of the present invention may form a salt, and are not particularly limited as long as the reaction proceeds. Salts of these compounds include, for example, inorganic acid salts (eg, hydrochloride, sulfate,
Hydrobromide, phosphate, etc.), organic acid salts (eg, acetate, trifluoroacetate, succinate, maleate,
Fumarate, propionate, citrate, tartrate, malate, lactate, oxalate, methanesulfonate, p-toluenesulfonate, etc., alkali metal salts (eg, sodium salt, potassium salt) Etc.), alkaline earth metal salts (eg, calcium salts, magnesium salts, etc.), organic base salts (eg, trimethylamine salts, triethylamine salts, pyridine salts, piperidine salts, ethanolamine salts, etc.), aluminum salts, ammonium salts and the like. Used. In addition, the starting compound and the production intermediate of the present invention can be isolated according to a conventional method, but can also be used as they are in the next reaction step without isolation. In each of the reactions of the present invention, when the compound has an amino group, a carboxyl group, or a hydroxy group as a substituent, even if a protecting group generally used in peptide chemistry or the like is introduced into these groups, The desired compound can be obtained by removing the protecting group if necessary after the reaction.

Examples of the amino-protecting group include a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, ethylcarbonyl, etc.), a benzyl group, a t-butyloxycarbonyl group, a benzyloxycarbonyl group, and a 9-amino group.
Fluorenylmethyloxycarbonyl group, allyloxycarbonyl group, phenylcarbonyl group, C _1-6 alkyloxy-carbonyl group (for example, methoxycarbonyl,
Ethoxycarbonyl, etc.), C _7-10 aralkyl-carbonyl group (eg, benzylcarbonyl, etc.), trityl group,
A phthaloyl group, an N, N-dimethylaminomethylene group and the like are used. These groups may be substituted with 1 to 3 halogen atoms (for example, fluorine, chlorine, bromine, etc.), nitro group and the like. As the protecting group for the carboxyl group,
For example, a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, t-butyl, etc.), a phenyl group, a silyl group, a benzyl group, an allyl group and the like are used. These groups may be substituted with 1 to 3 halogen atoms (for example, fluorine, chlorine, bromine, etc.), nitro group and the like. As the protecting group for the hydroxy group,
For example, a methoxymethyl group, an allyl group, a t-butyl group, a C _7-10 aralkyl group (eg, benzyl etc.), a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, ethyl carbonyl etc.), Benzoyl group, C _7-10
An aralkyl-carbonyl group (e.g., benzylcarbonyl), a pyranyl group, a furanyl group, a trialkylsilyl group, and the like are used. These groups include one to three halogen atoms (eg, fluorine, chlorine, bromine, etc.), a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, t-butyl, etc.), a phenyl group , C _7-10
It may be substituted with an aralkyl group (for example, benzyl and the like), a nitro group and the like.

As a method for removing these protecting groups, a method known per se or a method analogous thereto is used. For example, acid, base, reduction, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium A method using fluoride, palladium acetate, or the like is used. When a compound is obtained in a free state by each reaction of the present invention, it may be converted to a salt according to a conventional method, and when obtained as a salt, converted to a free form or another salt according to a conventional method. You can also. The compound (I) of the present invention or a salt thereof thus obtained may be isolated and purified from the reaction solvent by a known means, for example, phase transfer, concentration, solvent extraction, fractionation, crystallization, recrystallization, chromatography and the like. Can be. Compound (I) of the present invention or a salt thereof is a diastereomer,
When present as a conformer or the like, each can be isolated by a usual separation and purification means, if desired. When the compound (I) or a salt thereof of the present invention is in a racemic form, it can be separated into d-form and l-form by a usual optical resolution means. The compound having a somatostatin receptor function regulating action or a prodrug thereof used in the present invention may be itself or a pharmacologically acceptable salt. Examples of such salts include inorganic bases (eg, alkali metals such as sodium and potassium, and alkaline earth metals such as calcium and magnesium) when the compound having a somatostatin receptor function regulating action has an acidic group such as a carboxyl group. , Zinc, iron,
Transition metals such as copper) and organic bases (eg, trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, organic amines such as N, N'-dibenzylethylenediamine, arginine, lysine And basic amino acids such as ornithine).

When the compound having a function of regulating somatostatin receptor function has a basic group such as an amino group, an inorganic acid or an organic acid (eg, hydrochloric acid, nitric acid, sulfuric acid, phosphoric acid, carbonic acid, bicarbonate, formic acid, acetic acid, acetic acid, propionate) Acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid,
Salts with acidic amino acids such as succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid), aspartic acid, and glutamic acid. The prodrug of a compound having a somatostatin receptor function regulating action used in the present invention is a compound that converts into a compound having a somatostatin receptor function regulating action by a reaction with an enzyme or stomach acid under physiological conditions in vivo, that is, enzymatic A compound which undergoes oxidation, reduction, hydrolysis or the like to change to a compound having a somatostatin receptor function regulating action, or a compound which undergoes hydrolysis or the like due to stomach acid or the like to change to a compound having a somatostatin receptor function regulating action. As a prodrug of a compound having a somatostatin receptor function regulating action, a compound in which the amino group of a compound having a somatostatin receptor function regulating action is acylated, alkylated or phosphorylated (eg, having a somatostatin receptor function regulating action) When the amino group of the compound is eicosanoylated, alanylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylated, tetrahydrofuranylated, pyrrolidylmethylated, pivalomethylated Yloxymethylated, tert-butylated compounds, etc.); compounds in which the hydroxyl group of a compound having a somatostatin receptor function regulating action is acylated, alkylated, phosphorylated, or borated (eg, a somatostatin receptor function regulating action) The hydroxyl group of the compound having Toyl, propanoyl, pivaloyl, succinylated, fumaryl reduction, alanyl, dimethylaminomethylcarbonyl compounds, etc.); carboxyl group esterified compound having a regulating action of somatostatin receptor function,
The carboxyl group of an amidated compound (eg, a compound having a somatostatin receptor function regulating action) has an ethyl ester, phenyl ester, carboxymethyl ester, dimethylaminomethyl ester, pivaloyloxymethyl ester, ethoxy Carbonyloxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methylamidated compound, etc.); Is mentioned. These compounds can be produced from compounds having a somatostatin receptor function regulating action by a method known per se. In addition, prodrugs of compounds having a somatostatin receptor function regulating action can be obtained under physiological conditions as described in Hirokawa Shoten, 1990, “Development of Pharmaceuticals,” Vol. 7, pp. 163 to 198, Molecular Design. It may be changed to a compound having a function regulating action. The compound having a somatostatin receptor function regulating action may be either a hydrate or a non-hydrate. Further, a compound having a regulating action of somatostatin receptor function isotope (e.g., ³ H,
¹⁴ C, ³⁵ S, ¹²⁵ I etc.).

The regulation of the function of the somatostatin receptor refers to activation or suppression of the function of the somatostatin receptor, and the activation of the function of the somatostatin receptor refers to activation of the transmission system of the somatostatin receptor. Substances having such an action can be applied as somatostatin receptor ligands, somatostatin receptor ligand agonists, somatostatin receptor agonists, somatostatin receptor co-activator agents, and the like. Any substance can be used as long as a response similar to the response produced by the action of the ligand on the receptor can be obtained. In addition, suppression of somatostatin receptor function indicates that the somatostatin receptor transmission system is suppressed, and a substance having such an action can be applied as a somatostatin receptor antagonist or the like.
Any substance can be used as long as it can suppress the response generated by the action of the ligand on the somatostatin receptor. Of the above-mentioned somatostatin receptor function regulating actions, the somatostatin receptor action action (agonist action) is preferred.

The compound (I) or a salt thereof of the present invention has low toxicity and side effects, and is useful in mammals (for example, human,
It can be used as a variety of prophylactic, diagnostic, or therapeutic agents for cattle, horses, dogs, cats, monkeys, mice, rats, etc., and especially humans). The compound (I) of the present invention or a salt thereof suppresses or regulates the production or secretion of various hormones, growth factors, physiologically active substances and the like. As hormones, for example, growth hormone (GH),
Thyroid stimulating hormone (TSH), prolactin, insulin, glucagon and the like. As growth factors,
For example, IGF-1 and the like can be mentioned. Examples of the physiologically active substance include bathoactive intestinal polypeptide (VIP), gastrin, and glucagon-like peptide.
1, amylin, substance-P, CGRP, CCK
(Cholecystokinin), amylase and the like. The "bioactive substance" includes interleukins and T
Cytokines such as NF-α. These compounds also act via various intracellular signaling systems involving somatostatin. These intracellular signaling systems include adenylate cyclase, K ⁺ channel, Ca ²⁺
Channel, protein dephosphorylation, phospholipase C / inositol 3-phosphate producing system, MAP kinase, Na ⁺ /
H ⁺ exchange system, intracellular signal transduction system involving transcription factors such as phospholipase A2, NF-κB and the like are included. Also,
These compounds and salts thereof regulate the direct or indirect cytostatic or apoptotic action involving somatostatin. Therefore, the compound (I) of the present invention or a salt thereof may be used for these hormones, growth factors,
Diseases associated with abnormal production or secretion of physiologically active substances,
It is useful for these abnormalities in the intracellular signal transduction system (for example, diseases accompanied by excessive enhancement or suppression) or diseases accompanied by abnormal cell growth control. Specifically, for example, (1) acromegaly, TSH producing tumor, non-secreting (non-functional) pituitary tumor, ectopic ACTH (adrenocorticotropin) producing tumor, medullary thyroid cancer, VIP producing tumor, Remedies for tumors such as glucagon producing tumor, gastrin producing tumor, insulinoma, carcinoid, (2) insulin dependent or independent diabetes or various diseases related to these diabetes, for example, diabetic retinopathy, diabetic nephropathy Drugs for diabetic neuropathy, Dawn syndrome, orthostatic hypotension, etc., (3) drugs for obesity, bulimia, etc. due to improvement of hyperinsulinemia or suppression of appetite, (4) exocrine secretion in the digestive tract From suppressing or regulating, for example, acute pancreatitis, chronic pancreatitis, pancreatic / intestinal fistula, hemorrhagic ulcer,
Remedies for peptic ulcer, gastritis, hyperacidity, etc., (5) agents for improving various symptoms associated with Helicobacter pylori infection,
For example, gastrin secretion inhibitor, (6) an amylase secretion inhibitor associated with endoscopic cholangiopancreatography, and a prognostic agent for pancreatic surgery, (7) reduced intestinal absorption capacity, increased secretion or digestive tract Diarrhea caused by abnormal motor function (eg, short bowel syndrome), diarrhea caused by drugs such as cancer chemotherapy, diarrhea caused by congenital small bowel atrophy, diarrhea caused by neuroendocrine tumors such as VIP-producing tumors, AIDS Diarrhea caused by diarrhea caused by cerebral apoplexy, diarrhea caused by graft reaction against host accompanying bone marrow transplantation, diarrhea caused by diabetes, diarrhea caused by blockade of celiac plexus, diarrhea caused by systemic sclerosis and eosinophilia Remedy for diarrhea caused by the disease, (8) remedy for dumping syndrome, irritable colitis, Crohn's disease, inflammatory bowel disease, etc., (9) growth dependent on insulin or IGF-1 or other growth factors Tumors or cancers due to various cancers having abnormalities or abnormal cell growth suppression due to other reasons (for example, thyroid cancer, colon cancer, breast cancer, prostate cancer,
Small cell lung cancer, non-small cell lung cancer, pancreatic cancer, gastric cancer, bile duct cancer, liver cancer, bladder cancer, ovarian cancer, uterine cancer, melanoma, osteosarcoma,
Chondrosarcoma, malignant pheochromocytoma, neuroblastoma, brain tumor, thymoma, kidney cancer, etc.), leukemia (eg, leukemia of basophil leukocytes, chronic lymphocytic leukemia, chronic myelogenous leukemia, Hodgkin's disease, non-Hodgkin's disease) Therapeutic agents such as lymphoma and the like (therapeutic agents used for these cancers are single or other anticancer agents such as tamoxifen, LHRH agonist, LHRH antagonist, interferon-α, interferon-β and inderferon-γ, interleukin-
(10) Prevention of hypertrophic cardiomyopathy, arteriosclerosis, valvular heart disease, myocardial infarction (particularly myocardial infarction after percutaneous transluminal coronary angioplasty), revascularization・ Therapeutic agent, (11) therapeutic agent for esophageal varices bleeding, cirrhosis, peripheral vascular disease, (12) biologically active substance acting on the immune system (eg, substance P, tahikinin, cytokine, etc.)
For example, diseases associated with systemic or local inflammation, such as polyarteritis, rheumatoid arthritis, psoriasis, sunburn, eczema, allergies (eg, asthma, atopic dermatitis, (13) production of neuromodulatory factors
Because it affects secretion, for example, dementia (eg,
Remedies for Alzheimer's disease, Alzheimer's senile dementia, vascular / multiple dementia, etc.), headache, migraine, schizophrenia, epilepsy, depression, general anxiety injury, sleep injury, multiple sclerosis, etc. (14 A) analgesics, (15) acute bacterial meningitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, severe systemic fungal infection, tuberculosis, spinal cord injury,
Fracture, liver failure, pneumonia, alcoholic hepatitis, hepatitis A, B
Hepatitis C, hepatitis C, AIDS infection, human papillomavirus infection, influenza infection, cancer metastasis, multiple myeloma, osteomalacia, osteoporosis, bone Pechet disease, reflux esophagitis, nephritis, renal failure, sepsis, Remedies for septic shock, hypercalcemia, hypercholesterolemia, hyperglyceridemia, hyperlipidemia, systemic lupus erythematosus, transient ischemic attack, alcoholic hepatitis, etc., (16) organ transplantation, burns , wound healing, such as alopecia, (17) eye diseases (e.g., glaucoma, etc.), (18) the compound directly or suitable spacer through the radioactive material (e.g., ¹²³ iota,
^{125 Ι, 111 Ιn} etc.) are introduced and tumor imaging with somatostatin receptor, and (19) directly or via a suitable spacer to the compound by introducing a cancer drug,
It can be used for targeting a tumor having a somatostatin receptor.

The compound (I) of the present invention or a salt thereof can be used as it is, but is usually formulated with an appropriate amount of a carrier for pharmaceutical preparations according to a conventional method. Examples of the “carrier for pharmaceutical preparations” include excipients (eg, calcium carbonate, kaolin, sodium bicarbonate, lactose, D-mannitol, starches, crystalline cellulose, talc, granulated sugar, porous substances, etc.), binding Agents (eg, dextrin, gums, pregelatinized starch, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, pullulan, etc.), thickeners (eg, natural gums, cellulose derivatives, acrylic acid derivatives, etc.), disintegrants (eg, , Carboxymethylcellulose calcium, croscarmellose sodium, crospovidone, low-substituted hydroxypropylcellulose, partially pregelatinized starch, etc.),
Solvents (eg, water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, etc.),
Dispersants (for example, Tween 80, HCO60, polyethylene glycol, carboxymethylcellulose, sodium alginate, etc.), dissolution aids (for example, polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, triethanolamine) , Sodium carbonate, sodium citrate, etc.), suspending agents (eg, stearyl triethanolamine, sodium lauryl sulfate, benzalkonium chloride, polyvinyl alcohol, polyvinyl pyrrolidone, hydroxymethyl cellulose, etc.), soothing agents (eg, benzyl alcohol) Etc.), tonicity agents (eg, sodium chloride, glycerin, etc.), buffers (eg, phosphates, acetates, carbonates, citrates, etc.), lubricants (eg, stearic acid) Magnesium, calcium stearate, talc, starch, sodium benzoate etc.), colorants (e.g., tar pigments, caramel, iron sesquioxide, titanium oxide, riboflavin, etc.), flavoring agent (e.g., sweets,
Perfumes, etc.), stabilizers (eg, sodium sulfite, ascorbic acid, etc.) and preservatives (eg, parabens, sorbic acid, etc.) are used. The medical prophylactic / therapeutic agent of the present invention, which may contain the carrier for pharmaceutical preparations, comprises the compound (I) of the present invention or a pharmaceutically acceptable salt thereof in an amount necessary for preventing / treating various diseases. Contains salt. The content of the compound (I) of the present invention or a pharmaceutically acceptable salt thereof in the preparation of the present invention is usually 0.1 to 100% by weight of the whole preparation. Specific examples of the dosage form include tablets (including sugar-coated tablets and film-coated tablets), pills, capsules (including microcapsules), granules,
Fine granules, powders, drops, syrups, emulsions, suspensions, injections, inhalants, ointments, suppositories, troches, cataplasms and the like are used. These preparations are prepared according to a conventional method (for example, the method described in Japanese Pharmacopoeia 12th Edition).

The production methods of the main preparations in the present invention are shown below, but are not limited thereto. (1) Tablets The compound of the present invention as it is, or a mixture obtained by adding an excipient, a binder, a disintegrant or other suitable additives and mixing uniformly, is granulated by an appropriate method, and then lubricated. Add the agent and compression molding. Then, if necessary, the skin may be coated with a suitable coating agent for the purpose of taste masking, enteric coating or persistence. (2) Injection A certain amount of the compound of the present invention is added to a stabilizer, a solubilizer, a suspending agent, an emulsifier, a buffer, a preservative, and the like, if necessary.
Dissolve, suspend or emulsify in water for injection to make a fixed dose. (3) Suppository Based on an oily base, water-soluble base or other suitable substance, add an emulsifier, a suspending agent and the like, if necessary, add the compound of the present invention, mix and equalize. After that, it is made into an appropriate shape. (4) Capsules The compound of the present invention and additives such as suitable excipients are mixed evenly, or granulated by an appropriate method, or the granules are coated with an appropriate coating agent. The capsules are filled as they are or lightly. The pharmaceutical preparation of the present invention has low toxicity, high safety, and excellent somatostatin receptor agonism, and thus is useful as a prophylactic / therapeutic agent for the above-mentioned diseases. The amount of the compound of the present invention used in the pharmaceutical preparation varies depending on the selected compound, the animal species selected for the administration subject, the number of administrations, and the like.
It is effective over a wide area. For example, for an adult patient with acromegaly, diabetic complications, intractable laxatives, diabetes or obesity, the daily dose when the pharmaceutical preparation of the present invention is orally administered is the same as that of the compound (I) of the present invention. An effective amount is usually about 0.001 to about 20 mg / kg.
The body weight is preferably about 0.2 to about 3 mg / kg body weight, but in the case of parenteral administration, these dosages are generally used when combined with other active ingredients or used in combination with other pharmaceutical preparations. Will be less. However, the amount of the compound to be actually administered is determined by the conditions such as the selection of the compound, various preparation forms, the age, weight, sex, degree of the disease, the degree of the disease, the administration route, the administration period and the interval of administration of the patient. It can be changed at any time according to the judgment of the doctor. The administration route of the pharmaceutical preparation is not particularly limited by various circumstances, and for example, can be administered by an oral or parenteral route. As used herein, "parenteral" includes intravenous, intramuscular, subcutaneous, intranasal, rectal, vaginal and intraperitoneal administration. The administration period and interval of the pharmaceutical preparation are changed according to various situations and are determined at any time by a doctor's judgment, but divided administration, daily administration, intermittent administration, short-term large-volume administration, repeated administration There are methods such as administration. For example, in the case of oral administration, it is preferable to administer the drug in one to several times a day (particularly one to three times a day). It is also possible to perform intravenous infusion over a long period of time.

[0052]

DETAILED DESCRIPTION OF THE INVENTION The present invention further includes the following examples,
Although described in detail with experimental examples, these examples are merely implementations and do not limit the present invention, and may be changed without departing from the scope of the present invention. The abbreviations in Reference Examples and Examples have the following meanings. s: singlet, d: doublet, t: triplet, q: quartet, dd: double doublet, d
t: double triplet, m: multiplet, bs:
Broad singlet, tt: triple triplet, b
r: Wide triple triplet, J: Coupling constant, room temperature: 0 to 30 ° C. The acid chloride used in the experiment was a commercially available acid chloride or a commercially available carboxylic acid, for example, the following Example 184 (1) The acid chloride synthesized by treating with oxalyl chloride in the same manner as in the above was used without any particular purification.

[0053]

EXAMPLES Example 1 N- [2- (3-Aminomethylphenoxy) -4-chlorophenyl]-
N- (4-biphenylmethyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (1) 3-methoxybenzylamine (81 g, 590 mmol) and 47%
A mixture of hydrobromic acid (300 ml) was stirred with heating under reflux for 10 hours. After cooling the reaction solution, the solvent was distilled off under reduced pressure, and the residue was poured into water. Potassium hydroxide is added to the resulting mixture.
(34 g, 600 mmol) in water (200 ml) was added and stirred at room temperature for 30 minutes. Then di-tert-butyl dicarbonate (129 g, 0.5
A solution of 9 mmol) in diethyl ether (100 ml) was added dropwise at 0 ° C. over 2 hours. After stirring the reaction mixture at 0 ° C. for 12 hours, it was extracted with diethyl ether. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, crystals of N-tert-butoxycarbonyl-3-hydroxybenzylamine (111 g, 84%) were obtained. 73-74 ° C ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 4.24 (2H, d, J = 6 Hz),
4.95 (1H, bs), 6.59 (1H, bs), 6.71-6.79 (3H, m), 7.12-
7.20 (1H, m). (2) 4-chloro-2-fluoronitrobenzene (8.78 g, 50 m
mol), N-tert-butoxycarbonyl-3-hydroxybenzylamine (11.2 g, 50 mmol), potassium carbonate (6.95 g, 50
mmol) and N, N-dimethylformamide (70 ml).
Stirred at 0 ° C. for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The precipitated crystals were collected by filtration to obtain [3- (5-chloro-2-nitrophenoxy) benzyl] carbamic acid tert-butyl ester (15.8 g, 83.4%) as crystals. Mp 122-123 ° C. Elemental analysis _{C 18 H 19 N 2 O 5} Cl theoretically:. C, 57.07; H, 5.06; N, 7.40 Found:. C, 57.18; H, 4.92; N, 7.33 1 H -NMR (CDCl ₃ ) δ: 1.45 (9H, s), 4.33 (2H, d, J = 6Hz),
4.91 (1H, bs), 6.94-7.01 (3H, m), 7.12-7.19 (2H, m),
7.30 (1H, t, J = 7.7Hz), 7.90 (1H, d, J = 8.6Hz).

(3) [3- (5-Chloro-2-nitrophenoxy) benzyl] carbamic acid tert-butyl ester (11.4 g, 3
(0 mmol) in ethyl acetate (200 ml) was added 5% palladium on carbon (3.4 g). The resulting mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The precipitated crystals were collected by filtration to obtain crystals of [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (10.1 g, 96.2%). Mp 115-116 ° C. Elemental analysis _{C 18 H 21 N 2 O 3} Cl theoretically:. C, 61.98; H, 6.07; N, 8.03 Found:. C, 62.07; H, 5.99; N, 8.07 1 H -NMR (CDCl ₃ ) δ: 1.45 (9H, s), 3.41 (2H, bs), 4.29 (2
H, d, J = 5.8Hz), 4.86 (1H, bs), 6.75 (1H ,, d, J = 8.2Hz),
6.81 (1H, d, J = 2.2Hz), 6.85-6.92 (2H, m), 6.96 (1H,
d, J = 2.2Hz), 7.02 (1H, d, J = 7.2Hz), 7.29 (1H, t, J =
(7.7 Hz). (4) [3- (2-Amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (3.48 g, 10 mmol), 4-phenylbenzaldehyde (2.19 g, 12 mmol), acetic acid (1 ml)
After stirring a mixture of methanol and methanol (40 ml) at room temperature for 1 hour, sodium cyanoborohydride (0.75 g, 12 mmol) was added. Thereafter, the mixture was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [3- [2- (4-biphenylmethylamino) -5-chlorophenoxy] benzyl] carbamic acid tert-butyl ester
(2.92 g, 56.7%) of prism crystals were obtained. Melting point: 104-105 ° C Elemental analysis: C ₃₁ H ₃₁ N ₂ O ₃ Cl Theoretical: C, 72.29; H, 6.07; N, 5.44. Found: C, 72.54; H, 6.07; N, 5.31. ¹ H -NMR (CDCl ₃ ) δ: 1.45 (9H, s), 4.30 (2H, d, J = 5.6H
z), 4.40 (2H, s), 4.68 (1H, bs), 4.88 (1H, bs), 6.61 (1
H, d, J = 8.4Hz), 6.79 (1H, d, J = 2.4Hz), 6.87-6.98 (3
H, m), 7.03 (1H, d, J = 7.6Hz), 7.30-7.48 (6H, m), 7.5
5-7.60 (4H, m).

(5) [3- [2- (4-biphenylmethylamino) -5
-Chlorophenoxy] benzyl] carbamic acid tert-butyl ester (2.58 g, 5 mmol), ethylsuccinyl chloride (1.1 ml, 7.5 mmol), 4-dimethylaminopyridine (0.92
g, 7.5 mmol) and tetrahydrofuran (30 ml) was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] succinamide An oil was obtained as the acid ethyl ester (2.65 g, 82.6%). Elemental analysis C ₃₇ H ₃₉ N ₂ O ₆ theory as Cl:. C, 69.09; H , 6.11; N, 4.36 Found:. C, 68.97; H, 6.16; N, 4.39 1 H-NMR (CDCl 3 ) δ: 1.26 (3H, t, J = 7.4Hz), 1.44 (9H,
s), 2.41-2.81 (4H, m), 4.17 (2H, q, J = 7.4Hz), 4.21 (2
H, d, J = 5.6Hz), 4.75 (1H, d, J = 14.3Hz), 4.84 (1H, b
s), 5.03 (1H, d, J = 14.3Hz), 6.68 (3H, m), 7.22-7.57
(11H, m). (6) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] succinamidic acid ethyl ester (2.57 g, 4 mmol)
1N aqueous sodium hydroxide solution (8 ml, 8 mmol) was added to a solution of the above in tetrahydrofuran (10 ml) and ethanol (10 ml). The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] succinamic acid
(2.4 g, 97.6%) of an amorphous solid was obtained. Elemental analysis: C ₃₅ H ₃₅ N ₂ O ₆ Cl ・ 1 / 4H ₂ O Theoretical: C, 67.85; H, 5.77; N, 4.52. Found: C, 67.89; H, 5.88; N, 4.44. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.42-2.53 (2H, m), 2.
63-2.81 (2H, m), 4.20 (2H, q, J = 6.0Hz), 4.76 (1H, d,
J = 14.8Hz), 4.88 (1H, bs), 5.03 (1H, d, J = 14.8Hz), 6.
72-6.78 (2H, m), 7.00-7.08 (3H, m), 7.22-7.57 (11H, m
m).

(7) N- (4-biphenylmethyl) -N- [2- [3- (te
rt-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] succinamidic acid (0.92 g, 1.5 mmol), 2
-Fluorobenzylamine (0.21 ml, 1.8 mmol), diethyl cyanophosphate (0.25 ml, 1.8 mmol), triethylamine
(0.25 ml, 1.8 mmol) and N, N-dimethylformamide (10 m
The mixture of l) was stirred at room temperature for 2 hours. Pour the reaction into water,
Extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]- An amorphous solid of N '-(2-fluorobenzyl) succinamide (1.02 g, 94.4%) was obtained. Elemental analysis: as C ₄₂ H ₄₁ N ₃ O ₅ ClF Theoretical: C, 69.84; H, 5.72; N,
5.82. Found: C, 69.82; H, 5.55; N,
5.60. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 2.47-2.
61 (4H, m), 4.19 (2H, d, J = 7.4Hz), 4.45 (2H, d, J = 6.0
Hz), 4.73 (1H, d, J = 14.4Hz), 5.03 (1H, d, J = 14.4Hz),
5.06 (1H, bs), 6.48 (1H, bs), 6.68-6.76 (3H, m), 6.9
7-7.56 (12H, m). (8) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(2 (2) definition of (-fluorobenzyl) succinamide
Hydrochloric acid ethyl acetate solution (10 ml) was stirred at room temperature for 1 hour.
The reaction solution was concentrated under reduced pressure. After filtering the precipitated solid,
After washing with ethyl ether, N- [2- (3-aminomethylphenoxy) -4-chlorophenyl] -N- (4-biphenylmethyl) -N'-
(2-Fluorobenzyl) succinamide hydrochloride (0.62 g,
95.4%) of an amorphous solid. Elemental analysis: C ₃₇ H ₃₄ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 66.57; H, 5.28; N, 6.29. Found: C, 66.29; H, 5.13; N, 6.11 ^{. 1 H-NMR (DMSO-} d 6) δ: 2.34-2.58 (4H, m), 4.01 (2H, s),
4.29 (2H, s), 4.53 (1H, d, J = 14.9Hz), 5.133 (1H, d, J =
14.9Hz), 6.82 (1H, d, J = 1.8Hz), 6.95 (1H, d, J = 8Hz),
7.10 (18H, m), 8.32-8.47 (3H, m).

Example 2 N- [2- (3-aminomethylphenoxy) -4-chlorophenyl]-
N- (4-hydroxybenzyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (3.48 g, 10 mmol), 4-te
rt-butyldimethylsilyloxybenzaldehyde (2.19
g, 12 mmol), a mixture of acetic acid (1 ml) and methanol (40 ml) was stirred at room temperature for 1 hour, and sodium cyanoborohydride (0.75 g, 12 mmol) was added. Thereafter, the mixture was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water, drying over anhydrous magnesium sulfate,
It was concentrated under reduced pressure. The residue was purified by silica gel column chromatography and [3- [2- (4-tert-butyldimethylsilyloxybenzylamino) -5-chlorophenoxy] benzyl] carbamic acid tert-butyl ester (2.40 g, 42.2
%) Oil was obtained. Elemental analysis value C ₃₁ H ₄₁ N ₂ O ₄ ClSi · 1 / 2H
Theory as _{2 O:. C, 64.39;} H, 7.32; N, 4.84 Found:. C, 64.82; H, 7.38; N, 4.53 1 H-NMR (CDCl 3) δ: 0.18 (6H, m), 0.97 (9H, s), 1.45 (9
H, s), 4.27-4.31 (4H, m), 4.53 (1H, bs), 4.83 (1H, b
s), 6.70-7.05 (7H, m), 7.14-7.33 (4H, m). (2) [3- [2- (4-tert-butyldimethylsilyloxybenzylamino) -5-chlorophenoxy] benzyl] Carbamic acid
tert-butyl ester (2.58 g, 5 mmol), ethyl succinyl chloride (1.1 ml, 7.5 mmol), 4-dimethylaminopyridine (0.92 g, 7.5 mmol) and tetrahydrofuran (30 m
The mixture of l) was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-tert-butyldimethylsilyloxybenzyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl)
An oil of phenoxy] -4-chlorophenyl] succinamidic acid ethyl ester (2.18 g, 31.3%) was obtained. Elemental analysis: C ₃₇ H ₄₉ N ₂ O ₇ ClSi · 1 / 2H ₂ O Theoretical: C, 62.92; H, 7.13; N, 3.97. Found: C, 63.21; H, 7.25; N, 3.70. ¹ H-NMR (CDCl ₃ ) δ: 0.16 (6H, s), 0.96 (9H, s), 1.22 (3
(H, t, J = 7.0Hz), 1.44 (9H, s), 2.38-2.78 (4H, m), 4.1
2 (2H, q, J = 7.0Hz), 4.27 (2H, d, J = 6.2Hz), 4.60 (1H,
d, J = 14.2Hz), 4.96 (1H, d, J = 14.2Hz), 5.16 (1H, bs),
6.60-6.81 (4H, m), 6.97-7.11 (5H, m), 7.26-7.34 (2H,
m).

(3) N- (4-tert-butyldimethylsilyloxybenzyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] succinamidic acid ethyl ester (2.09 g) , 3 mmol) and tetrabutylammonium fluoride trihydrate (0.95 g, 3 mmol) in tetrahydrofuran (20 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] was purified.
A non-crystalline solid of -N- (4-hydroxybenzyl) succinamic acid ethyl ester (1.68 g, 97%) was obtained. Elemental analysis C ₃₁ H ₃₅ N ₂ O ₇ theory as Cl:. C, 63.86; H , 6.05; N, 4.80 Found:. C, 63.66; H, 5.95; N, 4.53 1 H-NMR (CDCl 3 ) δ: 1.25 (3H, t, J = 7.2Hz), 1.47 (9H,
s), 2.47-2.84 (4H, m), 4.11 (2H, q, J = 7.2Hz), 4.20-
4.32 (3H, m), 5.18 (1H, t, J = 6.4Hz), 5.43 (1H, d, J = 1
3.2Hz), 6.12 (1H, bs), 6.63 (2H, d, J = 7.8Hz), 6.78-
7.07 (5H, m), 7.27-7.32 (3H, m). (4) N- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] -N- (4-hydroxybenzyl) succinamidic acid ethyl ester (2.57 g, 4 mmo
To a solution of l) in tetrahydrofuran (10 ml) and ethanol (10 ml) was added a 1N aqueous sodium hydroxide solution (8 ml, 8 mmol). The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- [2- [3- (tert-
A non-crystalline solid of butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-hydroxybenzyl) succinamidic acid (1.47 g, 99%) was obtained. Elemental analysis: C ₂₉ H ₃₁ N ₂ O ₇ Cl ・ 1 / 2H ₂ O Theoretical: C, 61.75; H, 5.72; N, 4.97. Found: C, 61.99; H, 5.66; N, 4.78. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 2.45-2.58 (2H, m), 2.
70-2.82 (2H, m), 4.22 (2H, d, J = 6.0Hz), 4.25-4.39 (1
H, m), 5.22 (1H, bs), 5.55 (1H, bs), 6.16 (1H, s), 6.
47 (1H, s), 6.64 (2H, d, J = 8.4Hz), 6.76-6.79 (1H, m),
6.93-7.31 (4H, m).

(5) N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-hydroxybenzyl) succinamic acid (0.67 g, 1.2 mmol),
2-fluorobenzylamine (0.16 ml, 1.4 mmol), diethyl cyanophosphate (0.20 ml, 1.4 mmol), triethylamine (0.20 ml, 1.4 mmol) and N, N-dimethylformamide (10
ml) of the mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-hydroxybenzyl)-
N '-(2-fluorobenzyl) succinamide (0.69 g, 97
%) Of an amorphous solid. Elemental analysis _{C 36 H 37 N 3 O 6} ClF theoretically:. C, 65.30; H, 5.63; N, 6.35 Found:. C, 65.04; H, 5.80; N, 6.60 1 H-NMR (CDCl 3 ) δ: 1.46 (9H, s), 2.54 (4H, s), 4.21 (2
H, d, J = 5.8Hz), 4.23-4.28 (1H, m), 4.45 (2H, d, J = 6.
0Hz), 5.26-5.37 (1H, m), 6.13 (1H, s), 6.61-6.65 (4H,
m), 6.78-6.34 (12H, m). (6) N- [2- [3- (tert-butoxycarbonylaminomethyl)
A solution of phenoxy] -4-chlorophenyl] -N- (4-hydroxybenzyl) -N ′-(2-fluorobenzyl) succinamide in 2N hydrochloric acid in ethyl acetate (10 ml) was stirred at room temperature for 1 hour.
The reaction solution was concentrated under reduced pressure. After filtering the precipitated solid,
After washing with ethyl ether, N- [2- (3-aminomethylphenoxy) -4-chlorophenyl] -N- (4-biphenylmethyl) -N'-
(2-Fluorobenzyl) succinamide hydrochloride (0.49 g,
83%) of an amorphous solid was obtained. Elemental analysis: C ₃₁ H ₃₀ N ₃ O ₄ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 61.29; H, 5.14; N, 6.92. Found: C, 61.59; H, 5.10; N, 6.92 ^{. 1 H-NMR (DMSO-} d 6) δ: 2.28-2.45 (4H, m), 4.03 (2H, d, J
= 6.0Hz), 4.26-4.33 (3H, m), 5.03 (1H, d, J = 14Hz), 6.6
3 (2H, d, J = 8.4Hz), 6.79 (1H, d, J = 1.6Hz), 6.97 (2H,
d, J = 8.4Hz), 6.99-7.46 (10H, m), 8.43 (3H, bs).

Example 3 N- [2- (3-aminomethylphenoxy) -4-chlorophenyl]-
N- (3,4-dichlorobenzyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (3.49 g , 10 mmol), 3,4-
Dichlorobenzyl chloride (2.1 ml, 15 mmol), potassium carbonate (1.38 g, 10 mmol) and N, N-dimethylformamide (30
ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography to give [3- [5-chloro-2- (3,4-dichlorobenzylamino) phenoxy] benzyl] carbamic acid tert-butyl ester
(3.03 g, 59.8%) oil was obtained. Mp 104-105 ° C. Elemental analysis _{C 25 H 25 N 2 O 3} Cl 3 theoretically:. C, 59.13; H, 4.96; N, 5.52 Found:. C, 59.03; H, 4.99; N, 5.34 1 H-NMR (CDCl ₃ ) δ: 1.45 (9H, s), 4.29-4.34 (4H, m), 4.
68 (2H, bs), 4.89 (1H, bs), 6.47 (1H, d, J = 8.4Hz), 6.8
0 (1H, d, J = 2Hz), 6.86-6.95 (3H, m), 7.03-7.07 (1H,
m), 7.23-7.48 (6H, m), 7.19- (1H, dd, J = 2,8.4Hz), 7.
31-7.41 (3H, m). (2) [3- [5-Chloro-2- (3,4-dichlorobenzylamino) phenoxy] benzylcarbamic acid tert-butyl ester
(2.79 g, 5.5 mmol), ethyl succinyl chloride (1.2 m
l, 8.3 mmol), 4-dimethylaminopyridine (1.01 g, 8.3
mmol) and tetrahydrofuran (30 ml) at room temperature.
After stirring for 60 hours, the mixture was stirred at 60 ° C. for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (3,4-dichlorobenzyl ) Succinamic acid ethyl ester (3.34 g, 95.
(7%) oil was obtained. Elemental analysis _{C 31 H 33 N 2 O 6} Cl 3 · 2H 2 O theoretically:. C, 55.41; H, 5.55; N, 4.17 Found:. C, 55.16; H, 5.57; N, 4.45 1 H -NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.0Hz), 1.45 (9H,
s), 2.54-2.84 (4H, m), 4.13 (2H, q, J = 7.0Hz), 4.29 (2
H, d, J = 5.8Hz), 4.72 (1H, d, J = 14.8Hz), 4.86 (1H, d,
J = 14.8Hz), 5.00 (1H, bs), 6.71-6.82 (2H, m), 7.01-
7.13 (4H, m), 7.25-7.35 (4H, m).

(3) N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (2,3-dichlorobenzyl) succinamidic acid ethyl ester (3.1
8 g, 5 mmol) in tetrahydrofuran (10 ml) and ethanol
(10 ml) solution in 1N aqueous sodium hydroxide solution (10 ml,
10 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- [2
A non-crystalline solid of-[3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (3,4-dichlorobenzyl) succinamic acid (2.46 g, 81.2%) was obtained. Elemental analysis: C ₂₉ H ₂₉ N ₂ O ₆ Cl ・ 3 / 4H ₂ O Theoretical: C, 56.05; H, 4.78; N, 4.50. Found: C, 56.21; H, 4.79; N, 4.40. ¹ H-NMR (CDCl ₃ ) δ: 1.44 (9H, s), 2.45 (2H, bs), 2.68 (2
H, bs), 4.28 (2H, d, J = 5.6Hz), 4.59-4.92 (2H, m), 5.
04 (1H, bs), 6.71-6.83 (3H, m), 7.03-7.12 (4H, m), 7.2
6-7.35 (3H, m). (4) N- [2- [3- (tert-butoxycarbonylaminomethyl)
[Phenoxy] -4-chlorophenyl] -N- (3,4-dichlorobenzyl) succinamic acid (0.91 g, 1.5 mmol), 2-fluorobenzylamine (0.23 g, 1.8 mmol), diethyl cyanophosphate (0.25 ml, 1.8 mmol) ), Triethylamine (0.25 ml,
A mixture of 1.8 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- [3- (tert-
A non-crystalline solid of butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (3,4-dichlorobenzyl) -N '-(2-fluorobenzyl) succinamide (0.61 g, 57%) was obtained. Elemental analysis _{C 36 H 35 N 3 O 5} Cl 3 F theoretically:. C, 60.47; H, 4.93; N, 5.88 Found:. C, 60.26; H, 4.93; N, 5.78 1 H-NMR ( CDCl ₃ ) δ: 1.43 (9H, s), 2.44-2.60 (4H, m), 4.
27 (2H, d, J = 6.2Hz), 4.45 (2H, d, J = 6.0Hz), 4.71 (1H,
d, J = 14.2Hz), 4.85 (2H, d, J = 14.2Hz), 5.17 (1H, b
s), 6.32 (1H, bs), 6.71-6.81 (3H, m), 6.97-7.19 (5H,
m), 7.22-7.33 (6H, m). (5) N- [2- [3- (tert-butoxycarbonylaminomethyl)
[Phenoxy] -4-chlorophenyl] -N- (3,4-dichlorobenzyl) -N ′-(2-fluorobenzyl) succinamide (0.50
g, 0.7 mmol) in 2N hydrochloric acid in ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- [2-
(3-Aminomethylphenoxy) -4-chlorophenyl] -N- (3,
A non-crystalline solid of 4-dichlorobenzyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (0.37 g, 82.2%) was obtained. Elemental analysis _{C 31 H 28 N 3 O 3} Cl 4 F theoretically:. C, 57.16; H, 4.33; N, 6.45 Found:. C, 56.99; H, 4.39; N, 6.30 1 H-NMR ( DMSO-d ₆ ) δ: 2.23-2.52 (4H, m), 4.03 (2H, s),
4.29 (2H, s), 4.54 (1H, d, J = 15.3Hz), 5.00 (1H, d, J = 1
5.3Hz), 6.85 (1H, d, J = 2.2Hz), 6.99 (1H, d, J = 8.2H
z), 7.13-7.50 (12H, m), 8.41 (3H, bs).

Example 4 N- [2- (3-Aminomethylphenoxy) -4-hydroxyphenyl] -N- (4-biphenylmethyl)]-N '-(2-fluorobenzyl) succinamide hydrochloride (1) 3-fluoro-4-nitrophenol (5.03 g, 32 mmo
l), benzyl bromide (4.5 ml, 38.4 mmol), potassium carbonate (4.4
2 g, 32 mmol) and N, N-dimethylformamide (50 ml) were stirred at room temperature for 1.5 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The precipitated crystals were collected by filtration and 4-benzyloxy-2-fluoronitrobenzene (6.47
g, 81.8%). Melting point: 83-84 ° C Elemental analysis: C ₁₃ H ₁₀ NO ₃ F Theoretical: C, 63.16; H, 4.08; N, 5.67. Found: C, 63.07; H, 4.01; N, 5.68. ¹ H-NMR (CDCl ₃ ) δ: 5.15 (2H, s), 6.76-6.86 (2H, m), 7.
40-7.43 (5H, m), 8.05-8.16 (1H, m). (2) 4-benzyloxy-2-fluoronitrobenzene (6.43
g, 26 mmol), N-tert-butoxycarbonyl-3-hydroxybenzylamine (5.78 g, 26 mmol), potassium carbonate (3.
A mixture of 59 g, 26 mmol) and N, N-dimethylformamide (70 ml) was stirred at 100 ° C. for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and the solvent was distilled off to remove [3- (5-benzyloxy-2-nitrophenoxy) benzyl] carbamic acid.
A yellow oil of tert-butyl ester (11.2 g, 95.0%) was obtained. Elemental analysis C ₂₅ H ₂₆ N ₂ O ₆ as the theoretical value:. C, 66.65; H, 5.82; N, 6.22 Found:. C, 66.30; H, 5.79; N, 6.00 1 H-NMR (CDCl 3) δ: 1.44 (9H, s), 4.31 (2H, d, J = 6.2H
z), 4.90 (1H, bs), 5.02 (2H, s), 6.47 (1H, d, J = 2.6H
z), 6.74 (1H, dd, J = 2.6,9.2Hz), 6.88-6.96 (2H, m),
7.11 (1H, d, J = 7.8Hz), 7.26-7.41 (6H, m), 8.06 (1H,
d, J = 9.2Hz).

(3) [3- (5-benzyloxy-2-nitrophenoxy) benzyl] carbamic acid tert-butyl ester (1
To a solution of 0.5 g (23.3 mmol) in ethyl acetate (300 ml) was added 5% palladium on carbon (3.2 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure to give [3- (2-amino-5-hydroxyphenoxy) benzyl] carbamic acid tert-butyl ester (7.6
g, 98.8%). ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 4.23 (2H, d, J = 6.2H
z), 5.06 (1H, bs), 6.31 (1H, d, J = 2.4Hz), 6.44 (1H, d
d, J = 2.4,8.4Hz), 6.66 (1H, d, J = 8.4Hz), 6.79-6.84 (2
H, m), 6.94 (1H, d, J = 7.6Hz), 7.20 (1H, d, J = 7.6Hz). (4) [3- (2-amino-5-hydroxyphenoxy) benzyl]
Carbamic acid tert-butyl ester (3.30 g, 10 mmo
l), 4-phenylbenzaldehyde (2.18 g, 12 mmol), acetic acid (1 ml), methanol (15 ml) and tetrahydrofuran (15
After stirring the mixture at room temperature for 1 hour, sodium cyanoborohydride (0.75 g, 12 mmol) was added. Thereafter, the mixture was stirred at room temperature for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [3- [2-
(4-biphenyl) methylamino-5-hydroxyphenoxy]
[Benzyl] carbamic acid tert-butyl ester (3.37 g,
67.9%). Mp 168-169 ° C. Elemental analysis C ₃₁ H ₃₂ N ₂ O ₄ as a theory:. C, 74.98; H, 6.50; N, 5.64 Found:. C, 75.03; H, 6.23; N, 5.45 1 H- NMR (CDCl ₃ ) δ: 1.43 (9H, s), 4.25 (2H, d, J = 6.2H
z), 4.35 (3H, s), 4.90 (1H, bs), 5.33 (1H, bs), 6.37 (1
H, bs), 6.47-6.64 (2H, m), 6.83-6.99 (3H, m), 7.20-7.
60 (10H, m).

(5) 3- [2- (4-biphenyl) methylamino-5-
[Hydroxyphenoxy] benzylcarbamic acid tert-butyl ester (2.98 g, 6 mmol), ethylsuccinyl chloride (2.6 ml, 18 mmol), 4-dimethylaminopyridine (2.
A mixture of 2 g, 18 mmol) and tetrahydrofuran (30 ml) was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4- [3- An oil of (ethoxycarbonyl) propionyloxy] phenyl] succinamic acid ethyl ester (4.5 g, 100%) was obtained. Elemental analysis _{C 43 H 48 N 2 O 10} · 1 / 2H 2 O theoretically:. C, 67.79; H, 6.48; N, 3.68 Found:. C, 67.61; H, 6.51; N, 3.63 1 H -NMR (CDCl ₃ ) δ: 1.19-1.30 (6H, m), 1.44 (9H, s), 2.
41-2.84 (8H, m), 4.08-4.21 (6H, m), 4.75 (1H, d, J = 1
4.5Hz), 4.87 (1H, bs), 5.04 (1H, d, J = 14.5Hz), 6.57 (1
H, d, J = 2.2Hz), 6.71 (2H, d, J = 7.4Hz), 6.81 (1H, dd,
J = 2.6,8.4Hz), 7.04 (1H, d, J = 7.8Hz), 7.13 (1H, d, J
= 7.8Hz), 7.21-7.56 (10H, m). (6) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4- [3- To a solution of (ethoxycarbonyl) propionyloxy] phenyl] succinamic acid ethyl ester (4.51 g, 6 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml) was added a 1N aqueous sodium hydroxide solution (23 ml, 23 mmol). did. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- (4-biphenylmethyl) -N-
[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-hydroxyphenyl] succinamidic acid (3.5 g,
97.8%) of an amorphous solid. Elemental analysis: C ₃₅ H ₃₆ N ₂ O ₇・ 1 / 2H ₂ O ・ 1/2 Ethyl acetate Theoretical: C, 68.40; H, 6.36; N, 4.31. Found: C, 68.37; H, 6.14; ^{. N, 4.08 1 H-NMR} (CDCl 3) δ: 1.39 (9H, s), 2.45-2.48 (2H, m), 2.
57-2.61 (2H, m), 4.02-4.04 (2H, m), 4.71-4.94 (3H,
m), 6.18 (1H, s), 6.45-6.61 (3H, m), 6.85-6.92 (2H,
m), 7.10-7.52 (11H, m).

(7) N- (4-biphenylmethyl) -N- [2- [3- (te
rt-butoxycarbonylaminomethyl) phenoxy] -4-hydroxyphenyl] succinamidic acid (1.19 g, 2 mmol),
2-fluorobenzylamine (0.27 ml, 2.4 mmol), diethyl cyanophosphate (0.33 ml, 2.4 mmol), triethylamine (0.33 ml, 2.4 mmol) and N, N-dimethylformamide (10
ml) of the mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
(4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-hydroxyphenyl]
-N '-(2-fluorobenzyl) succinamide (0.75 g, 5
3.6%) of an amorphous solid was obtained. Elemental analysis: C ₄₂ H ₄₂ N ₃ O ₆ F ・ 1 / 2H ₂ O Theoretical: C, 70.77; H, 6.08; N, 5.90. Found: C, 71.08; H, 6.06; N, 6.14. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (9H, s), 2.47 (4H, bs), 4.06-
4.07 (1H, m), 4.40 (2H, d, J = 5.4Hz), 4.68 (1H, d, J = 1
4.3Hz), 4.92 (1H, d, J == 14.3Hz), 4.98 (1H, bs), 6.26
(1H, d, J = 3Hz), 6.43 (1H, dd, J = 2.8,8.6Hz), 6.60-6.
65 (2H, m), 6.76-7.53 (16H, m), 8.42 (1H, bs). (8) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] -4-hydroxyphenyl] -N ′-(2-fluorobenzyl) succinamide (0.70
g, 1 mmol) in 2N hydrochloric acid in ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and treated with N- [2-
[3- (aminomethyl) phenoxy] -4-hydroxyphenyl]
A non-crystalline solid of -N- (4-biphenylmethyl)]-N '-(2-fluorobenzyl) succinamide hydrochloride (0.40 g, 62.5%) was obtained. Elemental analysis: C ₃₇ H ₃₅ N ₃ O ₄ ClF · 1 / 2H ₂ O Theoretical: C, 68.46; H, 5.59; N, 6.47. Found: C, 68.14; H, 5.37; N, 6.49. ¹ H-NMR (DMSO-d ₆ ) δ: 2.33-2.51 (4H, m), 4.01 (2H, s),
4.40 (2H, s), 4.40 (1H, d, J = 14.8Hz), 5.13 (1H, d, J = 1
4.8Hz), 6.29 (1H, s), 6.50 (1H, dd, J = 2.1,8.5Hz), 6.
89-7.01 (2H, m), 7.10-7.64 (16H, m), 8.43 (3H, bs).

Example 5 N- (2-fluorobenzyl) -4- [N '-[4-chloro-2- (1,2,3,4-
Tetrahydroisoquinolin-5-yloxy) phenyl] -N '
-(4-Phenylbenzoyl)] aminobutylamide hydrochloride (1) Acetic acid of 5-hydroxyisoquinoline (2.9 g, 20 mmol)
Platinum oxide (100 mg) was added to the (30 ml) solution, and hydrogenated under normal temperature and normal pressure conditions. After the reaction, the catalyst is filtered off,
The filtrate was concentrated under reduced pressure. The residue was crystallized from toluene (20 ml) and collected by filtration. The obtained crystals were dissolved in a mixture of 1N aqueous sodium hydroxide solution (40 ml) and tetrahydrofuran (40 ml), and di-tert-butyl dicarbonate (4.8 g, 22 mmo
l) was added. After the reaction mixture was stirred at room temperature for 1 hour, 1N hydrochloric acid (40 ml) was added, and the mixture was extracted with diethyl ether.
The extract was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The precipitated crystals were recrystallized from diisopropyl ether to give colorless crystals of 2-tert-butoxycarbonyl-5-hydroxy-tetrahydroisoquinoline (2.9 g, 58%). Melting point 163-164 ° C ¹ H-NMR (CDCl ₃ ) δ: 1.49 (9H, s), 2.76 (2H, t, J = 6.0H
z), 3.67 (1H, t, J = 6.0Hz), 4.56 (2H, s), 5.50-5.90 (1
H, bs), 6.67-6.70 (2H, m), 6.98-7.10 (1H, m). (2) 4-chloro-2-fluoronitrobenzene (1.93 g, 11 mm
ol), 2-tert-butoxycarbonyl-5-hydroxy-tetrahydroisoquinoline (2.74 g, 11 mmol), potassium carbonate
(1.53 g, 11 mmol) and N, N-dimethylformamide (20 ml)
Was stirred at 60 ° C. for 24 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 2-ter
t-butoxycarbonyl-5- (5-chloro-2-nitrophenoxy) -1,2,3,4-tetrahydroisoquinoline (4.35 g, 97.7
%) Oil was obtained. Elemental analysis C ₂₀ H ₂₁ N ₂ O ₅ theory as Cl:. C, 59.33; H , 5.23; N, 6.92 Found:. C, 59.06; H, 5.22; N, 7.00 1 H-NMR (CDCl 3 ) δ: 1.49 (9H, s), 2.74 (2H, t, J = 6Hz),
3.64 (2H, t, J = 6.0Hz), 4.64 (2H, s), 6.81-6.87 (2H,
m), 7.04 (1H, t, J = 7.2Hz), 7.13 (1H, dd, J = 2,8.8Hz),
7.24 (1H, t, J = 7.8Hz), 7.94 (1H, d, J = 8.8Hz).

(3) 2-tert-butoxycarbonyl-5- (5-chloro-2-nitrophenoxy) -2,3,4,5-tetrahydroisoquinoline (4.25 g, 10.5 mmol) in ethyl acetate (100 ml) To the solution was added 5% palladium on carbon (1.3 g). The resulting mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 5- (2-amino-5-chlorophenoxy) -2-tert-butoxycarbonyl-1,2,3,4-tetrahydroisoquinoline (2.95 g, 75%) as an oil. I got something. Elemental analysis C ₂₀ H ₂₃ N ₂ O ₃ theory as Cl:. C, 64.08; H , 6.18; N, 7.47 Found:. C, 64.09; H, 6.31; N, 7.48 1 H-NMR (CDCl 3 ) δ: 1.50 (9H, s), 2.79 (2H, t, J = 5.8H
z), 3.65 (2H, t, J = 5.8Hz), 3.84 (2H, bs), 4.71 (2H,
s), 6.63 (1H, d, J = 2.2Hz), 6.70-6.75 (2H, m), 6.87-6.
94 (2H, m), 7.15 (1H, t, J = 7.8Hz). (4) 5- (2-amino-5-chlorophenoxy) -2-tert-butoxycarbonyl-1,2,3,4- Tetrahydroisoquinoline (2.92
g, 7.8 mmol), ethyl 4-bromobutyrate (2.2 ml,
A mixture of 15.6 mmol), potassium carbonate (1.08 g, 10 mmol) and N, N-dimethylformamide (10 ml) was stirred at 60 ° C for 3 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [2- [2- (tert-butoxycarbonyl) -1,2,3,4-tetrahydroisoquinolin-5-yloxy] -4- Chlorophenyl] aminobutyric acid ethyl ester
(2.47 g, 64.8%) was obtained as an oil. Elemental analysis C ₂₆ H ₃₃ N ₂ O ₅ theory as Cl:. C, 63.86; H , 6.80; N, 5.73 Found:. C, 63.73; H, 6.84; N, 5.52 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.4Hz), 1.50 (9H,
s), 1.89-2.03 (2H, m), 2.40 (2H, t, J = 7.2Hz), 2.77 (2H
H, t, J = 5.9Hz), 3.22 (2H, t, J = 6.9Hz), 3.65 (2H, t,
J = 6.9Hz), 4.11 (2H, q, J = 7.4Hz), 4.28 (1H, bs), 4.62
(2H, s), 6.57-6.73 (3H, m), 6.90-6.97 (2H, m), 7.19
(1H, t, J = 7.9Hz).

(5) 4- [2- [2- (tert-butoxycarbonyl)-
1,2,3,4-tetrahydroisoquinolin-5-yloxy] -4-
Chlorophenyl] aminobutyric acid ethyl ester (2.45 g, 5
mmol), 4-dimethylaminopyridine (1.22 g, 10 mmol) in tetrahydrofuran (30 ml) was added with 4-phenylbenzoyl chloride (1.6 g, 7.5 mmol). The reaction solution was stirred at room temperature for 5 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [2- (tert-butoxycarbonyl) -1,2,3,4-tetrahydroisoquinolin-5-yloxy]
An oil of 4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester (2.04 g, 58.5%) was obtained. Elemental analysis C ₃₉ H ₄₁ N ₂ O ₆ theory as Cl:. C, 70.00; H , 6.18; N, 4.19 Found:. C, 70.23; H, 6.24; N, 4.34 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.0Hz), 1.48 (9H,
s), 2.04 (2H, bs), 2.43-2.50 (4H, m), 3.56 (2H, bs),
3.90 (1H, bs), 4.04 (1H, bs), 4.12 (2H, q, J = 7Hz), 4.
59 (2H, s), 6.10 (1H, bs), 6.92-7.07 (3H, m), 7.27-7.
48 (8H, m), 7.53-7.58 (2H, m). (6) 4- [N- [2- [2- (tert-butoxycarbonyl) -1,2,3,4-
Tetrahydroisoquinolin-5-yloxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester (2.01 g, 3 mmol) in tetrahydrofuran (10 ml)
1N aqueous sodium hydroxide solution (4.5 ml, 4.5 mmol) was added to a solution of ethanol and ethanol (10 ml). The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [2- [2- (tert-butoxycarbonyl) -1,
2,3,4-tetrahydroisoquinolin-5-yloxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid
(1.90 g, 99.0%) of an amorphous solid was obtained. Elemental analysis _{C 37 H 37 N 2 O 6} Cl · 1 / 2H 2 O theoretically:. C, 68.35; H, 5.89; N, 4.31 Found:. C, 68.66; H, 5.90; N, 4.10 1 1 H-NMR (CDCl ₃ ) δ: 1.47 (9H, s);
95-2.09 (2H, m), 3.54 (2H,
bs), 3.84-3.89 (1H, m), 4.
11-4.18 (1H, m), 4.59 (2H,
s), 6.06 (1H, bs), 6.41 (1
H, s), 6.92-7.07 (3H, m),
7.28-7.58 (10H, m).

(7) 4- [N- [2- [2- (ter
t-butoxycarbonyl) -1,2,3,4-tetrahydroisoquinolin-5-yloxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.83 g, 1.3 mmol), 2-fluorobenzyl Amine (0.18 ml, 1.6 mmol), diethyl cyanophosphate (0.22 ml, 1.3 mmol), triethylamine (0.2
A mixture of 2 ml, 1.3 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [2- (tert-butoxycarbonyl) -1,2,3 , 4-Tetrahydroisoquinolin-5-yloxy]
A non-crystalline solid of [-4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.70 g, 72.2%) was obtained. Elemental analysis _{C 44 H 43 N 3 O 5} ClF theoretically:. C, 70.62; H, 5.79; N, 5.62 Found:. C, 70.33; H, 5.61; N, 5.47 1 H-NMR (CDCl 3 ) δ: 1.47 (9H, s), 1.97-2.05 (2H, m), 2.
36-2.49 (4H, m), 3.53 (2H, bs), 3.81-3.92 (1H, m), 4.
07-4.17 (1H, m), 4.53 (2H, d, J = 5.2Hz), 4.58 (2H, bs),
6.90 (1H, bs), 6.39 (1H, d, J = 2Hz), 6.92-7.13 (5H,
m), 7.23-7.58 (13H, m). (8) N- (2-fluorobenzyl) -4- [N '-[2- [2- (tert-butoxycarbonyl) -1,2,3,4 -Tetrahydroisoquinoline-5
A solution of -yloxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.6 g, 0.8 mmol) in 2N hydrochloric acid in ethyl acetate (10 ml) was stirred at room temperature for 1 hour.
The reaction solution was concentrated under reduced pressure. After filtering the precipitated solid,
After washing with ethyl ether, N- (2-fluorobenzyl) -4
-[N '-[4-Chloro-2- (1,2,3,4-tetrahydroisoquinoline
-5-yloxy) phenyl] -N '-(4-phenylbenzoyl)]
An amorphous solid of aminobutylamide hydrochloride (0.46 g, 85.2%) was obtained. Elemental analysis: C ₃₉ H ₃₆ N ₃ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 67.53; H, 5.38; N, 6.06. Found: C, 67.69; H, 5.32; N, 6.00 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.87 (2H, bs), 2.27 (2H, s), 2.63
(2H, s), 3.28 (2H, s), 3.82 (2H, bs), 3.97 (2H, bs),
4.29 (2H, s), 6.40 (1H, s), 7.10-7.67 (18H, m), 8.37 (1
H, bs), 9.28 (1H, bs).

Example 6 N- (2-fluorobenzyl) -4- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide Hydrochloride (1) (3- (2-amino-5-chlorophenoxy) benzylcarbamic acid tert-butyl ester (3.5 g, 10 mmol), 4-bromobutyric acid ethyl ester (2.9 ml, 20 mmol), potassium carbonate ( 1.4 g, 10 mmol) and N, N-dimethylformamide (30 m
The mixture of l) was stirred at 60 ° C. for 3 hours. After cooling the reaction solution,
Poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (2.74 g, 59.3% )). Elemental analysis C ₂₄ H ₃₁ N ₂ O ₅ theory as Cl:. C, 62.26; H , 6.75; N, 6.05 Found:. C, 62.32; H, 6.84; N, 5.84 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.4Hz), 1.45 (9H,
s), 1.85-1.99 (2H, m), 2.37 (2H, t, J = 7.1Hz), 3.19 (2
H, q, J = 6.6Hz), 4.11 (2H, q, J = 7.4Hz), 4.20 (2H, b
s), 4.29 (2H, d, J = 6.2Hz), 4.90 (1H, bs), 6.64 (1H,
d, J = 8.8Hz), 6.76 (1H, d, J = 2.6Hz9, 6.84-7.05 (4H,
m), 7.24-7.32 (1H, m). (2) 4- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (2.3 g, 5.0 mmol), 4-dimethylaminopyridine (1.
1 g, 1.8 mmol) in tetrahydrofuran (20 ml).
Phenylbenzoyl chloride (2.2 g, 10 mmol) was added. The reaction solution was stirred at room temperature for 3 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3- (tert-
A non-crystalline solid of ethyl butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl) aminobutyrate (2.06 g, 64.2%) was obtained. Elemental analysis: C ₃₇ H ₃₉ N ₂ O ₆ Cl Theoretical: C, 69.09; H, 6.11; N, 4.36. Found: C, 68.86; H, 6.35; N, 4.21. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.2Hz), 1.44 (9H,
s), 1.99 (2H, t, J = 7.4Hz), 2.46 (2H, t, J = 7.4Hz), 3.
83-3.94 (1H, m), 4.20-4.18 (3H, m), 4.22 (2H, d J = 5.8
Hz), 4.91 (1H, bs), 6.47-6.64 (3H, m), 6.98-7.10 (2H,
m), 7.19-7.28 (2H, m), 7.31-7.48 (7H, m), 7.55-7.59
(2H, m).

(3) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-
Phenylbenzoyl)] aminobutyric acid ethyl ester (1.9
g, 3.0 mmol) in tetrahydrofuran (5 ml) and ethanol
(5 ml) in 1N aqueous sodium hydroxide solution (6 ml, 6 ml
mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N
-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)]
An amorphous solid of aminobutyric acid (1.73 g, 94.0%) was obtained. Elemental analysis: C ₃₅ H ₃₅ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 67.35; H, 5.81; N, 4.49. Found: C, 67.68; H, 5.80; N, 4.44. ¹ H-NMR (CDCl ₃ ) δ: 1.44 (9H, s), 1.97 (2H, bs), 2.50 (2
H, bs), 3.61 (1H, bs), 3.96 (1H, bs), 4.25 (2H, d, J =
6.2Hz), 5.13 (1H, bs), 6.63-7.07 (5H, m), 7.31-7.58
(11H, m). (4) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.80 g , 1.3 mmol), 2-fluorobenzylamine (0.18 ml, 1.6 mmol), diethyl cyanophosphate (0.22 ml, 1.3 mmol), triethylamine (0.22 ml,
A mixture of 1.3 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.85 g, 90.4%)
A non-crystalline solid was obtained. Elemental analysis: C ₄₂ H ₄₁ N ₃ O ₅ ClF · 1 / 4H ₂ O Theoretical: C, 69.41; H, 5.76; N, 5.78. Found: C, 69.41; H, 5.72; N, 5.65. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.94-2.01 (2H, m), 2.
34-2.44 (2H, m), 3.77-3.83 (1H, m), 4.07-4.17 (1H,
m), 4.19 (2H, d, J = 7.8Hz), 4.51 (2H, d, J = 5.4Hz), 4.
98 (1H, bs), 6.44 (1H, d, J = 8Hz), 6.58 (2H, d, J = 9.8H
z), 6.87 (1H, bs), 6.99-7.12 (11H, m), 7.54-7.59 (2H,
m). (5) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenyl Benzoyl)] aminobutyramide (0.72 g, 1.0 mmol) in 2N hydrochloric acid in ethyl acetate (10
ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid was collected by filtration, washed with ethyl ether, and washed with N- (2-fluorobenzyl) -4- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-( 4-Phenylbenzoyl)] aminobutylamide hydrochloride (0.61 g, 93.8%) was obtained as an amorphous solid. Elemental analysis: C ₃₇ H ₃₄ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 66.57; H, 5.28; N, 6.29. Found: C, 66.92; H, 5.27; N, 6.20 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.75-1.88 (2H, m), 2.21-2.35 (2H,
m), 3.68-3.81 (2H, m), 4.00 (2H, s), 4.29 (2H, s), 5.
50 (1H, bs), 6.59 (1H, bs), 6.63-6.72 (1H, m), 7.15-7.
68 (18H, m), 8.44 (2H, bs).

Example 7 N- (2-fluorobenzyl) -5- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminovaleramide Hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (10.5 g, 30 mmol), 5-bromovaleric acid ethyl ester (10.2 ml, 60 mmol), carbonic acid Potassium (4.2 g, 30 mmol) and N, N-dimethylformamide (1
(00 ml) was stirred at 60 ° C. for 96 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 5- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminovaleric acid ethyl ester (8.65 g, 60.4 g %) Oil was obtained. Elemental analysis: C ₂₅ H ₃₃ N ₂ O ₅ Cl ・ 1 / 2H ₂ O Theoretical: C, 61.75; H, 7.05; N, 5.76. Found: C, 62.14; H, 6.95; N, 5.64. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (3H, t, J = 7.0 Hz), 1.45 (9H,
s), 1.64-1.75 (4H, m), 2.32 (2H, t, J = 6.6Hz), 3.14 (2
H, t, J = 6.3Hz), 4.08 (2H, q, J = 7.0Hz), 4.12 (1H, b
s), 4.29 (2H, d, J = 6.2Hz), 4.93 (1H, bs), 6.61 (1H,
d, J = 8.8Hz), 6.76 (1H, d, J = 2.2Hz), 6.84-7.05 (4H,
m), 7.28 (1H, t, J = 7.9Hz). (2) 5- [2- [3- (tert-butoxycarbonylaminomethyl)
[Phenoxy] -4-chlorophenyl] aminovaleric acid ethyl ester (8.40 g, 17.6 mmol) and 4-dimethylaminopyridine (4.3 g, 35 mmol) in tetrahydrofuran (50 ml) were treated with 4-phenylbenzoyl chloride (7.6 g, 35). mmol) was added. The reaction solution was stirred at room temperature for 5 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 5- [N- [2- [3- (tert.
-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminovaleric acid
A prism crystal of ethyl ester (8.81 g, 76.2%) was obtained. 133-134 ° C Elemental analysis: C ₃₈ H ₄₁ N ₂ O ₆ Cl Theoretical: C, 69.45; H, 6.29; N, 4.26. Found: C, 69.41; H, 6.39; N, 4.35. ¹ H -NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.4Hz), 1.44 (9H,
s), 1.92 (4H, m), 2.34 (2H, bs), 3.87 (2H, bs), 4.11
(2H, q, J = 7.0Hz), 4.23 (2H, d, J = 6.0Hz), 4.94 (1H, b
s), 6.50-6.67 (3H, m), 6.97-7.09 (2H, m), 7.20-7.46
(8H, m), 7.54-7.58 (3H, m).

(3) 5- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-
Phenylbenzoyl)] aminovaleric acid ethyl ester (2.
0 g, 3.0 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml).
ml, 6 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 5-
Prism crystals of [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminovaleric acid (1.83 g, 96.8%) were obtained. . Melting point 141-142 ° C Elemental analysis: C ₃₆ H ₃₇ N ₂ O ₆ Cl Theoretical: C, 68.73; H, 5.93; N, 4.45. Found: C, 68.71; H, 5.86; N, 4.61. ¹ H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.70 (4H, bs), 2.67 (2
H, bs), 3.35-3.67 (1H, m), 4.24-4.29 (1H, m), 4.28 (2
H, s), 5.18 (1H, bs), 6.43-6.58 (2H, m), 6.91-7.06 (3
H, m), 7.21-7.59 (11H, m). (4) 5- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenyl Benzoyl)] aminovaleric acid (0.82 g, 1.3 mmol), 2-fluorobenzylamine (0.18 ml, 1.6 mmol), diethyl cyanophosphate (0.22 ml, 1.3 mmol), triethylamine (0.22 m
1, 1.3 mmol) and N, N-dimethylformamide (10 ml) were stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -5- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-(4-
Phenylbenzoyl)] aminovaleramide (0.67 g, 70.
5%) of an amorphous solid was obtained. Elemental analysis: C ₄₃ H ₄₃ N ₃ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 69.30; H, 5.95; N, 5.64. Found: C, 69.60; H, 5.94; N, 5.67. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.67 (4H, bs), 2.27-
2.30 (2H, m), 3.81 (1H, bs), 3.98 (1H, bs), 4.20 (2H,
d, J = 6.4Hz), 4.47 (2H, d, J = 5.8Hz), 5.00 (1H, bs), 6.
36 (1H, bs), 6.48-6.65 (3H, m), 6.94-7.09 (4H, m), 7.
18-7.47 (11H, m), 7.53-7.58 (2H, m). (5) N- (2-fluorobenzyl) -5- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) Phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminovaleramide (0.59 g, 0.8 mmol) in 2N hydrochloric acid in ethyl acetate
ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -5- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-( 4-Phenylbenzoyl)] aminovaleramide hydrochloride (0.46 g, 86.8%) was obtained as an amorphous solid. Elemental analysis: C ₃₈ H ₃₆ N ₃ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 66.96; H, 5.47; N, 6.16. Found: C, 67.22; H, 5.50; N, 6.28 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.58 (4H, bs), 2.19 (2H, bs), 3.7
6 (2H, s), 4.01 (2H, s), 4.28 (2H, d, J = 4.8Hz), 6.58-
6.68 (2H, m), 7.09-7.67 (18H, m), 8.36 (3H, bs).

Example 8 N- (2-fluorobenzyl) -6- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminohexanamide Hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (3.5 g, 10 mmol), 6-bromohexanoic acid ethyl ester (3.6 ml, 21 mmol), carbonic acid A mixture of potassium (4.2 g, 10 mmol) and N, N-dimethylformamide (30 ml) was stirred at 60 ° C. for 24 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 6- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminohexanoic acid ethyl ester (2.29 g, 46.6 g) %) Oil was obtained. Elemental analysis C ₂₆ H ₃₅ N ₂ O ₅ theory as Cl:. C, 63.60; H , 7.18; N, 5.71 Found:. C, 63.83; H, 7.23; N, 5.59 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.4Hz), 1.33-1.45 (1
2H, m), 1.55-1.72 (4H, m), 2.28 (2H, t, J = 7.4Hz), 3.0
4-3.19 (2H, m), 4.08 (2H, q, J = 7.4Hz), 4.29 (2H, d, J
= 5.8Hz), 4.92 (1H, bs), 6.61 (1H, d, J = 8.8Hz), 6.75
(1H, dd, J = 2.2Hz), 6.84-7.04 (4H, m), 7.24-7.32 (1H,
m). (2) 6- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminohexanoic acid ethyl ester (8.40 g, 17.6 mmol), 4-dimethylaminopyridine (4.3 g, 35.2 mmol) in tetrahydrofuran (50 m
l) To the solution was added 4-phenylbenzoyl chloride, (7.6 g, 35.2
mmol) was added. After stirring the reaction solution at room temperature for 12 hours,
Stirred for 96 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 6- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenyl Benzoyl)] aminohexanoic acid ethyl ester (2.47 g, 81.8%) was obtained as an oil. Elemental analysis: C ₃₉ H ₄₃ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 69.79; H, 6.46; N, 4.17. Found: C, 69.59; H, 6.77; N, 4.14. ¹ H-NMR (CDCl ₃ ) δ: 1.17-1.30 (7H,
m), 1.44 (9H, s), 1.54-1.7.
2 (2H, m), 2.28 (2H, t, J =
7.3 Hz), 3.78-3.87 (2H, m),
3.12 (2H, q, J = 7.0 Hz);
23 (2H, d, J = 6.0 Hz), 4.92
(1H, bs), 6.45-6.66 (3H,
m), 6.98-7.09 (2H, m), 7.2
1 (2H, d, J = 8.2 Hz), 7.34−
7.47 (7H, m), 7.54-7.59 (2
H, m).

(3) 6- [N- [2- [3- (ter
t-butoxycarbonylaminomethyl) phenoxy] -4-
Chlorophenyl] -N- (4-phenylbenzoyl)] aminohexanoic acid ethyl ester (2.3 g, 3.4 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml) was added to a 1N aqueous solution of sodium hydroxide (7 ml, 7 ml). mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, 6- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminohexanoic acid (1.9
6 g, 89.9%) of an amorphous solid was obtained. Elemental analysis: C ₃₇ H ₃₉ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 68.14; H, 6.18; N, 4.30. Found: C, 68.51; H, 6.06; N, 4.34. ¹ H-NMR (CDCl ₃ ) δ: 1.44 (11H, s), 1.64 (4H, bs), 2.31-
2.37 (2H, m), 3.70 (1H, bs), 4.07 (1H, bs), 4.25 (2H,
d, J = 6.0Hz), 5.03 (1H, bs), 6.56 (1H, bs), 6.74 (1H, b
s), 6.97-7.01 (3H, m), 7.18-7.22 (3H, m), 7.31-7.58
(9H, m). (4) 6- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminohexanoic acid (0.84 g, 1.3 mmol), 2-fluorobenzylamine (0.18 ml, 1.6 mmol), diethyl cyanophosphate (0.22 ml, 1.3 mmol), triethylamine (0.22 ml
ml, 1.3 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -6- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-(4
-Phenylbenzoyl)] aminohexaneamide (0.65 g, 6
7.0%) of an amorphous solid. Elemental analysis _{C 44 H 45 N 3 O 5} ClF theoretically:. C, 70.43; H, 6.05; N, 5.60 Found:. C, 70.29; H, 6.11; N, 5.52 1 H-NMR (CDCl 3 ) δ: 1.42 (9H, s), 1.52-1.77 (6H, m), 2.
19 (2H, t, J = 7.8Hz), 3.73 (1H, bs), 3.95 (1H, bs), 4.2
1 (2H, d, J = 6.6Hz), 4.46 (2H, d, J = 6.2Hz), 5.17 (1H, b
s), 6.07 (1H, bs), 6.48 (1H, bs), 6.58 (1H, s), 6.69
(1H, s), 6.98-7.47 (15H, m), 7.53-7.58 (2H, m). (5) N- (2-fluorobenzyl) -6- [N '-[2- [3- (tert 2-N-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminohexanamide (0.53 g, 0.7 mmol) hydrochloric acid in ethyl acetate
(10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -6- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-( 4-phenylbenzoyl)] aminohexanoamide hydrochloride (0.40 g, 83.3
%) Of an amorphous solid. Elemental analysis: C ₃₉ H ₃₈ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 67.34; H, 5.64; N, 6.04. Found: C, 67.55; H, 5.63; N, 6.00 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.30 (2H, bs), 1.53 (4H, bs), 2.1
3 (2H, s), 3.74 (2H, bs), 4.02 (2H, s), 4.96 (2H, s),
6.59-6.71 (2H, m), 7.14-7.63 (18H, m), 8.34 (3H, bs).

Example 9 N- (2-fluorobenzyl) -3- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminopropionamide Hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (2.8 g, 8.0 mmol), 3-
Bromopropionic acid ethyl ester (2.1 ml, 16 mmol),
A mixture of potassium carbonate (1.1 g, 8.0 mmol) and N, N-dimethylformamide (30 ml) was stirred at 60 ° C. for 72 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 3- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminopropionic acid ethyl ester (1.42 g, 39.6 g) %) Oil was obtained. Elemental analysis: as C ₂₃ H ₂₉ N ₂ O ₅ Cl Theoretical: C, 61.53; H, 6.51; N, 6.24. Found: C, 61.25; H, 6.43; N, 6.37. ¹ H-NMR (CDCl ₃ ) δ: 1.21 (3H, t, J = 7.0Hz), 1.45 (9H,
s), 2.59 (2H, t, J = 6.6Hz), 3.47 (2H, t, J = 6.6Hz), 4.
09 (2H, q, J = 7.0Hz), 4.29 (2H, d, J = 6.0z), 4.93 (1H,
bs), 6.66 (1H, d, J = 8.6Hz), 6.77 (1H, d, J = 2.4Hz),
6.82-6.89 (2H, m), 6.98-7.05 (2H, m), 7.28 (1H, t, J =
(7.8Hz). (2) 3- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminopropionic acid ethyl ester (1.4 g, 3.0 mmol), 4-dimethylaminopyridine (0.74 g, 6.0 mmol) in tetrahydrofuran (30 m
l) Add 4-phenylbenzoyl chloride (1.3 g, 6.0 mm
ol). The reaction solution was stirred at room temperature for 3 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
-(tert-Butoxycarbonylaminomethyl) phenoxy]-
An oil of 4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopropionic acid ethyl ester (1.52 g, 80.9%) was obtained. Elemental analysis: C ₃₆ H ₃₇ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 67.76; H, 6.00; N, 4.39. Found: C, 67.95; H, 5.90; N, 4.35. ¹ H-NMR (CDCl ₃ ) δ: 1.22 (3H, t, J = 7.1 Hz), 1.44 (9H,
s), 2.73 (1H, bs), 2.84 (1H, bs), 4.03-4.17 (4H, m),
4.23 (2H, d, J = 5.9Hz), 4.85 (1H, bs), 6.47-6.67 (3H,
m), 6.96-7.10 (2H, m), 7.19-7.27 (2H, m), 7.31-7.47
(7H, m), 7.54-7.58 (2H, m).

(3) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-
To a solution of ethyl phenylbenzoyl)] aminopropionate (1.5 g, 2.3 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml) was added a 1N aqueous sodium hydroxide solution (5 ml, 5 mmol). The resulting mixture is allowed to stand at room temperature
Stir for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopropionic acid (1.35 g, 97.8 g) %) Of an amorphous solid. Elemental analysis C ₃₄ H ₃₃ N ₂ O ₆ theory as Cl:. C, 67.94; H , 5.53; N, 4.66 Found:. C, 67.56; H, 5.52; N, 4.51 1 H-NMR (CDCl 3 ) δ: 1.43 (9H, s), 2.78-2.92 (2H, m), 3.
99-4.15 (5H, m), 4.98 (1H, bs), 6.47-6.56 (2H, m), 6.
72 (1H, s), 6.96-7.08 (2H, m), 7.23-7.26 (2H, m), 7.3
5-7.60 (2H, m). (4) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopropion Acid (0.42 g, 0.70 mmol), 2-
Fluorobenzylamine (0.10 ml, 0.90 mmol), diethyl cyanophosphate (0.13 ml, 0.90 mmol), triethylamine
(0.13 ml, 0.90 mmol) and N, N-dimethylformamide (10
ml) of the mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
(2-Fluorobenzyl) -3- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]
-N '-(4-Phenylbenzoyl)] aminopropionamide
(0.39 g, 79.6%) of an amorphous solid was obtained. Elemental analysis _{C 41 H 39 N 3 O 5} ClF · H 2 O theoretically:. C, 67.81; H, 5.69; N, 5.79 Found:. C, 67.83; H, 5.44; N, 5.59 1 H- NMR (CDCl ₃ ) δ: 1.42 (9H, s), 2.51-2.82 (2H, m), 4.
01-4.34 (4H, m), 4.47 (2H, d, J = 5.6Hz), 4.93 (1H, b
s), 6.41-6.59 (3H, m), 6.88 (1H, bs), 6.96-7.08 (4H,
m), 7.17-7.48 (11H, m), 7.53-7.58 (2H, m). (5) N- (2-fluorobenzyl) -3- [N '-[2- [3- (tert-butoxycarbonyl A 2N hydrochloric acid-ethyl acetate solution (10 ml) of [aminomethyl) phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminopropionamide (0.35 g, 0.50 mmol) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -3- [N '-[2- (3-aminomethylphenoxy) -4-chlorophenyl] -N'-( 4-phenylbenzoyl)] aminopropionamide hydrochloride (0.25 g, 7
8.1%) of an amorphous solid. Elemental analysis: C ₃₆ H ₃₂ N ₃ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 66.16; H, 5.09; N, 6.43. Found: C, 65.98; H, 5.12; N, 6.35 ^{. 1 H-NMR (DMSO-} d 6) δ: 2.41-2.79 (2H, m), 3.87-4.00 (2H,
m), 4.28 (2H, d, J = 4.8Hz), 4.57 (2H, s), 6.58 (1H,
s), 6.72-6.76 (1H, m), 7.12-7.20 (3H, m), 7.26-7.68
(15H, m). 8.50 (2H, bs), 8.60 (1H, s).

Example 10 N- (2-fluorobenzyl) -4- [N '-[2- [3- (2-aminoethyl) phenoxy] -3-pyridyl] -N'-(4-phenylbenzoyl) ] Aminobutylamide hydrochloride (1) 3-methoxyphenethylamine (21.9 ml, 150 mmol)
And a mixture of 47% hydrobromic acid (100 ml) with heating under reflux.
Stirred for 0 hours. After cooling the reaction solution, the solvent was distilled off under reduced pressure, and the residue was poured into water. An aqueous solution (100 ml) of sodium hydroxide (6 g, 150 mmol) was added to the obtained mixture, and the mixture was added at room temperature.
Stir for 30 minutes. Then di-tert-butyl dicarbonate (32.7
g, 0.15 mmol) in diethyl ether (100 ml) at 0 ° C.
It was added dropwise over 2 hours. After stirring the reaction mixture at 0 ° C. for 12 hours, it was extracted with diethyl ether. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to obtain crystals of N-tert-butoxycarbonyl-3-hydroxyphenethylamine (33.4 g, 95.3%). Melting point 84-85 ° C ¹ H-NMR (CDCl ₃ ) δ: 1.44 (9H, s), 2.72 (2H, t, J = 6.8H
z), 3.32-3.42 (2H, m), 4.65 (1H, bs), 6.56 (1H, bs),
6.70-6.76 (3H, m), 7.11-7.19 (1H, m). (2) 2-Chloro-3-nitropyridine (4.76 g, 30 mmol), Nt
ert-butoxycarbonyl-3-hydroxyphenethylamine (7.11 g, 30 mmol), potassium carbonate (4.14 g, 30 mmol)
And a mixture of N, N-dimethylformamide (50 ml) at 100 ° C.
Stir for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to obtain [2- [3- (3-nitro-2-pyridyloxy) phenyl] ethyl] carbamic acid tert-butyl ester (10.1 g, 92.5%) as a yellow oil. Was. Elemental analysis C ₁₈ H ₂₁ N ₃ O ₅ theoretically:. C, 60.16; H, 5.89; N, 11.69 Found:. C, 60.11; H, 5.98; N, 11.58 1 H-NMR (CDCl 3) δ: 1.43 (9H, s), 2.83 (2H, t, J = 6.6H
z), 3.39 (2H, q, J = 6.6Hz), 4.60 (1H, bs), 7.03-7.19
(4H, m), 7.34-7.42 (1H, m), 7.32-8.39 (2H, m).

(3) [2- [3- (3-nitro-2-pyridyloxy)
Phenyl] ethyl] carbamic acid tert-butyl ester
To a solution of (10.1 g, 28 mmol) in ethanol (100 ml) was added 5% palladium on carbon (3.0 g). The resulting mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. [2- [3- (3-amino-2-pyridyloxy) phenyl] ethyl] carbamic acid
An oil of tert-butyl ester (7.09 g, 76.9%) was obtained. Elemental analysis _{C 18 H 23 N 3 O 3} · 1 / 4H 2 O theoretically:. C, 64.75; H, 7.09; N, 12.58 Found:. C, 65.10; H, 6.83; N, 12.22 1 H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.80 (2H, t, J = 7.0H
z), 3.33-3.43 (2H, m), 3.92 (2H, bs), 4.65 (1H, bs), 6.
84 (1H, dd, J = 2.7,7.7Hz), 6.98-7.06 (4H, m), 7.27-7.3
6 (1H, m), 7.56 (1H, dd, J = 1.5,4.7Hz). (4) [2- [3- (3-amino-2-pyridyloxy) phenyl] ethyl] carbamic acid tert-butyl ester (3.3 g, 10 mmo
l), 4-bromobutyric acid ethyl ester (2.8 ml, 20 mmol),
A mixture of potassium carbonate (1.4 g, 10 mmol) and N, N-dimethylformamide (30 ml) was stirred at 60 ° C. for 72 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [2- [3- [2- (tert-butoxycarbonylamino) ethyl] phenoxy] -3-pyridyl] aminobutyric acid ethyl ester (2.41 g, 54.4%). Elemental analysis C ₂₄ H ₃₃ N ₃ O ₅ theoretically:. C, 64.99; H, 7.50; N, 9.47 Found:. C, 64.80; H, 7.39; N, 9.22 1 H-NMR (CDCl 3) δ: 1.26 (3H, t, J = 7.2Hz), 1.43 (9H,
s), 1.94-2.08 (2H, m), 2.46 (2H, t, J = 7.0Hz), 2.80 (2H
(H, t, J = 7.0Hz), 3.24 (2H, bs), 3.33-3.43 (2H, m), 4.1
1 (2H, q, J = 7.2Hz), 4.42 (1H, bs), 4.65 (1H, bs), 6.8
9-7.02 (5H, m), 7.31 (1H, t, J = 7.9), 7.46 (1H, t, J = 3.
3Hz).

(5) 4- [2- [3- [2- (tert-butoxycarbonylamino) ethyl] phenoxy] -3-pyridyl] aminobutyric acid
Ethyl ester (2.2 g, 5.0 mmol), 4-dimethylaminopyridine (1.2 g, 10 mmol) in tetrahydrofuran (30 ml)
Add 4-phenylbenzoyl chloride (1.6 g, 7.5 mmo
l) was added. The reaction solution was stirred at room temperature for 5 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3
A non-crystalline solid of-[2- (tert-butoxycarbonylamino) ethyl] phenoxy] -3-pyridyl] -N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester (2.54 g, 81.7%) was obtained. Elemental analysis: C ₃₇ H ₄₁ N ₃ O ₆・ 1 / 2H ₂ O Theoretical: C, 70.23; H, 6.69; N, 6.64. Found: C, 70.53; H, 6.79; N, 6.70. ¹ H -NMR (CDCl ₃ ) δ: 1.24 (3H, t, J = 7.0Hz), 1.43 (9H,
s), 1.97-2.12 (2H, m), 2.50 (2H, t, J = 7.4Hz), 2.69 (2H
H, t, J = 6.8Hz), 3.27 (2H, bs), 4.12 (2H, q, J = 7.0Hz),
4.50 (1H, bs), 6.63 (1H, d, J = 7.8Hz), 6.96-7.02 (2H,
m), 7.25-7.31 (1H, m), 7.35-7.57 (9H, m), 7.63 (1H,
dd, J = 1.8,7.8Hz), 7.97 (1H, dd, J = 4,4.8Hz). (6) 4- [N- [2- [3- [2- (tert-butoxycarbonylamino)
Ethyl [phenoxy] -3-pyridyl] -N- (4-phenylbenzoyl)] aminobutyric acid 1N sodium hydroxide in a solution of ethyl ester (2.4 g, 3.8 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml) An aqueous solution (7 ml, 7 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [2- [3- [2- (tert
-Butoxycarbonylamino) ethyl] phenoxy] -3-pyridyl] -N- (4-phenylbenzoyl)] aminobutyric acid (2.19
g, 96.9%). Elemental analysis: C ₃₅ H ₃₇ N ₃ O ₆・ 1 / 2H ₂ O Theoretical: C, 69.52; H, 6.33; N, 6.95. Found: C, 69.41; H, 6.26; N, 6.8.1. ¹ H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.96 (2H, bs), 2.55 (2
H, bs), 3.31 (2H, bs), 3.93 (1H, bs), 4.20 (1H, bs),
4.73 (1H, bs), 6.42 (1H, s), 6.77-7.06 (4H, m), 7.30-
7.57 (10H, m), 7.98 (1H, dd, J = 1.7,4.9Hz).

(7) 4- [N- [2- [3- [2- (tert-butoxycarbonylamino) ethyl] phenoxy] -3-pyridyl] -N- (4-phenylbenzoyl)] aminobutyric acid (1.0 g, 1.7 mmol), 2-
Fluorobenzylamine (0.23 ml, 2.0 mmol), diethyl cyanophosphate (0.28 ml, 2.0 mmol), triethylamine
(0.28 ml, 2.0 mmol) and N, N-dimethylformamide (10 m
The mixture of l) was stirred at room temperature for 2 hours. Pour the reaction into water,
Extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- [2- (tert-butoxycarbonylamino) ethyl] ethyl] was added. Phenoxy] -3-pyridyl] -N '-(4-
Phenylbenzoyl)] aminobutyramide (0.92 g, 77.
3%) of an amorphous solid was obtained. Elemental analysis: C ₄₂ H ₄₃ N ₄ O ₅ F ・ 1 / 2H ₂ O Theoretical: C, 70.87; H, 6.23; N, 7.87. Found: C, 70.99; H, 6.12; N, 7.87. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 2.05 (2H, bs), 2.43-
2.47 (2H, m), 2.67 (2H, t, J = 7.0Hz), 3.26 (2H, bs),
3.97 (1H, bs), 4.11 (1H, bs), 4.50 (1H, bs), 4.52 (2H,
d, J = 5.4Hz), 6.46 (1H, s), 6.56-6.60 (1H, m), 6.82
(1H, bs), 6.97-7.56 (16H, m), 7.67 (1H, dd, J = 1.8, 7.
6Hz), 7.97 (1H, dd, J = 1.8,5.0Hz). (8) N- (2-fluorobenzyl) -4- [N '-[2- [3- [2- (tert-butoxycarbonylamino) ) Ethyl] phenoxy] -3-pyridyl] -N '-(4-phenylbenzoyl)] aminobutyramide
(0.84 g, 1.2 mmol) in 2N hydrochloric acid in ethyl acetate (10 m
l) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (2-aminoethyl) phenoxy] -3-pyridyl] [-N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (0.75 g, 92.6%) was obtained as an amorphous solid. Elemental analysis: C ₃₇ H ₃₆ N ₄ O ₃ ClF.H ₂ O Theoretical: C, 67.62; H, 5.83; N, 8.53. Found: C, 67.83; H, 5.86; N, 8.46. ¹ H- NMR (DMSO-d ₆ ) δ: 1.81-1.92 (2H, m), 2.27-2.34 (2H,
m), 2.91-3.05 (4H, m), 3.85 (2H, bs), 4.29 (2H, s),
6.35-6.62 (1H, m), 6.87 (1H, s), 7.11-7.66 (16H, m),
7.94-7.98 (2H, m), 8.10 (2H, bs), 8.41 (1H, bs).

Example 11 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (1) 2-fluoronitrobenzene From N-tert-butoxycarbonyl-3-hydroxybenzylamine, Example 1 (1),
It was synthesized using the same method as (2). (Oil) ¹ H-NMR (CDCl ₃ ) δ: 1.44 (9H, s), 3.78 (2H, bs), 4.27 (2
(H, d, J = 5.8Hz), 4.88 (1H, bs), 6.67-6.78 (1H, m), 6.7
9-7.03 (6H, m), 7.25 (1H, t, J = 7.6Hz). (2) [3- (2-amino-5-chlorophenoxy) benzyl] carbamic acid tert-butyl ester (6.3 g, 20 mmol), 4-phenylbenzaldehyde (4.4 g, 24 mmol), a mixture of acetic acid (2 ml) and methanol (50 ml) was stirred at room temperature for 1 hour,
Sodium cyanoborohydride (1.6 g, 24 mmol) was added. Thereafter, the mixture was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [3- [2- (4-
An oil was obtained as tert-butyl biphenylmethylamino) phenoxy] benzyl] carbamate (8.40 g, 87.4%). Elemental analysis _{C 31 H 32 N 2 O 3} · 3 / 4H 2 O theoretically:. C, 75.36; H, 6.83; N, 5.67 Found:. C, 75.32; H, 6.86; N, 5.52 1 H -NMR (CDCl ₃ ) δ: 1.44 (9H, s), 4.29 (2H, d, J = 5.8H
z), 4.41 (2H, s), 4.66 (1H, bs), 4.83 (1H, bs), 6.61-
7.06 (7H, m), 7.22-7.60 (10H, m).

(3) [3- [2- (4-biphenylmethylamino) phenoxy] benzyl] carbamic acid tert-butyl ester
(7.7 g, 16 mmol), ethyl succinyl chloride (2.7 ml,
A mixture of 19 mmol), sodium hydrogen carbonate (4.0 g, 48 mmol), ethyl acetate (70 ml) and water (20 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl)
-N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamic acid ethyl ester (8.
33 g (85.6%) of an oil was obtained. Elemental analysis: C ₃₇ H ₄₀ N ₂ O ₆・ 1 / 2H ₂ O Theoretical: C, 71.94; H, 6.69; N, 4.53. Found: C, 71.75; H, 6.75; N, 4.36. ¹ H -NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.2Hz), 1.43 (9H,
s), 2.42-2.75 (4H, m), 4.07-4.20 (4H, m), 4.73 (1H, d,
J = 14.2Hz), 4.81 (1H, bs), 5.07 (1H, d, J = 14.2Hz),
6.70-6.72 (2H, m), 6.861H, d, J = 8.0Hz), 6.98-7.55 (1
(4H, m). (4) Tetrahydrofuran of N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamidic acid ethyl ester (7.9 g, 13 mmol) (40 ml) and a solution of ethanol (40 ml) were added with a 1N aqueous sodium hydroxide solution (20 ml, 20 mmol). The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, N- (4-diphenylmethyl) -N- [2- (3-tert-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamic acid (7.34 g, 97.3
%) Of an amorphous solid. Elemental analysis _{C 35 H 36 N 2 O 6} · 1 / 2H 2 O theoretically:. C, 71.29; H, 6.32; N, 4.75 Found:. C, 71.35; H, 6.29; N, 4.66 1 H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.50-2.53 (2H, m), 2.
66-2.69 (2H, m), 4.18 (2H, d, J = 3.8Hz), 4.72-4.85 (2
H, m), 5.06 (1H, d, J = 13.2Hz), 6.70 (3H, m), 6.84-7.1
0 (3H, m), 7.20-7.55 (11H, m).

(5) N- (4-biphenylmethyl) -N- [2- (3-ter
t-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamic acid (1.16 g, 2 mmol), 2-fluorobenzylamine (0.27 ml, 2.4 mmol), diethyl cyanophosphate
(0.35 ml, 2.4 mmol), triethylamine (0.33 ml, 2.4 mmol)
And a mixture of N, N-dimethylformamide (10 ml) at room temperature
Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N
A non-crystalline solid of-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N '-(2-fluorobenzyl) succinamide (1.08 g, 78.8%) was obtained. Elemental analysis: C ₄₂ H ₄₂ N ₃ O ₅ F ・ 1 / 2H ₂ O Theoretical: C, 72.39; H, 6.22; N, 6.03. Found: C, 72.60; H, 6.21; N, 6.01. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (9H, s), 2.55 (4H, s), 4.17 (2
H, d, J = 3.6Hz), 4.43 (2H, d, J = 5.2Hz), 5.07 (1H, d,
J = 14.2Hz), 5.11 (1H, bs), 6.56 (1H, bs), 6.69-6.73 (2
H, m), 6.85 (1H, d, J = 8.2Hz), 6.97-7.08 (4H, m), 7.1
9-7.55 (14H, m). (6) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N '-(2-
(Fluorobenzyl) succinamide (0.83 g, 1.2 mmol)
A 2N hydrochloric acid ethyl acetate solution (20 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N'-
(2-Fluorobenzyl) succinamide hydrochloride (0.70 g,
94.6%) of an amorphous solid was obtained. Elemental analysis: C ₃₇ H ₃₅ N ₃ O ₃ ClF Theoretical: C, 71.20; H, 5.65; N, 6.73. Found: C, 71.38; H, 5.76; N, 6.31. ¹ H-NMR (DMSO- d ₆ ) δ: 2.36-2.49 (4H, m), 4.00 (2H, s),
4.28 (2H, s), 4.48 (1H, d, J = 14.8Hz), 5.17 (1H, d, J = 1
4.8Hz), 6.91 (2H, d, J = 8.0Hz), 7.10-7.63 (19H, m),
8.42 (2H, bs).

Example 12 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N '-(2-fluorobenzyl) malonamide
Hydrochloride (1) [3- [2- (4-biphenylmethylamino) phenoxy] benzyl] carbamic acid tert-butyl ester (1.4 g, 3.0
mmol), ethylmalonyl chloride (0.58 ml, 4.5 mmol),
Sodium bicarbonate (0.76 g, 9.0 mmol), ethyl acetate (15
ml) and water (5 ml) were stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (te
rt-butoxycarbonylaminomethyl) phenoxy] phenyl] malonamic acid ethyl ester (1.55 g, 88.8%)
Oil was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.19-1.33 (3H, m), 1.44 (9H, s), 3.
32 (2H, s), 4.07-4.19 (4H, m), 4.74 (1H, bs), 4.77 (1
H, d, J = 14.7Hz), 5.08 (1H, d, J = 14.7Hz), 6.67-6.69
(1H, d, J = 8.4Hz), 6.97-7.55 (14H, m). (2) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] To a solution of ethyl [phenyl] malonamic acid (1.6 g, 2.6 mmol) in tetrahydrofuran (5 ml) and ethanol (5 ml) was added a 1N aqueous sodium hydroxide solution (5 ml, 5 mmol). The resulting mixture was stirred at room temperature for 3 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- (4-biphenylmethyl) -N-
[2- (3-tert-Butoxycarbonylaminomethyl) phenoxy] phenyl] malonamic acid (1.40 g, 95.2%) was obtained as an amorphous solid. Elemental analysis: C ₃₄ H ₃₄ N ₂ O ₆・ 1 / 2H ₂ O Theoretical: C, 70.94; H, 6.13; N, 4.87. Found: C, 71.04; H, 6.05; N, 4.83. ¹ H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 3.20 (1H, d, J = 19.4H
z), 3.33 (1H, d, J = 19.4Hz), 4.16 (2H, d, J = 5.0Hz),
4.76 (1H, bs), 4.97 (2H, s), 6.60-6.63 (2H, m), 6.83 (1
H, d, J = 8.4Hz), 7.01-7.09 (3H, m), 7.19-7.55 (11H,
m).

(3) N- (4-biphenylmethyl) -N- [2- (3-ter
t-butoxycarbonylaminomethyl) phenoxy] phenyl] malonamic acid (0.57 g, 1.0 mmol), 2-fluorobenzylamine (0.14 ml, 1.2 mmol), diethyl cyanophosphate (0.17 ml, 1.2 mmol), triethylamine (0.17 ml,
A mixture of 1.2 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N'- (2-fluorobenzyl)
Malonamide (0.54 g, 81%) was obtained as an amorphous solid. Elemental analysis _{C 41 H 40 N 3 O 5} F · 1 / 4H 2 O theoretically:. C, 72.60; H, 6.02; N, 6.20 Found:. C, 72.62; H, 5.98; N, 6.10 1 H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 3.23 (2H, s), 4.15 (2
H, d, J = 4.4Hz), 4.51 (2H, d, J = 5.8Hz), 4.85 (1H, d,
J = 14.4Hz), 4.89 (1H, bs), 5.01 (1H, d, J = 14.4Hz), 6.6
3-6.67 (2H, m), 6.82 (1H, d, J = 8.0Hz), 6.94-7.06 (5H,
m), 7.16-7.56 (13H, m), 8.45 (1H, bs). (4) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl ] -N '-(2-
Fluorobenzyl) malonamide (0.47 g, 0.70 mmol)
A 2N hydrochloric acid ethyl acetate solution (20 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N'-
(2-Fluorobenzyl) malonamide hydrochloride (0.37 g, 88
%) Of an amorphous solid. Elemental analysis: C ₃₆ H ₃₃ N ₃ O ₃ ClF · 1 / 2H ₂ O Theoretical: C, 69.84; H, 5.54; N, 6.79. Found: C, 69.47; H, 5.39; N, 6.59. ¹ H-NMR (DMSO-d ₆ ) δ: 3.07 (1H, d, J = 15.4Hz), 3.28 (1H,
d, J = 15.4Hz), 4.00 (2H, s), 4.28 (2H, s), 4.49 (1H,
d, J = 15.2Hz), 5.22 (1H, d, J = 15.2Hz), 6.91-6.97 (2H,
m), 7.06-7.65 (19H, m), 8.46 (2H, bs).

Example 13 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N ′-(2-fluorobenzyl) glutaramide hydrochloride (1) [3- [ 2- (4-biphenylmethylamino) phenoxy] benzyl] carbamic acid tert-butyl ester (1.4 g, 3.0
mmol), ethyl glutar chloride (0.56 ml, 3.6 mmol),
Sodium bicarbonate (0.76 g, 9.0 mmol), ethyl acetate (15
ml) and water (5 ml) were stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (te
rt-butoxycarbonylaminomethyl) phenoxy] phenyl] glutaramic acid ethyl ester (1.33 g, 71.5
%) Oil was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.26 (3H, t, J = 7.0 Hz), 1.43 (9H,
s), 1.92-1.99 (2H, m), 4.87 (1H, bs), 5.06 (1H, d, J = 1
4.3Hz), 6.68-6.71 (2H, m), 6.84 (1H, d, J = 8.0Hz), 6.
99-7.06 (3H, m), 7.18-7.56 (12H, m). (2) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] Glutaramic acid ethyl ester (1.6 g, 2.6 mmol) in tetrahydrofuran (5 ml) and ethanol (5 ml)
An aqueous solution of sodium hydroxide (5 ml, 5 mmol) was added. The resulting mixture was stirred at room temperature for 3 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N- (4-biphenylmethyl) -N-
[2- (3-tert-Butoxycarbonylaminomethyl) phenoxy] phenyl] glutaramic acid (1.14 g, 91.9%) was obtained as an amorphous solid. Elemental analysis: C ₃₆ H ₃₈ N ₂ O ₆・ 1 / 2H ₂ O Theoretical: C, 71.62; H, 6.51; N, 4.64. Found: C, 71.80; H, 6.33; N, 4.51. ¹ H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.87-2.54 (6H, m), 4.
22-4.28 (2H, m), 4.73 (1H, d, J = 13.9Hz), 5.17 (1H, d,
J = 13.9Hz), 6.68-6.81 (2H, m), 6.98-7.02 (3H, m), 7.2
4-7.59 (12H, m).

(3) N- (4-biphenylmethyl) -N- [2- (3-ter
[t-butoxycarbonylaminomethyl) phenoxy] phenyl] glutaramic acid (0.57 g, 1.0 mmol), 2-fluorobenzylamine (0.14 ml, 1.2 mmol), diethyl cyanophosphate (0.17 ml, 1.2 mmol), triethylamine (0.17 ml ,
A mixture of 1.2 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N'- (2-fluorobenzyl)
Glutaramide (1.14 g, 91.9%) was obtained as an amorphous solid. Elemental analysis: C ₄₃ H ₄₄ N ₃ O ₅ F · 1 / 2H ₂ O Theoretical: C, 72.66; H, 6.38; N, 5.91. Found: C, 72.56; H, 6.23; N, 5.9.1. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (9H, s), 1.90-2.01 (4H, m), 2.
19-2.28 (4H, m), 4.17 (2H, d, J = 5.4Hz), 4.43 (2H, d,
J = 5.8Hz), 4.67 (1H, d, J = 14.2Hz), 5.05 (1H, bs), 5.0
9 (1H, d, J = 14.2Hz), 6.26 (1H, bs), 6.68-6.71 (2H,
m), 6.85 (1H, d, J = 8.2Hz), 6.97-7.10 (5H, m), 7.18-
7.56 (13H, m). (4) N- (4-biphenylmethyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N '-(2-
(Fluorobenzyl) glutaramide (0.47 g, 0.7 mmol)
A 2N hydrochloric acid ethyl acetate solution (20 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated crystals are collected by filtration, washed with ethyl ether, and N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N'-
(2-Fluorobenzyl) glutaramide hydrochloride (0.33 g,
(86.8%) of an amorphous solid. Elemental analysis: C ₃₈ H ₃₇ N ₃ O ₃ ClF.H ₂ O Theoretical: C, 69.55; H, 5.99; N, 6.40. Found: C, 69.63; H, 5.89; N, 6.3.3. ¹ H- NMR (DMSO-d ₆ ) δ: 1.76-1.87 (2H, m), 2.10-2.16 (4H,
m), 3.99 (2H, s), 4.25 (2H, d, J = 4.4Hz), 4.51 (1H,
d, J = 15.1Hz), 5.14 (1H, d, J = 15.1Hz), 6.83-6.90 (2H,
m), 7.11-7.63 (18H, m), 8.32-8.43 (3H, m).

Example 14 N- [2- [3- (2-aminoethyl) phenoxy] -4-chlorophenyl] -N- (4-biphenylmethyl) -N ′-(2-fluorobenzyl)
Succinamide hydrochloride (1) 4-chloro-2-fluoronitrobenzene (7.0 g, 40 mm
ol), N-tert-butoxycarbonyl-3-hydroxyphenethylamine (9.5 g, 40 mmol), potassium carbonate (5.5 g, 40 mmo
l) and N, N-dimethylformamide (100 ml)
Stirred at C for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 2- [3- (5-chloro-2
-Nitrophenoxy) phenyl] ethylcarbamic acid tert
An oil of -butyl ester (15.2 g, 96.6%) was obtained. Elemental analysis: C ₁₉ H ₂₁ N ₂ O ₅ Cl Theoretical: C, 58.09; H, 5.39; N, 7.13. Found: C, 57.93; H, 5.42; N, 6.84. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.82 (2H, t, J = 7.2H
z), 3.38 (2H, q, J = 7.2Hz), 4.58 (1H, bs), 6.92-6.96
(3H, m), 7.08 (1H, d, J = 7.6Hz), 7.15 (1H, dd, J = 2.2,
(8.8Hz), 7.18 (1H, m), 7.94 (1H, d, J = 8.8Hz). (2) 2- [3- (5-chloro-2-nitrophenoxy) phenyl] ethylcarbamic acid tert-butyl ester (14.7 g, 37.5
(mmol) in ethyl acetate (300 ml) was added 5% palladium on carbon (4.5 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The precipitated solid was collected by filtration to obtain a solid of 2- [3- (2-amino-5-chlorophenoxy) phenyl] ethylcarbamic acid tert-butyl ester (13.6 g, 100%). Elemental analysis C ₁₉ H ₂₃ N ₂ O ₃ theory as Cl:. C, 62.89; H , 6.39; N, 7.72 Found:. C, 62.79; H, 6.51; N, 7.48 1 H-NMR (CDCl 3 ) δ: 1.43 (9H, s), 2.77 (2H, t, J = 7.0H
z), 3.31-3.39 (2H, m), 4.10 (2H, bs), 4.59 (1H, bs),
6.76-6.85 (4H, m), 6.90-6.96 (2H, m), 7.21-7.30 (1H,
m).

(3) 2- [3- (2-amino-5-chlorophenoxy)
Phenyl] ethylcarbamic acid tert-butyl ester (3.
6 g, 10 mmol), 4-phenylbenzyl chloride (2.0 g, 10
mmol), potassium carbonate (1.0 g, 7.5 mmol) and N, N-dimethylformamide (30 ml) were stirred at room temperature for 12 hours, then the reaction solution was poured into water, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 2- [3- [2- (4-biphenylmethylamino) -5-chlorophenoxy] phenyl] ethylcarbamic acid tert-butyl ester (2.14 g, 40.5%). Prism crystals were obtained. Melting point: 108-109 ° C Elemental analysis: C ₃₂ H ₃₃ N ₂ O ₃ Cl Theoretical: C, 72.65; H, 6.29; N, 5.29. Found: C, 72.93; H, 6.01; N, 5.36. ¹ H -NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.78 (2H, t, J = 7.1H
z), 3.36 (2H, q, J = 7.1Hz), 4.40 (2H, d, J = 5.2Hz), 4.
54 (1H, bs), 4.68 (1H, bs), 6.62 (1H, d, J = 8.8Hz), 6.80
(1H, d, J = 2.2Hz), 6.85-6.92 (2H, m), 6.95 (2H, dd, J
= 2.2,8.8Hz), 7.23-7.48 (6H, m), 7.55-7.60 (4H, m). (4) 2- [3- [2- (4-biphenylmethylamino) -5-chlorophenoxy] phenyl ] Ethylcarbamic acid tert-butyl ester (3.7 g, 7.0 mmol), ethylsuccinyl chloride
(1.5 ml, 10.5 mmol), 4-dimethylaminopyridine (1.28
g, 10.5 mmol) and tetrahydrofuran (30 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4
An oil was obtained of -biphenylmethyl) -N- [2- [3- (2-tert-butoxycarbonylaminoethyl) phenoxy] -4-chlorophenyl] succinamic acid ethyl ester (4.38 g, 95.2%). Elemental analysis: C ₃₈ H ₄₁ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 68.51; H, 6.35; N, 4.20. Found: C, 68.48; H, 6.52; N, 4.00. ¹ H-NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.0Hz), 1.43 (9H,
s), 2.40-2.76 (6H, m), 3.27-3.30 (2H, m), 4.07-4.19 (2
H, m), 4.60 (1H, bs), 4.73 (1H, d, J = 14.6Hz), 5.05
(1H, d, J = 14.6Hz), 6.64-6.67 (2H, m), 6.77 (1H, d, J
= 2.2Hz), 6.97-7.04 (3H, m), 7.08-7.59 (10H, m).

(5) N- (4-biphenylmethyl) -N- [2- [3- (2-
tert-butoxycarbonylaminoethyl) phenoxy] -4-
Chlorophenyl] succinamidic acid ethyl ester (3.9
g, 6.0 mmol) in a solution of tetrahydrofuran (10 ml) and ethanol (10 ml) in 1N aqueous sodium hydroxide solution (12 m
1, 12 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give N-
An amorphous solid of (4-biphenylmethyl) -N- [2- [3- (2-tert-butoxycarbonylaminoethyl) phenoxy] -4-chlorophenyl] succinamic acid (3.75 g, 99.5%) was obtained. Elemental analysis: C ₃₆ H ₃₇ N ₂ O ₆ Cl ・ 1 / 4H ₂ O Theoretical: C, 68.24; H, 5.97; N, 4.42. Found: C, 68.27; H, 5.96; N, 4.46. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.29-2.70 (6H, m), 3.
20-3.42 (2H, m), 4.52 (2H, d, J = 14.6Hz), 4.71 (1H, b
s), 4.74 (1H, d, J = 14.6Hz), 6.30 (1H, bs), 6.68-7.10
(5H, m), 7.26-7.59 (11H, m). (6) N- (4-biphenylmethyl) -N- [2- [3- (2-tert-butoxycarbonylaminoethyl) phenoxy] -4- [Chlorophenyl] succinamic acid (1.3 g, 2.0 mmol), 2-fluorobenzylamine (0.27 ml, 2.4 mmol), diethyl cyanophosphate (0.33 ml, 2.4 mmol), triethylamine (0.33 ml,
A mixture of 2.4 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [3- (2-tert-butoxycarbonylaminoethyl) phenoxy] -4-chlorophenyl ] -N '-(2-fluorobenzyl) succinamide (1.10 g, 74.8%) was obtained as an amorphous solid. Elemental analysis _{C 43 H 43 N 3 O 5} ClF theoretically:. C, 70.15; H, 5.89; N, 5.71 Found:. C, 70.09; H, 5.82; N, 5.50 1 H-NMR (CDCl 3 ) δ: 1.41 (9H, s), 2.41-2.73 (6H, m), 3.
26-3.29 (2H, m), 4.46 (2H, d, J = 6.0Hz), 4.65-4.78 (2
H, m), 5.01 (1H, d, J = 13.6Hz), 6.46 (1H, bs), 6.62-6.
74 (3H, m), 7.00-7.08 (5H, m), 7.18-7.58 (12H, m). (7) N- (4-biphenylmethyl) -N- [2- [3- (2-tert- Butoxycarbonylaminoethyl) phenoxy] -4-chlorophenyl] -N '-(2-fluorobenzyl) succinamide (0.74
g, 1.0 mmol) in 2N hydrochloric acid in ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated crystals were collected by filtration, washed with ethyl ether, and N- [2- [3-
(2-aminoethyl) phenoxy] -4-chlorophenyl] -N- (4
A prism of -biphenylmethyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (0.66 g, 98.5%) was obtained. Melting point 123-125 ° C Elemental analysis: C ₃₈ H ₃₆ N ₃ O ₃ Cl ₂ F Theoretical: C, 67.86; H, 5.39; N, 6.25. Found: C, 67.55; H, 5.59; N, 6.29. ¹ H-NMR (DMSO-d ₆ ) δ: 2.30-2.52 (4H,
m), 2.88-3.09 (4H, m), 4.3
6 (2H, s), 4.55 (1H, d, J = 1
4.8 Hz), 5.12 (1H, d, J = 14.
8Hz), 6.79-6.87 (2H, m),
6.94-7.63 (18H, m), 8.04 (2
H, bs), 8.42 (1H, bs).

Example 15 N- [2- (4-aminomethylphenoxy) phenyl] -N
-(4-biphenylmethyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (1) 2-fluoronitrobenzene (1.1 g, 10 mmol), p-hydroxyphenylacetic acid methyl ester (1.7 g, 10 mmol)
And a mixture of potassium carbonate (1.4 g, 10 mmol) was stirred at 140 ° C. for 1 hour. The reaction mixture was diluted with ethyl acetate, washed with water, and dried over anhydrous magnesium sulfate. Concentration under reduced pressure provided an oil of 4- (2-nitrophenoxy) phenylacetic acid methyl ester (2.78 g, 96.9%). ¹ H-NMR (CDCl ₃ ) δ: 3.67 (2H, s), 3.70 (3H, s), 6.99 (2
H, d, J = 8.0Hz), 7.02 (1H, d, J = 8.0Hz), 7.19 (1H, t,
J = 8.0Hz), 7.28 (2H, d, J = 8.4Hz), 7.50 (1H, t, J = 8.0H
z), 7.94 (1H, d, J = 8.0 Hz). (2) 4- (2-Nitrophenoxy) phenylacetic acid methyl ester (2.7 g, 9.3 mmol) in tetrahydrofuran (50 ml) and methanol (150 ml) To the solution was added a 1N aqueous solution of sodium hydroxide (41.7 ml, 41.7 mmol). The resulting mixture was stirred at 40 C for 1 hour. Water and potassium hydrogen sulfate (5.68 g, 41.7 mmol) were added to the reaction solution, and the mixture was extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the obtained solid was
Recrystallization from hexane gave crystals of 4- (2-nitrophenoxy) phenylacetic acid (1.83 g, 71.8%). Mp 109-111 ° C. Elemental analysis C ₁₄ H ₁₁ NO ₅ theoretically:. C, 61.54; H, 4.06; N, 5.13 Found:. C, 61.54; H, 4.08; N, 5.03 1 H-NMR ( CDCl ₃ ) δ: 3.62 (2H, s), 7.01 (2H, d, J = 8.8H
z), 7.04 (1H, d, J = 8.2Hz), 7.20 (1H, t, J = 8.2Hz), 7.
30 (2H, d, J = 8.8Hz), 7.50 (1H, t, J = 8.2Hz), 7.92 (1H,
d, J = 8.2Hz).

(3) To a solution of [4- (2-nitrophenoxy) phenyl] acetic acid (0.42 g, 1.5 mmol) in tert-butanol (4 ml) was added diphenylphosphoryl azide (0.398 ml, 1.85 mmol). After stirring the reaction mixture at room temperature, it was stirred at 90 ° C. for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract is water, 1N aqueous sodium hydroxide,
After sequentially washing with water, the extract was dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and recrystallized from ethyl acetate-hexane to give [4- (2-nitrophenoxy) benzyl] carbamic acid t
Crystals of ert-butyl ester (0.128 g, 24.2%) were obtained. Melting point: 89-90 ° C Elemental analysis: C ₁₈ H ₂ 0N ₂ O ₅ Theoretical: C, 62.78; H, 5.85; N, 8.13. Found: C, 62.71; H, 5.77; N, 8.43. ¹ H- NMR (CDCl ₃ ) δ: 1.47 (9H, s), 4.30 (2H, d, J = 6.4H
z), 4.85 (1H, bs), 6.98-7.03 (3H, m), 7.20 (1H, t, J =
7.6Hz), 7.30 (2H, t, J = 8.6Hz), 7.50 (1H, d, J = 7.6H
z), 7.95 (1H, d, J = 7.6Hz). (4) [4- (2-nitrophenoxy) benzyl] carbamic acid t
ert-butyl ester (1.43 g, 4.15 mmol) in ethanol
To the (20 ml) solution was added 10% palladium on carbon (0.2 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions.
The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. An oil of [4- (2-aminophenoxy) benzyl] carbamic acid tert-butyl ester (1.13 g, 86.9%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.45 (9H, s), 3.78 (2H, bs), 4.25 (2
(H, d, J = 5.8Hz), 4.84 (1H, bs), 6.66-7.35 (8H, m).

(5) [4- (2-Aminophenoxy) benzyl] carbamic acid tert-butyl ester (2.10 g, 6.66 mmol),
4-phenylbenzaldehyde (1.21 g, 6.66 mmol), acetic acid
(0.458 ml) and ethanol (30 ml) was stirred at room temperature for 30 minutes, and then sodium cyanoborohydride (1.8 g, 10
mmol) was added. After stirring at 60 ° C. for 1 hour, sodium cyanoborohydride (1.8 g, 10 mmol) was further added,
Stirred at 60 ° C. for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain crystals of [4- [2- (4-biphenylmethylamino) phenoxy] benzyl] carbamic acid tert-butyl ester (0.488 g, 15.3%). 138-140 ° C ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 4.27 (2H, d, J = 5.8H
z), 4.42 (2H, d, J = 5.8Hz), 4.65 (1H, t, J = 5.8Hz), 4.
80 (1H, bs), 6.62-7.60 (17H, m). (6) [4- [2- (4-biphenylmethylamino) phenoxy] benzyl] carbamic acid tert-butyl ester (0.411 g,
To a solution of 0.855 mmol) in ethyl acetate (5 ml) was added a 1 N aqueous solution of sodium hydroxide (5.14 ml. 5.14 mmol) and ethyl succinyl chloride (0.357 g, 2.17 mmol). 1 at room temperature
Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2-
[4- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamic acid ethyl ester (0.426
g, 81.9%). ¹ H-NMR (CDCl ₃ ) δ: 1.28 (3H, t, J = 7.0 Hz), 1.47 (9H,
s), 2.46-2.76 (4H, m), 4.13 (2H, q, J = 7.0Hz), 4.23 (2
H, d, J = 6.6Hz), 4.78 (1H, d, J = 14.2Hz), 4.80 (1H, b
s), 5.04 (1H, d, J = 14.2Hz), 6.73-7.55 (17H, m).

(7) N- (4-biphenylmethyl) -N- [2- [4- (te
rt-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamic acid ethyl ester (0.37 g, 0.61
mmol) in tetrahydrofuran (4 ml) and methanol (12 ml)
1N aqueous sodium hydroxide solution (2.71 ml, 2.71
mmol) was added. The resulting mixture was stirred at 60 C for 2 hours. Add water and potassium hydrogen sulfate (0.37 g, 2.7 mmo
l) was added and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure to obtain a non-crystalline solid of N- (4-biphenylmethyl) -N- [2- [4- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] succinamidic acid (0.35 g, 99.4%). Obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 2.46-2.71 (4H, m), 4.
22 (2H, d, J = 5.6Hz), 4.78 (1H, d, J = 14.6Hz), 4.82 (1H,
bs), 5.05 (1H, d, J = 14.6Hz), 6.71-7.55 (17H, m). (8) N- (4-biphenylmethyl) -N- [2- [4- (tert-butoxycarbonylamino) Methyl) phenoxy] phenyl] succinamic acid (0.25 g, 0.43 mmol), 2-fluorobenzylamine (0.0542 ml, 0.474 mmol), diethyl cyanophosphate
(0.0774 ml, 0.517 mmol), triethylamine (0.0721 ml,
0.517 mmol) and N, N-dimethylformamide (3 ml) were stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (4-biphenylmethyl) -N- [2- [4- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N'- An amorphous solid of (2-fluorobenzyl) succinamide (50 mg, 17%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.45 (9H, s), 2.47-2.62 (4H, m),
4.21 (2H, d, J = 5.8Hz), 4.46 (2H, d, J = 6.0Hz), 4.75 (1
H, d, J = 14.4Hz), 4.85 (1H, bs), 5.01 (1H, d, J = 14.4H
z), 6.71-7.54 (22H, m).

(9) N- (4-biphenylmethyl) -N- [2- [4- (te
rt-butoxycarbonylaminomethyl) phenoxy] phenyl] -N '-(2-fluorobenzyl) succinamide (50 mg,
0.073 mmol) of 2N hydrochloric acid in ethyl acetate (2 ml) was stirred at room temperature for 1 hour. The reaction solution is concentrated under reduced pressure, and N- [2- (4-aminomethylphenoxy) phenyl] -N- (4-biphenylmethyl) -N '-(2-fluorobenzyl) succinamide hydrochloride (2
(3 mg, 45%). ¹ H-NMR (DMSO-d ₆ ) δ: 2.06-2.30 (4H, m), 3.75-3.83 (3H,
m), 4.08 (2H, d, J = 6.0Hz), 4.30 (1H, d, J = 15.0Hz),
4.90 (1H, d, J = 15.0Hz), 6.63-7.42 (21H, m), 8.20 (3H,
bs).

In the following examples, HPLC was measured under the following conditions. Measurement equipment: Shimadzu Corporation LC-10Avp system Column: CAPCELL PAK C18UG120, S-3 μm, 2.0 X 50 m
m solvent: solution A; water containing 0.1% trifluoroacetic acid, solution B;
Acetonitrile containing 0.1% trifluoroacetic acid Gradient cycle: 0.00 min (Solution A / Solution B = 90 /
10), 4.00 minutes (Solution A / Solution B = 5/95), 5.50 minutes (A
Solution / B solution = 5/95), 5.51 min (Solution A / B solution = 90/1)
0), 8.00 min (Solution A / Solution B = 90/10) Injection volume: 2 μl, Flow rate: 0.5 ml / min Detection method: UV 220 nm In the following examples, mass spectrum (MASS) was measured under the following conditions. . Measuring instrument: Micromass Platform II Ionization method: Atmospheric pressure chemical ionization method (Atomosperic Pr
(essure Chemical Ionization: APCI)

Example 16 1N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N'-benzylsuccinamide trifluoroacetate 1) p-nitrophenoxycarbonyl wang p-hydroxymethylphenoxymethyl Polystyrene (hereinafter abbreviated as Wang) (Polymer Laboratories, 250-
300 μm, 1.7 mmol / g) (1.00 g, 1.7 mmol) was suspended in a mixed solution of dichloromethane (15 ml) and pyridine (1.65 ml), and then p-nitrophenyl chloroformate (1.03 g,
5.11 mmol) and N, N-diisopropylethylamine
(0.86 ml, 5.11 mmol) was added. After stirring these mixtures at room temperature for 20 hours, the solvent was removed by filtration. The obtained resin is N, N-dimethylformamide, tetrahydrofuran,
After washing with methanol three times, drying under reduced pressure
p-Nitrophenoxycarbonyl wang (1.44 g) was obtained. Elemental analysis actual measured value: N, 1.77, the supported amount per 1 g of resin was determined to be 1.26 mmol / g. IR (KBr): 1767 cm ^-1 2) 3- (2-nitrophenoxy) benzylcarbamic acid wing ester p-nitrophenoxycarbonyl resin (1.35 g, 1.70 m
mol), 3- (2-nitrophenoxy) benzylamine (1.16
g, 4.75 mmol), N, N-diisopropylethylamine (0.
8 ml, 4.75 mmol), N, N-dimethylformamide (10 m
After the mixture of 1) was stirred at room temperature for 67 hours, the solvent was removed by filtration. The obtained resin was washed three times each with N, N-dimethylformamide, tetrahydrofuran, and methanol, and dried under reduced pressure to obtain 3- (2-nitrophenoxy) benzylcarbamic acid wang ester (1.5 g). Got
3- (2-Nitrophenoxy) benzylcarbamic acid wangster (5 beads) is treated with trifluoroacetic acid-dichloromethane (3: 1, 50 μl) to cut out 3- (2-nitrophenoxy) benzylamine from the resin, HPLC analysis was performed. HPLC analysis (220 nm): 92% purity (retention time: 2.271
Minutes)

3) 3- (2-Aminophenoxy) benzylcarbamic acid wing ester 3- (2-nitrophenoxy) benzylcarbamic acid wangster (1.3 g, 1.4 mmol) was converted to 2 M tin (II) N,
Suspend in N-dimethylformamide solution (20 ml)
Stirred for hours. The solvent is removed by filtration, and the obtained resin is washed with N, N-dimethylformamide, tetrahydrofuran, and methanol three times each, dried under reduced pressure, and 3- (2-aminophenoxy) benzylcarbamic acid wing ester
(1.4 g) was obtained. The resulting 3- (2-aminophenoxy) benzylcarbamic acid wangster (5 beads) is treated with trifluoroacetic acid-dichloromethane (3: 1, 50 μl), and 3- (2-aminophenoxy) benzylamine is obtained from the resin. Was cut out and subjected to HPLC analysis. HPLC analysis (220 nm): Purity
94% (retention time: 0.642 min) 4) 3- (2-benzylaminophenoxy) benzylcarbamic acid wangster 3- (2-aminophenoxy) benzylcarbamic acid wangster (100 mg, 0.11 mmol) containing 1% acetic acid After suspending in an N, N-dimethylformamide solution (3 ml), benzaldehyde (0.56 ml, 5.5 mmol) was added, and the mixture was stirred at room temperature for 1 hour. In addition, sodium cyanoborohydride (346 mg,
55 mmol) and stirred at room temperature for 15 hours. The solvent was removed by filtration, and the obtained resin was washed three times each with 1% acetic acid-containing N, N-dimethylformamide, tetrahydrofuran, and methanol, and then dried under reduced pressure to obtain 3- (2-benzylaminophenoxy) benzylcarbamic acid. Wang ester (10
0 mg). The obtained 3- (2-benzylaminophenoxy) benzylcarbamic acid wangster (5 beads)
Was treated with trifluoroacetic acid-dichloromethane (3: 1, 50 μl) to cut out 3- (2-benzylaminophenoxy) benzylamine from the resin, and subjected to HPLC analysis and mass spectrometry. HPLC analysis (220 nm): 93% purity (retention time: 2.772
^{Minute) MASS (APCI -): 303} (M-1)

5) N-benzyl-N- [2- (3-wangcarbonylaminomethyl) phenoxy] phenylsuccinamic acid ethyl ester 3- (2-benzylaminophenoxy) benzylcarbamic acid wang ester (200 mg, 0.22 mmol), ethyl succinyl chloride (362 mg, 2.2 mmol), pyridine (348 mg,
A mixture of 4.4 mmol) and N, N-dimethylformamide (3 ml) was stirred at room temperature for 15 hours. The solvent was removed by filtration, and the obtained resin was washed with N, N-dimethylformamide, a mixed solution of N, N-dimethylformamide-water (1: 1), N, N-dimethylformamide, tetrahydrofuran, and methanol, respectively.
After washing each time, it was dried under reduced pressure to obtain N-benzyl-N- [2- (3-wangcarbonylaminomethyl) phenoxy] phenylsuccinamic acid ethyl ester (200 mg). The obtained N-benzyl-N- [2- (3-wangcarbonylaminomethyl) phenoxy] phenylsuccinamic acid ethyl ester (5 beads) was treated with trifluoroacetic acid-dichloromethane.
(3: 1, 50 μl) and treated with N-benzyl-N- [2- (3
[-Aminomethyl) phenoxy] phenylsuccinamic acid ethyl ester was cut out and subjected to HPLC analysis and mass spectrum measurement. HPLC analysis (220 nm): 90% purity (retention time: 2.984
Min) MASS (APCI ⁺ ): 433 (M + 1) 6) N-benzyl-N- [2- (3-wangcarbonylaminomethyl) phenoxy] phenylsuccinamidate N-benzyl-N- [2- (3- Wangcarbonylaminomethyl) phenoxy] phenylsuccinamic acid ethyl ester
(200 mg, 0.22 mmol), 1N aqueous sodium hydroxide
(2.2 ml, 2.2 mmol) and a mixture of tetrahydrofuran (2.2 ml) were stirred at room temperature for 17 hours. The solvent was removed by filtration, and the obtained resin was treated with tetrahydrofuran, tetrahydrofuran-
Acetic acid (1: 1) mixed solution, tetrahydrofuran-water (1: 1)
After washing three times each with the mixed solution, tetrahydrofuran, and methanol, drying under reduced pressure was performed to obtain N-benzyl-N- [2- (3-
Wang carbonylaminomethyl) phenoxy] phenylsuccinamic acid (200 mg) was obtained. N-benzyl obtained
-N- [2- (3-Wangcarbonylaminomethyl) phenoxy]
Phenylsuccinamic acid (5 beads) is treated with trifluoroacetic acid-dichloromethane (3: 1, 50 μl) and N-benzyl-N- [2- (3-aminomethyl) phenoxy] phenylsuccinamide is obtained from the resin. The acid was cut out and subjected to HPLC analysis and mass spectrum measurement. HPLC analysis (220 nm): 92% purity (retention time: 2.623
Minute) MASS (APCI ⁺ ): 405 (M + 1)

7) N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N'-benzylsuccinamide trifluoroacetate N-benzyl-N- [2- (3-wangcarbonylamino Methyl) phenoxy] phenylsuccinamic acid (100 mg), benzylamine (0.12 ml, 1.1 mmol), BOP reagent (487 mg, 1.1
mmol), N, N-diisopropylethylamine (0.19 ml,
A mixture of 1.1 mmol) and N, N-dimethylformamide (1 ml) was stirred at room temperature for 17 hours. The solvent is removed by filtration, and the obtained resin is washed with N, N-dimethylformamide, a mixed solution of N, N-dimethylformamide-water (1: 1), N, N-dimethylformamide, tetrahydrofuran, and methanol three times each. After drying under reduced pressure, N- [2- (3-Wangcarbonylaminomethylphenoxy) phenyl] -N-benzyl-N'-
Benzyl succinamide (100 mg) was obtained. Obtained N-
[2- (3-Wangcarbonylaminomethylphenoxy) phenyl] -N-benzyl-N'-benzylsuccinamide (47 m
g) in trifluoroacetic acid-dichloromethane (3: 1, 1 ml)
And treated with N- [2- (3-aminomethylphenoxy) phenyl]
-N-benzyl-N'-benzylsuccinamide trifluoroacetate (15 mg) was obtained. HPLC analysis (220 nm): 91% purity (retention time: 3.022
Min) MASS (APCI ⁺ ): 494 (M + 1) ¹ H-NMR (CDCl3) δ: 2.40-2.60 (4H, m), 3.83 (2H, s),
4.37 (2H, d, J = 5.8Hz), 4.55 (1H, d, J = 14.4 Hz),
5.17 (1H, 14.4Hz), 6.60-6.70 (1H, m), 6.70-7.30 (1
8H, m). The following compounds were produced in the same manner as in Example 16.

Example 17 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 26 mg HPLC analysis (220 nm): Purity 87% (Retention time: 3.189
Min) MASS (APCI ⁺ ): 512 (M + 1) Example 18 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N '-(2,6-difluorobenzyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 88% pure (retention time: 3.186
Minute) MASS (APCI ⁺ ): 530 (M + 1)

Example 19 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(3,4-difluorobenzyl) succinamide trifluoroacetic acid salt Yield: 25 mg HPLC analysis (220 nm ): 89% purity (retention time: 3.261
Min) MASS (APCI ⁺ ): 530 (M + 1) Example 20 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N ′-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 86% purity (retention time: 3.369
Min) MASS (APCI ⁺ ): 562 (M + 1)

Example 21 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(4-methoxybenzyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 86% purity (retention time: 3.160
Min) MASS (APCI ⁺ ): 524 (M + 1) Example 22 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N '-[2- (2,4-dichlorophenethyl)] succinamide
Trifluoroacetate yield: 28 mg HPLC analysis (220 nm): 86% purity (retention time: 3.490
Min) MASS (APCI ⁺ ): 576 (M + 1), 578 (M + 3)

Example 23 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 26 mg HPLC analysis (220 nm): Purity 88% (Retention time: 3.374
Min) MASS (APCI ⁺ ): 544 (M + 1) Example 24 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N '-(1-indanyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 81% purity (retention time: 3.296
Minute) MASS (APCI ⁺ ): 520 (M + 1)

Example 25 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(3-pyridylmethyl) succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm): Purity 84% (Retention time: 2.497
Min) MASS (APCI ⁺ ): 495 (M + 1) Example 26 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N '-(1,2,3,4-tetrahydroisoquinolino ) Succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): Purity 79% (Retention time: 3.309
Minute) MASS (APCI ⁺ ): 520 (M + 1)

Example 27 N- [2- (3-Aminomethylphenoxy) phenyl] -N-benzyl-N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm ): 85% purity (retention time: 3.011
Min) MASS (APCI ⁺ ): 549 (M + 1) Example 28 N- [2- (3-aminomethylphenoxy) phenyl] -N-benzyl-N '-[2- (1-pyrrolidinoethyl)] succinamide tri Fluoroacetate yield: 27 mg HPLC analysis (220 nm): 71% purity (retention time: 3.548
Minute) MASS (APCI ⁺ ): 501 (M + 1)

Example 29 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 8.7 mg HPLC analysis (220 nm): 100% purity (retention time: 3.74
2 min) MASS (APCI ⁺ ): 604 (M + 1) Example 30 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-(2,6-difluorobenzyl ) Succinamide trifluoroacetate Yield: 7.9 mg HPLC analysis (220 nm): 100% purity (retention time: 3.73
6 minutes) MASS (APCI ⁺ ): 622 (M + 1)

Example 31 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-(3,4-difluorobenzyl) succinamide Trifluoroacetate Yield: 8.8 mg HPLC analysis (220 nm): 100% purity (retention time: 3.77
8 min) MASS (APCI ⁺ ): 604 (M + 1) Example 32 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-(2-trifluoromethylbenzyl )
Succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 99% pure (retention time: 3.864
Min) MASS (APCI ⁺ ): 654 (M + 1)

Example 33 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N '-(2-methoxybenzyl) succinamide trifluoroacetate Yield: 4.6 mg HPLC analysis (220 nm): 100% purity (retention time: 3.15
4 min) MASS (APCI ⁺ ): 616 (M + 1) Example 34 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-[2- (2,4 -Dichlorophenethyl)] succinamide trifluoroacetate Yield: 10 mg HPLC analysis (220 nm): 100% pure (retention time: 3.36
7 minutes) MASS (APCI ⁺ ): 668 (M + 1), 670 (M + 3)

Example 35 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 100% purity (retention time: 3.87
3 min) MASS (APCI ⁺ ): 636 (M + 1) Example 36 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N ′-(1-indanyl) succinamide
Trifluoroacetate yield: 10 mg HPLC analysis (220 nm): 99% purity (retention time: 3.813
Minute) MASS (APCI ⁺ ): 612 (M + 1)

Example 37 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N '-(2-pyridylmethyl) succinamide trifluoroacetate Yield: 7.1 mg HPLC analysis (220 nm): 99% purity (retention time: 3.147
Min) MASS (APCI ⁺ ): 587 (M + 1) Example 38 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N '-(1,2,3,4 -Tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 9.1 mg HPLC analysis (220 nm): 98% pure (retention time: 3.392
Min) MASS (APCI ⁺ ): 612 (M + 1)

Example 39 N- [2- (3-aminomethylphenoxy) phenyl] -N
-(4-phenoxybenzyl) -N '-(4-phenylpiperazino)
Succinamide trifluoroacetate Yield: 7.8 mg HPLC analysis (220 nm): 99% pure (retention time: 3.824
Min) MASS (APCI ⁺ ): 641 (M + 1) Example 40 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-phenoxybenzyl) -N '-[2- (1-pyrrolidino Ethyl)] succinamide trifluoroacetate Yield: 6.5 mg HPLC analysis (220 nm): 98% pure (retention time: 3.175
Min) MASS (APCI ⁺ ): 593 (M + 1)

Example 41 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): Purity 77% (Retention time: 3.596
Min) MASS (APCI ⁺ ): 568 (M + 1) Example 42 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(2,6-difluorobenzyl) succinamide trifluoroacetate Yield: 24 mg HPLC analysis (220 nm): Purity 80% (Retention time: 3.601
Minute) MASS (APCI ⁺ ): 586 (M + 1)

Example 43 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(3,4-difluorobenzyl) succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): Purity 72% (Retention time: 3.640
Min) MASS (APCI ⁺ ): 586 (M + 1) Example 44 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(2-trifluoromethylbenzyl)
Succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 82% purity (retention time: 3.739
Minutes)

Example 45 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(4-methoxybenzyl) succinamide trifluoroacetate Yield: 20 mg HPLC analysis (220 nm): Purity 75% (Retention time: 3.568
Min) MASS (APCI ⁺ ): 580 (M + 1) Example 46 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-[2- (2,4-dichlorophenethyl)] succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 85% pure (retention time: 3.868
Min) MASS (APCI ⁺ ): 632 (M + 1), 634 (M + 3)

Example 47 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 22 mg HPLC analysis (220 nm): 86% pure (retention time: 3.741
Min) MASS (APCI ⁺ ): 600 (M + 1) Example 48 N- [2- (3-aminomethylphenoxy) phenyl] -N
-(4-tert-butylbenzyl) -N '-(1-indanyl) succinamide trifluoroacetate Yield: 22 mg HPLC analysis (220 nm): Purity 71% (Retention time: 3.688
Minute) MASS (APCI ⁺ ): 576 (M + 1)

Example 49 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(3-pyridylmethyl) succinamide trifluoroacetate Yield: 24 mg HPLC analysis (220 nm): 78% pure (retention time: 2.963
Min) MASS (APCI ⁺ ): 551 (M + 1) Example 50 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 22 mg HPLC analysis (220 nm): Purity 72% (Retention time: 3.694
Minute) MASS (APCI ⁺ ): 576 (M + 1)

Example 51 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 81% pure (retention time: 3.436
Min) MASS (APCI ⁺ ): 605 (M + 1) Example 52 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-tert
-Butylbenzyl) -N '-[2- (1-pyrrolidinoethyl)] succinamide trifluoroacetate Yield: 7.4 mg HPLC analysis (220 nm): 99% pure (retention time: 3.004
Min) MASS (APCI ⁺ ): 557 (M + 1)

Example 53 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N ′-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 19 mg HPLC analysis (220 nm): 80% purity (retention time: 3.388
Min) MASS (APCI ⁺ ): 562 (M + 1) Example 54 N- [2- (3-aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(2,6-difluorobenzyl) Succinamide trifluoroacetate Yield: 20 mg HPLC analysis (220 nm): 80% pure (retention time: 3.390
Min) MASS (APCI ⁺ ): 580 (M + 1)

Example 55 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N ′-(3,4-difluorobenzyl) succinamide trifluoroacetate Yield: 20 mg HPLC analysis (220 nm): 77% purity (retention time: 3.445
Min) MASS (APCI ⁺ ): 580 (M + 1) Example 56 N- [2- (3-aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(2-trifluoromethylbenzyl) Succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): 74% pure (retention time: 3.544
Min) MASS (APCI ⁺ ): 612 (M + 1)

Example 57 N- [2- (3-Aminomethylphenoxy) phenyl] -N
-(1-Naphthylmethyl) -N '-(4-methoxybenzyl) succinamide trifluoroacetate Yield: 19 mg HPLC analysis (220 nm): Purity 80% (Retention time: 3.357
Min) MASS (APCI ⁺ ): 574 (M + 1) Example 58 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-[2- (2,4- Dichlorophenethyl)] succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): 79% purity (retention time: 3.662
Min) MASS (APCI ⁺ ): 626 (M + 1), 628 (M + 3)

Example 59 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N ′-(1-naphthylmethyl) succinamide
Trifluoroacetate yield: 21 mg HPLC analysis (220 nm): 76% pure (retention time: 3.554
Min) MASS (APCI ⁺ ): 594 (M + 1) Example 60 N- [2- (3-aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(1-indanyl) succinamide trifluoro Acetate yield: 21 mg HPLC analysis (220 nm): 76% pure (retention time: 3.481
Min) MASS (APCI ⁺ ): 570 (M + 1)

Example 61 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(3-pyridylmethyl) succinamide
Trifluoroacetate yield: 25 mg HPLC analysis (220 nm): 76% purity (retention time: 2.723
Min) MASS (APCI ⁺ ): 587 (M + 1) Example 62 N- [2- (3-aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(1,2,3,4 -Tetrahydroisoquinolino)
Succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 73% pure (retention time: 3.494
Min) MASS (APCI ⁺ ): 570 (M + 1)

Example 63 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 26 mg HPLC analysis (220 nm): 68% purity (retention time: 3.209
Min) MASS (APCI ⁺ ): 599 (M + 1) Example 64 N- [2- (3-aminomethylphenoxy) phenyl] -N- (1-naphthylmethyl) -N '-[2- (1-pyrrolidino Ethyl)] succinamide trifluoroacetate Yield: 24 mg HPLC analysis (220 nm): Purity 68% (Retention time: 2.763
Minute) MASS (APCI ⁺ ): 551 (M + 1)

Example 65 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 29 mg HPLC analysis (220 nm): Purity 76% (Retention time: 2.899
Min) MASS (APCI ⁺ ): 569 (M + 1) Example 66 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(2,6-difluorobenzyl) Succinamide trifluoroacetate Yield: 30 mg HPLC analysis (220 nm): 75% pure (retention time: 2.903
Min) MASS (APCI ⁺ ): 587 (M + 1)

Example 67 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N ′-(3,4-difluorobenzyl) succinamide Trifluoroacetate Yield: 29 mg HPLC analysis (220 nm): 76% purity (retention time: 2.976
Min) MASS (APCI ⁺ ): 587 (M + 1) Example 68 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(2-trifluoromethylbenzyl) Succinamide trifluoroacetate Yield: 29 mg HPLC analysis (220 nm): 75% pure (retention time: 3.100
Min) MASS (APCI ⁺ ): 619 (M + 1)

Example 69 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N ′-(4-methoxybenzyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 75% purity (retention time: 2.865
Min) MASS (APCI ⁺ ): 581 (M + 1) Example 70 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-[2- (2,4- Dichlorophenethyl)]
Succinamide trifluoroacetate Yield: 30 mg HPLC analysis (220 nm): 82% purity (retention time: 3.229
Min) MASS (APCI ⁺ ): 633 (M + 1), 635 (M + 3)

Example 71 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 29 mg HPLC analysis (220 nm): 79% purity (retention time: 3.106
Min) MASS (APCI ⁺ ): 601 (M + 1) Example 72 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(1-indanyl) succinamide trifluoro Acetate yield: 21 mg HPLC analysis (220 nm): 77% pure (retention time: 3.004
Minute) MASS (APCI ⁺ ): 576 (M + 1)

Example 73 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N ′-(3-pyridylmethyl) succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm): 83% purity (retention time: 2.237
Min) MASS (APCI ⁺ ): 552 (M + 1) Example 74 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(1,2,3,4 -Tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 27 mg HPLC analysis (220 nm): Purity 74% (Retention time: 3.028
Min) MASS (APCI ⁺ ): 577 (M + 1)

Example 75 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 32 mg HPLC analysis (220 nm): 78% purity (retention time: 2.723)
Min) MASS (APCI ⁺ ): 606 (M + 1) Example 76 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-acetamidobenzyl) -N ′-[2- (1-pyrrolidino Ethyl)] succinamide trifluoroacetate Yield: 29 mg HPLC analysis (220 nm): 74% pure (retention time: 2.283
Minute) MASS (APCI ⁺ ): 558 (M + 1)

Example 77 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 9.5 mg HPLC analysis (220 nm): 99% purity (retention time: 3.297
Min) MASS (APCI ⁺ ): 537 (M + 1) Example 78 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-(2,6-difluorobenzyl) Succinamide trifluoroacetate Yield: 12 mg HPLC analysis (220 nm): 99% pure (retention time: 3.297
Minutes) MASS (APCI ⁺ ): 555 (M + 1)

Example 79 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-(3,4-difluorobenzyl) succinamide trifluoroacetate Yield: 7.6 mg HPLC analysis (220 nm): 100% purity (retention time: 3.36
0 min) MASS (APCI ⁺ ): 555 (M + 1) Example 80 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-(2-trifluoromethylbenzyl ) Succinamide trifluoroacetate Yield: 12 mg HPLC analysis (220 nm): 91% purity (retention time: 3.481
Min) MASS (APCI ⁺ ): 587 (M + 1)

Example 81 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-(2-methoxybenzyl) succinamide trifluoroacetate Yield: 8.5 mg HPLC analysis (220 nm): 99% purity (retention time: 3.355
Min) MASS (APCI ⁺ ): 549 (M + 1) Example 82 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-[2- (2,4- Dichlorophenethyl)] succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 97% pure (retention time: 3.614
Minute) MASS (APCI ⁺ ): 601 (M + 1), 603 (M + 3)

Example 83 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-(1-naphthylmethyl) succinamide
Trifluoroacetate yield: 11 mg HPLC analysis (220 nm): 93% purity (retention time: 3.500
Min) MASS (APCI ⁺ ): 569 (M + 1) Example 84 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-(1-indanyl) succinamide trifluoro Acetate yield: 11 mg HPLC analysis (220 nm): 100% pure (retention time: 3.41
2 minutes) MASS (APCI ⁺ ): 545 (M + 1)

Example 85 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N '-(2-pyridylmethyl) succinamide
Trifluoroacetate yield: 8.8 mg HPLC analysis (220 nm): 100% purity (retention time: 2.66
4 min) MASS (APCI ⁺ ): 520 (M + 1) Example 86 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-(1,2,3, 4-tetrahydroisoquinolino)
Succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 99% pure (retention time: 3.438
Min) MASS (APCI ⁺ ): 545 (M + 1)

Example 87 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 12 mg HPLC analysis (220 nm): 100% purity (retention time: 3.16
3 min) MASS (APCI ⁺ ): 574 (M + 1) Example 88 N- [2- (3-aminomethylphenoxy) phenyl] -N- (4-cyanobenzyl) -N ′-[2- (1-pyrrolid) Dinoethyl)] succinamide trifluoroacetate Yield: 8.7 mg HPLC analysis (220 nm): 99% pure (retention time: 2.682
Minute) MASS (APCI ⁺ ): 525 (M + 1)

Example 89 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 9.0 mg HPLC analysis (220 nm): 98% purity (retention time: 3.331
Min) MASS (APCI ⁺ ): 601 (M + 1) Example 90 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
(Trimethoxybenzyl) -N '-(2,6-difluorobenzyl)
Succinamide trifluoroacetate Yield: 10 mg HPLC analysis (220 nm): 98% pure (retention time: 3.329
Min) MASS (APCI ⁺ ): 620 (M + 1)

Example 91 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
(Trimethoxybenzyl) -N '-(3,4-difluorobenzyl)
Succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 97% pure (retention time: 3.369
Min) MASS (APCI ⁺ ): 620 (M + 1) Example 92 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 8.7 mg HPLC analysis (220 nm): Purity 99% (Retention time: 3.509
Min) MASS (APCI ⁺ ): 652 (M + 1)

Example 93 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(2-methoxybenzyl) succinamide trifluoroacetate Yield: 3.9 mg HPLC analysis (220 nm): 98% pure (retention time: 3.359
Min) MASS (APCI ⁺ ): 614 (M + 1) Example 94 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-[2- (2,4-dichlorophenethyl)] succinamide trifluoroacetate Yield: 9.6 mg HPLC analysis (220 nm): Purity 98% (Retention time: 3.629
Minute) MASS (APCI ⁺ ): 666 (M + 1), 668 (M + 3)

Example 95 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 96% pure (retention time: 3.511
Min) MASS (APCI ⁺ ): 634 (M + 1) Example 96 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(1-indanyl) succinamide trifluoroacetate Yield: 6.4 mg HPLC analysis (220 nm): Purity 97% (Retention time: 3.397
Min) MASS (APCI ⁺ ): 610 (M + 1)

Example 97 N- [2- (3-Aminomethylphenoxy) phenyl] -N
-(3,4,5-trimethoxybenzyl) -N '-(2-pyridylmethyl) succinamide trifluoroacetate Yield: 5.5 mg HPLC analysis (220 nm): 99% pure (retention time: 2.666
Min) MASS (APCI ⁺ ): 585 (M + 1) Example 98 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 5.9 mg HPLC analysis (220 nm): Purity 94% (Retention time: 3.421
Minutes) MASS (APCI ⁺ ): 610 (M + 1)

Example 99 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 7.3 mg HPLC analysis (220 nm): 100% purity (retention time: 3.15
2 min) MASS (APCI ⁺ ): 639 (M + 1) Example 100 N- [2- (3-aminomethylphenoxy) phenyl] -N- (3,4,5-
Trimethoxybenzyl) -N '-[2- (1-pyrrolidinoethyl)]
Succinamide trifluoroacetate yield: 5.1 mg HPLC analysis (220 nm): 98% purity (retention time: 2.721
Minute) MASS (APCI ⁺ ): 591 (M + 1)

Example 101 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(2-fluorobenzoyl) succinamide trifluoroacetate Yield: 9.5 mg HPLC analysis (220 nm): 99% purity (retention time: 3.774
Min) MASS (APCI ⁺ ): 600 (M + 1) Example 102 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(2,6-difluoro Benzyl) succinamide trifluoroacetate Yield: 10 mg HPLC analysis (220 nm): 99% pure (retention time: 3.775
Minute) MASS (APCI ⁺ ): 618 (M + 1)

Example 103 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(3,4-difluorobenzyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 100% purity (retention time: 3.88
2 min) MASS (APCI ⁺ ): 618 (M + 1) Example 104 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N ′-(2-trifluoro Methyl benzyl)
Succinamide trifluoroacetate Yield: 12 mg HPLC analysis (220 nm): 99% purity (retention time: 3.902
Min) MASS (APCI ⁺ ): 650 (M + 1)

Example 105 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(2-methoxybenzyl) succinamide trifluoroacetate Yield: 8.0 mg HPLC analysis (220 nm): 99% purity (retention time: 3.794
Min) MASS (APCI ⁺ ): 612 (M + 1) Example 106 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-[2- (2, 4-Dichlorophenethyl)] succinamide trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): 99% pure (retention time: 4.011
Min) MASS (APCI ⁺ ): 664 (M + 1), 666 (M + 3)

Example 107 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(1-naphthylmethyl) succinamide trifluoroacetate Yield: 8.6 mg HPLC analysis (220 nm): 99% purity (retention time: 3.916
Min) MASS (APCI ⁺ ): 632 (M + 1) Example 108 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(1-indanyl) succinamide
Trifluoroacetate yield: 11 mg HPLC analysis (220 nm): 100% pure (retention time: 3.85
8 minutes) MASS (APCI ⁺ ): 608 (M + 1)

Example 109 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N ′-(2-pyridylmethyl) succinamide Trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): 100% purity (retention time: 3.17
6 min) MASS (APCI ⁺ ): 583 (M + 1) Example 110 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N ′-(1,2, 3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 97% pure (retention time: 3.867
Minute) MASS (APCI ⁺ ): 608 (M + 1)

Example 111 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 96% purity (retention time: 3.610
Min) MASS (APCI ⁺ ): 637 (M + 1) Example 112 N- [2- (3-aminomethylphenoxy) phenyl] -N- (2-fluorenylmethyl) -N '-[2- (1- Pyrrolidinoethyl)] succinamide trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.17
9 minutes) MASS (APCI ⁺ ): 589 (M + 1) 1

Example 113 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2'-
Methylphenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate N- (4-bromobenzyl) -N- [2- (3-wangcarbonylaminomethyl) phenoxy] -N'-(2 2-Fluorophenyl) succinamic acid (50 mg) in DMF (4 ml) An aqueous solution (0.28 ml) was added. Mix at 80-C 22
Stirred for hours. The solvent was removed by filtration, and the obtained resin was washed with N, N-dimethylformamide, N, N-dimethylformamide-water (1:
1) After washing three times each with the mixed solution, N, N-dimethylformamide, tetrahydrofuran, and methanol, drying under reduced pressure, N- [2- (3-wangcarbonylaminomethylphenoxy) phenyl] -N- (4- (2'-methylphenyl) benzyl) -N'-
(2-Fluorobenzyl) succinamide was obtained. The obtained resin is trifluoroacetic acid-dichloromethane (3: 1, 1 ml)
And treated with N- [2- (3-aminomethylphenoxy) phenyl]
-N- [4- (2'-methylphenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate (22 m
g) was obtained. HPLC analysis (220 nm): 93% purity (retention time: 4.346
Min) MASS (APCI ⁺ ): 602 (M + 1) ¹ H-NMR (CDCl ₃ ) d: 2.22 (3H, s), 2.30-2.40 (4H, m),
4.03 (2H, s), 4.21 (2H, t, J = 6.6 Hz), 4.41 (1H, d,
J = 14.2 Hz), 5.31 (1H, d, J = 14.2 Hz), 6.90-7.40 (20
H, m) The following compounds were produced as in Example 113.

Example 114 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2′-
Methylphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): Purity 83% (Retention time: 4.449
Min) MASS (APCI ⁺ ): 652 (M + 1) ¹ H-NMR (CDCl ₃ ) d: 2.22 (3H, s), 2.30-2.55 (4H, m),
4.02 (2H, s), 4.34 (2H, m), 4.39 (1H, d, J = 14.6 H
z), 5.32 (1H, d, J = 14.6 Hz), 6.85-7.70 (20H, m) Example 115 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2'-
Methylphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 24 mg HPLC analysis (220 nm): 88% pure (retention time: 4.422
Min) MASS (APCI ⁺ ): 610 (M + 1)

Example 116 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2′-
Methylphenyl) benzyl] -N '-(4-phenylpiperazino)
Succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm): 81% purity (retention time: 3.423
Min) MASS (APCI ⁺ ): 639 (M + 1) Example 117 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2'-
Methylphenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 84% purity (retention time: 3.696
Min) MASS (APCI ⁺ ): 610 (M + 1)

Example 118 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2′-
Methoxyphenyl) benzyl] -N '-(2-fluorobenzyl)
Succinamide trifluoroacetate Yield: 1.8 mg HPLC analysis (220 nm): 98% pure (retention time: 4.220
Min) MASS (APCI ⁺ ): 618 (M + 1) Example 119 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2'-
[Methoxyphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 3.1 mg HPLC analysis (220 nm): 98% pure (retention time: 4.348
Min) MASS (APCI ⁺ ): 668 (M + 1)

Example 120 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2′-
[Methoxyphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 3.3 mg HPLC analysis (220 nm): 100% purity (retention time: 4.30
5 min) MASS (APCI ⁺ ): 626 (M + 1) Example 121 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2′-
[Methoxyphenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 4.1 mg HPLC analysis (220 nm): Purity 85% (Retention time: 3.597
Min) MASS (APCI ⁺ ): 655 (M + 1)

Example 122 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (2′-
[Methoxyphenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 3.3 mg HPLC analysis (220 nm): 89% purity (retention time: 3.329
Min) MASS (APCI ⁺ ): 626 (M + 1) Example 123 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4- (3'-
Thienyl) benzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 1.6 mg HPLC analysis (220 nm): Purity 100% (Retention time: 4.21
6 minutes) MASS (APCI ⁺ ): 594 (M + 1)

Example 124 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3'-
Thienyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 2.2 mg HPLC analysis (220 nm): Purity 100% (Retention time: 4.34
6 min) MASS (APCI ⁺ ): 644 (M + 1) Example 125 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Thienyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 1.7 mg HPLC analysis (220 nm): Purity 99% (Retention time: 4.289
Min) MASS (APCI ⁺ ): 602 (M + 1)

Example 126 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3′-
Thienyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 2.1 mg HPLC analysis (220 nm): Purity 92% (Retention time: 3.268
Min) MASS (APCI ⁺ ): 631 (M + 1) Example 127 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3'-
Thienyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 2.6 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.53
9 minutes) MASS (APCI ⁺ ): 602 (M + 1)

Example 128 N- [2- (3-Aminomethylphenoxy) phenyl] -N- (4- (benzofuran-2'-yl) benzyl) -N '-(2-fluorobenzyl) succinamide trifluoroacetic acid Salt yield: 1.3 mg HPLC analysis (220 nm): 99% purity (retention time: 4.408
Min) MASS (APCI ⁺ ): 628 (M + 1) Example 129 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (benzofuran-2'-yl) benzyl] -N ' -(2-Trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 1.0 mg HPLC analysis (220 nm): 98% purity (retention time: 4.513
Min) MASS (APCI ⁺ ): 678 (M + 1)

Example 130 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (benzofuran-2'-yl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 1.2 mg HPLC analysis (220 nm): 98% purity (retention time: 4.479
Min) MASS (APCI ⁺ ): 636 (M + 1) Example 131 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (benzofuran-2'-yl) benzyl] -N ' -(4-Phenylpiperazino) succinamide trifluoroacetate Yield: 1.6 mg HPLC analysis (220 nm): 99% pure (retention time: 3.528
Min) MASS (APCI ⁺ ): 665 (M + 1)

Example 132 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (benzofuran-2'-yl) benzyl] -N '-(1,2,3,4-tetrahydro Isoquinolino) succinamide trifluoroacetate Yield: 1.2 mg HPLC analysis (220 nm): 99% pure (retention time: 3.776
Min) MASS (APCI ⁺ ): 636 (M + 1) Example 133 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3'-
Trifluoromethylphenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): Purity 92% (Retention time: 4.420
Min) MASS (APCI ⁺ ): 656 (M + 1)

Example 134 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
[Trifluoromethylphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): 91% purity (retention time: 4.534
Min) MASS (APCI ⁺ ): 706 (M + 1) Example 135 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3'-
Trifluoromethylphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 26 mg HPLC analysis (220 nm): 90% pure (retention time: 4.491
Min) MASS (APCI ⁺ ): 664 (M + 1)

Example 136 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Trifluoromethylphenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 30 mg HPLC analysis (220 nm): Purity 81% (Retention time: 3.527
Min) MASS (APCI ⁺ ): 693 (M + 1) Example 137 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3'-
Trifluoromethylphenyl) benzyl] -N '-(1,2,3,4-
Tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 96% pure (retention time: 3.790
Min) MASS (APCI ⁺ ): 664 (M + 1)

Example 138 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4'-
Fluorophenyl) benzyl] -N '-(2-fluorobenzyl)
Succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 93% purity (retention time: 4.293
Min) MASS (APCI ⁺ ): 606 (M + 1) Example 139 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4'-
Fluorophenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 88% pure (retention time: 4.406
Min) MASS (APCI ⁺ ): 656 (M + 1)

Example 140 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4′-
Fluorophenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 87% pure (retention time: 4.365
Min) MASS (APCI ⁺ ): 614 (M + 1) Example 141 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4'-
Fluorophenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm): Purity 85% (Retention time: 3.356
Min) MASS (APCI ⁺ ): 643 (M + 1)

Example 142 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4′-
Fluorophenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 22 mg HPLC analysis (220 nm): Purity 80% (Retention time: 3.634
Min) MASS (APCI ⁺ ): 614 (M + 1) Example 143 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (1'-
Naphthyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): 94% pure (retention time: 4.437
Min) MASS (APCI ⁺ ): 638 (M + 1)

Example 144 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (1′-
Naphthyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 21 mg HPLC analysis (220 nm): Purity 94% (Retention time: 4.540
Min) MASS (APCI ⁺ ): 688 (M + 1) Example 145 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (1'-
Naphthyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 23 mg HPLC analysis (220 nm): 86% pure (retention time: 4.695
Min) MASS (APCI ⁺ ): 646 (M + 1)

Example 146 N- [2- (3-aminomethylphenoxy) phenyl] -N
-[4- (1'-Naphthyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 24 mg HPLC analysis (220 nm): 89% purity (retention time: 3.547
Min) MASS (APCI ⁺ ): 675 (M + 1) Example 147 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (1'-
Naphthyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 22 mg HPLC analysis (220 nm): Purity 80% (Retention time: 3.803
Min) MASS (APCI ⁺ ): 646 (M + 1)

Example 148 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4′-
Methoxyphenyl) benzyl] -N '-(2-fluorobenzyl)
Succinamide trifluoroacetate yield: 5.4 mg HPLC analysis (220 nm): 100% pure (retention time: 3.46
8 min) MASS (APCI ⁺ ): 618 (M + 1) Example 149 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4′-
[Methoxyphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 5.3 mg HPLC analysis (220 nm): Purity 99% (Retention time: 3.604
Min) MASS (APCI ⁺ ): 668 (M + 1)

Example 150 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4'-
[Methoxyphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 6.7 mg HPLC analysis (220 nm): 89% purity (retention time: 3.562
Min) MASS (APCI ⁺ ): 626 (M + 1) Example 151 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4'-
[Methoxyphenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 6.4 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.32
1 minute) MASS (APCI ⁺ ): 655 (M + 1)

Example 152 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4′-
[Methoxyphenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 8.3 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.57
6 min) MASS (APCI ⁺ ): 626 (M + 1) Example 153 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Methoxyphenyl) benzyl] -N '-(2-fluorobenzyl)
Succinamide trifluoroacetate yield: 1.4 mg HPLC analysis (220 nm): 100% pure (retention time: 3.49
6 minutes) MASS (APCI ⁺ ): 618 (M + 1)

Example 154 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3′-
[Methoxyphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 1.7 mg HPLC analysis (220 nm): 100% purity (retention time: 3.63
1 min) MASS (APCI ⁺ ): 668 (M + 1) Example 155 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
[Methoxyphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 1.4 mg HPLC analysis (220 nm): 100% purity (retention time: 3.57
8 minutes) MASS (APCI ⁺ ): 626 (M + 1)

Example 156 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
[Methoxyphenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 1.6 mg HPLC analysis (220 nm): 100% pure (retention time: 3.33
2 min) MASS (APCI ⁺ ): 655 (M + 1) Example 157 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
[Methoxyphenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 1.5 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.59
0 min) MASS (APCI ⁺ ): 626 (M + 1)

Example 158 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3′-
Formylphenyl) benzyl] -N '-(2-fluorobenzyl)
Succinamide trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): 100% pure (retention time: 3.47
3 min) MASS (APCI ⁺ ): 616 (M + 1) Example 159 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Formylphenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): Purity 95% (Retention time: 3.614
Min) MASS (APCI ⁺ ): 666 (M + 1)

Example 160 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Formylphenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 100% pure (retention time: 3.55
8 min) MASS (APCI ⁺ ): 624 (M + 1) Example 161 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Formylphenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): 100% pure (retention time: 3.31
0 minutes) MASS (APCI ⁺ ): 653 (M + 1)

Example 162 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3'-
Formylphenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 12 mg HPLC analysis (220 nm): Purity 92% (Retention time: 3.574
Min) MASS (APCI ⁺ ): 624 (M + 1) Example 163 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4'-
Methylthiophenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 5.2 mg HPLC analysis (220 nm): Purity 99% (Retention time: 3.621
Min) MASS (APCI ⁺ ): 634 (M + 1)

Example 164 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (4′-
Methylthiophenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 2.9 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.75
2 min) MASS (APCI ⁺ ): 684 (M + 1) Example 165 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4′-
Methylthiophenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 3.7 mg HPLC analysis (220 nm): Purity 95% (Retention time: 3.755
Min) MASS (APCI ⁺ ): 642 (M + 1)

Example 166 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4′-
Methylthiophenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 2.7 mg HPLC analysis (220 nm): Purity 99% (Retention time: 3.462
Min) MASS (APCI ⁺ ): 671 (M + 1) Example 167 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (4'-
Methylthiophenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 2.8 mg HPLC analysis (220 nm): 99% pure (retention time: 3.742
Min) MASS (APCI ⁺ ): 642 (M + 1)

Example 168 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2 ′,
5'-Dichlorophenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.82
3 min) MASS (APCI ⁺ ): 656 (M + 1) Example 169 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2 ′,
5'-Dichlorophenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 11 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.96
1 minute) MASS (APCI ⁺ ): 706 (M + 1)

Example 170 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2 ′,
5'-Dichlorophenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 9.1 mg HPLC analysis (220 nm): Purity 98% (Retention time: 3.910
Min) MASS (APCI ⁺ ): 664 (M + 1) Example 171 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2 ',
5'-Dichlorophenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 9.3 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.66
8 minutes) MASS (APCI ⁺ ): 693 (M + 1)

Example 172 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2 ′,
5'-Dichlorophenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 8.7 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.93
7 min) MASS (APCI ⁺ ): 664 (M + 1) Example 173 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Acetamidophenyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 28 mg HPLC analysis (220 nm): 91% purity (retention time: 3.168
Min) MASS (APCI ⁺ ): 645 (M + 1)

Example 174 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Acetamidophenyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide trifluoroacetate Yield: 25 mg HPLC analysis (220 nm): Purity 92% (Retention time: 3.318
Min) MASS (APCI ⁺ ): 695 (M + 1) Example 175 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3'-
Acetamidophenyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 13 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.2
57 minutes) MASS (APCI ⁺ ): 653 (M + 1)

Example 176 N- [2- (3-Aminomethylphenoxy) phenyl] -N- [4- (3′-
Acetamidophenyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 10 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.02
0 min) MASS (APCI ⁺ ): 682 (M + 1) Example 177 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (3′-
Acetamidophenyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 20 mg HPLC analysis (220 nm): Purity 88% (Retention time: 3.289
Min) MASS (APCI ⁺ ): 653 (M + 1)

Example 178 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2′-
Thienyl) benzyl] -N '-(2-fluorobenzyl) succinamide trifluoroacetate Yield: 1.1 mg HPLC analysis (220 nm): Purity 99% (Retention time: 3.461
Min) MASS (APCI ⁺ ): 594 (M + 1) Example 179 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2'-
Thienyl) benzyl] -N '-(2-trifluoromethylbenzyl) succinamide tolutrifluoroacetate Yield: 1.3 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.48
4 minutes) MASS (APCI ⁺ ): 644 (M + 1)

Example 180 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2′-
Thienyl) benzyl] -N '-(1-indanyl) succinamide trifluoroacetate Yield: 1.1 mg HPLC analysis (220 nm): Purity 94% (Retention time: 3.54
6 min) MASS (APCI ⁺ ): 602 (M + 1) Example 181 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2′-
Thienyl) benzyl] -N '-(4-phenylpiperazino) succinamide trifluoroacetate Yield: 2.3 mg HPLC analysis (220 nm): Purity 100% (Retention time: 3.13
8 minutes) MASS (APCI ⁺ ): 631 (M + 1)

Example 182 N- [2- (3-aminomethylphenoxy) phenyl] -N- [4- (2′-
Thienyl) benzyl] -N '-(1,2,3,4-tetrahydroisoquinolino) succinamide trifluoroacetate Yield: 1.2 mg HPLC analysis (220 nm): Purity 94% (Retention time: 3.439
Min) MASS (APCI ⁺ ): 602 (M + 1) Example 183 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(9-oxo-9H-fluorene-2-carbonyl)] aminobutylamide hydrochloride (1) 4- [2- [3- (tert-butoxycarbonylaminomethyl)
To a solution of phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (4.6 g, 10 mmol) in tetrahydrofuran (15 ml) and ethanol (15 ml) was added a 1N aqueous sodium hydroxide solution (15 ml, 15 mmol). The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure to give 4- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminobutyric acid (4.1
g, 95%) of an amorphous solid. Elemental analysis C ₂₂ H ₂₇ N ₂ O ₅ theory as Cl:. C, 60.76; H , 6.26; N, 6.44 Found:. C, 60.84; H, 6.30; N, 6.39 1 H-NMR (CDCl 3 ) δ: 1.44 (9H, s), 1.86-1.99 (2H, m), 2.
38 (2H, t, J = 6.8Hz), 3.19 (2H, t, J = 6.6Hz), 4.27 (2H, t, J = 6.6Hz)
s), 5.03 (1H, bs), 5.45 (1H, bs), 6.23 (1H.bs), 6.6
3 (1H, d, J = 8.4Hz), 6.81-6.87 (2H, m), 6.95-7.03 (3H,
m), 7.25 (1H, t, J = 7.9Hz). (2) 4- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminobutyric acid (3.9 g, 9 m
mol), 2-fluorobenzylamine (1.2 ml, 11 mmol),
Diethyl cyanophosphate (1.5 ml, 11 mmol), triethylamine (1.5 ml, 11 mmol) and N, N-dimethylformamide (10
ml) of the mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
An oil of (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (2.8 g, 57%) was obtained. Was. Elemental analysis C ₂₉ H ₃₃ N ₃ O ₄ theory as ClF:. C, 64.26; H , 6.14; N, 7.75 Found:. C, 64.14; H, 6.10; N, 7.68 1 H-NMR (CDCl 3 ) δ: 1.42 (9H, s), 1.86-1.99 (2H, m), 2.
20 (2H, t, J = 7.2Hz), 3.17 (2H, t, J = 6.6Hz), 4.25 (2H,
d, J = 6.0Hz), 4.43 (2H, d, J = 5.8Hz), 4.94 (1H, bs),
6.01 (1H, bs), 6.60 (2H, d, J = 8.8Hz), 6.79-6.86 (3H,
m), 6.95-7.12 (4H, m), 7.21-7.33 (4H, m).

(3) N- (2-fluorobenzyl) -4- [N '-[2- [3
-(tert-Butoxycarbonylaminomethyl) phenoxy]-
4-Chlorophenyl]] aminobutyramide (0.6 g, 1.1 mm
ol), 9-Fluorenone-2-carbonyl chloride (0.32 mg,
A mixture of 1.3 mmol) and N, N-dimethylacetamide (20 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4
-[N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(9-oxo-9H-fluorene-2-carbonyl)] aminobutyramide (0.72 g , 87
%) Of an amorphous solid. Elemental analysis: C ₄₃ H ₃₉ N ₃ O ₆ 5ClF · 1 / 2H ₂ O Theoretical: C, 68.20; H, 5.32; N, 5.55. Found: C, 68.49; H, 5.35; N, 5.33. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.96 (2H, m), 2.37 (2
H, m), 3.86 (1H, m), 4.01 (1H, m), 4.22 (2H, d, J = 5.6
Hz), 4.50 (2H, d, J = 5.4Hz), 5.20 (1H, bs), 6.58 (1H,
s), 6.74 (3H, m), 6.96-7.67 (15H, m). (4) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] -4-chlorophenyl] -N '-(9-oxo-9H-fluorene-2-carbonyl)]
A solution of aminobutyramide (0.59 g, 0.8 mmol) in 2N hydrogen chloride and ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and washed with N- (2-fluorobenzyl) -4- [N '
-[2- [3- (Aminomethyl) phenoxy] -4-chlorophenyl]
A non-crystalline solid of -N '-(9-oxo-9H-fluorene-2-carbonyl)] aminobutylamide hydrochloride (0.35 g, 97%) was obtained. Elemental analysis: C ₃₈ H ₃₂ N ₃ O ₄ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 65.80; H, 4.80; N, 6.06. Found: C, 65.89; H, 4.89; N, 5.84 . ¹ H-NMR (DMSO-d ₆ ) δ: 1.84 (2H, m),
2.30 (2H, m), 3.47 (1H, m),
3.80 (1H, m), 4.00 (2H,
m), 4.31 (2H, d, J = 4.4 Hz),
6.63 (1H, s), 6.87 (1H,
m), 7.16-7.83 (16H, m), 8.
52 (3H, m).

Example 184 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[[4- (benzenesulfonylamino ) Phenyl] acetyl]] aminobutylamide hydrochloride (1) 4-aminophenylacetic acid ethyl ester (3.0 g, 17
mmol), benzenesulfonyl chloride (3.0 g, 17 mmol)
And N, N-dimethylacetamide (30 ml) at room temperature
Stirred for hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and a 1N aqueous sodium hydroxide solution (50 ml, 50 mmol) was added to a solution of the residue in tetrahydrofuran (50 ml) and ethanol (50 ml). The resulting mixture was stirred at 60 ° C. for 1 hour. After adding water to the reaction solution and acidifying with potassium hydrogen sulfate,
Extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was crystallized from hexane-ethyl acetate to give a solid of 4-benzenesulfonylaminophenylacetic acid (3.1 g, 64%). ^{1 H-NMR (DMSO-d} 6) δ: 3.45 (2H, s), 7.00-7.13 (4H, m),
7.49-7.64 (3H, m), 7.76 (2H, m), 10.26 (1H, bs) .4-benzenesulfonylaminophenylacetic acid (0.35 g, 1.2
mmol), oxalyl chloride (0.30 g, 2.4 mmol), N, N-
Dimethylformamide (0.3 ml) in tetrahydrofuran (1
5 ml) solution was stirred at room temperature for 1 hour. After the reaction solution was concentrated under reduced pressure, N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert
-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.6 g, 1.1 mmol)
N, N-dimethylacetamide (10 ml) was added. The resulting mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[[4- (benzenesulfonylamino) phenyl] acetyl] -N'-[ A non-crystalline solid of 2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.56 g, 62%) was obtained. Elemental analysis value C ₄₃ H ₄₄ N ₄ O ₇ ClFS · 1 / 2H
Theory as _{2 O:. C, 62.65;} H, 5.50; N, 6.80 Found:. C, 62.84; H, 5.41; N, 6.68 1 H-NMR (CDCl 3) δ: 1.43 (9H, s), 1.85 (2H, m), 2.26 (2
H, m), 3.41 (2H, m), 3.65 (1H, m), 3.80 (1H, m), 4.26
(2H, m), 4.42 (2H, d, J = 5.4Hz), 5.21 (1H, m), 6.68-
7.51 (19H, m), 7.71 (2H, m), 7.92 (1H, m). (2) N- (2-fluorobenzyl) -4- [N '-[[4- (benzenesulfonylamino) phenyl] Acetyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.29 g, 0.36 mmol)
Normal hydrogen chloride Ethyl acetate solution (2 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' -[[4- (benzenesulfonylamino) phenyl] acetyl]] aminobutylamide hydrochloride (0.26 g, 9
6%) of an amorphous solid was obtained. Elemental analysis: C ₃₈ H ₃₇ N ₄ O ₅ Cl ₂ FS ・ H ₂ O Theoretical: C, 59.30; H, 5.11; N, 7.28. Found: C, 59.22; H, 4.93; N, 7.26. ¹ H-NMR (DMSO-d ₆ ) δ: 1.67 (2H, m), 2.16 (2H, m), 3.31
(2H, m), 3.46 (1H, m), 3.70 (1H, m), 4.03 (2H.
m), 4.26 (2H, d, J = 4.4Hz), 6.81-7.60 (18H, m), 7.76
(2H, m), 8.39 (1H, m), 8.51 (2H, bs), 10.31 (1H,
s).

Example 185 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(2-naphthyl) acetyl]] aminobutyramide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-[2- [3- ( tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.5 g, 0.9 mmol), 2-naphthylacetyl chloride (0.38 mg, 1.8 mmol) and N, N-dimethylacetamide (15 ml) The mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[(2-naphthyl) acetyl] -N'-[2- [3- An amorphous solid of (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.57 g, 87%) was obtained. Elemental analysis: C ₄₁ H ₄₁ N ₃ O ₅ ClFF1 / 4H ₂ O Theoretical: C, 68.90; H, 5.85; N, 5.88. Found: C, 68.94; H, 5.96; N, 5.78. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.84 (2H, m), 2.25 (2
H, m), 3.67 (2H, m), 3.74 (2H, m), 4.19 (2H, d, J = 5.8
Hz), 4.44 (2H, d, J = 5.6Hz), 5.02 (1H, bs), 6.65-6.78
(4H, m), 6.97-7.48 (12H, m), 7.66-7.83 (3H, m). (2) N- (2-fluorobenzyl) -4- [N '-[(2-naphthyl) acetyl] -N '-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.33 g, 0.46 mmol) in 2N hydrogen chloride in ethyl acetate (2 ml) at room temperature For 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' -[(2-Naphthyl) acetyl] aminobutylamide hydrochloride (0.29 g, 95
%) Of an amorphous solid. Elemental analysis: C ₃₆ H ₃₄ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 65.95; H, 5.38; N, 6.41. Found: C, 66.13; H, 5.26; N, 6.41 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.73 (2H, m), 2.21 (2H, m), 3.46
(1H, m), 3.64 (1H, m), 3.80 (1H, m), 4.01 (2H.m), 4.
27 (2H, d, J = 5.0Hz), 6.85 (1H, m), 6.98-7.54 (14H,
m), 7.77-7.90 (3H, m), 8.44 (1H, m), 8.60 (2H, bs).

Example 186 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[[4- (2-oxopyrrolidin-1-yl) phenyl] acetyl]] aminobutylamide hydrochloride (1) 4-aminophenylacetic acid ethyl ester (2.0 g, 11
mmol), 4-bromobutanoic acid ethyl ester (8.7 g, 45 m
mol), potassium carbonate (2.3 g, 17 mmol) and N, N-dimethylformamide (50 ml) were stirred at 60 ° C. for 24 hours.
After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to obtain an oil of ethyl 4- [4- (ethoxycarbonylmethyl) phenyl] aminobutanoate (2.4 g, 74%). ¹ H-NMR (CDCl ₃ ) δ: 1.25 (6H, m), 1.94 (2H, m), 2.41 (2
H, m), 3.16 (2H, m), 3.48 (2H, s), 3.70 (1H, bs), 4.1
3 (4H, m), 6.56 (2H, d, J = 8.6Hz), 7.08 (2H, d, J = 8.6H
z). (2) 4- [4- (ethoxycarbonylmethyl) phenyl] aminobutanoic acid ethyl ester (2.4 g, 8.3 mmol), sodium hydride (oily) (0.5 g, 12 mmol) in tetrahydrofuran
(50 ml) The mixture was stirred under reflux for 18 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to give [4- (2-oxopyrrolidin-1-yl) phenyl].
Acetic acid ethyl ester (1.2 g, 59%) was obtained as a solid. Mp 63-65 ° C. Elemental analysis C ₁₄ H ₁₇ NO ₃ as the theoretical value:. C, 68.00; H, 6.93; N, 5.66 Found:. C, 68.07; H, 6.69; N, 5.71 1 H-NMR ( CDCl ₃ ) δ: 1.24 (3H, t, J = 7.2Hz), 2.16 (2H, t
t, J = 7.0,8.0Hz), 2.61 (2H, t, J = 8.0Hz), 3.59 (2H,
s), 3.85 (2H, t, J = 7.0Hz), 4.14 (2H, q, J = 7.2Hz), 7.2
9 (2H, d, J = 8.4Hz), 7.57 (2H, d, J = 8.4Hz).

(3) To a solution of ethyl [4- (2-oxopyrrolidin-1-yl) phenyl] acetic acid (0.97 g, 3.9 mmol) in tetrahydrofuran (20 ml) and ethanol (20 ml) was added 1N hydroxylated solution. Aqueous sodium solution (10 ml, 10 mmol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. Water was added to the reaction solution, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was crystallized from hexane-ethanol to give [4- (2-oxopyrrolidine-
A solid of 1-yl) phenyl] acetic acid (0.5 g, 57%) was obtained. Mp 171-172 ° C. Elemental analysis C ₁₂ H ₁₃ NO ₃ as the theoretical value:. C, 65.74; H, 5.98; N, 6.39 Found:. C, 65.84; H, 5.74; N, 6.43 1 H-NMR ( CDCl ₃ ) δ: 2.05 (2H, tt, J = 7.0,8.0Hz), 2.48 (2
H, t, J = 8.4Hz), 3.53 (2H, s), 3.81 (2H, t, J = 7.0Hz),
7.24 (2H, d, J = 8.4Hz), 7.58 (2H, d, J = 8.4Hz), 12.3 (1
H, s). (4) [4- (2-oxopyrrolidin-1-yl) phenyl] acetic acid (0.
54 g, 2.4 mmol), oxalyl chloride (0.62 g, 4.9 mmo
l) A solution of N, N-dimethylformamide (0.5 ml) in tetrahydrofuran (15 ml) was stirred at room temperature for 1 hour. After the reaction solution was concentrated under reduced pressure, N- (2-fluorobenzyl) -4- [N '-[2-
[3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.66 g,
1.2 mmol) and N, N-dimethylacetamide (15 ml) were added. The resulting mixture was stirred at room temperature for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl] -N '-[[4- (2-oxopyrrolidin-1-yl) phenyl] acetyl]] aminobutyramide (0.47 g, 5
1%) of an amorphous solid was obtained. Elemental analysis _{C 41 H 44 N 4 O 6} ClF theoretically:. C, 66.25; H, 5.97; N, 7.54 Found:. C, 66.01; H, 6.15; N, 7.30 1 H-NMR (CDCl 3 ) δ: 1.42 (9H, s), 1.83 (2H, m), 2.19 (4
H, m), 2.60 (2H, m), 3.46 (2H, m), 3.71 (2H, m), 3.83
(2H, m), 4.26 (2H, d, J = 5.8Hz), 4.44 (2H, d, J = 5.8H
z), 5.33 (1H, bs), 6.70 (1H, bs), 6.83-7.32 (13H, m),
7.48 (2H, m). (5) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'- [[4- (2-oxopyrrolidin-1-yl) phenyl] acetyl]] aminobutyramide (0.28 g, 0.37 mmol)
A 2N solution of hydrogen chloride in ethyl acetate (2 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' -[[4- (2-Pyrrolidin-1-yl) phenyl] acetyl]] aminobutylamide hydrochloride (0.24 g, 94
%) Of an amorphous solid. Elemental analysis: C ₃₆ H ₃₇ N ₄ O ₄ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 62.79; H, 5.56; N, 8.14. Found: C, 62.93; H, 5.58; N, 8.16 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.75 (2H, m), 2.10 (2H, m), 2.23
(2H, m), 2.54 (2H, m), 3.46 (4H, m), 3.84 (2H, m), 4.
08 (2H.m), 4.31 (2H, m), 6.91-7.06 (15H, m), 8.47 (1
H, m), 8.61 (2H, bs).

Example 187 2- [N- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoethylcarbamic acid 2-fluorobenzyl ester hydrochloride (1) 3 -[N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]]-N- (4-phenylbenzoyl)] aminopropionic acid (0.8 g, 1.3 mmol), diphenylphosphoryl azide A mixture of (DPPA) (0.56 g, 2.0 mmol), triethylamine (0.17 g, 1.6 mmol) and N, N-dimethylformamide (5 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Then, add 2-fluorobenzyl alcohol (0.42 g, 3.3 mmol) to the reaction solution.
Was added and refluxed for another 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and 2-[[N- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoethylcarbamic acid 2 A non-crystalline solid of -fluorobenzyl ester (0.37 g, 38%) was obtained. Elemental analysis: C ₄₁ H ₃₉ N ₃ O ₆ ClF · 1 / 2H ₂₀ Theoretical: C, 67.16; H, 5.50; N, 5.73. Found: C, 67.47; H, 5.66; N, 6.13. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 3.51 (2H, m), 4.00 (1
H, m), 4.17 (3H, m), 4.88 (1H, bs), 5.09 (2H, m), 5.6
3 (1H, bs), 6.47 (1H, m), 6.56 (2H, m), 7.00-7.59 (17
H, m). (2) 2-[[N- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoethylcarbamic acid 2-fluorobenzyl ester (0.25 g, 0.34 mmol) in 2N hydrogen chloride in ethyl acetate (4 ml) at room temperature for 1 hour Stirred. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give 2-[[N- [3- (aminomethyl) phenoxy] -4-
Chlorophenyl] -N- (4-phenylbenzoyl)] aminoethylcarbamic acid 2-fluorobenzyl ester hydrochloride
(0.22 g, 99%) of an amorphous solid was obtained. Elemental analysis: C ₃₆ H ₃₂ N ₃ O ₄ Cl ₂ F ・ 1 / 4H ₂ O Theoretical: C, 65.01; H, 4.93; N, 6.32. Found: C, 64.87; H, 5.00; N, 6.70 ^{. 1 H-NMR (DMSO-} d 6) δ: 3.32 (1H, m), 3.52 (1H, m), 4.04
(4H, m), 5.08 (2H, s), 6.63 (1H, s), 6.78 (1H, m), 7.
21-7.28 (4H.m), 7.42-7.69 (14H, m), 8.60 (3H, m).

Example 188 N- [2- [3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N- [2- (3-phenylbutyryl) aminoethyl] -4-phenylbenzamide hydrochloride (1 ) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]]-N- (4-phenylbenzoyl)] aminopropionic acid (1.0 g, 1.7 mmol), diphenyl A mixture of phosphoryl azide (DPPA) (0.73 g, 2.6 mmol), triethylamine (0.21 g, 2.1 mmol) and N, N-dimethylformamide (5 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Thereafter, 9-fluorenylmethanol (0.33 g, 1.7 mmol) was added to the reaction solution, and the mixture was further refluxed for 3 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoethylcarbamide Acid 9H-fluoren-9-ylmethyl ester (0.81 g, 61
%) Of an amorphous solid. Elemental analysis _{C 48 H 44 N 3 O 6} Cl · H 2 0 theoretically:. C, 70.97; H, 5.71; N, 5.17 Found:. C, 71.03; H, 5.66; N, 6.48 1 H- NMR (CDCl ₃ ) δ: 1.40 (9H, s), 3.49 (2H, m), 3.98 (1
H, m), 4.14 (4H, m), 4.26 (2H, m), 4.79 (1H, bs), 5.80
(1H, bs), 6.45 (1H, m), 6.57 (2H, m), 7.00-7.58 (19H,
m), 7.75 (2H, d). (2) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] amino Ethylcarbamic acid 9H-fluorene-9-
Il methyl ester (0.65 g, 0.82 mmol) and piperidine
(0.5 ml) in N, N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, 3-phenyl-n-butyryl chloride (0.3 g, 1.6 mmol) and N,
N-dimethylacetamide (10 ml) was added. The resulting mixture was stirred at room temperature for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with brine,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- [2- (3-phenylbutyryl) aminoethyl] -4-phenylbenzamide (0.1 g, 17
%) Of an amorphous solid. (3) N- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] -N- [2- (3-phenylbutyryl) aminoethyl] -4-phenylbenzamide (0.1 g,
0.14 mmol) of a 2N solution of hydrogen chloride in ethyl acetate (4 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- [2
-[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N-
[2- (3-Phenylbutyryl) aminoethyl] -4-phenylbenzamide hydrochloride (0.087 g, 95%) was obtained as an amorphous solid. Elemental analysis _{C 38 H 37 N 3 O 3} Cl 2 · H 2 O theoretically:. C, 67.85; H, 5.84; N, 6.25 Found:. C, 68.14; H, 5.75; N, 6.30 1 H -NMR (DMSO-d ₆ ) δ: 1.16 (3H, d, J = 7.0Hz), 2.33 (2H,
m), 3.15 (2H, m), 3.50 (1H, m), 3.91 (1H, m), 4.03 (2
H, m), 4.40 (1H, m), 6.64 (1H, bs), 7.20-7.68 (19H.
m), 8.16 (1H, m), 8.52 (2H, bs).

Example 189 N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- [3-[(2-fluorophenylacetyl) amino] propyl] -4-phenylbenzamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutanoic acid (0.88 g, 2.1 mmol), diphenyl A mixture of phosphoryl azide (DPPA) (0.59 g, 2.2 mmol), triethylamine (0.22 g, 2.2 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Then, add 9
-Fluorenylmethanol (0.28 g, 1.4 mmol) was added, and the mixture was further refluxed for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water and brine,
After drying over anhydrous magnesium sulfate, the solvent was distilled off. The residue was purified by silica gel column chromatography.
[N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopropylcarbamic acid 9H-fluoren-9-ylmethyl ester (0.66 g , 57%) of an amorphous solid. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.77 (2H, m), 3.38 (2
H, m), 3.81 (1H, m), 4.17-4.26 (4H, m), 4.36 (2H, m),
4.87 (1H, bs), 6.02 (1H, m), 6.40 (1H, m), 6.57 (2H,
m), 7.01-7.79 (21H, m). (2) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl) ] Aminoethylcarbamic acid 9H-fluorene-9-
Yl methyl ester (0.65 g, 0.8 mmol) and piperidine (0.
A solution of 5 ml) in N, N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue
2-fluorophenylacetyl chloride (0.28 g, 1.6 mmo
l) and N, N-dimethylacetamide (10 ml) were added. The resulting mixture was stirred at room temperature for 5 hours. Pour the reaction into water,
Extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- [3-[(2- A non-crystalline solid of fluorophenyl) acetylamino] propyl] -4-phenylbenzamide (0.28 g, 48%) was obtained. Elemental analysis: C ₄₂ H ₄₁ N ₃ O ₅ ClF · 1 / 2H ₂₀ Theoretical: C, 68.98; H, 5.79; N, 5.75. Found: C, 69.37; H, 5.84; N, 5.74. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.73 (2H, m), 3.62 (2
H, s), 3.72 (1H, m), 3.85 (1H, m), 4.13 (1H, m), 4.20
(2H, d, J = 6.4Hz), 4.91 (1H, bs), 6.37 (1H, d), 6.55 (2
H, m), 6.87 (1H, bs), 6.99-7.59 (17H, m). (3) N- [2- [3- (tert-butoxycarbonylaminomethyl)
A solution of phenoxy] -4-chlorophenyl] -N- [3-[(2-fluorophenyl) acetylamino] propyl] -4-phenylbenzamide (0.18 g, 0.25 mmol) in 2N hydrogen chloride in ethyl acetate (4 ml) was prepared. Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- [3-[(2-fluorophenylacetyl) amino] Propyl] -4-phenylbenzamide hydrochloride (0.16 g,
95%) of an amorphous solid. Elemental analysis: C ₃₇ H ₃₄ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 66.57; H, 5.28; N, 6.29. Found: C, 66.77; H, 5.20; N, 6.24 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.75 (2H, m), 3.15 (2H, m), 3.49
(2H, s), 3.81 (2H, m), 4.02 (2H, m), 6.58 (1H, s), 6.
69 (1H, m), 7.09-7.68 (18H.m), 8.25 (1H, m), 8.54 (2
H, bs).

Example 190 N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-(4 -Phenylbenzoyl)] aminobutylamide hydrochloride (1) (S) -1- (3-methoxyphenyl) ethylamine (10 g, 6
6 mmol) in dichloromethane (100 ml)
(19 ml, 200 mmol) in dichloromethane (50 ml) at -78 ° C
Was dropped. After stirring at that temperature for 30 minutes, the reaction was carried out at room temperature for 1 hour. After stopping the reaction by adding methanol to the reaction solution, the reaction solution was concentrated under reduced pressure. Tetrahydrofuran (2
00 ml), triethylamine (33.4 g, 330 mmol) and di-tert-butyl dicarbonate (14.4 g, 66 mmol). The resulting mixture was heated at reflux for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N hydrochloric acid and brine, and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography. An oil of (1S) -1- (3-hydroxyphenyl) ethylcarbamic acid tert-butyl ester (13.4 g, 85%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.45 (3H, s), 4.72 (1
H, m), 4.81 (1H, m), 5.92 (1H, bs), 6.68-6.84 (3H,
m), 7.17 (1H, m). (2) 4-Chloro-2-fluoronitrobenzene (10.4 g, 59.2
mmol), (1S) -1- (3-hydroxyphenyl) ethylcarbamic acid tert-butyl ester (13.4 g, 56.5 mmol), potassium carbonate (9.4 g, 68 mmol) and N, N-dimethylformamide
(150 ml) of the mixture was stirred at 100 ° C. for 1 hour. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and the obtained crystals were recrystallized from hexane-ethyl acetate to give (1S)-(-)-1- [3- (5-chloro-2-nitrophenoxy) phenyl ] Crystals of ethyl carbamic acid tert-butyl ester (15.7 g, 71%) were obtained. Melting point 94-96 ° C [α] _D ²⁴ -50 ° (C = 0.5, MeOH) Elemental analysis: C ₁₉ H ₂₁ N ₂ O ₅ Cl Theoretical: C, 58.09; H, 5.39; N, 7.13. :. C, 58.05; H, 5.29; N, 7.10 1 H-NMR (CDCl 3) δ: 1.41 (12H, m), 4.79 (2H, m), 6.93-
7.42 (6H, m), 7.94 (1H, d).

(3) (1S)-(-)-1- [3- (5-chloro-2-nitrophenoxy) phenyl] ethylcarbamic acid tert-butyl ester (3.5 g, 8.9 mmol) in ethyl acetate (50 g) 5 ml in solution)
% Palladium on carbon (1.1 g) was added. The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 1 hour. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give (1S) -1- [3- (2-amino-5-chlorophenoxy) phenyl] ethylcarbamic acid
An oil of tert-butyl ester (3.2 g, 99%) was obtained. _{^{1 H-NMR (CDCl 3)}} δ: 1.41 (12H, m), 4.79 (2H, m), 6.93-7.
42 (6H, m), 7.94 (1H, d). (4) (1S) -1- [3- (2-amino-5-chlorophenoxy) phenyl] ethylcarbamic acid tert-butyl ester (3.2 g,
8.8 mmol), 4-bromobutyric acid ethyl ester (14 g, 70 mm
ol), potassium carbonate (3.6 g, 26 mmol) and N, N-dimethylformamide (50 ml) were stirred at 80 ° C. for 48 hours.
After cooling, the reaction solution was poured into water and extracted with ethyl acetate.
After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] An oil of aminobutyric acid ethyl ester (2.8 g, 66%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (3H, t, J = 7.0Hz), 1.41 (12H,
m), 1.95 (2H, m), 2.38 (2H, m), 3.19 (2H, m), 4.10 (2
H, q, J = 7.0Hz), 4.22 (1H, m), 4.79 (2H, m), 6.64 (1H,
d), 6.75-6.85 (2H, m), 6.95-7.07 (3H, m), 7.28 (1H, m
m).

(5) 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.8 g, 5.9 mmol) , Four-
Phenylbenzoyl chloride (1.5 g, 7.1 mmol) and N, N-
A mixture of dimethylacetamide (50 ml) was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate.
The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]- N- (4-
Phenylbenzoyl)] aminobutyric acid ethyl ester (3.1
g, 80%). Elemental analysis _{C 38 H 41 N 2 O 6} Cl · 1 / 2H 2 O theoretically:. C, 68.51; H, 6.35; N, 4.20 Found:. C, 68.80; H, 6.63; N, 4.03 1 H-NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.2 Hz), 1.34 (3H, d,
J = 7.0Hz), 1.40 (9H, s), 2.00 (2H, m), 2.46 (2H, m),
3.88 (1H, m), 4.06 (1H, m), 4.11 (2H, q, J = 7.2Hz), 4.
76 (2H, m), 6.44-6.53 (2H, m), 6.66 (1H, m), 6.96-7.5
9 (13H, m). (6) 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl )] Aminobutyric acid ethyl ester (2.8 g, 4.2
mmol) in tetrahydrofuran (50 ml) and ethanol (50 m
l) solution in 1N aqueous sodium hydroxide solution (20 ml, 20 mm
ol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N
Non-crystal of-[2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (2.7 g, 99%) A crystalline solid was obtained.

(7) 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]
-N- (4-phenylbenzoyl)] aminobutyric acid (0.8 g, 1.3 mm
ol), 2-fluorobenzylamine (0.25 g, 2.0 mmol),
1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.49 g, 2.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.35 g, 2.6 mmol) and N, N-
A mixture of dimethylformamide (10 ml) was stirred at room temperature for 6 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '
Of-[2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.66 g, 70%) An amorphous solid was obtained. [α] _D ²⁴ -29 ° (C = 0.5, MeOH) Elemental analysis: C ₄₃ H ₄₃ N ₃ O ₅ ClF ・ 1 / 2H ₂ O Theoretical: C, 69.30; H, 5.95; N, 5.64. values:. C, 69.57; H, 5.77; N, 5.63 1 H-NMR (CDCl 3) δ: 1.33 (3H, d, H = 6.8Hz), 1.39 (9H,
s), 1.97 (2H, m), 2.39 (2H, m), 3.81 (1H, m), 4.12 (1
H, m), 4.51 (2H, d, J = 5.8Hz), 4.67 (1H, m), 4.83 (1H,
m), 6.43 (1H, d), 6.52 (1H, s), 6.63 (1H, d), 6.93 (1
H, bs), 6.98-7.59 (17H, m). (8) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-ter
A solution of t-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.36 g, 0.51 mmol) in 2N hydrogen chloride in ethyl acetate (4 ml) was added at room temperature. Stir for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and washed with N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1
S) -1-Aminoethyl] phenoxy] -4-chlorophenyl] -N '
-(4-Phenylbenzoyl)] aminobutylamide hydrochloride
(0.3 g, 87%) of an amorphous solid was obtained. [α] _D ²⁴ -0.1 ° (C = 0.5, MeOH) Elemental analysis: C ₃₈ H ₃₆ N ₃ O ₃ Cl ₂ F Theoretical: C, 67.86; H, 5.39; N, 6.25. Found: C, . 67.85; H, 5.43; N , 6.29 1 H-NMR (DMSO-d 6) δ: 1.48 (3H, d, J = 7.0Hz), 1.83 (2H,
m), 2.27 (2H, m), 3.77 (2H, m), 4.29 (2H, m), 4.37 (1
H, m), 6.59 (1H, s), 6.70 (1H, bs), 7.11-7.68 (18H,
m), 8.44 (1H, bs), 8.59 (2H, bs).

Example 191 N- (2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-1-
Carbonyl)] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyl Amide (0.6 g, 1.1 mmol), 9H-fluorene-1-carbonyl chloride (0.51 g, 2.2 mmol)
A mixture of N, N-dimethylacetamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with a 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl] -N '-(9H-fluorene-1-carbonyl)]
An amorphous solid of aminobutyramide (0.69 g, 84%) was obtained. Elemental analysis _{C 43 H 41 N 3 O 5} ClF theoretically:. C, 70.34; H, 5.63; N, 5.72 Found:. C, 70.02; H, 5.66; N, 5.56 1 H-NMR (CDCl 3 ) δ: 1.43 (9H, s), 2.01 (2H, m), 2.46 (2
H, m), 3.52 (1H, d, J = 22.8Hz), 3.75 (3H m), 4.10 (1H,
d, J = 22.8Hz), 4.30 (2H, m), 4.54 (2H, d, J = 5.6Hz),
5.82 (1H, s), 6.43 (2H, m), 6.78 (1H, d), 6.95-7.43 (1
3H, m), 7.22 (2H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-(9H-fluorene-1-carbonyl)] aminobutyramide (0.39 g, 0.53 mmol) in 2N hydrogen chloride in ethyl acetate (6 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' -(9H-Fluorene-1-carbonyl)] aminobutyramide hydrochloride
(0.34 g, 95%) of an amorphous solid was obtained. Elemental analysis value C ₃₈ H ₃₄ N ₃ O ₃ Cl ₂ F · 1 / 2H
Theory as _{2 O:. C, 67.16;} H, 5.19; N, 6.18 Found:. C, 67.13; H, 5.37; N, 6.05 1 H-NMR (DMSO-d 6) δ: 1.89 (2H, m ), 2.34 (2H, m), 3.66-
4.05 (6H, m), 4.32 (2H, d, J = 5.6Hz), 6.48 (1H, s), 6.6
4 (1H, m), 6.82 (1H, s), 7.09-7.60 (13H, m), 7.87 (2H,
m), 8.49 (4H, m).

Example 192 N- (2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[4- (2-thiazolyl)
Benzoyl]] aminobutylamide hydrochloride (1) 2-bromothiazole (0.9 ml, 10 mmol), 4-formylphenylboronic acid (1.65 g, 11 mmol), sodium carbonate
(2.65 g, 25 mmol), toluene (150 ml), ethanol (30
mixture at room temperature under an argon atmosphere.
Stirred for 0 minutes. After addition of tetrakis (triphenylphosphine) palladium (0) (0.58 mg, 0.5 mmol), the mixture was heated under reflux for 15 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and recrystallized from ethyl acetate-hexane to obtain 4- (2-thiazolyl) benzaldehyde (1.4 g, 74%). Mp 91.5-92.5 ° C. Elemental analysis C ₁₀ H ₇ NOS theoretically:. C, 63.47; H, 3.73; N, 7.40 Found:. C, 63.67; H, 3.60; N, 7.316 1 H-NMR (CDCl ₃ ) δ: 7.46 (1H, d, J = 3.2Hz), 7.95-7.99 (3
H, m), 8.15 (2H, d, J = 8.2Hz), 10.07 (1H, s) .4- (2-thiazolyl) benzaldehyde (4.6 g, 24 mmol),
Sodium chlorite (5.5 g, 61 mmol), sodium dihydrogen phosphate (3.2 g, 27 mmol), 2-methyl-2-butene (8.6 g,
A mixture of 120 mmol), tert-butanol (40 ml), tetrahydrofuran (40 ml) and water (20 ml) was stirred at room temperature for 3 hours. The mixture was poured into 1N hydrochloric acid, and the deposited precipitate was collected by filtration and dried. 4- (2-thiazolyl) benzoic acid (4.0 g, 79
%) Solid was obtained. ¹ H-NMR (DMSO-d ₆ ) δ: 7.89 (1H, m), 8.00-8.06 (5H, m) .4- (2-thiazolyl) benzoic acid (0.55 g, 2.7 mmol), oxalyl chloride (0.69 g , 5.4 mmol), a solution of N, N-dimethylformamide (0.5 ml) in tetrahydrofuran (30 ml) was stirred at room temperature for 1 hour. After concentrating the reaction solution under reduced pressure, N-
(2-Fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.49 g, 0.9 mmol) and N, N- Dimethylacetamide (10 ml) was added. The resulting mixture was stirred at room temperature for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. Extract solution is 1N sodium hydroxide solution,
After washing with brine, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '
Non-crystal of-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[4- (2-thiazolyl) benzoyl]] aminobutyramide (0.31 g, 47%) A crystalline solid was obtained. Elemental analysis _{C 39 H 38 N 4O O 5} ClFS theoretically:. C, 64.23; H, 5.25; N, 7.68 Found:. C, 64.12; H, 5.62; N, 7.35 1 H-NMR (CDCl 3 ) δ: 1.41 (9H, s), 1.95 (2H, m), 2.37 (2
H, m), 3.81 (1H, m), 4.14 (3H, m), 4.50 (2H, d, J = 5.8
Hz), 5.32 (1H, bs), 6.46 (1H, s), 6.58 (2H, m), 6.79 (1
H, bs), 6.98-7.42 (11H, m), 7.76 (2H, m), 7.87 (1H,
m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- ( A solution of 2-thiazolyl) benzoyl]] aminobutylamide (0.2 g, 0.27 mmol) in 2N hydrogen chloride in ethyl acetate (4 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- (2-fluorobenzyl) -4- [N '-[2- [3-
(Aminomethyl) phenoxy] -4-chlorophenyl] -N '-[4-
(2-Thiazolyl) benzoyl]] aminobutylamide hydrochloride (0.17 g, 97%) was obtained as an amorphous solid. Elemental analysis: C ₃₄ H ₃₁ N ₄ O ₃ Cl ₂ FS1.5 H ₂ O Theoretical: C, 58.96; H, 4.95; N, 8.09. Found: C, 58.79; H, 4.99; N, 7.89. ^{1 H-NMR (DMSO-d} 6) δ: 1.83 (2H, m), 2.28 (2H, m), 3.80
(2H, m), 4.01 (2H, m), 4.29 (2H, d, J = 5.6Hz), 6.59 (1
H, s), 6.85 (1H, m), 7.11-7.59 (11H, m), 7.82-7.96 (4
H, m), 8.49 (1H, m), 8.57 (2H, bs).

Example 193 N- (2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(4-trifluoromethylphenyl) acetyl]] aminobutyramide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-[2- [ 3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.45 g, 0.83 mmol), (4-
(Trifluoromethylphenyl) acetyl chloride (0.46
g, 2.1 mmol) and N, N-dimethylacetamide (10 ml) was stirred at room temperature for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-[(4-trifluoromethylphenyl) acetyl]] aminobutyramide (0.49
g, 80%). Elemental analysis: C ₃₈ H ₃₈ N ₃ O ₅ ClF ₄・ 1 / 2H ₂ O Theoretical: C, 61.91; H, 5.33; N, 5.70. Found: C, 62.10; H, 5.52; N, 5.70. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.84 (2H, m), 2.24 (2
H, m), 3.54 (2H, m), 3.72 (2H, m), 4.27 (2H, d, J = 6.2
Hz), 4.43 (2H, d, J = 5.8Hz), 5.16 (1H, bs), 6.54 (1H,
m), 6.77-6.88 (3H, m), 6.96-7.37 (10H, m), 7.51 (2H,
d). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[(4- Trifluoromethylphenyl) acetyl]] aminobutyramide (0.34 g, 0.46 mmol)
A hydrogen chloride ethyl acetate solution (6 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N '-[(4-Trifluoromethylphenyl) acetyl]] aminobutylamide hydrochloride (0.3 g, 98%) was obtained as an amorphous solid. Elemental analysis: C ₃₃ H ₃₁ N ₃ O ₃ Cl ₂ F ₄ Theoretical: C, 58.96; H, 4.95; N, 8.09. Found: C, 58.79; H, 4.99; N, 7.89. ¹ H-NMR (DMSO-d ₆ ) δ: 1.71 (2H, m), 2.20 (2H, m), 3.46
(1H, m), 3.55 (2H, m), 3.80 (1H, m), 4.04 (2H.m), 4.
26 (2H, d, J = 5.4Hz), 6.88 (1H, d), 7.07-7.65 (14H,
m), 8.46 (1H, m), 8.64 (3H, bs).

Example 194 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(4-acetylaminophenoxy) acetyl]] aminobutyramide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-[2- [3 -(tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (1.08 g, 2 mmol), chloroacetyl chloride (0.32 ml, 4 mmol), 4-dimethylaminopyridine (0.49 g, 4 mmol) ) And tetrahydrofuran (30 m
The mixture of l) was stirred at room temperature for 2 hours. Pour the reaction into water,
Extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N'-chloroacetyl] aminobutyramide (0.9
(1 g, 74%) of an amorphous solid was obtained. Elemental analysis: C ₃₁ H ₃₄ N ₃ O ₇ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 59.33; H, 5.62; N, 6.70. Found: C, 59.40; H, 5.44; N, 6.68 _{^{. 1 H-NMR (CDCl 3}} ) δ: 1.43 (9H, s), 1.82-1.94 (2H, m), 2.
27 (2H, t, J = 6.8Hz), 3.70-3.80 (2H, m), 3.87 (1H, d,
J = 13.4Hz), 3.95 (1H, d, J = 13.4Hz), 4.29 (2H, d, J = 4.
4Hz), 4.45 (2H, d, J = 6.0Hz), 5.17 (1H, bs), 6.47 (1H,
bs), 6.86-7.19 (7H, m), 7.21-7.38 (4H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonyl) Aminomethyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutyramide (0.5
g, 0.81 mmol), 4-acetamidophenol (0.12 g, 0.
A mixture of 78 mmol), potassium carbonate (0.13 g, 0.94 mmol) and N, N-dimethylformamide (5 ml) was stirred at 60 ° C for 24 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[(4-acetylaminophenoxy) acetyl] -N'-[2- [ A non-crystalline solid of 3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.51 g, 89%) was obtained. Elemental analysis: C ₃₉ H ₄₂ N ₄ O ₇ ClF ・ 1 / 4H ₂ O Theoretical: C, 63.50; H, 5.81; N, 7.59. Found: C, 63.56; H, 5.93; N, 7.43. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (9H, s), 1.86 (2H, m), 2.11 (3
H, s), 2.24 (2H, m), 3.75 (2H, m), 4.28 (2H, d, J = 6.0H
z), 4.43 (2H, d, J = 6.2Hz), 4.45 (2H, s), 5.45 (1H, b
s), 6.58 (1H, m), 6.72-7.38 (15H, m), 7.64 (1H, bs). (3) N- (2-fluorobenzyl) -4- [N '-[(4-acetylamino Phenoxy) acetyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]]
A 2N solution of aminobutyramide (0.32 g, 0.43 mmol) in 2N hydrogen chloride in ethyl acetate was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and washed with N- (2-fluorobenzyl) -4- [N '
-[2- [3- (Aminomethyl) phenoxy] -4-chlorophenyl]
An amorphous solid of -N '-[(4-acetylaminophenoxy) acetyl]] aminobutylamide hydrochloride (0.28 g, 98%) was obtained. Elemental analysis: C ₃₄ H ₃₅ N ₄ O ₅ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 60.18; H, 5.35; N, 8.26. Found: C, 60.01; H, 5.55; N, 8.00 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.71 (2H, m), 2.00 (3H, s), 2.20
(2H, m), 3.45 (1H, m), 3.81 (1H, m), 4.05 (2H.m), 4.
27 (2H, d, J = 5.6Hz), 4.36 (1H, d, J = 15.2Hz), 4.54 (1
H, d, J = 15.2Hz), 6.70 (2H, d), 6.90 (1H, d), 7.09-7.
67 (12H, m), 8.42 (1H, m), 8.52 (2H, bs), 9.95 (1H,
s).

Example 195 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(2-oxo-benzo
[1,3] oxathiol-6-yloxy) acetyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylamino) Methyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutyramide (0.48
g, 0.78 mmol), 6-hydroxy-1,3-benzoxathiol-2-one (0.20 g, 1.2 mmol), potassium carbonate (0.13 g, 0.
94 mmol) and N, N-dimethylformamide (5 ml).
Stirred at 60 ° C. for 3 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-[(2-oxo-benzo [1,3] oxathiol-6-
Yloxy) acetyl]] aminobutyramide (0.32 g, 54
%) Of an amorphous solid. Elemental analysis _{C 38 H 37 N 3 O 8} ClFS theoretically:. C, 60.84; H, 4.97; N, 5.60 Found:. C, 60.67; H, 5.09; N, 5.31 1 H-NMR (CDCl 3 ) δ: 1.41 (9H, s), 1.87 (2H, m), 2.25 (2
H, m), 3.75 (2H, m), 4.30 (2H, d, J = 6.4Hz), 4.43 (2H,
d, J = 5.6Hz), 4.50 (2H, m), 5.30 (1H, bs), 6.35 (1H, b
s), 6.76-7.40 (14H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-[(2-oxo-benzo [1,3] oxathiol-6-
Yloxy) acetyl]] aminobutyramide (0.23 g,
A solution of 0.3 mmol) of 2N hydrogen chloride in ethyl acetate (2 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-
Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[(2-oxo-benzo [1,3]
Oxathiol-6-yloxy) acetyl]] aminobutylamide hydrochloride (0.19 g, 92%) was obtained as an amorphous solid. Elemental analysis _{C 33 H 30 N 3 O 6} Cl 2 FS theoretically:. C, 57.73; H, 4.40; N, 6.12 Found:. C, 57.64; H, 4.54; N, 6.10 1 H-NMR ( DMSO-d ₆ ) δ: 1.72 (2H, m), 2.21 (2H, m), 3.40
(1H, m), 3.79 (1H, m), 4.05 (2H.m), 4.27 (2H, d, J =
5.2Hz), 4.47 (1H, d, J = 15.4Hz), 4.68 (1H, d, J = 15.4H)
z), 6.80-7.71 (14H, m), 8.43 (1H, m), 8.55 (3H, bs).

Example 196 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(1H-indole-5
-Yloxy) acetyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutyramide (0.57
g, 0.92 mmol), 5-hydroxyindole (0.18 g, 1.4
mmol), potassium carbonate (0.19 g, 1.4 mmol) and N, N-dimethylformamide (10 ml) were stirred at 60 ° C. for 8 hours.
After cooling, the reaction solution was poured into water and extracted with ethyl acetate.
The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-[(1H-indol-5-yloxy) acetyl]] aminobutyramide
(0.47 g, 71%) of an amorphous solid was obtained. Elemental analysis: C ₃₉ H ₄₀ N ₄ O ₆ ClF ・ 1 / 4H ₂ O Theoretical: C, 65.08; H, 5.67; N, 7.78. Found: C, 65.14; H, 5.71; N, 7.50. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.86 (2H, m), 2.25 (2
H, m), 3.75 (2H, m), 4.22 (2H, d, J = 5.4Hz), 4.43 (2H, m
d, J = 6.2Hz), 4.53 (2H, s), 5.06 (1H, bs), 6.32 (1H,
s), 6.55 (1H, bs), 6.73-7.36 (15H, m), 8.32 (1H, bs). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[(1H-indol-5-yloxy) acetyl]]
A 2N solution of aminobutyramide (0.33 g, 0.46 mmol) in hydrogen chloride and ethyl acetate (6 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and washed with N- (2-fluorobenzyl) -4- [N '
-[2- [3- (Aminomethyl) phenoxy] -4-chlorophenyl]
A non-crystalline solid of -N '-[(1H-indol-5-yloxy) acetyl]] aminobutyramide hydrochloride (0.30 g, 99%) was obtained. Elemental analysis: C ₃₄ H ₃₃ N ₄ O ₄ Cl ₂ F.H ₂ O Theoretical: C, 60.99; H, 5.27; N, 8.37. Found: C, 60.91; H, 5.15; N, 8.22. ¹ H-NMR (DMSO-d ₆ ) δ: 1.73 (2H, m), 2.22 (2H, m), 3.44
(1H, m), 3.79 (1H, m), 4.03 (2H.m), 4.26 (2H, d, J =
5.0Hz), 4.53 (2H, m), 6.84-7.72 (16H, m), 8.54 (4H, m
m), 10.68 (1H, bs).

Example 197 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(6-ethoxybenzothiazol-2-ylsulfanyl) acetyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutylamide (0.67
g, 1.1 mmol), 6-ethoxy-2-mercaptobenzothiazole (0.34 g, 1.6 mmol), potassium carbonate (0.22 g, 1.6 mm
ol) and a mixture of N, N-dimethylformamide (10 ml) at 60 ° C.
For 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water and brine,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N- (2-fluorobenzoyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-
A non-crystalline solid of [(6-ethoxybenzothiazol-2-ylsulfanyl) acetyl]] aminobutyramide (0.38 g, 44%) was obtained. Elemental analysis: C ₄₀ H ₄₂ N ₄ O ₆ ClFS ₂・ 1 / 2H ₂ O Theoretical: C, 59.88; H, 5.40; N, 6.98. Found: C, 60.21; H, 5.44; N, 6.94. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.43 (3H, t, J = 6.8H
z), 1.87 (2H, m), 2.28 (2H, m), 3.77 (2H, m), 3.95 (1H,
d, J = 15.4Hz), 4.05 (2H, q, J = 6.8Hz), 4.17 (1H, d, J =
15.4Hz), 4.26 (2H, d, J = 5.8Hz), 4.42 (2H, d, J = 5.8H)
z), 5.12 (1H, bs), 6.46 (1H, bs), 6.85-7.37 (13H, m),
7.60 (1H, d). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'- [(6-ethoxybenzothiazol-2-ylsulfanyl) acetyl]] aminobutyramide (0.28 g, 0.3
A solution of 6 mmol) of 2N hydrogen chloride in ethyl acetate (6 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' A non-crystalline solid of-[(6-ethoxybenzothiazol-2-ylsulfanyl) acetyl]] aminobutylamide hydrochloride (0.26 g, 99%) was obtained. Elemental analysis: C ₃₅ H ₃₅ N ₄ O ₄ Cl ₂ FS ₂・ 2H ₂ O Theoretical: C, 54.90; H, 5.13; N, 7.32. Actual found: C, 54.60; H, 5.13; N, 7.25. ¹ H-NMR (DMSO-d ₆ ) δ: 1.34 (3H, t, J = 6.8 Hz), 1.72 (2H,
m), 2.21 (2H, m), 3.46 (1H, m), 3.80 (1H, m), 3.98-4.
10 (5H, m), 4.20-4.28 (3H.m), 6.88-7.71 (14H, m), 8.4
4 (1H, m), 8.62 (1H, bs).

Example 198 N- (2-fluorobenzyl) -4- [N '-[2- [4- (aminomethyl)
Phenylamino] phenyl] -N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (1) (4-aminobenzyl) carbamic acid tert-butyl ester tetrahydrofuran of 4-aminobenzylamine (24.3 g, 199 mmol) (400 ml) in an ice-cooled stirred solution.
ert-Butyl (43.9 g, 199 mmol) was added dropwise. The resulting reaction mixture was stirred at 0 C for 1 hour. The reaction solution was concentrated under reduced pressure, the residue was diluted with ethyl acetate, washed with water, and dried over anhydrous magnesium sulfate. After the solvent was distilled off under reduced pressure, the residue was crystallized from hexane and collected by filtration.
(4-aminobenzyl) carbamic acid tert-butyl ester
(41.9 g, 94.8%) of crystals were obtained. Melting point 69-70 ° C. ¹ H-NMR (CDCl ₃ ) δ: 1.47 (9H, s), 3.62 (2H, bs), 4.19 (2
H, d, J = 5.8Hz), 4.73 (1H, bs), 6.65 (2H, d, J = 8.6H
z), 7.08 (2H, d, J = 8.6Hz). (2) [4- (2-nitrophenylamino) benzyl] carbamic acid tert-butyl ester (4-aminobenzyl) carbamic acid tert-butyl ester
(89.2 g, 401 mmol), o-fluoronitrobenzene (56.7
g, 401 mmol) and potassium carbonate (55.4 g, 401 mmol) were stirred at 140 ° C. for 2 hours under a nitrogen atmosphere. After cooling, the reaction mixture was diluted with ethyl acetate and washed with water. After drying over anhydrous magnesium sulfate, the mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [4- (2-
Crystals of nitrophenylamino) benzyl] carbamic acid tert-butyl ester (36 g, 26%) were obtained. Mp 121-123 ° C. Elemental analysis C ₁₈ H ₂₁ N ₃ O ₄ as a theory:. C, 62.96; H, 6.16; N, 12.24 Found:. C, 62.71; H, 6.05; N, 12.12 1 H- NMR (CDCl ₃ ) δ: 1.49 (9H, s), 4.34 (2H, d, J = 6 Hz),
4.92 (1H, bs), 6.78 (1H, t, J = 7.2Hz), 7.18-7.37 (6H,
m), 8.21 (1H, d, J = 8.6Hz), 9.47 (1H, bs).

(3) [4- (2-aminophenylamino) benzyl] carbamic acid tert-butyl ester [4- (2-nitrophenylamino) benzyl] carbamic acid t
To a solution of ert-butyl ester (36 g, 105 mmol) in ethanol was added 10% palladium on carbon (4 g). The resulting mixture was hydrogenated under normal temperature and normal pressure conditions for 4 hours.
The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The remaining solid was recrystallized from hexane-ethyl acetate to give [4- (2-aminophenylamino) benzyl] carbamic acid tert-butyl ester (29.
(5 g, 89.9%). Melting point 117-119 ° C Elemental analysis: C ₁₈ H ₂₃ N ₃ O ₂ Theoretical: C, 68.88; H, 7.40; N, 13.41. Found: C, 69.09; H, 7.55; N, 13.48. ¹ H- NMR (CDCl ₃ ) δ: 1.46 (9H, s), 3.78 (2H, bs), 4.21 (2
(H, d, J = 5.4Hz), 4.73 (1H, bs), 5.19 (1H, bs), 6.69-7.15
(4H) [4- [2- (4-biphenylmethylamino) phenylamino] benzyl] carbamic acid tert-butyl ester [4- (2-aminophenylamino) benzyl] carbamic acid t
Acetic acid (5.4 m) was added to an ethanol solution (500 ml) of ert-butyl ester (29.5 g, 94.1 mmol) and 4-phenylbenzaldehyde.
1, 94 mmol) was added. After stirring the resulting mixture at 0 ° C. for 30 minutes, sodium cyanoborohydride (7.1 g, 117
mmol) was added. Thereafter, the mixture was stirred at 0 ° C. for 1 hour and at room temperature for 30 minutes. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [4- [2- (4-biphenylmethylamino) phenylamino] benzyl] carbamic acid tert-butyl ester (4
(0.5 g, 90%). ¹ H-NMR (CDCl ₃ ) δ: 1.45 (9 H, s), 4.21 (2 H, d, J = 5.4 Hz),
4.39 (2H, s), 4.75 (1H, bs), 5.12 (1H, bs), 6.68-7.59
(16H, m).

(5) [4- (2-aminophenyl) amino] benzylcarbamic acid tert-butyl ester (4.2 g, 14 mm
ol), 4-bromobutyric acid ethyl ester (7.7 ml, 54 mmol),
A mixture of potassium carbonate (2.1 g, 15 mmol) and N, N-dimethylformamide (30 ml) was stirred at 90 ° C. for 4 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and ethyl 4- [2- [4- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] aminobutyrate (4.8 g, 83%) was used. Oil was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 6.8H
z), 1.45 (9H, s), 1.82-1.98 (2H, m), 2.36 (2H, t, J =
7.2Hz), 3.18 (2H, t, J = 7.0Hz), 4.07 (2H, q, J = 6.8H
z), 4.11 (2H, bs), 4.20 (2H, d, J = 5.6Hz), 4.77 (1H, b
s), 5.09 (1H, bs), 6.94-7.26 (8H, m). (6) 4- [2- [4- (tert-butoxycarbonylaminomethyl)
Phenylamino] phenyl] aminobutyric acid ethyl ester
(5.0 g, 12 mmol), 4-dimethylaminopyridine (1.6 g, 1
To a solution of 3 mmol) in tetrahydrofuran (150 ml) was added 4-phenylbenzoyl chloride (2.8 g, 13 mmol) at 0 ° C.
After stirring the reaction solution at 0 ° C for 30 minutes and at room temperature for 30 minutes, 4-dimethylaminopyridine (1.6 g, 13 mmol) and 4-phenylbenzoyl chloride (2.8 g, 13 mmol) were added again at 0 ° C. The reaction solution was stirred at 0 ° C. for 30 minutes and at room temperature for 30 minutes, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [4-
(tert-butoxycarbonylaminomethyl) phenylamino] phenyl] -N- (4-phenylbenzoyl)] aminobutyric acid
An oil of ethyl ester (3.1 g, 44%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.17 (3H, t, J = 7.2 Hz), 1.45 (9H,
s), 1.78-1.98 (2H, m), 2.33-2.42 (2H, m), 3.10-3.30
(2H, m), 4.07 (2H, q, J = 7.2Hz), 4.11 (2H, d, J = 5.8H
z), 4.62 (1H, bs), 4.88 (1H, bs), 6.47-7.66 (17H, m).

(7) 4- [N- [2- [4- (tert-butoxycarbonylaminomethyl) phenylamino] phenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester (3.0 g,
4.9 mmol) of tetrahydrofuran (30 ml) and methanol (3
1N sodium hydroxide solution (10 ml, 1 ml)
0 mmol) was added. The resulting mixture was stirred at 60 C for 2 hours. Water and potassium hydrogen sulfate (1.4 g, 10 mmol) were added to the reaction solution.
After adding thereto, the mixture was extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [2- [4- (tert-butoxycarbonylaminomethyl) phenylamino] phenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (2.5 g, 87%). An oil was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 1.83-1.95 (2H, m), 2.
39 (2H, t, J = 7.2Hz), 3.18-3.36 (2H, m), 4.19 (2H, d,
J = 6.0Hz), 4.79 (1H, bs), 5.39 (1H, bs), 6.78-7.60 (17
H, m). (8) 4- [N- [2- [4- (tert-butoxycarbonylaminomethyl) phenylamino] phenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.50 g, 1.0 mmol ), 2-fluorobenzylamine (0.23 ml, 2.0 mmol), diethyl cyanophosphate
(0.30 ml, 2.0 mmol), triethylamine (0.28 ml, 2.0 mmol)
mmol) and N, N-dimethylformamide (6 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '
An oil of-[2- [4- (tert-butoxycarbonylaminomethyl) phenylamino] phenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.21 g, 31%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (9H, s), 1.88-1.98 (2H, m), 2.
27 (2H, t, J = 7.0Hz), 3.25-3.51 (2H, m), 4.20 (2H, d,
J = 6.0Hz), 4.44 (2H, d, J = 5.6Hz), 4.82 (1H, bs), 5.50
(1H, bs), 6.70 (1H, t, J = 5.6Hz), 6.81-7.57 (21H, m). (9) N- (2-fluorobenzyl) -4- [N '-[2- [4 -(tert-Butoxycarbonylaminomethyl) phenylamino] phenyl] -N '-(4-phenylbenzoyl)] aminobutyramide
(0.17 g, 0.25 mmol) in ethyl acetate (1 ml) was added 4N hydrogen chloride in ethyl acetate (1 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [4- (aminomethyl) phenylamino]
A non-crystalline solid of [phenyl] -N '-(4-phenylbenzoyl)] aminobutyramide dihydrochloride (0.13 g, 79%) was obtained. Elemental analysis: C ₃₇ H ₃₇ N ₄ O ₂ Cl ₂ F ・ 0.4H ₂ O Theoretical: C, 66.65; H, 5.71; N, 8.40. Found: C, 66.88; H, 5.98; N, 8.15. ¹ H-NMR (DMSO-d ₆ ) δ: 1.99-2.12 (2H,
m), 2.41 (2H, t, J = 6.6 Hz),
3.77-3.87 (2H, m), 4.18 (2
H, d, J = 5.8 Hz), 4.28 (2H,
d, J = 5.4 Hz), 4.70 (2H, b
7.s), 7.08-7.89 (20H, m).
23 (1H, d, J = 8.0 Hz), 8.57
(1H, t, J = 5.8 Hz), 8.79 (3
H, bs).

Example 199 N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2-
[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N'-
[(5-methyl-1,3,4-thiadiazol-2-ylsulfanyl) acetyl]] aminopropionamide hydrochloride (1) 3- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminopropionic acid ethyl ester (2.5 g, 5.5 mmol) in tetrahydrofuran
(40 ml) and a solution of ethanol (40 ml) were added with a 1 N aqueous solution of sodium hydroxide (20 ml, 20 mmol). The resulting mixture was stirred at 60 ° C. for 1 hour. After adding water and potassium hydrogen sulfate to the reaction solution, the mixture was extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentration under reduced pressure gave an amorphous solid. The obtained solid and 2-fluorophenethylamine (1.1 g,
8.2 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (2.1 g, 11 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (1.5 g, 11 mmol)
And a mixture of N, N-dimethylformamide (10 ml) was stirred at room temperature for 4 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] -4-chlorophenyl]] aminopropionamide (2.9 g, 98%) was obtained as an oil. (2) N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl]] aminopropionamide (2.9 g, 5.4
mmol), bromoacetyl bromide (2.2 g, 11 mmol) and N, N
A mixture of -dimethylacetamide (10 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate.
The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography and N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] -4-chlorophenyl] -N'-bromoacetyl] aminopropionamide (0.97 g, 27%)
Oil was obtained. Elemental analysis value C ₃₁ H ₃₄ N ₃ O ₅ BrClF.H ₂ O
Theory as:. C, 54.68; H, 5.33; N, 6.17 Found:. C, 54.71; H, 5.38; N, 6.26 1 H-NMR (CDCl 3) δ: 1.44 (9H, s), 2.49 ( 2H, m), 2.83 (2
H, m), 3.46 (2H, m), 3.69 (2H, m), 3.84 (1H, m), 3.97
(1H, m), 4.30 (2H, d, J = 5.6Hz), 5.02 (1H, bs), 6.20 (1
H, bs), 6.86-7.40 (11H, m).

(3) N- [2- (2-fluorophenyl) ethyl] -3
-[N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-bromoacetyl] aminopropionamide (0.
94 g, 1.4 mmol), 2-methoxy-1,3,4-thiazole-5-thiol (0.18 g, 1.4 mmol), potassium carbonate (0.3 g, 2.1 mmo
l) and N, N-dimethylformamide (10 ml) at 60 ° C
For 1 hour. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water and brine,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N- (2-fluorobenzyl) -3- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[(5-methyl-1,3, 4-thiadiazol-2-ylsulfanyl) acetyl]] aminopropionamide (0.49 g,
48%) of an amorphous solid was obtained. Elemental analysis _{C 34 H 37 N 5 O 5} ClFS 2 theoretically:. C, 57.17; H, 5.22; N, 9.80 Found:. C, 56.89; H, 5.43; N, 9.51 1 H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 2.42 (1H, m), 2.52 (1
H, m), 2.69 (3H, s), 2.83 (2H, m), 3.47 (2H, m), 3.80
-4.17 (4H, m), 4.30 (2H, d, J = 6.2Hz), 5.34 (1H, bs),
6.40 (1H, m), 6.87-7.38 (11H, m). (4) N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl] -N '-[(5-methyl-1,3,4-thiadiazol-2-ylsulfanyl) acetyl]] aminopropionamide (0.34 g, 0.47 mmol) in 2N hydrogen chloride in ethyl acetate (6 ml) ) Was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- [2- (2-fluorophenyl) ethyl] -3- [N'-
[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N '-[(5-
Methyl-1,3,4-thiadiazol-2-ylsulfanyl) acetyl]] aminopropionamide hydrochloride (0.3 g, 97%)
A non-crystalline solid was obtained. Elemental analysis: C ₂₉ H ₃₀ N ₅ O ₃ Cl ₂ FS ₂・ H ₂ O Theoretical: C, 52.09; H, 4.82; N, 10.47. Found: C, 52.27; H, 4.84; N, 10.40. ¹ H-NMR (DMSO-d ₆ ) δ: 2.35 (2H, m), 2.65 (3H, s), 2.70
(2H, m), 3.22 (2H, m), 3.66 (1H, m), 3.88-4.13 (5H,
m), 6.88 (1H, d), 7.07-7.59 (10H, m), 8.18 (1H, m),
8.57 (3H, bs).

Example 200 N- (2-fluorobenzyl) -4- [N ′-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N ′-(9H -Fluorene-2-carbonyl)] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4-N '-[2- [3-[(1S) -1-tert
-Butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyramide (0.56 g, 1 mmol), 9H
-Fluorene-2-carbonyl chloride (0.34 g, 1.5 mmol)
And a mixture of N, N-dimethylacetamide (10 ml) at room temperature
Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3-
[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-1-carbonyl)] aminobutyramide (0.45 g, 59%) non-crystalline solid I got [α] _D ²⁴ -27 ° (C = 0.5, MeOH) Elemental analysis: C ₄₄ H ₄₃ N ₃ O ₅ ClF Theoretical: C, 70.62; H, 5.79; N, 5.62. Found: C, 70.44; . H, 5.66; N, 5.49 1 H-NMR (CDCl 3) δ: 1.26 (3H, m), 1.39 (9H, s), 1.98 (2
H, m), 2.40 (2H, m), 3.76 (2H, s), 3.82 (1H, m), 4.14
(1H, m), 4.52 (2H, d, J = 5.4Hz), 4.53 (1H, m), 6.41-
6.64 (3H, m), 6.98-7.35 (12H, m), 7.51-7.60 (3H, m),
7.76 (1H, d). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-ter
t-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-2-carbonyl)] aminobutyramide (0.3 g, 0.4 mmol) in ethyl acetate (3 ml)
Add 4N hydrogen chloride / ethyl acetate solution (3 ml) to the solution,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2
-Fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-(9H-fluorene
-2-carbonyl)] aminobutylamide hydrochloride (0.27 g, 9
9%) of an amorphous solid was obtained. [α] _D ²⁴ + 1.2 ° (C = 0.5, MeOH) Elemental analysis: C ₃₉ H ₃₆ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 67.53; H, 5.38; N, 6.06 . Found:. C, 67.37; H, 5.58; N, 5.95 1 H-NMR (DMSO-d 6) δ: 1.47 (3H, d, J = 5.8Hz), 1.84 (2H,
m), 2.28 (2H, m), 3.83 (4H, m), 4.30 (3H, m), 6.57 (1
H, bs), 6.67 (1H, m), 7.14-7.38 (11H, m), 7.57 (3H,
m), 7.76 (1H, d), 7.88 (1H, d), 8.49 (1H, m), 8.66 (3H,
bs).

Example 201 N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-[[ 4- (benzenesulfonyl) aminophenyl] acetyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-ter
t-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyramide (0.54 g, 0.97 mmol
l), A mixture of [4- (benzenesulfonyl) aminophenyl] acetyl chloride (0.39 g, 1.3 mmol) and N, N-dimethylacetamide (10 ml) was stirred at room temperature for 4 hours. The reaction solution was poured into water and extracted with ethyl acetate. Extract 1
After washing with aqueous sodium hydroxide solution and brine,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N- (2-fluorobenzyl) -4- [N '-[[4- (benzenesulfonyl) aminophenyl] acetyl] -N'-[2- [3-[(1S) -1-tert-
A non-crystalline solid of butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyramide (0.5 g, 62%) was obtained. [α] _D ²⁴ -24 ° (C = 0.5, MeOH) Elemental analysis C ₄₄ H ₄₆ N ₄ O ₇ ClFS · 1 / 2H ₂ O Theoretical: C, 63.03; H, 5.65; N, 6.68. values:. C, 63.31; H, 5.84; N, 6.37 1 H-NMR (CDCl 3) δ: 1.39 (12H, m), 1.87 (2H, m), 2.26 (2
H, m), 3.72 (2H, m), 3.63 (1H, m), 4.44 (2H, d, J = 5.2
Hz), 4.68 (1H, m), 5.08 (1H, d), 6.65-7.52 (20H, m),
7.72 (2H, d). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-ter
t-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-[[4- (benzenesulfonyl) aminophenyl] acetyl]] aminobutyramide (0.33 g, 0.4 mm
ol) in ethyl acetate (3 ml), 4N hydrogen chloride in ethyl acetate (3 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. After filtering the precipitated solid,
After washing with ethyl ether, N- (2-fluorobenzyl) -4-
[N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-[[4- (benzenesulfonyl) aminophenyl] acetyl]] aminobutylamide hydrochloride (0.29 g, 9
6%) of an amorphous solid was obtained. [α] _D ²⁴ -2.8 ° (C = 0.5, MeOH) Elemental analysis value C ₃₉ H ₃₉ N ₄ O ₅ Cl ₂ FS ・ 1.5H ₂ O Theoretical value: C, 59.09; H, 5.34; N, 7.07. Found:. C, 59.33; H, 5.25; N, 6.91 1 H-NMR (DMSO-d 6) δ: 1.49 (3H, d, J = 4.0Hz), 1.67 (2H,
m), 2.16 (2H, m), 3.33 (4H, m), 4.25 (2H, d, J = 5.6H
z), 4.41 (1H, m), 6.82-7.59 (18H, m), 7.75 (2H, m),
8.40 (1H, m), 8.66 (3H, bs), 10.32 (1H, s).

Example 202 N- (2-Fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-[( 2'-Methoxybiphenyl-4-yl) acetyl]] aminobutylamide hydrochloride (1) To a solution of 4-bromophenylacetic acid (25 g, 120 mmol) in ethanol (300 ml) was added concentrated sulfuric acid (10 ml). The mixture was heated under reflux for 15 hours. The reaction solution was concentrated under reduced pressure, the residue was poured into ice water, and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure,
An oil of bromophenylacetic acid ethyl ester (28 g, 99%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.25 (3H, t, J = 7.2Hz),
3.56 (2H, s), 4.15 (2H, q, J = 7.2Hz), 7.14-7.20 (2H,
m), 7.42-7.49 (2H, m). The obtained 4-bromophenylacetic acid ethyl ester (16 g,
66 mmol), 2-methoxyphenylboronic acid (10 g, 66 mmo
l), sodium carbonate (17.5 g, 165 mmol), toluene (50 m
l), a mixture of ethanol (50 ml) and water (50 ml) was stirred at room temperature for 30 minutes under an argon atmosphere. After addition of tetrakis (triphenylphosphine) palladium (0) (1.9 g, 1.6 mmol), the mixture was heated under reflux for 15 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give (2'-methoxy-4-biphenyl) acetic acid ethyl ester (17.3 g, 97%) as an oil. ¹ H-NMR (CDCl ₃ ) δ: 1.27 (3H, t, J = 7.2 Hz), 3.65 (2H,
s), 3.81 (3H, s), 4.17 (2H, q, J = 7.2Hz), 6.96-7.06 (2
H, m), 7.26-7.35 (4H, m), 7.49 (2H, d, J = 8.4Hz).
(2'-Methoxy-4-biphenyl) acetic acid ethyl ester (17.3
g, 64 mmol) in ethanol (80 ml), 1N aqueous sodium hydroxide solution (70 ml, 70 mmol) was added, and the mixture was stirred at room temperature for 4 hours. After the reaction solution was concentrated under reduced pressure, water was added to the residue, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. The extract was washed with brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. A solid of (2'-methoxy-4-biphenyl) acetic acid (14.7 g, 95%) was obtained. Melting point 174-176 ° C ¹ H-NMR (CDCl ₃ ) δ: 3.69 (2H, s), 3.80 (3H, s), 6.96-7.
05 (2H, m), 7.25-7.35 (4H, m), 7.51 (2H, d, J = 8.0Hz).
(2'-methoxy-4-biphenyl) acetic acid (0.39 g, 1.6 mmol),
A solution of oxalyl chloride (0.41 g, 3.2 mmol) and N, N-dimethylformamide (0.3 ml) in tetrahydrofuran (20 ml) was stirred at room temperature for 1 hour. After the reaction solution was concentrated under reduced pressure, N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-tert
-Butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyramide (0.6 g, 1.1 mmol)
N, N-dimethylacetamide (10 ml) was added. The resulting mixture was stirred at room temperature for 3 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-tert-butoxycarbonylamino) was obtained. Ethyl] phenoxy] -4-chlorophenyl] -N '-[(2'
-Methoxybiphenyl-4-yl) acetyl]] aminobutyramide (0.74 g, 88%) was obtained as an amorphous solid. [α] _D ²⁴ -29 ° (C = 0.5, MeOH) Elemental analysis C ₄₅ H ₄₇ N ₃ O ₆ ClF ・ 1 / 2H ₂ O Theoretical: C, 68.47; H, 6.13; N, 5.32. values:. C, 68.35; H, 6.08; N, 5.07 1 H-NMR (CDCl 3) δ: 1.38 (12H, m), 1.86 (2H, m), 2.27 (2
H, m), 3.54 (2H, m), 3.74 (2H, m), 3.79 (3H, s), 4.46
(2H, d, J = 6.2Hz), 4.69 (1H, m), 4.96 (1H, m), 6.74-7.
50 (20H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S) -1-ter
t-Butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-[(2'-methoxybiphenyl-4-yl) acetyl]] aminobutyramide (0.35 g, 0.45 mmol) in ethyl acetate (3 ml) 4N hydrogen chloride in ethyl acetate solution
(3 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1S)
-1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-
[(2'-Methoxybiphenyl-4-yl) acetyl]] aminobutyramide hydrochloride (0.32 g, 99%) was obtained as an amorphous solid. [α] _D ²⁴ -1.0 ° (C = 0.5, MeOH) Elemental analysis value C ₄₀ H ₄₀ N ₃ O ₄ Cl ₂ F.H ₂ O Theoretical value: C, 65.39; H, 5.76; N, 5.72. values:. C, 65.18; H, 5.73; N, 5.59 1 H-NMR (DMSO-d 6) δ: 1.50 (3H, d, J = 6.6Hz), 1.73 (2H,
m), 2.20 (2H, m), 3.47 (2H, m), 3.71 (2H, m), 3.75 (3
H, s), 4.27 (2H, d, J = 5.2Hz), 4.42 (1H, m), 6.88-7.5
5 (19H, m), 8.42 (1H, m), 8.65 (3H, bs).

Example 203 N-[(1R) -1-indanyl] -4- [N ′-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N ′ -(4-Phenylbenzoyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N -(4-Phenylbenzoyl)] aminobutyric acid (0.71 g, 1.1 mmol), (R) -1-
Aminoindane (0.25 g, 1.9 mmol), 1-ethyl-3-hydrochloric acid
(3-Dimethylaminopropyl) carbodiimide (WSC) (0.44
g, 2.3 mmol), a mixture of 1-hydroxybenzotriazole monohydrate (HOBt) (0.31 g, 2.3 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 16 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N-[(R) -1-indanyl] -4- [N'-
[2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl]
A non-crystalline solid of phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.67 g, 79%) was obtained. [α] _D ²⁴ + 17 ° (C = 0.5, MeOH) Elemental analysis C ₄₅ H ₄₆ N ₃ O ₅ Cl ・ 1 / 2H ₂ O Theoretical: C, 71.75; H, 6.29; N, 5.58. values:. C, 71.69; H, 6.52; N, 5.47 1 H-NMR (CDCl 3) δ: 1.32 (3H, d), 1.38 (9H, s), 1.85 (1
H, m), 2.02 (2H, m), 2.39 (2H, m), 2.50 (1H, m), 2.88
(2H, m), 3.85 (1H, m), 4.09 (1H, m), 4.17 (1H, m), 4.
87 (1H, bs), 5.50 (1H, m), 6.42-6.74 (4H, m), 6.98-7.
57 (17H, m). (2) N-[(R) -1-indanyl] -4- [N '-[2- [3-[(1S) -1-tert-
Butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N ′-(4-phenylbenzoyl)] aminobutyramide (0.33 g, 0.44 mmol) in ethyl acetate (3 ml)
4N Hydrogen chloride ethyl acetate solution (3 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N-[(R) -1
-Indanyl] -4- [N '-[2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutylamide hydrochloride ( 0.3 g (100%) of an amorphous solid was obtained. [α] _D ²⁴ + 47 ° (C = 0.5, MeOH) Elemental analysis value C ₄₀ H ₃₉ N ₃ O ₃ Cl ₂・ 2H ₂ O Theoretical value: C, 67.03; H, 6.05; N, 5.86. :. C, 67.14; H, 5.93; N, 5.81 1 H-NMR (DMSO-d 6) δ: 1.49 (3H, d, J = 6.6Hz), 1.71-1.87
(3H, m), 2.25-2.37 (3H, m), 2.85 (2H, m), 3.87 (2H,
m), 4.38 (1H, m), 5.27 (1H, m), 6.61 (1H, s), 6.73 (1
H, m), 7.14-7.68 (18H, m), 8.31 (1H, d), 8.66 (3H, b
s).

Example 204 N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1R) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N'-(4 -Phenylbenzoyl)] aminobutylamide hydrochloride (1) (R) -1- (3-methoxyphenyl) ethylamine (10 g, 6
6 mmol) in dichloromethane (100 ml)
(19 ml, 200 mmol) in dichloromethane (50 ml) at -78 ° C
Was dropped. After stirring at that temperature for 30 minutes, the reaction was carried out at room temperature for 1 hour. After stopping the reaction by adding methanol to the reaction solution, the reaction solution was concentrated under reduced pressure. Tetrahydrofuran (2
00 ml), triethylamine (33.8 g, 330 mmol) and di-tert-butyl dicarbonate (14.5 g, 66 mmol) were added. The resulting mixture was heated at reflux for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N hydrochloric acid and brine, and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography. An oil of (1R) -1- (3-hydroxyphenyl) ethylcarbamic acid tert-butyl ester (13.7 g, 87%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.46 (3H, s), 4.71 (1
H, m), 4.90 (1H, m), 6.68-6.81 (3H, m), 6.94 (1H, s),
7.14 (1H, m). (2) 4-Chloro-2-fluoronitrobenzene (10.6 g, 54 m
mol), (1R) -1- (3-hydroxyphenyl) ethylcarbamic acid tert-butyl ester (13.7 g, 58 mmol), potassium carbonate (8.7 g, 63 mmol) and N, N-dimethylformamide (150
ml) was stirred at 100 ° C. for 1 hour. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and the obtained crystals were recrystallized from hexane-ethyl acetate to give (1R)-(-)-1- [3- (5-chloro-2-nitrophenoxy) phenyl ] Crystals of ethyl carbamic acid tert-butyl ester (12.9 g, 60%) were obtained. 94-96 ° C [α] _D
²⁴ + 50 ° (C = 0.5, MeOH) Elemental analysis: C ₁₉ H ₂₁ N ₂ O ₅ Cl Theoretical: C, 58.09; H, 5.39; N, 7.13. Found: C, 58.12; H, 5.42; ^{. N, 7.04 1 H-NMR} (CDCl 3) δ: 1.41 (12H, m), 4.80 (2H, m), 6.93-
7.42 (6H, m), 7.93 (1H, d).

(3) (1S)-(-)-1- [3- (5-chloro-2-nitrophenoxy) phenyl] ethylcarbamic acid tert-butyl ester (3.5 g, 8.9 mmol) in ethyl acetate (50 g) 5 ml in solution)
% Palladium on carbon (1.1 g) was added. The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 1 hour. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue and 4-bromobutyric acid ethyl ester (7 g, 36 mmol), potassium carbonate (3.7 g,
A mixture of 27 mmol) and N, N-dimethylformamide (50 ml) was stirred at 80 ° C. for 72 hours. After cooling the reaction solution, pour it into water,
Extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N-
[2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl]
An oil of phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.4 g, 56%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.24 (3H, t, J = 7.0Hz), 1.41 (12H,
m), 1.93 (2H, m), 2.37 (2H, m), 3.19 (2H, m), 4.11 (2
(H, q, J = 7.0Hz), 4.21 (1H, m), 4.79 (2H, m), 6.61-7.3
2 (7H, m). (4) 4- [N- [2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]] aminobutyric acid
A mixture of ethyl ester (2.4 g, 5 mmol), 4-phenylbenzoyl chloride (1.6 g, 7.5 mmol) and N, N-dimethylacetamide (50 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N-
[2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl]
An oil of phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester (2.8 g, 86%) was obtained. Elemental analysis: C ₃₈ H ₄₁ N ₂ O ₆ Cl Theoretical: C, 69.45; H, 6.29; N, 4.26. Found: C, 69.22; H, 6.43; N, 4.20. : 1.23 (3H, t, J = 7.0Hz), 1.33 (3H,
m), 1.40 (9H, s), 2.01 (2H, m), 2.47 (2H, m), 3.87 (1
H, m), 4.06 (1H, m), 4.12 (2H, q, J = 7.0Hz), 4.70 (1H,
m), 4.80 (1H, bs), 6.44-6.53 (2H, m), 6.67 (1H, d),
6.97-7.59 (13H, m).

(5) 4- [N- [2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl]
[N]-(4-phenylbenzoyl)] aminobutyric acid ethyl ester (2.5 g, 3.8 mmol) in tetrahydrofuran (20 ml) and ethanol (20 ml)
(20 ml, 20 mmol) was added. At 60 ° C.
Stir for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (2.4 g, 100%) of an amorphous solid was obtained. Elemental analysis: C ₃₆ H ₃₇ N ₂ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 67.76; H, 6.00; N, 4.39. Found: C, 67.76; H, 6.19; N, 4.28. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, m), 1.42 (9H, s), 1.97 (2
H, m), 2.50 (2H, m), 4.00 (1H, m), 4.10 (1H, m), 4.66
(1H, m), 5.00 (1H, bs), 6.59-7.07 (6H, m), 7.30-7.58
(11H, m). (6) 4- [N- [2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl) ] Aminobutyric acid (1.0 g, 1.6 mmol), 2-fluorobenzylamine (0.3 g, 2.4 mmol), 1-ethyl hydrochloride
-3- (3-dimethylaminopropyl) carbodiimide (WSC)
(0.61 g, 3.2 mmol), 1-hydroxybenzotriazole
A mixture of monohydrate (HOBt) (0.43 g, 3.2 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4-
[N '-[2- [3-[(1R) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide (0.48 g, 41 %) Of an amorphous solid. [α] _D ²⁴ + 27 ° (C = 0.5, MeOH) Elemental analysis value C ₄₃ H ₄₃ N ₃ O ₅ ClF ・ 1 / 2H ₂ O Theoretical value: C, 69.30; H, 5.95; N, 5.64. values:. C, 69.60; H, 6.16; N, 5.62 1 H-NMR (CDCl 3) δ:
1.33 (3H, d), 1.39 (9H, s), 1.98 (2H, m), 2.39 (2H,
m), 3.81 (1H, m), 4.12 (1H, m), 4.51 (2H, d, J = 5.8H
z), 4.66 (1H, m), 4.86 (1H, bs), 6.43 (1H, d), 6.45 (1
H, s), 6.63 (1H, d), 6.91 (1H, bs), 6.98-7.59 (17H,
m). (7) N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1R) -1-ter
To a solution of t-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.32 g, 0.48 mmol) in ethyl acetate (3 ml), add 4N ethyl chloride hydrogen chloride The solution (3 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3-[(1R) -1-aminoethyl]
A non-crystalline solid of phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (0.3 g, 94%) was obtained. [α] _D ²⁴ + 0.1 ° (C = 0.5, MeOH) Elemental analysis value C ₃₈ H ₃₆ N ₃ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical value: C, 66.96; H, 5.47; N, 6.16 . Found: C, 66.65; H, 5.44; N, 6.28. ¹ H-NMR (DMSO-d ₆ ) δ: 1.49 (3H, d, J =
6.6 Hz), 1.83 (2H, m), 2.27
(2H, m), 3.78 (2H, m), 4.2
9 (2H, d, J = 5.2 Hz), 4.43 (1
H, m), 6.59 (1H, s), 6.70
(1H, m), 7.11-7.68 (18H,
m), 8.47 (1H, m), 8.66 (3H,
bs).

Example 205 N- [2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N- [3-[[[(2-fluorobenzyl) amino] carbonyl] Amino] propyl] -4-phenylbenzamide hydrochloride (1) 4- [N- [2- [3-[(1S) -1-tert-butoxycarbonylaminoethyl] phenoxy] -4-chlorophenyl] -N- ( 4-phenylbenzoyl)] aminobutyric acid (1.0 g, 1.6 mmol), diphenylphosphoryl azide (DPPA) (0.67 g, 2.4 mmol), triethylamine (0.2 g, 2.0 mmol) and N, N-dimethylformamide (10 ml) The mixture was stirred at room temperature for 6 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Then, add 2
-Fluorobenzylamine (0.5 g, 4.0 mmol) was added and refluxed for another 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water and brine,
After drying over anhydrous magnesium sulfate, the solvent was distilled off. The residue was purified by silica gel column chromatography, and (1
S) -1- [3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorobenzyl) amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy] phenyl] ethylcarbamine acid
A non-crystalline solid of tert-butyl ester (0.66 g, 55%) was obtained. [α] _D ²⁴ -24 ° (C = 0.5, MeOH) Elemental analysis C ₄₃ H ₄₄ N ₄ O ₅ ClF
1 / 2H ₂ O theoretically:. C, 67.93; H, 5.97; N, 7.37 Found:. C, 68.02; H, 5.98; N, 7.27 1 H-NMR (CDCl 3) δ: 1.31 (3H, m), 1.37 (9H, s), 1.76 (2
H, m), 3.36 (2H, m), 3.77 (1H, m), 4.17 (1H, m), 4.43
(2H, d, J = 5.8Hz), 4.66 (1H, bs), 4,84 (1H, m), 5.09 (1
H, m), 5.75 (1H, m), 6.42 (1H, m), 6.53-6.65 (2H, m),
6.95-7.58 (17H, m). (2) (1S) -1- [3- [2-[(4-phenylbenzoyl) [3-[[[(2-
To a solution of tert-butyl fluorobenzyl) amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy] phenyl] ethylcarbamate (0.36 g, 0.48 mmol) in ethyl acetate (3 ml) was added 4N hydrogen chloride acetic acid An ethyl solution (3 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- [2- [3-[(1S) -1-aminoethyl] phenoxy] -4-chlorophenyl] -N- [3-[[(( A non-crystalline solid of 2-fluorobenzyl) amino] carbonyl] amino] propyl] -4-phenylbenzamide hydrochloride (0.31 g, 95%) was obtained. [α] _D ²⁴ -2.1 ° (C = 0.5, MeOH) Elemental analysis value C ₃₈ H ₃₇ N ₄ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical value: C, 65.52; H, 5.50; N, 8.04 Found: C, 65.27; H, 5.57; N, 7.89. ¹ H-NMR (DMSO-d ₆ ) δ: 1.49 (3H, d, J = 6.6 Hz), 1.69 (2H,
m), 3.11 (2H, m), 3.81 (2H, m), 4.25 (2H, m), 4.40 (1
H, m), 6.29 (1H, m), 6.58 (3H, m), 7.10-7.69 (18H,
m), 8.61 (3H, bs).

Example 206 N-[(R) -1-Indanyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl )] Aminobutyramide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.8 g, 1.3 mmol), (R) -1-aminoindan (0.32 g, 2.4 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.5 g, 2.
6 mmol), 1-hydroxybenzotriazole monohydrate (HOB
t) (0.35 g, 2.6 mmol) and N, N-dimethylformamide (10
ml) of the mixture was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography.
[(R) -1-Indanyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]-
N '-(4-phenylbenzoyl)] aminobutyramide (0.79
g, 83%). [α] _D ²¹ + 45 ° (C = 0.5, MeOH) Elemental analysis: C ₄₄ H ₄₄ N ₃ O ₅ Cl Theoretical: C, 72.
36; H, 6.07; N, 5.75. Found: C, 72.20; H, 6.06; N,
5.81. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.88 (1
H, m), 2.00 (2H, m), 2.37 (2H, m), 2.56 (1H, m), 2.88
(2H, m), 3.84 (1H, m), 4.10-4.19 (3H, m), 4.98 (1H, b
s), 5.50 (1H, m), 6.48 (1H, bs), 6.56-6.62 (3H, m),
7.04 (2H, m), 7.18-7.58 (15H, m). (2) N-[(R) -1-indanyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide
(0.22 g, 0.31 mmol) in ethyl acetate (2 ml) was added 4N hydrogen chloride in ethyl acetate (2 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N-[(R) -1-indanyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] [-N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (0.2 g, 98%) was obtained as an amorphous solid. [α] _D ²¹ +46 (C = 0.5, MeOH) Elemental analysis value C ₃₉ H ₃₇ N ₃ O ₃ Cl ₂・ 1 / 2H ₂ O Theoretical value: C, 69.33; H, 5.67; N, 6.22. values:. C, 69.30; H, 5.81; N, 6.11 1 H-NMR (DMSO-d 6) δ: 1.70-1.91 (3H, m), 2.24 (2H, m),
2.31 (1H, m), 2.82 (2H, m), 3.79 (2H, m), 4.10 (2H, m),
5.27 (1H, m), 6.62 (1H, s), 6.76 (1H, m), 7.15-7.68
(18H, m), 8.29 (1H, d), 8.46 (2H, bs).

Example 207 N-[(S) -1-indanyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl )] Aminobutyramide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.5 g, 0.8 mmol), (S) -1-aminoindan (0.23 g, 1.7 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.31 g,
1.6 mmol), 1-hydroxybenzotriazole monohydrate (H
OBt) (0.22 g, 1.6 mmol) and N, N-dimethylformamide (1
0 ml) of the mixture was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N-[(S) -1-indanyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]
-N '-(4-phenylbenzoyl)] aminobutyramide (0.54
g, 91%). [α] _D ²¹ -38 ° (C = 0.5, MeOH) Elemental analysis: C ₄₄ H ₄₄ N ₃ O ₅ Cl Theoretical: C, 72.36; H, 6.
. 07; N, 5.75 Found:. C, 72.10; H, 6.23; N, 5.57 1 H-NMR (CDCl 3) δ: 1.42 (9H, s), 1.88 (1H, m), 2.00 (2
H, m), 2.37 (2H, m), 2.56 (1H, m), 2.88 (2H, m), 3.84
(1H, m), 4.10-4.19 (3H, m), 4.98 (1H, bs), 5.50 (1H,
m), 6.48 (1H, bs), 6.56-6.62 (3H, m), 7.04 (2H, m),
7.18-7.58 (15H, m). (2) N-[(S) -1-indanyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-(4-phenylbenzoyl)] aminobutyramide
(0.22 g, 0.30 mmol) in ethyl acetate (2 ml) was added 4N hydrogen chloride in ethyl acetate (2 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N-[(S) -1-indanyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] [-N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (0.19 g, 97%) was obtained as an amorphous solid. ^{_{[α] D 21 -51 ° (}} C = 0.5, MeOH) Elemental analysis _{C 39 H 37 N 3 O 3} Cl 2 · 1 / 2H 2 O theoretically: C, 69.33; H, 5.67 ; N, 6.22. Found:. C, 69.34; H, 5.75; N, 6.21 1 H-NMR (DMSO-d 6) δ: 1.70-1.91 (3H, m), 2.24 (2H, m),
2.31 (1H, m), 2.82 (2H, m), 3.79 (2H, m), 4.10 (2H, m),
5.27 (1H, m), 6.62 (1H, s), 6.76 (1H, m), 7.15-7.68
(18H, m), 8.29 (1H, d), 8.46 (2H, bs).

Example 208 N-[(R) -1-phenylethyl] -4- [N ′-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N ′-(4-phenyl Benzoyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ( (0.6 g, 0.97 mmol), (R) -1-phenylethylamine (0.25 g, 2.1 mmol), 1-ethyl-3-hydrochloride
(3-Dimethylaminopropyl) carbodiimide (WSC) (0.38
g, 2.0 mmol), a mixture of 1-hydroxybenzotriazole monohydrate (HOBt) (0.26 g, 2.0 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 6 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N-[(R) -1-phenylethyl] -4-
Non-crystallinity of [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutylamide (0.68 g, 97%) A solid was obtained. [α] _D ²¹ + 33 ° (C = 0.5, MeOH) Elemental analysis value C ₄₃ H ₄₄ N ₃ O ₅ Cl ・ 1 / 2H ₂ O Theoretical value: C, 71.01; H, 6.24; N, 5.78. values:. C, 71/08; H, 6.15; N, 5.59 1 H-NMR (CDCl 3) δ: 1.43 (9H, s), 1.52 (3H, m), 1.92 (2
H, m), 2.33 (2H, m), 3.80 (1H, m), 4.10-4.17 (3H, m),
4.93 (1H, bs), 5.15 (1H, m), 6.44 (1H, m), 6.55-6.63
(2H, m), 7.00-7.10 (3H, m), 7.15-7.48 (14H, m), 7.54
-7.59 (2H, m). (2) N-[(R) -1-phenylethyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-(4-phenylbenzoyl)] aminobutyramide (0.31 g, 0.43 mmol) in ethyl acetate (2 ml).
Add hydrogen chloride / ethyl acetate solution (2 ml) and add
Stir for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N-[(R) -1-phenylethyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl ] -N '-(4-phenylbenzoyl)] aminobutylamide hydrochloride (0.24 g, 84%) was obtained as an amorphous solid. ^{_{[α] D 21 + 35 °}} (C = 0.5, MeOH) Elemental analysis _{C 38 H 37 N 3 O 3} Cl 2 · 1 / 2H 2 O theoretically: C, 68.
77; H, 5.77; N, 6.33; Found: C, 68.48; H, 5.89; N, 6.3
^{1. 1 H-NMR (DMSO-} d 6) δ: 1.32 (3H, d, J = 7.0Hz), 1.79 (2H,
m), 2.22 (2H, m), 3.74 (2H, m), 4.01 (2H, m), 4.90 (1
H, m), 6.59 (1H, s), 6.69 (1H, s), 7.12-7.68 (19H,
m), 8.40 (3H, bs).

Example 209 N-[(S) -1-phenylethyl] -4- [N ′-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N ′-(4-phenyl Benzoyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid ( 0.45 g, 0.73 mmol), (S) -1-phenylethylamine (0.18 g, 1.5 mmol), 1-ethyl hydrochloride
3- (3-dimethylaminopropyl) carbodiimide (WSC) (0.
A mixture of 29 g, 1.5 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.20 g, 1.5 mmol) and N, N-dimethylformamide (8 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N-[(S) -1-phenylethyl] -4-
Non-crystallinity of [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide (0.50 g, 94%) A solid was obtained. [α] _D ²¹ -27 ° (C = 0.5, MeOH) Elemental analysis: C ₄₃ H ₄₄ N ₃ O ₅ Cl Theoretical: C, 71.90; H, 6.17; N, 5.85. Found: C, 71.70; . H, 6.42; N, 5.69 1 H-NMR (CDCl 3) δ: 1.43 (9H, s), 1.52 (3H, m), 1.92 (2
H, m), 2.33 (2H, m), 3.80 (1H, m), 4.10-4.19 (3H, m),
4.95 (1H, bs), 5.15 (1H, m), 6.44 (1H, m), 6.55-6.63
(2H, m), 7.00-7.10 (3H, m), 7.15-7.48 (14H, m), 7.54
-7.59 (2H, m). (2) N-[(S) -1-phenylethyl] -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-(4-phenylbenzoyl)] aminobutyramide (0.31 g, 0.43 mmol) in ethyl acetate (2 ml).
Add hydrogen chloride / ethyl acetate solution (2 ml) and add
Stir for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration and washed with ethyl ether.
N-[(S) -1-phenylethyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide Hydrochloride (0.24 g, 84%)
A non-crystalline solid was obtained. [α] _D ²¹ 34 ° (C = 0.5, MeOH) Elemental analysis: C ₃₈ H ₃₇ N ₃ O ₃ Cl ₂ Theoretical: C, 69.72; H, 5.70; N, 6.42. Found: C, 69.33; . H, 6.03; N, 6.23 1 H-NMR (DMSO-d 6) δ: 1.32 (3H, d, J = 7.0Hz), 1.80 (2H,
m), 2.23 (2H, m), 3.79 (2H, m), 4.01 (2H, m), 4.91 (1
H, m), 6.60 (1H, s), 6.74 (1H, m), 7.14-7.69 (19H,
m), 8.50 (3H, m).

Example 210 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(5-bromo-2-furancarbonyl)] aminobutyramide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] ] -4-Chlorophenyl]] aminobutyric acid ethyl ester (1.5 g, 3.2 mmol), 5-bromofurancarbonyl chloride (0.82 g, 3.9 mmol) and a mixture of N, N-dimethylacetamide (15 ml) at room temperature for 5 hours Stirred. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- (5-bromo-2-furancarbonyl)
A non-crystalline solid of -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.7 g, 82%) was obtained. Elemental analysis value C ₂₉
H ₃₂ N ₂ O ₇ theory as BrCl:. C, 54.77; H , 5.07; N, 4.41 Found:. C, 54.68; H, 5.04; N, 4.49 1 H-NMR (CDCl 3) δ: 1.22 ( 3H, t, J = 7.0Hz), 1.45 (9H,
s), 1.96 (2H, m), 2.43 (2H, m), 3.86 (2H, m), 4.10 (2
H, q, J = 7.0Hz), 4.28 (2H, d, J = 5.6Hz), 4.96 (1H, bs),
6.28 (2H, m), 6.74-6.80 (3H, m), 7.10 (2H, m), 7.21-
7.34 (2H, m). (2) 4- [N- (5-bromo-2-furancarbonyl) -N- [2- [3- (te
rt-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.5 g, 2.3
mmol) of tetrahydrofuran (20 ml) and ethanol (20 m
l) solution in 1N aqueous sodium hydroxide solution (10 ml, 10 mm
ol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue and 2-fluorobenzylamine (0.45 g, 3.6 mmol),
1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.89 g, 4.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.63 g, 4.6 mmol) and N, N- A mixture of dimethylformamide (6 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate.
After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-(5-
A non-crystalline solid of bromo-2-furancarbonyl) -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminobutyramide (1.2 g, 74%) was obtained. Was. Elemental analysis _{C 34 H 34 N 3 O 6} BrClF theoretically:. C, 57.11; H, 4.79; N, 5.88 Found:. C, 57.06; H, 4.98; N, 6.02 1 H-NMR (CDCl 3 ) δ: 1.44 (9H, s), 1.94 (2H, m), 2.34 (2
H, m), 3.82 (1H, m), 3.93 (1H, m), 4.25 (2H, d, J = 5.6
Hz), 4.48 (2H, d, J = 5.8Hz), 5.01 (1H, bs), 6.25 (2H,
m), 6.69-6.78 (4H, m), 6.98-7.36 (8H, m). (3) N- (2-fluorobenzyl) -4- [N '-(5-bromo-2-furancarbonyl)- To a solution of N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.18 g, 0.25 mmol) in ethyl acetate (2 ml), add 4N ethyl acetate hydrogen chloride The solution (2 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-
Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(5-bromo-2-furancarbonyl)] aminobutylamide hydrochloride (0.11 g , 68%) of an amorphous solid. Elemental analysis _{C 29 H 27 N 3 O 4} BrCl 2 F theoretically:. C, 53.48; H, 4.18; N, 6.45 Found:. C, 53.65; H, 4.46; N, 6.30 1 H-NMR ( DMSO-d ₆ ) δ: 1.79 (2H, m), 2.23 (2H, m), 3.68
(1H, m), 3.79 (1H, m), 4.01 (2H, m), 4.28 (2H, d, J =
5.0Hz), 6.27 (1H, bs), 6.62 (1H, d, J = 3.6Hz), 6.80 (1H
H, d), 6.85 (1H, d, J = 3.6Hz), 7.11-7.59 (9H, m), 8.4
2 (3H, m).

Example 211 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(5-phenyl-2-furancarbonyl)] aminobutyramide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-(5-bromo- 2-furancarbonyl) -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide (0.49 g, 0.68 mmol), phenylboronic acid (0.1
3 g, 1.0 mmol), sodium carbonate (0.24 g, 1.7 mmol),
A mixture of toluene (20 ml), ethanol (5 ml) and water (5 ml) was stirred at room temperature under an argon atmosphere for 10 minutes. Tetrakis
(Triphenylphosphine) palladium (0) (39 mg, 0.034
(mmol) was added and the mixture was heated under reflux for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract is washed with water and brine, dried over anhydrous magnesium sulfate,
It was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2-
A non-crystalline solid of [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(5-phenyl-2-furancarbonyl)] aminobutyramide (0.43 g, 89%) was obtained. Was. Elemental analysis _{C 40 H 39 N 3 O 6} ClF theoretically:. C, 67.46; H, 5.52; N, 5.90 Found:. C, 67.25; H, 5.47; N, 5.86 1 H-NMR (CDCl 3 ) δ: 1.42 (9H, s), 1.97 (2H, m), 2.38 (2
H, m), 3.85 (1H, m), 4.04 (1H, m), 4.06 (2H, d, J = 5.8
Hz), 4.50 (2H, d, J = 5.8Hz), 4.80 (1H, bs), 6.60-6.66
(3H, m), 6.82 (2H, m), 6.98-7.38 (14H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxy Carbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(5-phenyl-2-furancarbonyl)] aminobutyramide (0.28 g, 0.39 mmol) in ethyl acetate (2 ml)
Add 4N hydrogen chloride / ethyl acetate solution (2 ml) to the solution,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2
-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(5-phenyl-2-furancarbonyl)] aminobutylamide hydrochloride (0.24 g, 95
%) Of an amorphous solid. Elemental analysis _{C 35 H 32 N 3 O 4} Cl 2 F theoretically:. C, 64.82; H, 4.97; N, 6.48 Found:. C, 64.81; H, 5.08; N, 6.25 1 H-NMR ( DMSO-d ₆ ) δ: 1.87 (2H, m), 2.25 (2H, m), 3.70
(1H, m), 3.91 (3H, m), 4.28 (2H, d, J = 5.6Hz), 6.72 (1
H, m), 6.87 (2H, m), 7.01-7.42 (14H, m), 7.65 (1H,
d), 8.42 (3H, m).

Example 212 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(2-methoxyphenyl) -2-furancarbonyl]] aminobutyramide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-(5 -Bromo-2-furancarbonyl) -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide (0.42 g, 0.59 mmol), 2-methoxyphenylboron Acid (0.13 g, 0.88 mmol), sodium carbonate (0.2 g, 1.
5 mmol), toluene (20 ml), ethanol (5 ml) and water (5 m
The mixture of l) was stirred at room temperature under argon atmosphere for 10 minutes.
Tetrakis (triphenylphosphine) palladium (0) (34
mg, 0.029 mmol), and the mixture was heated under reflux for 12 hours.
After cooling, the reaction solution was poured into water and extracted with ethyl acetate.
The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl)
-4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(2-methoxyphenyl) -2-furancarbonyl]] aminobutyramide (0.39
g, 89%) of an amorphous solid. Elemental analysis value C ₄₁ H ₄₁ N ₃ O ₇
Theory as ClF:. C, 66.35; H , 5.57; N, 5.66 Found:. C, 66.05; H, 5.47; N, 5.52 1 H-NMR (CDCl 3) δ: 1.42 (9H, s), 1.97 (2H, m), 2.38 (2
H, m), 3.84 (1H, m), 3.92 (3H, s), 4.02 (2H, d, J = 5.2
Hz), 4.03 (1H, m), 4.50 (2H, d, J = 5.6Hz), 4.82 (1H, b
s), 6.49 (1H, s), 6.66 (1H, m), 6.78-7.37 (16H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[(2-methoxyphenyl) -2-furancarbonyl]] aminobutyramide (0.25 g, 0.34 mmol) in ethyl acetate (2 ml) Add 4N hydrogen chloride to ethyl acetate solution (2 m
l) was added and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' A non-crystalline solid of-[(2-methoxyphenyl) -2-furancarbonyl]] aminobutylamide hydrochloride (0.19 g, 82%) was obtained. Elemental analysis _{C 36 H 34 N 3 O 5} Cl 2 F theoretically:. C, 63.72; H, 5.05; N, 6.19 Found:. C, 63.69; H, 5.23; N, 6.20 1 H-NMR ( DMSO-d ₆ ) δ: 1.83 (2H, m), 2.26 (2H, m), 3.70
(1H, m), 3.84 (3H, m), 3.90 (3H, s), 4.28 (2H, d, J =
4.4Hz), 6.70 (1H, m), 6.82-6.93 (5H, m), 7.08-7.42 (1
0H, m), 7.64 (1H, d), 8.45 (3H, m).

Example 213 N- (2-fluorobenzyl) -4- [N '-[(4-acetylaminophenyl) acetyl] -N'-[2- [3- (aminomethyl) phenoxy] -4- Chlorophenyl]] aminobutylamide hydrochloride (1) 4-aminophenylacetic acid ethyl ester (5.0 g, 28
mmol), acetyl chloride (2.6 g, 34 mmol) and N, N-dimethylacetamide (30 ml) were stirred at room temperature for 30 minutes. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, and then dried over anhydrous magnesium sulfate. Concentrate under reduced pressure and add the residue to a solution of tetrahydrofuran (100 ml) and ethanol (100 ml).
A normal aqueous sodium hydroxide solution (90 ml, 90 mmol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. Water was added to the reaction solution, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was crystallized from hexane-ethyl acetate to give a solid of 4-acetamidophenylacetic acid (3.8 g, 71%). ¹ H-NMR (DMSO-d ₆ ) δ:
2.03 (3H, s), 3.49 (2H, s), 7.71 (2H, d, J = 8.6Hz), 7.
51 (2H, d, J = 8.6Hz), 9.91 (1H, s) .4-acetamidophenylacetic acid (1.0 g, 5.2 mmol), oxalyl chloride (1.3 g, 10 mmol), N, N-dimethylformamide (0.5 ml) in tetrahydrofuran (30 ml) was stirred at room temperature for 1 hour. After concentrating the reaction solution under reduced pressure, 4- [N
-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester
(1.2 g, 2.6 mmol) and N, N-dimethylacetamide (40 ml)
Was added. The resulting mixture was stirred at room temperature for 24 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N '-[(4-
Acetylaminophenyl) acetyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.1 g, 67%) was obtained as an amorphous solid. . Elemental analysis C ₃₄ H ₄₀ N ₃ O ₇ theory as Cl:. C, 63.99; H , 6.32; N, 6.58 Found:. C, 63.80; H, 6.32; N, 6.63 1 H-NMR (CDCl 3 ) δ: 1.20 (3H, t, J = 7.2Hz), 1.46 (9H,
s), 1.84 (2H, m), 2.34 (2H, m), 2.16 (3H, s), 3.48 (2
H, s), 3.51 (1H, m), 3.91 (1H, m), 4.07 (2H, q, J = 7.2
Hz), 4.27 (2H, m), 5.20 (1H, bs), 6.70 (2H, m), 6.82-
7.18 (6H, m), 7.27-7.38 (3H, m), 8.00 (1H, bs). (2) 4- [N '-[(4-acetylaminophenyl) acetyl] -N-
[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester
To a solution of (0.91 g, 1.4 mmol) in tetrahydrofuran (10 ml) and ethanol (10 ml) was added a 1N aqueous sodium hydroxide solution (8 ml, 8 mmol). At 60 ° C.
Stir for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue and 2-fluorobenzylamine (0.30 g, 2.
4 mmol), 1-ethyl-3- (3-dimethylaminopropyl) hydrochloride
Carbodiimide (WSC) (0.55 g, 2.9 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.39 g, 2.9 mmo
A mixture of l) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 24 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[(4-acetylaminophenyl) acetyl] -N'-
[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.88 g,
86%) of an amorphous solid. Elemental analysis _{C 39 H 42 N 4 O 6} ClF theoretically:. C, 65.31; H, 5.90; N, 7.81 Found:. C, 65.21; H, 5.82; N, 7.86 1 H-NMR (CDCl 3 ) δ: 1.45 (9H, s), 1.83 (2H, m), 2.15 (3
H, s), 2.22 (2H, m), 3.46 (2H, s), 3.63 (1H, m), 3.78
(1H, m), 4.25 (2H, m), 4.44 (2H, d, J = 6.0Hz), 5.26 (1
H, bs), 6.68-7.38 (16H, m), 7.99 (1H, bs). (3) N- (2-fluorobenzyl) -4- [N '-[(4-acetylaminophenyl) acetyl]- N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.59 g, 0.82 mmol) in ethyl acetate (4
4N hydrogen chloride / ethyl acetate solution (4 ml) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid is collected by filtration and washed with ethyl ether.
N- (2-fluorobenzyl) -4- [N '-[(4-acetylaminophenyl) acetyl] -N'-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide Hydrochloride (0.
53 g, 99%) of an amorphous solid was obtained. Elemental analysis: C ₃₄ H ₃₅ N ₄ O ₄ Cl ₂ F ・ 1 / 4H ₂ O Theoretical: C, 62.05; H, 5.44; N, 8.51. Found: C, 62.07; H, 5.55; N, 8.26 . ¹ H-NMR (DMSO-d ₆ ) δ: 1.70 (2H, m),
2.02 (3H, s), 2.19 (2H, m),
3.39 (2H, s), 3.76 (1H,
m), 4.05 (3H, m), 4.28 (2H,
m), 6.83-7.45 (15H, m),
8.51 (1H, bs), 8.54 (2H, b
s), 10.05 (1H, bs).

Example 214 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- (benzenesulfonylamino) Benzoyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyl A mixture of amide (1.1 g, 2.0 mmol), 4-nitrobenzoyl chloride (0.49 g, 2.6 mmol) and N, N-dimethylacetamide (20 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 A non-crystalline solid of -chlorophenyl] -N '-(4-nitrobenzoyl)] aminobutyramide (1.3 g, 89%) was obtained. Elemental analysis: C ₃₆ H ₃₆ N ₄ O ₇ ClF · 1 / 2H ₂ O Theoretical: C, 61.76; H, 5.33; N, 8.00. Found: C, 62.08; H, 5.48; N, 7.90. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.98 (2H, m), 2.35 (2
H, m), 3.86 (1H, m), 4.01 (1H, m), 4.24 (2H, d, J = 6.2
Hz), 4.48 (2H, d, J = 5.8Hz), 5.14 (1H, bs), 6.98-7.35
(8H, m), 7.51 (2H, d, J = 8.8Hz), 8.06 (2H, d, J = 8.8H
z). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-nitro Benzoyl)] aminobutyramide
(0.7 g, 1.0 mmol) in ethyl acetate (15 ml) was added 5% palladium on carbon (0.21 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 1 hour. Filter off the catalyst,
The filtrate was concentrated under reduced pressure. Dissolve the residue in N, N-dimethylacetamide (10 ml) and add benzenesulfonyl chloride
(0.45 g, 2.6 mmol) was added. After the obtained mixture was stirred at room temperature for 4 hours, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to give N- (2-fluorobenzyl) -4-
[N '-[4- (benzenesulfonylamino) benzoyl] -N'-[2
-[3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.57 g, 7
(0%) amorphous solid. Elemental analysis: C ₄₂ H ₄₂ N ₄ O ₇ ClFS ・ 1 / 2H ₂ O Theoretical: C, 62.25; H, 5.35; N, 6.91. Found: C, 62.37; H, 5.25; N, 6.70. ¹ H-NMR (CDCl ₃ ) δ: 1.45 (9H, s), 1.95 (2H, m), 2.36 (2
H, m), 3.69 (1H, m), 4.12 (3H, m), 4.49 (2H, d, J = 5.4
Hz), 5.20 (1H, bs), 5.92 (1H, bs), 6.50-6.59 (2H, m),
6.89-7.53 (16H, m), 7.71 (2H, d), 8.09 (1H, bs). (3) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert- Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[4- (benzenesulfonylamino) benzoyl]] aminobutyramide (0.33 g, 0.41 mmol) in ethyl acetate (2 ml) solution 4N Hydrogen chloride Ethyl acetate solution (2 m
l) was added and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' -[4- (benzenesulfonylamino) benzoyl]] aminobutyramide
An amorphous solid of hydrochloride (0.30 g, 99%) was obtained. Elemental analysis: C ₃₇ H ₃₅ N ₄ O ₅ Cl ₂ FS ・ 1 / 2H ₂ O Theoretical: C, 59.52; H, 4.86; N, 7.50. Found: C, 59.36; H, 5.09; N, 7.20 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.76 (2H, m), 2.21 (2H, m), 3.67
(2H, m), 3.99 (2H, m), 4.27 (2H, d, J = 5.6Hz), 6.51 (2
H, m), 6.95-7.75 (18H, m), 8.47 (3H, m), 10.60 (1H,
s).

Example 215 N- (1,2,3,4-tetrahydronaphthalen-1-yl) -4- [N ′-[2
-[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N '
-(4-Phenylbenzoyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl )] Aminobutyric acid (0.5 g, 0.81 mmol), 1,2,3,4-tetrahydro-1-naphthylamine hydrochloride (0.22 g, 1.2 mmo
l), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.32 g, 1.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.22 g, 1.6 mmol),
A mixture of triethylamine (0.15 g, 1.5 mmol) and N, N-dimethylformamide (8 ml) was stirred at room temperature for 6 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (1,2,3,4-tetrahydronaphthalen-1-yl) -4- [N '-[2- [3- (tert A non-crystalline solid of -butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.58 g, 96%) was obtained. Elemental analysis _{C 45 H 46 N 3 O 5} Cl · 1 / 2H 2 O theoretically:. C, 71.75; H, 6.29; N, 5.58 Found:. C, 71.70; H, 6.31; N, 5.59 1 H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.83 (1H, m), 2.00 (2
H, m), 2.36 (2H, m), 2.76 (2H, m), 3.81 (1H, m), 4.07
(1H, m), 4.19 (2H, m), 4.99 (1H, bs), 5.22 (1H, m), 6.
48-6.63 (4H, m), 7.00-7.58 (17H, m). (2) N- (1,2,3,4-tetrahydronaphthalen-1-yl) -4-
[N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide (0.30 g, 0.41 mmol) in ethyl acetate ( 3 ml) solution in 4N hydrogen chloride / ethyl acetate solution (3 ml).
ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (1,2,3,4-tetrahydronaphthalen-1-yl)-
Non-crystalline property of 4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide hydrochloride (0.26 g, 94%) A solid was obtained. Elemental analysis _{C 40 H 39 N 3 O 3} Cl 2 · 1 / 2H 2 O theoretically:. C, 69.66; H, 5.85; N, 6.09 Found: C, 69.32; H, 5.75 ; N, 5.98. ¹ H-NMR (DMSO-d ₆ ) δ: 1.68 (2H, m), 1.84 (4H, m), 2.24
(2H, m), 2.73 (2H, m), 3.80 (2H, m), 4.01 (2H, m), 4.9
6 (1H, m), 6.62 (1H, s), 6.77 (1H, m), 7.10-7.68 (18H,
m), 8.28 (1H, d), 8.44 (2H, bs).

Example 216 N-[[3- (aminomethyl) phenoxy] -4-chlorophenyl]-
N- [2-[[[(2-fluorobenzyl) amino] carbonyl] amino] ethyl] -9H-fluorene-2-carboxamide hydrochloride (1) 3- [N- [2- [3- (tert-butoxy) Carbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminopropionic acid ethyl ester (1.8 g, 4.1 mmol), 9H-fluorene-
A mixture of 2-carbonyl chloride (1.2 g, 5.3 mmol) and N, N-dimethylacetamide (20 ml) was stirred at room temperature for 4 hours.
The reaction solution was poured into water and extracted with ethyl acetate. Extract
After washing with 1N aqueous sodium hydroxide solution and brine,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure,
The residue was purified by silica gel column chromatography to give 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
2-carbonyl)] aminopropionic acid ethyl ester (1.
(8 g, 68%) of an amorphous solid. Elemental analysis value C ₃₇ H ₃₇ N _{2
O 6 Cl · 1 / 2H 2} O theoretically:. C, 68.35; H, 5.89; N, 4.31 Found:. C, 68.62; H, 6.13; N, 4.15 1 H-NMR (CDCl 3) δ: 1.25 (3H, t, J = 7.0Hz), 1.44 (9H,
s), 2.73 (1H, m), 2.85 (1H, m), 3.71 (2H, m), 4.03-4.
17 (5H, m), 4.23 (1H, m), 4.71 (1H, bs), 6.52 (3H, m),
6.95-7.76 (11H, m). (2) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
2-carbonyl)] aminopropionic acid ethyl ester (1.
6 g, 2.4 mmol) in tetrahydrofuran (30 ml) and ethanol (30 ml).
ml, 12 mmol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
A non-crystalline solid of [2-carbonyl)] aminopropionic acid (1.4 g, 96%) was obtained. Elemental analysis: C ₃₅ H ₃₃ N ₂ O ₆ Cl ・ 5 / 4H ₂ O Theoretical: C, 66.14; H, 5.63; N, 4.41. Found: C, 66.35; H, 5.64; N, 4.02. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.84 (2H, m), 3.73 (2
H, m), 4.10 (3H, m), 4.28 (1H, m), 4.80 (1H, bs), 6.4
8-6.55 (3H, m), 6.94-7.76 (12H, m).

(3) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H
-Fluorene-2-carbonyl)] aminopropionic acid (0.6
g, 0.98 mmol), diphenylphosphoryl azide (DPPA) (0.4
g, 1.5 mmol), triethylamine (0.12 g, 1.2 mmol)
And N, N-dimethylformamide (5 ml) at room temperature
Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20
ml) was added, and the resulting mixture was stirred for 3 hours while heating under reflux. Then, 2-fluorobenzylamine (0.3
9 g, 3.1 mmol) and triethylamine (0.36 g, 3.6 mmol)
Was added and refluxed for another 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorobenzyl) amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy ] Benzylcarbamic acid tert-
A non-crystalline solid of butyl ester (0.4 g, 55%) was obtained. Elemental analysis: C ₄₂ H ₄₀ N ₄ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 67.78; H, 5.55; N, 7.53. Found: C, 67.68; H, 5.65; N, 7.31. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (9H, s), 3.45 (1H, m), 3.56 (1
H, m), 3.70 (2H, m), 4.00-4.14 (4H, m), 4.36 (2H, m),
5.02 (1H, m), 5.20 (1H, bs), 5.65 (1H, bs), 6.53 (3H,
m), 6.92-7.53 (14H, m), 7.75 (1H, m). (4) 3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorobenzyl) amino] carbonyl] Amino] propyl] amino]
-5-Chlorophenoxy] benzylcarbamic acid tert-butyl ester (0.29 g, 0.39 mmol) in ethyl acetate (2 ml) was added 4N hydrogen chloride in ethyl acetate (2 ml),
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether and N-
[[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N-
[2-[[[(2-Fluorobenzyl) amino] carbonyl] amino] ethyl] -9H-fluorene-2-carboxamide hydrochloride
(0.26 g, 100%) of an amorphous solid was obtained. Elemental analysis: C ₃₇ H ₃₃ N ₄ O ₃ Cl ₂ F.H ₂ O Theoretical: C, 64.44; H, 5.12; N, 8.12. Observed: C, 64.59; H, 5.12; N, 7.89. ¹ H-NMR (DMSO-d ₆ ) δ: 3.32 (2H, m), 3.58 (1H, m), 3.98
(5H, m), 4.26 (2H, s), 6.62 (1H, bs), 6.77 (1H, bs),
7.15-7.37 (12H, m), 7.57-7.91 (5H, m), 8.46 (3H, bs).

Example 217 N-[[3- (Aminomethyl) phenoxy] -4-chlorophenyl]-
N- [2-[[[2-[(2-fluorophenyl) ethyl] amino] carbonyl] amino] ethyl] -9H-fluorene-2-carboxamide hydrochloride (1) 3- [N- [2- [3 -(tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
2-carbonyl)] aminopropionic acid (0.69 g, 1.1 mmol),
Diphenylphosphoryl azide (DPPA) (0.48 g, 1.8 mmo
l), a mixture of triethylamine (0.14 g, 1.4 mmol) and N, N-dimethylformamide (5 ml) was stirred at room temperature for 1 hour.
The reaction solution was poured into water and extracted with ethyl acetate. Extract water with water,
After washing with brine and drying over anhydrous magnesium sulfate, the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. afterwards,
Add 2-fluorophenethylamine (0.40 g, 2.8 mmo
l) and triethylamine (0.29 g, 2.8 mmol)
The mixture was refluxed for another 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 3- [2-
[(4-phenylbenzoyl) [3-[[[2-[(2-fluorophenyl) ethyl] amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy] benzylcarbamic acid tert-
A non-crystalline solid of butyl ester (0.55 g, 65%) was obtained. Elemental analysis: C ₄₃ H ₄₂ N ₄ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 68.11; H, 5.72; N, 7.39. Found: C, 68.17; H, 5.68; N, 7.31. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 2.78 (2H, m), 3.36 (2
H, m), 3.48 (2H, m), 3.73 (2H, d, J = 5.0Hz), 4.01-4.1
4 (4H, m), 4.81 (1H, bs), 5.04 (1H, m), 5.45 (1H, m),
6.53 (3H, m), 6.94-7.42 (11H, m), 7.55 (3H, m), 7.75
(1H, m). (2) 3- [2-[(4-phenylbenzoyl) [3-[[[2-[(2-fluorophenyl) ethyl] amino] carbonyl] amino] propyl] amino] -5 -Chlorophenoxy] benzylcarbamic acid
To a solution of tert-butyl ester (0.35 g, 0.46 mmol) in ethyl acetate (2 ml) was added 4N hydrogen chloride in ethyl acetate (2 m
l) was added and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N-[[3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- [2-[[[2-[(2-fluorophenyl) Ethyl [amino] carbonyl] amino] ethyl] -9H-fluorene-2-carboxamide hydrochloride (0.31 g, 98%) was obtained as an amorphous solid. Elemental analysis: C ₃₈ H ₃₅ N ₄ O ₃ Cl ₂ F ・ 2H ₂ O Theoretical: C, 63.25; H, 5.45; N, 7.76. Found: C, 63.10; H, 5.17; N, 7.53. ¹ H-NMR (DMSO-d ₆ ) δ: 2.72 (2H, m), 3.23 (4H, m), 3.85
(2H, s), 3.98 (2H, m), 4.52 (2H, m), 6.62 (1H, s), 6.
77 (1H, m), 7.10-7.37 (12H, m), 7.60 (3H, m), 7.78 (1
H, d), 7.90 (1H, d), 8.46 (3H, bs).

Example 218 N- (2-trifluoromethylbenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl) ] Aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (0.45 g , 0.73 mmol), 2-trifluorobenzylamine (0.27 g, 1.5 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC)
(0.29 g, 1.5 mmol), 1-hydroxybenzotriazole
A mixture of monohydrate (HOBt) (0.2 g, 1.5 mmol) and N, N-dimethylformamide (8 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-trifluoromethylbenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] A non-crystalline solid of [-4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.45 g, 80%) was obtained. Theory as elemental analysis _{C 43 H 41 N 3 O 5} ClF 3:. C, 66.88; H, 5.35; N, 5.44 Found:. C, 66.73; H, 5.37; N, 5.23 1 H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.98 (2H, m), 2.41 (2
H, m), 3.85 (1H, m), 4.16 (1H, m), 4.20 (2H, d, J = 5.2
Hz), 4.65 (2H, d, J = 5.2Hz), 4.98 (1H, bs), 6.47 (1H,
m), 6.59 (2H, d), 6.86 (1H, m), 7.01-7.09 (2H, m), 7.
18-7.66 (15H, m). (2) N- (2-trifluoromethylbenzyl) -4- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.24 g, 0.31 mmol) in ethyl acetate (2 ml)
To the solution was added a 4N hydrogen chloride / ethyl acetate solution (2 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid is collected by filtration and washed with ethyl ether.
N- (2-trifluoromethylbenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide hydrochloride (0.21 g,
96%) of an amorphous solid was obtained. Elemental analysis _{C 38 H 34 N 3 O 3} Cl 2 F 3 · 1 / 2H 2 O theoretically:. C, 63.60; H, 4.92; N, 5.86 Found: C, 63.73; H, 4.87 ; N, 5.60. ¹ H-NMR (DMSO-d ₆ ) δ: 1.88 (2H, m),
2.34 (2H, m), 3.80 (2H, m),
4.01 (2H, m), 4.44 (2H,
m), 6.60 (1H, s), 6.73 (2H,
m), 7.17-7.24 (2H, m), 7.3
8-7.73 (15H, m), 8.53 (3H,
m).

Example 219 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- (benzoylamino) benzoyl ]] Aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (3.0 g, 6.5 mmol), 4 -Nitrobenzoyl chloride (1.8 g, 9.8 mmol), 4-dimethylaminopyridine (1.
A mixture of 2 g, 9.8 mmol) and tetrahydrofuran (60 ml) was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure, poured into water, and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-nitro Benzoyl)] aminobutyric acid ethyl ester (1.9 g, 48%)
A non-crystalline solid was obtained. Elemental analysis: C ₃₁ H ₃₄ N ₃ O ₈ Cl Theoretical: C, 60.83; H, 5.60; N, 6.87; Found: C, 60.78;
. H, 5.72; N, 6.76 1 H-NMR (CDCl 3) δ: 1.24 (3H, t, J = 7.4H
z), 1.44 (9H, s), 1.98 (2H, m), 2.45 (2H, m), 3.89 (1
H, m), 3.97 (1H, m), 4.12 (2H, q, J = 7.4Hz), 4.27 (2H,
d, J = 6.0Hz), 5.03 (1H, bs), 6.57-6.68 (3H, m), 6.97-
7.34 (4H, m), 7.51 (2H, d, J = 8.8Hz), 8.07 (2H, d, J = 8.
(2) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-nitrobenzoyl)] aminobutyric acid ethyl ester (0.82 g, 1.3 mmol) in ethyl acetate (50 ml) in 5% palladium on carbon (0.23
g) was added. The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 1 hour. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (20 ml),
Benzoyl chloride (0.4 g, 2.9 mmol) and 4-dimethylaminopyridine (0.33 g, 2.7 mmol) were added. After stirring the resulting mixture at room temperature for 12 hours, the reaction solution was poured into water,
Extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to give 4- [N- [4- (benzoylamino) benzoyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]]
An amorphous solid of aminobutyric acid ethyl ester (0.85 g, 91%) was obtained. Elemental analysis C ₃₈ H ₄₀ N ₃ O ₇ theory as Cl:. C, 66.51; H , 5.88; N, 6.12 Found:. C, 66.55; H, 6.18; N, 5.84 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.0Hz), 1.42 (9H,
s), 1.99 (2H, m), 2.47 (2H, m), 3.71 (1H, m), 4.13 (3
H, m), 4.15 (2H, d), 5.23 (1H, bs), 5.94 (1H, s), 6.51
(1H, s), 6.79 (1H, m), 7.03 (2H, m), 7.25-7.35 (4H,
m), 7.41-7.54 (5H, m), 7.94 (2H, d), 8.71 (1H, bs).

(3) 4- [N- [4- (benzoylamino) benzoyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (0.73 g, 1.1 mmol) in tetrahydrofuran (10 m
To a solution of l) and ethanol (10 ml) was added a 1N aqueous sodium hydroxide solution (5 ml, 5 mmol). The resulting mixture
Stirred at 60 ° C. for 2 hours. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure to obtain an amorphous solid (690 mg).
This amorphous solid (0.4 g, 0.61 mmol), 2-fluorobenzylamine (0.16 g, 1.3 mmol), 1-ethyl-3- (3-hydrochloric acid)
Dimethylaminopropyl) carbodiimide (WSC) (0.23 g,
1.2 mmol), 1-hydroxybenzotriazole monohydrate
(HOBt) (0.17 g, 1.2 mmol) and N, N-dimethylformamide
(6 ml) was stirred at room temperature for 24 hours. The reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- (benzoylamino) benzoyl]] An amorphous solid of aminobutyramide (0.36 g, 78%) was obtained. Elemental analysis: C ₄₃ H ₄₂ N ₄ O ₆ ClF · 1 / 2H ₂ O Theoretical: C, 66.70; H, 5.60; N, 7.24. Found: C, 66.81; H, 5.75; N, 6.87. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.94 (2H, m), 2.38 (2
H, m), 3.68 (1H, m), 4.13 (2H, d, J = 4.8Hz), 4.20 (1H,
m), 4.51 (2H, d, J = 5.8Hz), 5.26 (1H, bs), 5.90 (1H,
s), 6.51 (1H, s), 6.72 (1H, d), 6.99-7.09 (5H, m), 7.
19-7.54 (11H, m), 7.93 (2H, d), 9.10 (1H, bs). (4) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert- Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[4- (benzoylamino) benzoyl]] aminobutyramide (0.17 g, 0.22 mmol) in ethyl acetate (2 ml)
Add 4N hydrogen chloride / ethyl acetate solution (2 ml) to the solution,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2
-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- (benzoylamino)
Benzoyl]] aminobutylamide hydrochloride (0.14 g, 91
%) Of an amorphous solid. Elemental analysis: C ₃₈ H ₃₅ N ₄ O ₄ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 64.23; H, 5.11; N, 7.88. Found: C, 64.46; H, 5.09; N, 7.88 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.81 (2H, m), 2.25 (2H, m), 3.73
(2H, m), 4.03 (2H, m), 4.30 (2H, m), 6.61 (1H, s), 6.
80 (1H, m), 7.08-7.72 (16H, m), 7.97 (2H, d), 8.45 (3
H, m), 10.44 (1H, bs).

Example 220 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[4- (methanesulfonylamino) benzoyl]] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] ] -4-Chlorophenyl] -N- (4-nitrobenzoyl)] aminobutyric acid ethyl ester (0.82 g, 1.3 mmol) in ethyl acetate (50 ml) was added 5% palladium on carbon (0.23 g).
g) was added. The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 2 hours. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (20 ml),
Methanesulfonyl chloride (0.64 g, 5.8 mmol) and 4-dimethylaminopyridine (0.66 g, 5.4 mmol) were added.
After the resulting mixture was stirred at room temperature for 12 hours and at 50 ° C. for 12 hours, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to give 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- [4- ( Methanesulfonylamino) benzoyl]] aminobutyric acid ethyl ester (0.50 g, 56%) was obtained as an amorphous solid. Elemental analysis _{C 32 H 38 N 3 O 8} ClS theoretically:. C, 58.22; H, 5.80; N, 6.36 Found:. C, 58.13; H, 6.02; N, 6.12 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.2Hz), 1.45 (9H,
s), 1.97 (2H, m), 2.46 (2H, m), 2.96 (3H, s), 3.70 (1
H, m), 4.11 (2H, q, J = 7.2Hz), 4.14 (3H, m), 5.13 (1H,
bs), 5.99 (1H, s), 6.57 (1H, s), 6.74 (1H, m), 7.02-
7.07 (4H, m), 7.24-7.32 (4H, m), 7.73 (1H, bs). (2) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4- Chlorophenyl] -N- [4- (methanesulfonylamino) benzoyl]] aminobutyric acid ethyl ester
(0.42 g, 0.64 mmol) in tetrahydrofuran (5 ml) and ethanol (5 ml) in 1N aqueous sodium hydroxide solution
(5 ml, 5 mmol) was added. The resulting mixture is heated at 60 ° C for 1
Stirred for hours. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue and 2-fluorobenzylamine (0.14 g, 1.1
mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.2 g, 1.1 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.14 g, 1.1 mmol).
A mixture of N, N-dimethylformamide (5 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4
-[N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[4- (methanesulfonylamino) benzoyl]] aminobutylamide (0.32 g, 74
%) Of an amorphous solid. Elemental analysis C ₃₇ H ₄₀ N ₄ O ₇ theory as ClFS:. C, 60.11; H , 5.45; N, 7.58 Found:. C, 59.93; H, 5.49; N, 7.76 1 H-NMR (CDCl 3 ) δ: 1.44 (9H, s), 1.94 (2H, m), 2.38 (2
H, m), 2.95 (3H, s), 3.69 (1H, m), 4.15 (2H, d, J = 6.2
Hz), 4.17 (1H, m), 4.51 (2H, d, J = 5.8Hz), 5.20 (1H, b
s), 6.03 (1H, s), 6.56 (1H, s), 6.67 (1H, m), 6.90 (1
H, m), 6.98-7.12 (6H, m), 7.20-7.38 (6H, m), 7.97 (1
H, bs). (3) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[4 -(Methanesulfonyl) benzoyl]] aminobutyramide (0.20 g, 0.27 mmol) in ethyl acetate (2 ml)
Add 4N hydrogen chloride / ethyl acetate solution (2 ml) to the solution,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with hexane, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'- [4- (Methanesulfonylamino) benzoyl]] aminobutylamide hydrochloride (0.15 g, 8
2%) of an amorphous solid was obtained. Elemental analysis _{C 32 H 33 N 4 O 5} Cl 2 FS · 1 / 2H 2 O theoretically:. C, 56.14; H, 5.01; N, 8.18 Found: C, 56.29; H, 5.09 ; N, 8.07 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.78 (2H, m), 2.23 (2H, m), 3.03
(3H, s), 3.75 (2H, m), 4.00 (2H, m), 4.28 (2H, d, J =
4.0Hz), 6.59 (1H, s), 6.72 (1H, m), 7.04-7.54 (13H,
m), 8.46 (3H, m), 10.08 (1H, s).

Example 221 N-[[3- (Aminomethyl) phenoxy] -4-chlorophenyl]-
N- [2-[[(2-fluorobenzyl) aminocarbonyl] amino] ethyl] -4-phenylbenzamide hydrochloride (1) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy ] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopropionic acid (1.1 g, 1.8 mmol), diphenylphosphoryl azide (DPPA) (0.68 g, 2.5 mmol), triethylamine (0.24 g, 2.4 mmol) A mixture of N, N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Thereafter, 2-fluorobenzylamine (0.40 g, 3.2 mmol) and triethylamine (0.4 g, 4.0 mmol) were added to the reaction solution, and the mixture was further refluxed for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 3- [2-[(4-phenylbenzoyl) [3-[[(2-fluorobenzyl) aminocarbonyl] amino] propyl] amino] -5-chlorophenoxy] benzyl Carbamic acid tert-butyl ester (0.88 g, 68
%) Of an amorphous solid. Elemental analysis _{C 41 H 40 N 4 O 5} ClF theoretically:. C, 68.09; H, 5.57; N, 7.75 Found:. C, 67.96; H, 5.69; N, 7.67 1 H-NMR (CDCl 3 ) δ: 1.41 (9H, s), 3.43 (1H, m), 3.55 (1
H, m), 4.01 (2H, m), 4.20 (2H, d, J = 5.2Hz), 4.35 (2H,
d, J = 5.8Hz), 5.17 (1H, m), 5.22 (1H, bs), 5.62 (1H,
m), 6.50-6.56 (2H, m), 6.67 (1H, s), 6.93-7.58 (17H,
m). (2) 3- [2-[(4-phenylbenzoyl) [3-[[(2-fluorobenzyl) aminocarbonyl] amino] propyl] amino] -5-
To a solution of chlorophenoxy] benzylcarbamic acid tert-butyl ester (0.38 g, 0.53 mmol) in ethyl acetate (3 ml) was added 4N hydrogen chloride in ethyl acetate (3 ml).
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether and N-
[[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N-
[2-[(2-Fluorobenzyl) aminocarbonyl] amino] ethyl] -4-phenylbenzamide hydrochloride (0.32 g, 92%)
A non-crystalline solid was obtained. Elemental analysis: C ₃₆ H ₃₃ N ₄ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 64.67; H, 5.13; N, 8.38. Found: C, 64.32; H, 5.16; N, 8.36 . ¹ H-NMR (DMSO-d ₆ ) δ: 3.31 (2H, m),
3.57 (1H, m), 3.95 (1H, m),
4.01 (2H, m), 4.25 (2H,
m), 6.45 (1H, bs), 6.64 (1
H, s), 6.77 (1H, m), 7.10-
7.69 (18H, m), 8.46 (3H, b
s).

Example 222 N- [2- (2-fluorophenyl) ethyl] -3- [N '-[2-
[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N'-
(4-phenylbenzoyl)] aminopropanamide hydrochloride (1) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl) ] Aminopropionic acid (0.50 g, 0.83 mmol), 2-
Fluorophenethylamine (0.24 g, 1.7 mmol), hydrochloric acid 1
-Ethyl-3- (3-dimethylaminopropyl) carbodiimide
A mixture of (WSC) (0.24 g, 1.3 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.17 g, 1.3 mmol) and N, N-dimethylformamide (8 ml) was stirred at room temperature for 6 hours. .
The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- (2-fluorophenyl) ethyl] -4- [N '
-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)]
An amorphous solid of aminopropionamide (0.58 g, 96%) was obtained. Elemental analysis: C ₄₂ H ₄₁ N ₃ O ₅ Cl.H ₂ O Theoretical: C, 69.94; H, 6.01; N, 5.83. Found: C, 69.70; H, 5.80; N, 5.88. ¹ H- NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.55 (1H, m), 2.67 (1
H, m), 2.84 (2H, m), 3.48 (2H, m), 4.07 (1H, m), 4.21
(2H, d, J = 6.2Hz), 4.22 (1H, m), 4.93 (1H, bs), 6.48 (2
H, m), 6.60 (2H, m), 6.97-7.59 (17H, m). (2) N- [2- (2-fluorophenyl) ethyl] -4- [N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl] -N '-(4-phenylbenzoyl)] aminopropionamide (0.23 g, 0.32 mmol) in ethyl acetate (2
4N hydrogen chloride / ethyl acetate solution (2 ml) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure.
The precipitated solid was collected by filtration, washed with ethyl ether, and N- [2- (2-fluorophenyl) ethyl] -4- [N '-[2- [3- (aminomethyl) phenoxy] -4- Chlorophenyl] -N '-(4-phenylbenzoyl)] aminopropionamide hydrochloride (0.
13 g, 63%) of an amorphous solid was obtained. Elemental analysis: C ₃₇ H ₃₄ N ₃ O ₃ Cl ₂ F ₂ Theoretical: C, 67.48; H, 5.20; N, 6.38. Found: C, 67.32; H, 5.32; N, 6.37. ¹ H-NMR (DMSO-d ₆ ) δ: 2.42 (2H, m), 2.73 (2H, m), 3.24
(2H, m), 4.02 (4H, m), 6.60 (1H, s), 6.79 (1H, m), 7.
12-7.68 (18H, m), 8.21 (1H, bs), 8.50 (2H, bs).

Example 223 N- [2- (1H-indol-3-yl) -1-methylethyl] -3- [N′-
[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]-
N '-(4-phenylbenzoyl)] aminopropanamide hydrochloride (1) 3- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4- Phenylbenzoyl)] aminopropionic acid (0.50 g, 0.83 mmol), α-
Methyltryptamine (0.22 g, 1.3 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC)
(0.24 g, 1.3 mmol), 1-hydroxybenzotriazole
A mixture of monohydrate (HOBt) (0.17 g, 1.3 mmol) and N, N-dimethylformamide (8 ml) was stirred at room temperature for 9 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2- (1H-indol-3-yl)-
1-methylethyl] -3- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4
-Phenylbenzoyl)] aminopropionamide (0.42
g, 66%) of an amorphous solid. Elemental analysis _{C 45 H 45 N 4 O 5} Cl · 1 / 2H 2 O theoretically:. C, 70.53; H, 6.05; N, 7.31 Found:. C, 70.47; H, 5.98; N, 7.07 1 H-NMR (CDCl ₃ ) δ: 1.15 (3H, m), 1.43 (9H, s), 2.50 (1
H, m), 2.63 (1H, m), 2.90 (2H, m), 4.03 (1H, m), 4.19
(2H, d, J = 5.8Hz), 4.31 (1H, m), 4.94 (1H, bs), 6.42 (2H
H, m), 6.57 (2H, m), 6.95-7.69 (18H, m), 8.31 (1H, b
s). (2) N- [2- (1H-indol-3-yl) -1-methylethyl] -3-
[N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminopropionamide (0.26 g, 0.34 mmol) in ethyl acetate ( To the solution (2 ml) was added 4N hydrogen chloride / ethyl acetate solution (2 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. After filtering the precipitated solid,
After washing with ethyl ether, N- [2- (1H-indol-3-yl) -1-methylethyl] -3- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] [-N '-(4-phenylbenzoyl)] aminopropionamide hydrochloride (0.23 g, 96%) was obtained as an amorphous solid. Elemental analysis _{C 40 H 38 N 4 O 3} Cl 2 · 1 / 2H 2 O theoretically:. C, 68.37; H, 5.59; N, 7.97 Found: C, 67.99; H, 5.88 ; N, 7.67. ¹ H-NMR (DMSO-d ₆ ) δ: 1.01 (3H, d, J = 6.6 Hz), 2.41 (2H,
m), 2.66 (1H, m), 2.84 (1H, m), 3.71-4.05 (6H, m), 6.
60 (1H, s), 6.79 (1H, m), 6.92-7.19 (5H, m), 7.32-7.6
8 (14H, m), 8.04 (1H, bs), 8.48 (2H, bs), 10.86 (1H, b
s).

Example 224 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-2-
Carbonyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.0 g, 4.3 mmol), A mixture of 9H-fluorene-2-carbonyl chloride (1.2 g, 5.2 mmol) and N, N-dimethylacetamide (40 ml) was stirred at room temperature for 4 hours. The reaction solution was poured into water and extracted with ethyl acetate. Extract 1N
After washing with an aqueous sodium hydroxide solution and brine, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N
Non-crystallinity of-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-2-carbonyl)] aminobutyric acid ethyl ester (2.1 g, 75%) A solid was obtained. Elemental analysis C ₃₈ H ₃₉ N ₂ O ₆ theory as Cl:. C, 69.66; H , 6.00; N, 4.28 Found:. C, 69.72; H, 5.89; N, 4.05 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.2Hz), 1.44 (9H,
s), 2.00 (2H, m), 2.47 (2H, m), 3.72 (2H, m), 3.82 (1
H, m), 4.01-4.17 (5H, m), 4.85 (1H, bs), 6.46-6.55 (3
H, m), 6.98-7.42 (7H, m), 7.55 (3H, m), 7.76 (1H, m). (2) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) Phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
2-carbonyl)] aminobutyric acid ethyl ester (2.0 g, 3.1
mmol) of tetrahydrofuran (20 ml) and ethanol (20 m
l) solution in 1N aqueous sodium hydroxide solution (15 ml, 15 mm
ol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. An amorphous solid (1.9 g, 100%) was obtained. The obtained amorphous solid
(0.8 g, 1.3 mmol), 2-fluorobenzylamine (0.35 g,
2.8 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.49 g, 2.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.26 g, 1.9
mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 -Chlorophenyl] -N '-(9H-fluorene-2-carbonyl)] aminobutyramide (0.72 g, 77%)
A non-crystalline solid was obtained. Elemental analysis _{C 43 H 41 N 3 O 5} ClF theoretically:. C, 70.34; H, 5.63; N, 5.72 Found:. C, 70.44; H, 5.50; N, 6.00 1 H-NMR (CDCl 3 ) δ: 1.42 (9H, s), 1.96 (2H, m), 2.38 (2
H, m), 3.72 (2H, m), 3.79 (1H, m), 4.07 (2H, d, J = 4.8
Hz), 4.09 (1H, m), 4.51 (2H, d, J = 5.4Hz), 4.80 (1H, b
s), 6.43-6.53 (3H, m), 6.98-7.38 (12H, m), 7.54 (3H,
m), 7.75 (1H, m). (3) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]- To a solution of N '-(9H-fluorene-2-carbonyl)] aminobutyramide (0.35 g, 0.53 mmol) in ethyl acetate (3 ml) was added a 4N solution of hydrogen chloride in ethyl acetate (3 ml). Stirred for hours. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N' A non-crystalline solid of-(9H-fluorene-2-carbonyl)] aminobutylamide hydrochloride (0.31 g, 98%) was obtained. Elemental analysis: C ₃₈ H ₃₄ N ₃ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 67.16; H, 5.19; N, 6.18. Found: C, 67.08; H, 5.44; N, 6.22 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.84 (2H, m), 2.29 (2H, m), 3.75-
4.09 (6H, m), 4.30 (2H, m), 6.59 (1H, s), 6.72 (1H, m),
7.13-7.37 (11H, m), 7.57 (3H, m), 7.78 (1H, d), 7.90
(1H, m), 8.54 (3H, m).

Example 225 N- (3,4-difluorophenyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(9H-fluorene
-2-carbonyl)] aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (9H-fluorene-
2-carbonyl)] aminobutyric acid ethyl ester (2.0 g, 3.1
mmol) of tetrahydrofuran (20 ml) and ethanol (20 m
l) solution in 1N aqueous sodium hydroxide solution (15 ml, 15 mm
ol) was added. The resulting mixture was stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. The extract was washed with water, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. An amorphous solid (1.9 g, 100%) was obtained. The obtained amorphous solid
(0.8 g, 1.3 mmol), 3,4-difluoroaniline (0.38 g,
2.9 mmol), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC) (0.49 g, 2.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.26 g, 1.9 mm
ol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 12 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (3,4-difluorophenyl) -4- [N '
Non-crystallinity of-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-2-carbonyl)] aminobutyramide (0.58 g, 62%) A solid was obtained. Elemental analysis: as C ₄₂ H ₃₈ N ₃ O ₅ ClF ₂ Theoretical: C, 68.33; H, 5.19; N, 5.69. Found: C, 68.28; H, 5.33; N, 5.63. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 2.05 (2H, m), 2.47 (1
H, m), 2.64 (1H, m), 3.74 (2H, d), 3.83 (1H, m), 4.08
(2H, d, J = 4.6Hz), 4.37 (1H, m), 4.69 (1H, bs), 6.38-
6.42 (2H, m), 6.55 (1H, m), 7.00-7.85 (14H, m), 9.92
(1H, s). (3) N- (3,4-difluorophenyl) -4- [N '-[2- [3- (tert-
Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-(9H-fluorene-2-carbonyl)] aminobutyramide (0.3 g, 0.41 mmol) in ethyl acetate (2 ml) 4N Hydrogen chloride Acetic acid Ethyl solution (2 ml) was added,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether and N-
(3,4-difluorophenyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(9H-fluorene
-2-carbonyl)] aminobutylamide hydrochloride (0.26 g, 9
3%) of an amorphous solid was obtained. Elemental analysis _{C 37 H 31 N 3 O 3} Cl 2 F 2 as the theoretical value:. C, 65.88; H, 4.63; N, 6.23 Found:. C, 65.86; H, 5.01; N, 6.39 1 H-NMR (DMSO-d ₆ ) δ: 1.90 (2H, m), 2.49 (2H, m), 3.83
(2H, s), 3.79 (2H, m), 3.98 (2H, m), 6.59 (1H, s), 6.
76 (1H, bs), 7.15-7.44 (9H, m), 7.57-7.64 (3H, m), 7.
75-7.92 (3H, m), 8.46 (2H, bs), 10.43 (1H, s).

Example 226 N- (2-Fluorobenzyl) -4- [N ′-[2- [3- (1-amino-1-methylethyl) phenoxy] -4-chlorophenyl] -N ′-(4 -Phenylbenzoyl)] aminobutylamide hydrochloride (1) Bromomethylmagnesium was added to a solution of 3-methoxyacetophenone (10 g, 67 mmol) in diethyl ether (200 ml).
(3 M diethyl ether solution) (24 ml, 72 mmol) was added dropwise at room temperature. After the addition, the mixture was stirred at room temperature for 1 hour. After adding a saturated aqueous solution of ammonium chloride to the reaction mixture, the mixture was extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, an oily substance of 2- (3-methoxyphenyl) propan-2-ol (11 g, 98%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.56 (6H, s), 3.80 (3H, s), 6.77 (1
H, m), 7.01-7.06 (2H, m), 7.25 (1H, m). (2) 2- (3-methoxyphenyl) propan-2-ol (10.9
g, 65.6 mmol) and trimethylsilyl azide (8.3 g, 72 mm
ol) in toluene (100 ml) was added dropwise boron trifluoride diethyl ether complex (11.2 g, 78.9 mmol) at room temperature.
The resulting mixture was stirred at room temperature for 20 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 1- (1-azido-1-methylethyl) -3-methoxybenzene
(12.5 g, 100%) of an oil was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.62 (6H, s), 3.83 (3H, s), 6.83 (1
H, m), 7.00-7.05 (2H, m), 7.28 (1H, m).

(3) 1- (1-azido-1-methylethyl) -3-methoxybenzene (34.1 g, 178 mmol), Raney nickel (100
A mixture of g) and ethanol (300 ml) was stirred at room temperature for 24 hours. The catalyst was removed by decantation, and the obtained supernatant was concentrated under reduced pressure. 1N hydrochloric acid was added to the residue, and the mixture was washed with diethyl ether. The aqueous layer was neutralized with sodium hydroxide, made alkaline, and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate.
The mixture was concentrated under reduced pressure to obtain an oily substance of 1- (3-methoxyphenyl) -1-methylethylamine (17.9 g, 60%). ¹ H-NMR (CDCl ₃ ) δ: 1.49 (6H, s), 1.68 (2H, s), 3.82 (3
H, s), 6.77 (1H, m), 7.06-7.10 (2H, m), 7.27 (1H, m). (4) 1- (3-methoxyphenyl) -1-methylethylamine (8.
12 g, 49.1 mmol) in dichloromethane (50 ml) solution of 1N boron tribromide in dichloromethane (150 ml) at -78 ° C.
Was dropped. After stirring at that temperature for 30 minutes, the reaction was carried out at room temperature for 1 hour. After stopping the reaction by adding methanol to the reaction solution, the reaction solution was concentrated under reduced pressure. Tetrahydrofuran (1
00 ml), triethylamine (14.9 g, 147 mmol) and di-tert-butyl dicarbonate (10.7 g, 49 mmol) were added. The resulting mixture was heated at reflux for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After washing the extract with brine,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure,
The residue was purified by silica gel column chromatography. An oil of [1- (3-hydroxyphenyl) -1-methylethyl] carbamic acid tert-butyl ester (8.5 g, 68%) was obtained. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (9H, bs), 1.59 (6H, s), 5.00 (1
H, s), 6.00 (1H, bs), 6.65 (1H, m), 6.86-6.93 (2H,
m), 7.15 (1H, m).

(5) 4-chloro-2-fluoronitrobenzene
(2.57 g, 14.6 mmol), [1- (3-hydroxyphenyl) -1-methylethyl] carbamic acid tert-butyl ester (3.21
g, 12.8 mmol), potassium carbonate (2.02 g, 14.6 mmol) and N, N
A mixture of -dimethylformamide (20 ml) was stirred at 100 ° C for 2 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give [1- [3- (5-chloro-2-nitrophenoxy) phenyl] -1-methylethyl]
Crystals of carbamic acid tert-butyl ester (3.6 g, 69%) were obtained. Mp 87-88 ° C. Elemental analysis _{C 20 H 23 N 2 O 5} Cl theoretically:. C, 59.04; H, 5.70; N, 6.89 Found:. C, 59.21; H, 5.84; N, 6.79 1 H -NMR (CDCl ₃ ) δ: 1.34 (9H, bs), 1.62 (6H, s), 4.95 (1
H, bs), 6.93 (2H, m), 7.08-7.17 (2H, m), 7.30-7.42 (2
H, m), 7.92 (1H, d). (6) [1- [3- (5-chloro-2-nitrophenoxy) phenyl] -1
-Methylethyl] carbamic acid tert-butyl ester (3.
3 g, 8.1 mmol) in ethyl acetate (100 ml) was added 5% palladium on carbon (1.0 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions for 3 hours. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give [1- [3- (2-amino-5-chlorophenoxy) phenyl] -1-methylethyl] carbamic acid ter
An amorphous solid of t-butyl ester (2.7 g, 89%) was obtained. ¹
H-NMR (CDCl ₃ ) δ: 1.37 (9H, bs), 1.61 (6H, s), 3.50 (2
H, bs), 4.94 (1H, bs), 6.70-6.94 (4H, m), 7.07-7.32 (3
H, m).

(7) [1- [3- (2-Amino-5-chlorophenoxy) phenyl] -1-methylethyl] carbamic acid tert-butyl ester (2.5 g, 6.62 mmol), 4-bromobutyric acid ethyl ester (9.0 g, 46 mmol), potassium carbonate (2.7 g, 20 m
mol) and N, N-dimethylformamide (20 ml)
Stirred at C for 24 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3
-(1-tert-butoxycarbonylamino-1-methylethyl)
An oil of phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.6 g, 49%) was obtained. ¹ H-NMR (CDCl ₃ ) δ:
1.26 (3H, t), 1.36 (9H, bs), 1.61 (6H, s), 1.94 (2H,
m), 2.39 (2H, m), 3.20 (2H, m), 4.12 (2H, q), 4.25 (1H,
m), 4.94 (1H, bs), 6.60-7.31 (7H, m). (8) 4- [N- [2- [3
-(1-tert-butoxycarbonylamino-1-methylethyl)
Phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.4 g, 2.8 mmol), 4-phenylbenzoyl chloride (0.72 g, 3.3 mmol) and N, N-dimethylacetamide (2
0 ml) of the mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3- (1-tert-butoxycarbonylamino-1-methylethyl) phenoxy] -4-chlorophenyl]-
N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester
(1.6 g, 88%) of an amorphous solid was obtained. Elemental analysis value C ₃₉ H
_{43 N 2 O 6 Cl · 1} / 2H 2 O theoretically:. C, 68.86; H, 6.52; N, 4.12 Found:. C, 68.74; H, 6.55; N, 3.82 1 H-NMR (CDCl 3 ) δ: 1.26 (3H, t, J = 7.4Hz), 1.29 (9H, b
s), 1.52 (6H, d), 2.02 (2H, m), 2.48 (2H, m), 3.89 (1
H, m), 4.07 (1H, m), 4.12 (2H, q, J = 7.4Hz), 4.84 (1H,
bs), 6.50 (2H, m), 6.71 (1H, bs), 6.97 (1H, m), 7.20
-7.61 (12H, m).

(9) 4- [N- [2- [3- (1-tert-butoxycarbonyl-1-methylaminoethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid Ethyl ester (1.4 g, 2.1 mmol) in tetrahydrofuran (50 ml)
1N aqueous sodium hydroxide solution (10 ml, 10 mmol) was added to a solution of ethanol and ethanol (50 ml). The resulting mixture
Stirred at 60 ° C. for 1 hour. The reaction solution was poured into water, acidified with potassium hydrogen sulfate, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [2- [3- (1-tert-butoxycarbonylamino-1-methylethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (1.3 g, 9
7%) of an amorphous solid was obtained. Elemental analysis value C ₃₇ H ₃₉ N ₂ O ₆ Cl ・ 1
/ 2H ₂ O theoretically:. C, 68.14; H, 6.18; N, 4.30 Found:. C, 68.36; H, 6.32; N, 4.31 1 H-NMR (CDCl 3) δ: 1.29 (9H, bs ), 1.56 (6H, d), 2.00 (2
H, m), 2.52 (2H, m), 3.98-4.20 (2H, m), 5.00 (1H, b
s), 6.06 (1H, bs), 6.54 (1H, s), 6.94 (1H, bs), 7.22-
7.58 (14H, m). (10) 4- [N- [2- [3- (1-tert-butoxycarbonylamino-1
-Methylethyl) phenoxy] -4-chlorophenyl] -N- (4-
Phenylbenzoyl)] aminobutyric acid (0.5 g, 0.78 mmol),
2-fluorobenzylamine (0.19 g, 1.5 mmol), hydrochloric acid 1
-Ethyl-3- (3-dimethylaminopropyl) carbodiimide
A mixture of (WSC) (0.30 g, 1.6 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (0.21 g, 1.6 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 12 hours. . The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [3
-(1-tert-butoxycarbonylamino-1-methylethyl)
A non-crystalline solid of phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.49 g, 84%) was obtained. Elemental analysis: C ₄₄ H ₄₅ N ₃ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 69.60; H, 6.11; N, 5.53. Found: C, 69.84; H, 6.13; N, 5.63. ¹ H-NMR (CDCl ₃ ) δ: 1.33 (9H, bs), 1.51 (6H, d), 1.98 (2
H, m), 2.41 (2H, m), 3.85 (1H, m), 4.15 (1H, m), 4.52
(2H, d, J = 5.2Hz), 4.85 (1H, bs), 6.41 (1H, bs), 6.50
(1H, s), 6.69 (1H, s), 6.98-7.60 (18H, m). (11) N- (2-fluorobenzyl) -4- [N '-[2- [3- (1-tert -Butoxycarbonylamino-1-methylethyl) phenoxy]-
4-Chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (0.32 g, 0.43 mmol) in ethyl acetate (2 ml)
Add 4N hydrogen chloride / ethyl acetate solution (2 ml) to the solution,
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2
-Fluorobenzyl) -4- [N '-[2- [3- (1-amino-1-methylethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminobutyramide hydrochloride (0.29 g, 99
%) Of an amorphous solid. Elemental analysis value C ₃₉ H ₃₈ N ₃ O ₃ Cl ₂ F ・
1 / 2H ₂ O theoretically:. C, 67.34; H, 5.65; N, 6.04 Found:. C, 67.10; H, 5.84; N, 5.94 1 H-NMR (DMSO-d 6) δ: 1.61 ( 6H, s), 1.84 (2H, m), 2.29
(2H, m), 3.79 (2H, m), 4.30 (2H, d, J = 4.8Hz), 6.56 (1
H, s), 6.68 (1H, d), 7.11-7.69 (17H, m), 8.47 (1H,
m), 8.78 (3H, m).

Example 227 N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- [3-[[((2-fluorobenzyl) amino] carbonyl]
Amino] propyl] -4-phenylbenzamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] A mixture of aminobutyric acid (0.92 g, 1.5 mmol), diphenylphosphoryl azide (DPPA) (0.39 ml, 1.8 mmol), triethylamine (0.25 ml, 1.8 mmol) and N, N-dimethylformamide (10 ml) was added at 0 ° C for 1 hour. Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. Extract water with water,
After washing with brine and drying over anhydrous magnesium sulfate, the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 1 hour. afterwards,
Add 2-fluorobenzylamine (0.25 ml, 1.8 mmo
l) and triethylamine (0.25 ml, 1.8 mmol)
The mixture was refluxed for another 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 3- [2-
[(4-phenylbenzoyl) [3-[[[(2-fluorobenzyl)
Amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy] benzylcarbamic acid tert-butyl ester (0.76 g, 69%) was obtained as an amorphous solid. Elemental analysis value C ₄₂ H ₄₂ N ₄ O ₅ ClF · 1 / 2H ₂
O theoretically:. C, 67.60; H, 5.81; N, 7.51 Found:. C, 67.72; H, 5.73; N, 7.52 1 H-NMR (CDCl 3) δ: 1.41 (9H, m), 1.72 -1.80 (2H, m), 3.
34 (2H, bs), 3.70-3.80 (1H, m), 4.19 (2H, d, J = 6.4H
z), 4.43 (2H, d, J = 4.8Hz), 4.97-5.03 (2H, m), 5.75 (2H
H, m), 5.75 (1H, bs), 6.42 (1H, d, J = 7.6Hz), 6.58 (2
H, d, J = 7.8Hz), 6.95-7.17 (4H, m), 7.19-7.26 (4H,
m), 7.32-7.48 (8H, m), 7.53-7.58 (2H, m). (2) 3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorobenzyl) amino] Carbonyl] amino] propyl] amino]
To a solution of -5-chlorophenoxy] benzyl] carbamic acid tert-butyl ester (0.66 g, 0.9 mmol) in ethyl acetate (5 ml) was added 4N hydrogen chloride in ethyl acetate (5 ml).
Stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- [2
-[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N-
[3-[[[(2-Fluorobenzyl) amino] carbonyl] amino] propyl] -4-phenylbenzamide hydrochloride (0.54 g,
90%) of an amorphous solid. Elemental analysis: C ₃₇ H ₃₅ N ₄ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 65.10; H, 5.32; N, 8.21. Found: C, 64.92; H, 5.32; N, 8.32. ^{. 1 H-NMR (DMSO-} d 6) δ: 1.69 (2H, t, J = 6.6Hz), 3.10 (2H,
bs), 3.81 (2H, bs), 4.01 (2H, s), 4.25 (2H, s), 4.46
(1H, bs), 6.57-6.68 (2H, m), 7.13-7.68 (18H, m), 8.5
1 (3H, bs).

Example 228 N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N- [3-[[[(2-fluorophenyl) amino] carbonyl]
Amino] propyl] -4-phenylbenzamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] A mixture of aminobutyric acid (0.92 g, 1.5 mmol), diphenylphosphoryl azide (DPPA) (0.39 ml, 1.8 mmol), triethylamine (0.25 ml, 1.8 mmol) and N, N-dimethylformamide (10 ml) was added at 0 ° C for 1 hour. Stirred for hours. The reaction solution was poured into water and extracted with ethyl acetate. Extract water with water,
After washing with brine and drying over anhydrous magnesium sulfate, the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 1 hour. afterwards,
2-Fluoroaniline (0.17 ml, 1.8 mmol) and triethylamine (0.25 ml, 1.8 mmol) were added to the reaction solution, and an additional 12
Refluxed for hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorophenyl) amino] carbonyl] amino] propyl] amino] -5-chlorophenoxy ] Benzylcarbamic acid tert-butyl ester (0.81 g, 75%)
A non-crystalline solid was obtained. Elemental analysis _{C 41 H 40 N 4 O 5} ClF · 1 / 2H 2 O theoretically:. C, 67.25; H, 5.64; N, 7.65 Found:. C, 67.24; H, 5.43; N, 7.57 1 H-NMR (CDCl ₃ ) δ: 1.42 (9H, m), 1.81 (2H, bs), 3.41 (2
H, bs), 3.74-3.81 (1H, m), 4.18-4.22 (3H, m), 4.99 (1
H, bs), 6.21 (1H, bs), 6.46 (1H, d, J = 7.6Hz), 6.60 (2
H, d, J = 9.4Hz), 6.86-7.11 (6H, m), 7.18-7.48 (9H,
m), 7.54-7.59 (2H, m), 8.14 (1H, t, J = 8.5Hz). (2) 3- [2-[(4-phenylbenzoyl) [3-[[[(2-fluorophenyl ) Amino] carbonyl] amino] propyl] amino]
[5-Chlorophenoxy] benzylcarbamic acid tert-butyl ester by the same method as in Example 227 (2) to give N-
[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]-
A non-crystalline solid of N- [3-[[[(2-fluorophenyl) amino] carbonyl] amino] propyl] -4-phenylbenzamide hydrochloride was obtained. Elemental analysis: C ₃₆ H ₃₃ N ₄ O ₃ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 64.67; H, 5.13; N, 8.38. Found: C, 64.72; H, 4.96; N, 8.44 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.75 (2H, t, J = 6.8Hz), 3.19 (2H,
s), 3.92 (2H, s), 4.02 (2H, s), 6.56-6.63 (2H, m), 6.
89-7.95 (2H, m), 7.02-7.20 (3H, m), 7.34-7.49 (7H, m
m), 7.56-7.66 (5H, m), 8.13 (1H, t, J = 8.3Hz), 8.46 (3
H, bs).

Example 229 N- (2-fluorobenzyl) -4- [N '-[4- (acetamido) benzoyl] -N'-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] ] Aminobutylamide hydrochloride (1) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.3 g, 5.0 mmol), 4- (Acetamido) benzoyl chloride (2.0 g, 10 mmol), 4-dimethylaminopyridine (1.2 g, 10 mmol) and tetrahydrofuran (20 ml)
Was stirred at room temperature for 5 hours. Pour the reaction into water,
Extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [3- (tert.
A non-crystalline solid of -butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- [4- (acetamido) benzoyl)] aminobutyric acid ethyl ester (1.7 g, 54%) was obtained. Elemental analysis: C ₃₃ H ₃₈ N ₃ O ₇ Cl ・ 1 / 4H ₂ O Theoretical: C, 63.05; H, 6.17; N, 6.68. Found: C, 62.98; H, 5.94; N, 6.78. ¹ H-NMR (CDCl ₃ ) δ: 1.23 (3H, t, J = 7.2 Hz), 1.45 (9H,
s), 1.93-2.03 (2H, m), 2.14 (3H, s), 2.46 (2H, t, J =
7.2Hz), 3.67-3.75 (1H, m), 4.06-4.18 (5H, m), 5.24 (1
H, bs), 5.92 (1H, bs), 6.51 (1H, s), 6.72-6.95 (1H,
m), 7.02 (2H, d, J = 8.2Hz), 7.20-7.33 (6H, m), 8.40 (1
H, bs). (2) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- [4- (acetamido) benzoyl]] aminobutyric acid ethyl ester (1.6 g, 2.
5 mmol) of tetrahydrofuran (10 ml) and ethanol (10
1N aqueous sodium hydroxide solution (5 ml, 5 mmo)
l) was added. The resulting mixture was stirred at room temperature for 2 hours.
The reaction solution was poured into water, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 4- [N- [4- (acetamido) benzoyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]
An amorphous solid of aminobutyric acid (1.5 g, 99%) was obtained. Elemental analysis C ₃₁ H ₃₄ N ₃ O ₇ theory as Cl:. C, 62.46; H , 5.75; N, 7.05 Found:. C, 62.48; H, 5.90; N, 7.00 1 H-NMR (CDCl 3 ) δ: 1.44 (9H, s), 1.86-1.98 (2H, m), 2.
13 (3H, s), 2.50 (1H, bs), 3.75 (1H, bs), 4.07-4.17 (3
H, m), 5.31 (1H, bs), 5.99 (1H, bs), 6.34 (1H, bs), 6.
55 (2H, s), 6.58-6.74 (1H, m), 6.93-7.03 (3H, m), 7.2
4-7.41 (4H, m), 8.44 (1H, bs).

(3) 4- [N- [4- (acetamido) benzoyl]-
N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid (0.72 g, 1.2 m
mol), 2-fluorobenzylamine (0.17 ml, 1.5 mmol),
A mixture of diethyl cyanophosphate (0.21 ml, 1.5 mmol), triethylamine (0.21 ml, 1.5 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[4- (acetamido) benzoyl] -N'-[2- [3- An amorphous solid of (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.76 g, 91%) was obtained. Elemental analysis: C ₃₈ H ₄₀ N ₄ O ₆ ClF · 1 / 2H ₂ O Theoretical: C, 64.08; H, 5.80; N, 7.87. Found: C, 64.05; H, 5.81; N, 7.75. ¹ H-NMR (CDCl ₃ ) δ: 1.45 (9H, s), 1.90-1.93 (2H, m), 2.
14 (3H, s), 2.31-2.45 (2H, m), 3.63 (1H, m), 4.00-4.1
8 (3H, m), 4.50 (2H, d, J = 5.4Hz), 5.28 (1H, bs), 5.88
(1H, bs), 6.50 (1H, bs), 6.67-6.71 (1H, m), 7.00-7.1
1 (4H, m), 7.19-7.38 (9H, m), 8.50 (1H, bs). (4) N- (2-fluorobenzyl) -4- [N '-[4- (acetamide)
Benzoyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.63 g, 0.9 mmol) in ethyl acetate (5 ml)
4N Hydrogen chloride in ethyl acetate (5 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[4- (acetamido) benzoyl]-
A non-crystalline solid of N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide hydrochloride (0.44 g, 77%) was obtained. Elemental analysis: C ₃₃ H ₃₃ N ₄ O ₄ Cl ₂ F ・ 1 / 2H ₂ O Theoretical: C, 61.11; H, 5.28; N, 8.63. Found: C, 60.75; H, 5.32; N, 8.42 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.73-1.83 (2H, m), 2.05 (3H, s),
2.24 (2H, t, J = 7.0Hz), 3.59-3.76 (2H, m), 4.00 (2H,
s), 4.28 (2H, d, J = 4.8Hz), 6.58 (1H, s), 6.74-6.76 (1
H, m), 7.00-7.52 (13H, m), 8.42-8.45 (3H, m), 10.23
(1H, s).

Example 230 N- [2- [3- (Aminomethyl) phenoxy] phenyl] -N- [4-
[(2-Fluorobenzoyl) amino] butyl] -4-phenylbenzamide hydrochloride (1) 5- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminopentanoic acid (2.5 g, 4 mmol), diphenylphosphoryl azide (DPPA) (0.86 ml, 4 mmol), triethylamine (0.56 ml, 4 mmol) and N, N-dimethylformamide
(10 ml) mixture was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. Extract water with water,
After washing with brine and drying over anhydrous magnesium sulfate, the solvent was distilled off. Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 1 hour. afterwards,
Benzyl alcohol was added to the reaction solution, which was further refluxed for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography, and 3- [2-[(4-phenylbenzoyl) [3-[[(benzyloxycarbonyl] amino] butyl] amino] -5-chlorophenoxy] benzylcarbamic acid tert- An amorphous solid of butyl ester (1.3 g, 45%) was obtained Elemental analysis: C ₄₃ H ₄₄ N ₃ O ₆ Cl · 1 / 2H ₂ O Theoretical: C, 69.48; 10; N,
5.65. Found: C, 69.62; H, 6.04; N,
5.92. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, m), 1.63 (4
H, bs), 3.20-3.23 (2H, m), 3.76-3.80 (1H, m), 3.92-
4.07 (1H, m), 4.19 (2H, s), 5.01 (1H, bs), 5.07 (2H,
s), 5.10 (1H, bs), 6.47 (1H, d, J = 7.2Hz), 6.62 (2H,
d, J = 16.0Hz), 6.97-7.07 (2H, m), 7.18-7.47 (14H, m),
7.54-7.58 (3H, m). (2) 3- [2-[(4-phenylbenzoyl) [3-[[(benzyloxycarbonyl] amino] butyl] amino] -5-chlorophenoxy] benzylcarbamic acid tert -Butyl ester (0.66
g, 0.9 mmol) in ethyl acetate (10 ml) and tetrahydrofuran (10 ml) was added 5% palladium on carbon (0.4 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions.
The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (10 ml), and 2-fluorobenzoyl chloride (0.15 ml, 1.2 mmol), triethylamine
(0.17 ml, 1.2 mmol) was added. After the obtained mixture was stirred at room temperature for 1 hour, the reaction solution was poured into water and extracted with ethyl acetate. Extract solution is 1N sodium hydroxide solution,
After washing with brine, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography to give N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl] -N- [4-[(2-fluorobenzoyl) An amorphous solid of [amino] butyl] -4-phenylbenzamide (0.16 g, 25%) was obtained. Elemental analysis: C ₄₂ H ₄₂ N ₃ O ₅ F ・ 1 / 2H ₂ O Theoretical: C, 72.40; H, 6.22; N, 6.03. Found: C, 72.29; H, 6.16; N, 5.68. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.75 (4H, bs), 3.49 (2
H, bs), 3.88 (1H, bs), 4.07 (1H, bs), 4.17 (1H, bs),
5.06 (1H, bs), 6.49 (1H, br d, J = 7.4Hz), 6.65 (1H,
s), 6.82 (1H, bs), 6.98-7.56 (17H, m), 8.00-8.09 (1H,
m). (3) N- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] phenyl] -N- [4-[(2-fluorobenzoyl)
Amino] butyl] -4-phenylbenzamide (0.13 g, 0.18
(mmol) in ethyl acetate (5 ml) was added 4N hydrogen chloride in ethyl acetate (5 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration, washed with ethyl ether, and N- [2- [3- (aminomethyl) phenoxy] phenyl] -N- [4-[(2-fluorobenzoyl) amino]
[Butyl] -4-phenylbenzamide hydrochloride (0.07 g, 64%)
A non-crystalline solid was obtained. Elemental analysis: C ₃₇ H ₃₅ N ₃ O ₃ ClF · 1 / 2H ₂ O Theoretical: C, 70.19; H, 5.73; N, 6.64. Found: C, 69.79; H, 5.55; N, 6.51. ¹ H-NMR (DMSO-d ₆ ) δ: 1.69 (4H, bs), 3.23 (2H, bs), 3.8
0 (2H, bs), 3.99 (2H, bs), 6.61-6.69 (2H, m), 7.09-7.
64 (19H, m), 8.31 (2H, bs).

Example 231 N- [2- (2-fluorophenyl) ethyl] -2- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4- Phenylbenzoyl)] aminoacetamide hydrochloride (1) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoacetic acid ( 0.59 g, 1 mmol), 2- (2-fluorophenyl) ethylamine (0.16 ml, 1.2 mmol), diethyl cyanophosphate (0.17 ml, 1.2 mmol), triethylamine (0.
17 ml, 1.2 mmol) and N, N-dimethylformamide (10 ml)
Was stirred at room temperature for 2 hours. Pour the reaction into water,
Extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- [2-
(2-Fluorophenyl) ethyl] -2- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminoacetamide (0.57 g, 81 %) Of an amorphous solid. Elemental analysis _{C 41 H 39 N 3 O 5} ClF theoretically:. C, 69.53; H, 5.55; N, 5.93 Found:. C, 69.36; H, 5.62; N, 5.94 1 H-NMR (CDCl 3 ) δ: 1.43 (9H, s), 2.84-2.89 (2H, m), 3.
48-3.56 (2H, m), 4.18 (2H, d, J = 4.8Hz), 4.47 (2H, d,
J = 3.0Hz), 4.86 (1H, bs), 6.32 (1H, br d, J = 7.6Hz),
6.47-6.51 (2H, m), 6.90-7.24 (9H, m), 7.33-7.49 (6H,
m), 7.54-7.60 (3H, m). (2) N- [2- (2-fluorophenyl) ethyl] -2- [N '-[2- [3-
(Aminomethyl) phenoxy] -4-chlorophenyl] -N '-(4-
Phenylbenzoyl)] aminoacetamide (0.5 g, 0.7
(mmol) in ethyl acetate (5 ml) was added 4N hydrogen chloride in ethyl acetate (5 ml), and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- [2- (2-fluorophenyl) ethyl] -2- [N '-[2- [3- (aminomethyl) phenoxy] -4- A non-crystalline solid of [chlorophenyl] -N '-(4-phenylbenzoyl)] aminoacetamide hydrochloride (0.4 g, 89%) was obtained. Elemental analysis: C ₃₆ H ₃₂ N ₃ O ₃ Cl ₂ F.H ₂ O Theoretical: C, 66.62; H, 5.05; N, 6.47. Found: C, 66.66; H, 5.06; N, 6.45. ¹ H-NMR (DMSO-d ₆ ) δ: 2.73-2.81 (2H, m), 3.31-3.39 (2H,
m), 3.85 (1H, d, J = 16.3Hz), 4.02 (2H, s), 4.70 (1H,
d, J = 16.3Hz), 6.68 (1H, s), 6.77-6.81 (2H, m), 7.12-
7.69 (18H, m), 8.26 (1H, bs), 8.42 (2H, bs).

Example 232 N- [3- (3-Indolyl) -2-propyl] -2- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-( 4-phenylbenzoyl)] aminoacetamide hydrochloride (1) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] amino N- [3- (3-indolyl) -2 was obtained from acetic acid and α-methyltryptamine in the same manner as in Example 231 (1).
-Propyl] -2- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] aminoacetamide was synthesized. Elemental analysis _{C 44 H 43 N 4 O 5} ClF · H 2 O theoretically:. C, 69.42; H, 5.96; N, 7.36 Found:. C, 69.69; H, 5.90; N, 7.08 1 H- NMR (CDCl ₃ ) δ: 1.17 (3H, d, J = 6.0 Hz), 1.44 (9H,
s), 2.95 (2H, d, J = 5.4Hz), 4.07-4.17 (2H, m), 4.38-
4.44 (3H, m), 4.79 (1H, bs), 6.39-6.49 (3H, m), 6.74
(1H, bs), 6.85-7.11 (8H, m), 7.28-7.58 (11H, m), 8.3
1 (1H, bs). (2) N- [3- (3-indolyl) -2-propyl] -2- [N '-[2- [3- (t
ert-butoxycarbonylaminomethyl) phenoxy] -4-
Chlorophenyl] -N '-(4-phenylbenzoyl)] aminoacetamide was converted to N-
[3- (3-Indolyl) -2-propyl] -2- [N '-[2- [3- (1-aminomethyl) phenoxy] -4-chlorophenyl] -N'-(4-phenylbenzoyl)] An amorphous solid of aminoacetamide hydrochloride was obtained. Elemental analysis _{C 39 H 36 N 4 O 3} Cl 2 · 1 / 2H 2 O theoretically:. C, 68.02; H, 5.42; N, 8.14 Found: C, 67.98; H, 5.54 ; N, 8.08. ^{1 H-NMR (DMSO-d} 6) δ: 1.06 (3H, d, J = 7.0Hz), 2.65-2.95
(2H, m), 3.67-3.81 (1H, m), 4.02 (2H, s), 4.03-4.13 (1
H, m), 4.74 (1H, d, J = 14.6Hz), 6.68-6.76 (2H, m), 6.9
3-7.11 (6H, m), 7.32-7.68 (13H, m), 8.02-8.06 (1H,
m), 8.50 (2H, bs).

Example 233 N-[[4- (2-methoxyphenyl) -1-piperazinyl] carbonylmethyl] -N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -4-phenyl Benzamide dihydrochloride (1) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoacetic acid and 4- (2 N-[[4- (2-methoxyphenyl) -1-piperazinyl] carbonylmethyl] -N from (-methoxyphenyl) piperazine in the same manner as in (1) of Example 231
A non-crystalline solid of-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -4-phenylbenzamide was obtained. Elemental analysis _{C 44 H 45 N 4 O 6} ClF · 1 / 2H 2 O theoretically:. C, 68.60; H, 6.02; N, 7.27 Found:. C, 68.41; H, 5.99; N, 7.04 1 H-NMR (CDCl ₃ ) δ:
1.44 (9H, s), 3.07 (4H, bs), 3.74 (4H, bs), 3.88 (3H,
s), 4.03 (1H, d, J = 16.6Hz), 4.27 (2H, d, J = 6.2Hz),
4.88 (1H, bs), 5.33 (1H, d, J = 16.6Hz), 6.64-6.66 (2H,
m), 6.79 (1H, s), 6.87-7.11 (6H, m), 7.24-7.58 (11H,
m). (2) N-[[4- (2-methoxyphenyl) -1-piperazinyl] carbonylmethyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] N was obtained from -4-phenylbenzamide in the same manner as in Example 231 (2).
-[[4- (2-Methoxyphenyl) -1-piperazinyl] carbonylmethyl] -N- [2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -4-phenylbenzamide dihydrochloride A crystalline solid was obtained. Elemental analysis: C ₃₉ H ₃₉ N ₄ O ₄ Cl ₃₁ / 2H ₂ O Theoretical: C, 63.03; H, 5.43; N, 7.54. Found: C, 63.15; H, 5.42; N, 7.45. ¹ H-NMR (DMSO-d ₆ ) δ: 3.23-3.46 (4H, m), 3.80-3.90 (7H,
m), 4.04 (2H, s), 4.33 (1H, d, J = 16.4Hz), 5.15 (1H,
d, J = 16.4Hz), 6.68 (1H, s), 6.84-6.88 (1H, m), 6.98-
7.06 (1H, m), 7.17-7.68 (17H, m), 8.61 (2H, bs).

Example 234 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl]] aminobutylamide hydrochloride (1) isonipecotic acid (25 g, 0.19 mol), sodium hydrogen carbonate ( While stirring an aqueous solution (200 ml) of 49 g, 0.58 mol), a solution of benzyl chloroformate (36 g, 0.21 mol) in diethyl ether (50 ml) was added dropwise thereto at room temperature. After the addition, the mixture was stirred at room temperature for 15 hours. The reaction solution was acidified with concentrated hydrochloric acid and extracted with ethyl acetate. The extract was washed with brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure.
The residue was crystallized from isopropyl ether-hexane and collected by filtration. Colorless crystals of N-benzyloxycarbonylisonipecotic acid (36 g, 71%) were obtained. Melting point 79-80 ℃ ¹ H-
NMR (CDCl ₃ ) δ: 1.57-1.77 (2H, m), 1.90-1.96 (2H, m),
2.45-2.59 (1H, m), 2.89-3.03 (2H, m), 4.06-4.13 (2H,
m), 5.13 (2H, s), 7.30-7.39 (5H, m) .N-benzyloxycarbonylisonipecotic acid (7.9 g,
30 mmol), oxalyl chloride (5.0 g, 39 mmol), N, N-
Dimethylformamide (0.5 ml) in tetrahydrofuran (1
00 ml) solution was stirred at room temperature for 1 hour. After concentrating the reaction solution under reduced pressure, 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (6.9 g, 15 mmol), 4 -Dimethylaminopyridine (3.7 g, 30 mmol) and tetrahydrofuran (50
ml) was added and the resulting mixture was stirred at room temperature for 12 hours.
The reaction solution was poured into water and extracted with ethyl acetate. Extract 1
After washing with normal aqueous sodium hydroxide solution and brine,
It was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography,
4- [N-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (7.4 g, 70%) of an oil was obtained. Elemental analysis: C ₃₈ H ₄₆ N ₃ O ₈ Cl ・ 1 / 2H ₂ O Theoretical: C, 63.63;
. H, 6.60; N, 5.86 Found:. C, 63.86; H, 6.70; N, 5.99 1 H-NMR (CDCl 3) δ: 1.20 (3H, t, J = 7.0Hz), 1.43 (9H,
s), 1.60-1.90 (6H, m), 2.29-2.37 (3H, m), 2.59-2.65
(1H, m), 3.59-3.80 (2H, m), 4.07 (2H, d, J = 7.0Hz),
4.09-4.17 (2H, m), 4.30 (2H, d, J = 5.8Hz), 5.05 (1H, b
s), 5.10 (2H, s), 6.83-6.92 (3H, m), 7.08-7.17 (3H,
m), 7.27-7.38 (6H, m). (2) 4- [N-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N- [2- [3- (tert-butoxycarbonyl Aminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.8 g, 2.5 mmol) in a solution of tetrahydrofuran (10 ml) and ethanol (10 ml) in 1N aqueous sodium hydroxide solution (5 ml, 5 mmol) Was added. The resulting mixture was stirred at room temperature for 2 hours. Pour the reaction solution into water, 1
After acidification with normal hydrochloric acid, the mixture was extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate.
Concentrate under reduced pressure to give 4- [N-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ]] Aminobutyric acid (1.7 g, 98%) was obtained as an amorphous solid. Elemental analysis: C ₃₆ H ₄₂ N ₃ O ₈ Cl1 / 2 H ₂ O Theoretical: C, 62.74; H, 6.29; N, 6.10. Actual: C, 62.72; H, 6.30; N, 6.19. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s);
65-1.85 (6H, m), 2.34-2.41
(3H, m), 2.64 (1H, bs), 3.
33 (1H, bs), 3.73-3.81 (2H,
m), 3.95 (1H, bs), 4.21 (2
H, bs), 5.11 (2H, s), 5.19
(1H, bs), 6.68 (1H, bs),
6.87-6.91 (2H, m), 7.04-7.
15 (3H, m), 7.29-7.38 (6H,
m).

(3) 4- [N-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N- [2- [3
-(tert-Butoxycarbonylaminomethyl) phenoxy]-
4-chlorophenyl]] aminobutyric acid (0.68 g, 1 mmol), 2-fluorobenzylamine (0.14 ml, 1.2 mmol), diethyl cyanophosphate (0.17 ml, 1.2 mmol), triethylamine (0.1
A mixture of 7 ml, 1.2 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N An amorphous solid of '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.72 g, 92%) was obtained. Elemental analysis: C ₄₃ H ₄₈ N ₄ O ₇ ClF · 1 / 2H ₂ O Theoretical: C, 64.86; H, 6.20; N, 7.04. Found: C, 65.06; H, 6.04; N, 7.16. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (9H, s), 1.58-1.86 (8H, m), 2.
13-2.33 (2H, m), 2.59-2.66 (1H, m), 3.59-3.78 (2H, m
m), 4.07-4.17 (2H, m), 4.28 (2H, d, J = 6.4Hz), 4.45 (2H
H, d, J = 5.8Hz), 5.10 (1H, bs), 6.66 (1H, bs), 6.83-
6.90 (3H, m), 6.97-7.37 (13H, m). (4) N- (2-fluorobenzyl) -4- [N '-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
-Chlorophenyl]] aminobutyramide (0.63 g, 0.8 mm
ol) in ethyl acetate (5 ml), 4N hydrogen chloride in ethyl acetate (5 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration and washed with ethyl ether to give N- (2-fluorobenzyl) -4- [N'-
[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]-
N '-[[1- (benzyloxy) carbonyl-4-piperidinyl]
Carbonyl]] aminobutyramide hydrochloride (0.52 g, 91
%) Of an amorphous solid. Elemental analysis: C ₃₈ H ₄₁ N ₄ O ₅ Cl ₂ F · 1 / 2H ₂ O Theoretical: C, 62.30; H, 5.78; N,
7.65. Found: C, 62.09; H, 5.73; N,
7.97. ¹ H-NMR (DMSO-d ₆ ) δ: 1.44-1.73 (5H,
m), 2.17 (2H, t, J = 7.3Hz), 2.36 (1H, bs), 2.69 (1H, b
s), 3.40-3.50 (1H, m), 3.65-3.75 (1H, m), 3.92-4.05
(2H, m), 4.27 (2H, s), 4.48 (2H, s), 5.05 (2H, s), 6.
91 (1H, d, J = 2.2Hz), 6.99-7.18 (2H, m), 7.25-7.54 (13
H, m), 8.38 (1H, bs), 8.52 (2H, bs).

Example 235 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] phenyl] -N '-[[1-benzoyl-4-piperidinyl] carbonyl]] aminobutylamide hydrochloride (1) 4- [N-[[1- (benzyloxy) carbonyl-4-piperidinyl] carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.42 g, 2 mmol) in ethyl acetate (10
ml) and a solution of tetrahydrofuran (10 ml) were added 5% palladium on carbon (0.3 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (10 ml) and benzoyl chloride (0.35 ml, 3 mmol), triethylamine
(0.42 ml, 3 mmol) was added. The mixture was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N-[(1-benzoyl-4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl ) Phenoxy] phenyl]]
An amorphous solid of aminobutyric acid ethyl ester (0.54 g, 40%) was obtained. Elemental analysis _{C 37 H 45 N 3 O 7} · 1 / 2H 2 O theoretically:. C, 68.08; H, 7.10; N, 6.44 Found:. C, 68.02; H, 6.97; N, 6.36 1 H -NMR (CDCl ₃ ) δ: 1.20 (3H, t, J = 7.2Hz), 1.42 (9H,
s), 1.66-1.91 (6H, m), 2.33 (2H, t, J = 7.6Hz), 2.37-
2.85 (3H, m), 3.64-3.76 (3H, m), 4.07 (2H, d, J = 7.2H
z), 4.28 (2H, d, J = 5.4Hz), 4.61 (1H, bs), 5.05 (1H, b
s), 6.83-7.41 (11H, m). (2) 4- [N-[(1-benzoyl-4-piperidinyl) carbonyl]
From the ethyl ester of -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl]] aminobutyric acid, 4- [N-[(1-benzoyl) -
A non-crystalline solid of 4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl]] aminobutyric acid was obtained. Elemental analysis: C ₃₅ H ₄₁ N ₃ O ₇・ H ₂ O Theoretical: C, 66.33; H, 6.84; N, 6.63. Found: C, 66.46; H, 6.80; N, 6.49. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.81 (6H, bs), 2.34-
2.47 (3H, m), 2.71 (2H, bs), 3.32 (1H, bs), 3.72 (2H,
bs), 4.26 (2H, bs), 4.63 (1H, bs), 5.15 (1H, bs), 6.8
5-6.99 (3H, m), 7.17-7.42 (8H, m).

(3) Example from 4- [N-[(1-benzoyl-4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl]] aminobutyric acid In the same manner as in (3) of 234, N- (2-fluorobenzyl) -4- [N '-[(1-benzoyl-4-piperidinyl) carbonyl] -N'-[2- [3- (tert -Butoxycarbonylaminomethyl)
A non-crystalline solid of phenoxy] phenyl]] aminobutylamide was obtained. Elemental analysis: C ₄₂ H ₄₇ N ₄ O ₆ F.H ₂ O Theoretical: C, 68.09; H, 6.67; N, 7.56. Found: C, 67.81; H, 6.45; N, 7.75. ¹ H- NMR (CDCl ₃ ) δ: 1.40 (9H, s), 1.52-1.94 (6H, m), 2.
15-2.28 (2H, m), 2.43-2.52 (2H, m), 2.73 (1H, bs), 3.
61-3.82 (2H, m), 4.04-4.19 (1H, m), 4.25 (2H, d, J = 4.
8Hz), 4.46 (2H, d, J = 5.6Hz), 4.59 (1H, bs), 5.16 (1H,
bs), 6.75-7.41 (15H, m). (4) N- (2-fluorobenzyl) -4- [N '-[(1-benzoyl-4-
Piperidinyl) carbonyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] phenyl]] aminobutyramide was converted to N- by a method similar to (4) of Example 234.
(2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] phenyl] -N'-[[1-benzoyl-4-piperidinyl] carbonyl]] aminobutylamide hydrochloride An amorphous solid was obtained. Elemental analysis _{C 37 H 40 N 4 O 4} ClF · H 2 O theoretically:. C, 65.62; H, 6.25; N, 8.27 Found:. C, 65.35; H, 5.98; N, 8.46 1 H- NMR (DMSO-d ₆ ) δ: 1.28-1.76 (6H, m), 2.16 (2H, t, J
= 8.0Hz), 2.23 (1H, bs), 2.78 (1H, bs), 3.28-3.46 (1H,
m), 3.67-3.74 (2H, m), 4.01 (2H, s), 4.26 (2H, s), 4.3
5 (1H, bs), 6.98-7.44 (16H, m), 8.35 (2H, bs).

Example 236 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(1-benzenesulfonyl-4-piperidinyl] carbonyl]) aminobutylamide hydrochloride (1) 4- [N-[[1- (benzyloxy) carbonyl-4- Piperidinyl] carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.42 g, 2 mmol) in ethyl acetate (10
ml) and a solution of tetrahydrofuran (10 ml) were added 5% palladium on carbon (0.3 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was dissolved in tetrahydrofuran (10 ml), and benzenesulfonyl chloride (0.38 ml, 3 mmol) and triethylamine (0.42 ml, 3 mmol) were added. The mixture was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with brine and dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N-
[(1-benzenesulfonyl-4-piperidinyl) carbonyl]-
A non-crystalline solid of N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (1.2 g, 81%) was obtained. Elemental analysis: C ₃₆ H ₄₄ N ₃ O ₈ ClS Theoretical: C, 60.54; H,
. 6.21; N, 5.88 Found:. C, 60.53; H, 6.20; N, 5.99 1 H-NMR (CDCl 3) δ: 1.20 (3H, t, J = 7.2Hz), 1.44 (9H,
s), 1.61-1.86 (6H, m), 2.07-2.34 (5H, m), 3.57-3.78
(4H, m), 4.06 (2H, d, J = 7.2Hz), 4.28 (2H, d, J = 5.8H
z), 5.06 (1H, bs), 6.77-6.87 (3H, m), 7.04-7.16 (3H,
m), 7.28-7.36 (1H, m), 7.49-7.60 (3H, m), 7.72-7.77
(2H, m). (2) 4- [N-[(1-benzenesulfonyl-4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ]] 4-aminobutyric acid ethyl ester was prepared in the same manner as in Example 234 (2).
[N-[(1-benzenesulfonyl-4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl)
A non-crystalline solid of phenoxy] -4-chlorophenyl]] aminobutyric acid was obtained. Elemental analysis: C ₃₄ H ₄₀ N ₃ O ₇ ClS.1 / 2H ₂ O Theoretical: C, 58.74; H, 5.94; N, 6.04. Found: C, 68.81; H, 5.78; N, 5.74. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.69-1.98 (6H, m), 2.
11-2.35 (5H, m), 3.25 (1H, bs), 3.72-3.78 (2H, m), 4.
05 (2H, bs), 4.24 (2H, bs), 5.11 (1H, bs), 6.84 (2H,
d, J = 8.0Hz), 6.86-7.20 (5H, m), 7.29-7.37 (1H, m),
7.47-7.63 (3H, m), 7.71-7.76 (2H, m).

(3) 4- [N-[(1-benzenesulfonyl-4-piperidinyl) carbonyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] amino From butyric acid, N- was obtained in the same manner as in Example 234 (3).
(2-Fluorobenzyl) -4- [N '-[(1-benzenesulfonyl-
A non-crystalline solid of 4-piperidinyl) carbonyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide was obtained. Elemental analysis _{C 41 H 46 N 4 O 7} ClFS · 1 / 2H 2 O theoretically:. C, 61.37; H, 5.90; N, 6.98 Found:. C, 61.48; H, 5.87; N, 7.12 1 H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.63-1.96 (6H, m), 2.
02-2.27 (5H, m), 3.59-3.80 (4H, m), 4.25 (2H, d, J = 5.
8Hz), 4.44 (2H, d, J = 5.6Hz), 5.17 (1H, bs), 6.58 (1H,
bs), 6.76-6.85 (3H, m), 6.98-7.12 (5H, m), 7.16-7.3
4 (3H, m), 7.47-7.59 (3H, m), 7.71-7.75 (2H, m). (4) N- (2-fluorobenzyl) -4- [N '-[(1-benzenesulfonyl- 4-piperidinyl) carbonyl] -N '-[2- [3- (tert-
From butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide, N- (2-fluorobenzyl) -4- [N '-[2- [3-] A non-crystalline solid of (aminomethyl) phenoxy] -4-chlorophenyl] -N '-[(1-benzenesulfonyl-4-piperidinyl) carbonyl]] aminobutylamide hydrochloride was obtained. Elemental analysis: C ₃₆ H ₃₉ N ₄ O ₅ Cl ₂ FS ・ 1 / 2H ₂ O Theoretical: C, 58.53; H, 5.46; N, 7.58. Found: C, 58.79; H, 5.64; N, 7.77 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.46-1.68 (6H, m), 2.11-2.18 (5H,
m), 3.32-3.73 (4H, m), 4.01 (2H, s), 4.36 (2H, s), 6.
84 (1H, d, J = 2.2Hz), 7.04-7.59 (12H, m), 7.63-7.71 (3
H, m), 8.32-8.47 (3H, m).

Example 237 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(4-biphenyl) carbamoyl]] aminobutylamide hydrochloride (1) 4-phenylbenzoic acid (2.0 g, 10 mmol), diphenylphosphoryl azide (DPPA) (4.1 g , 15 mmol), triethylamine (1.2 g, 12 mmol) and N, N-dimethylformamide (5
ml) was stirred at room temperature for 1 hour. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was distilled off.
Toluene (20 ml) was added to the residue, and the resulting mixture was stirred under reflux with heating for 3 hours. Then, 4- [N- [2
-[3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.
31 g, 5 mmol) and 4-dimethylaminopyridine (1.22 g, 10
mmol) and the resulting mixture was stirred under reflux for 5 hours. The reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with 1N aqueous sodium hydroxide solution and brine, and then dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N-[(4-biphenyl) carbamoyl] -N- [2-
[3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.
2 g, 67%) of an amorphous solid was obtained. Elemental analysis C ₃₇ H ₄₀ N ₃ O ₆ theory as Cl:. C, 67.52; H , 6.13; N, 6.38 Found:. C, 67.30; H, 5.96; N, 6.57 1 H-NMR (CDCl 3 ) δ: 1.22 (3H, t, J = 7.1Hz), 1.42 (9H,
s), 1.84-1.98 (2H, m), 2.41 (2H, t, J = 7.5Hz), 3.74 (2H
H, t, J = 7.0Hz), 4.10 (2H, q, J = 7.1Hz), 4.24 (2H, d, J
= 4.4Hz), 4.93 (1H, bs), 6.45 (1H, s), 6.89-6.95 (3H,
m), 7.08 (1H, d, J = 7.6Hz), 7.17 (1H, dd, J = 2.2,8.4H
z), 7.29-7.58 (11H, m). (2) 4- [N-[(4-biphenyl) carbamoyl] -N- [2- [3- (ter
t-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid ethyl ester (2.0 g, 3 m
mol) of tetrahydrofuran (5 ml) and ethanol (5 ml), 1N aqueous sodium hydroxide solution (6 ml, 6 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. The reaction solution was poured into water, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, 4- [N-[(4-biphenyl) carbamoyl] -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid (1.85 g, 98%) of an amorphous solid was obtained. Elemental analysis: C ₃₅ H ₃₆ N ₃ O ₆ Cl ・ 1 / 2H ₂ O Theoretical: C, 65.77; H, 5.83; N, 6.57. Found: C, 65.83; H, 5.82; N, 6.52. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.82-1.96 (2H, m), 2.
44 (2H, bs), 3.78 (2H, bs), 4.24 (2H, d, J = 4.4Hz), 5.
09 (1H, bs), 6.35 (1H, bs), 6.89-7.05 (3H, m), 7.18 (1
H, dd, J = 2.2,8.6Hz), 7.28-7.58 (13H, m).

(3) 4- [N-[(4-biphenyl) carbamoyl]-
N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyric acid (0.95 g, 1.5 m
mol), 2-fluorobenzylamine (0.21 ml, 1.8 mmol),
A mixture of diethyl cyanophosphate (0.25 ml, 1.8 mmol), triethylamine (0.25 ml, 1.8 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[(4-biphenyl)
A non-crystalline solid of carbamoyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.82 g, 75%) was obtained. Elemental analysis: C ₄₂ H ₄₂ N ₄ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 67.60; H, 5.81; N, 7.51. Found: C, 67.94; H, 5.67; N, 7.73. ¹ H-NMR (CDCl ₃ ) δ: 1.41 (9H, s), 1.85-1.95 (2H, m), 2.
34 (2H, t, J = 6.5Hz), 3.77 (2H, t, J = 6.6Hz), 4.23 (2H, t, J = 6.6Hz)
d, J = 5.8Hz), 4.48 (2H, d, J = 6.0Hz), 5.00 (1H, bs),
6.68 (1H, bs), 6.76 (1H, bs), 6.87-6.98 (2H, m), 7.01
-7.58 (18H, m). (4) N- (2-fluorobenzyl) -4- [N '-[(4-biphenyl) carbamoyl] -N'-[2- [3- (tert-butoxycarbonylamino Methyl) phenoxy] -4-chlorophenyl]] aminobutyramide (0.74 g, 1 mmol) in ethyl acetate (5 ml)
Add hydrogen chloride / ethyl acetate solution (5 ml) and add
Stir for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid is collected by filtration and washed with ethyl ether.
N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(4-biphenyl) carbamoyl]] aminobutylamide hydrochloride (0.61 g, 91
%) Of an amorphous solid. Elemental analysis: C ₃₇ H ₃₅ N ₄ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 65.10; H, 5.32; N, 8.21. Found: C, 65.06; H, 5.27; N, 8.10 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.70-1.79 (2H, m), 2.20-2.27 (2H,
m), 3.62 (2H, bs), 3.97 (2H, s), 4.30 (2H, s), 6.92
(1H, d, J = 2.2Hz), 7.08-7.19 (3H, m), 7.25-7.52 (15H,
m), 7.61 (2H, d, J = 7.2Hz), 8.32-8.52 (3H, m).

Example 238 N- (2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[[4- (2-methoxyphenyl) -1-piperazinyl] acetyl]] aminobutyramide trihydrochloride (1) N- (2-fluorobenzyl) -4- [ N '-[2- [3-
(tert-butoxycarbonylaminomethyl) phenoxy] -4
Example 19 from -chlorophenyl] -N'-chloroacetyl] aminobutyramide and 4- (2-methoxyphenyl) piperazine
N- (2-fluorobenzyl) -4-by the same method as in (2) of 4
[N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[[4- (2-methoxyphenyl) -1-piperazinyl] acetyl]] aminobutyramide A non-crystalline solid was obtained. Elemental analysis: C ₄₂ H ₄₉ N ₅ O ₆ ClF · 1 / 2H ₂ O Theoretical: C, 64.40; H, 6.43; N, 8.94. Found: C, 64.45; H, 6.25; N, 8.94. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.81-1.85 (4H, m), 2.
23-2.28 (2H, m), 2.57-2.72 (4H, m), 3.05 (3H, s), 3.0
6-3.08 (2H, m), 3.68-3.78 (2H, m), 3.84 (2H, s), 4.29
(2H, d, J = 6.0Hz), 4.47 (2H, d, J = 5.8Hz), 5.16 (1H, b
s), 6.83-7.38 (16H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-[[4- (2-methoxyphenyl) -1-piperazinyl] acetyl]] aminobutyramide from Example 194 (3)
N- (2-fluorobenzyl) -4- [N '-[2-
[3- (Aminomethyl) phenoxy] -4-chlorophenyl] -N'-
[[4- (2-methoxyphenyl) -1-piperazinyl] acetyl]]
An amorphous solid of aminobutyramide trihydrochloride was obtained. Elemental analysis: C ₃₇ H ₄₄ N ₅ O ₄ Cl ₄ F ・ 1 / 2H ₂ O Theoretical: C, 56.0
. 7; H, 5.72; N , 8.84 Found:. C, 56.22; H, 5.74; N, 8.85 1 H-NMR (DMSO-d 6) δ: 1.76 (2H, t, J = 7.0Hz), 2.26 (2H,
t, J = 7.5Hz), 3.11-3.63 (11H, m), 3.79 (2H, s), 3.86-
3.97 (2H, m), 4.05 (2H, s), 4.27 (2H, s), 6.88-7.17 (8
H, m), 7.27-7.54 (6H, m), 7.65 (1H, d, J = 8.4Hz), 8.5
4 (1H, bs), 8.73 (2H, bs).

Example 239 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(3,4-dihydro-1H
-Isoquinolyl) acetyl]] aminobutylamide dihydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N'-chloroacetyl] aminobutyramide and 3,4-
N- (2-fluorobenzyl) -4- [N '-[2- [3- (ter) was obtained from dihydro-1H-isoquinoline in the same manner as in Example 194 (2).
A non-crystalline solid of t-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[(3,4-dihydro-1H-isoquinolyl) acetyl]] aminobutyramide was obtained. Elemental analysis: C ₄₀ H ₄₄ N ₄ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 66.33; H, 6.26; N, 7.74. Found: C, 66.45; H, 5.96; N, 7.78. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.78-1.89 (2H, m), 2.
23-2.36 (2H, m), 2.72-2.88 (4H, m), 3.18 (2H, d, J = 1.
6Hz), 3.67 (2H, s), 3.72-3.78 (2H, m), 4.25 (2H, d, J
= 6.2Hz), 4.46 (2H, d, J = 5.8Hz), 5.08 (1H, bs), 6.81-
6.84 (3H, m), 6.93-7.34 (12H, m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-Chlorophenyl] -N '-[(3,4-dihydro-1H-isoquinolyl) acetyl] aminobutyramide was converted to N- (2-fluorobenzyl) -4- according to a method similar to (3) of Example 194. [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[(3,4-dihydro-1H-isoquinolyl) acetyl] aminobutyramide 2
An amorphous solid of the hydrochloride was obtained. Elemental analysis value C ₃₅ H ₃₈ N ₄ O ₃ Cl
₃ F · 1 / 2H ₂ O theoretically:. C, 60.31; H, 5.64; N, 8.04 Found:. C, 60.31; H, 5.83; N, 8.30 1 H-NMR (DMSO-d 6) δ : 1.73-1.80 (2H, m), 2.26 (2H, t, J
= 7.4Hz), 2.90-3.17 (2H, m), 3.43-3.67 (4H, m), 3.85-
4.00 (2H, m), 4.05 (2H, s), 4.28 (2H, s), 4.48-4.56 (2
H, m), 6.86 (1H, s), 7.09-7.68 (14H, m), 8.51 (1H, b
s), 8.72 (2H, bs).

Example 240 N- (2-fluorobenzyl) -4- [N ′-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[[spiro (1H-indene-1,4'-piperidin) -1'-yl] acetyl]] aminobutyramide dihydrochloride (1) N- (2-fluoro Benzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutyramide and spiro (1H-indene-1,4 '-Piperidine) from Example 194 (2)
N- (2-fluorobenzyl) -4- [N '-[2
-[3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[[spiro (1H-indene-1,4'
A non-crystalline solid of -piperidin) -1'-yl] acetyl]] aminobutyramide was obtained. Elemental analysis: C ₄₄ H ₄₈ N ₄ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 68.07; H, 6.36; N, 7.22. Found: C, 68.34; H, 6.14; N, 7.08. ¹ H-NMR (CDCl ₃ ) δ: 1.42 (9H, s), 1.89-1.98 (4H, m), 2.
11-2.50 (6H, m), 2.88-3.08 (2H, m), 3.14 (2H, s), 3.6
5-3.84 (2H, m), 4.29 (2H, d, J = 6.2Hz), 4.47 (2H, d, J
= 5.6Hz), 5.14 (1H, bs), 6.72 (1H, d, J = 5.7Hz), 6.79
(1H, d, J = 5.7Hz), 6.89-6.94 (3H, m), 7.01-7.38 (12H,
m). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-[[spiro ( 1H-indene-1,4'-piperidine)-
1'-yl] acetyl] aminobutyramide from Example 194
N- (2-fluorobenzyl) -4- [N'-
[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl]-
N '-[[spiro (1H-indene-1,4'-piperidin) -1'-yl]
[Acetyl] aminobutylamide hydrochloride was obtained as 2 amorphous solids. Elemental analysis: C ₃₉ H ₄₂ N ₄ O ₃ Cl ₃ F ・ 3 / 2H ₂ O Theoretical: C, 61.06; H, 5.91; N, 7.30. Found: C, 61.16; H, 5.93; N, 7.45 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.17-1.32 (2H, m), 1.74-1.79 (2H,
m), 2.23-2.28 (2H, m), 2.51-2.74 (2H, m), 3.39-3.54
(4H, m), 3.89-4.05 (4H, m), 4.28 (2H, s), 6.85-6.90
(2H, s), 7.10-7.56 (13H, m), 7.63-7.68 (2H, m), 8.51
(1H, bs), 8.74 (2H, bs).

Example 241 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[[4- (2-oxo-2,3
-Dihydro-1H-benzimidazol-1-yl) -1-piperazinyl] acetyl]] aminobutyramide dihydrochloride (1) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N'-chloroacetyl] aminobutyramide and 4- (2
-Oxo-2,3-dihydro-1H-benzimidazol-1-yl)
From 1-piperan, N- was obtained in the same manner as in Example 194 (2).
(2-Fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]
An amorphous solid of -N '-[[4- (2-oxo-2,3-dihydro-1H-benzimidazol-1-yl) -1-piperazinyl]] acetyl]] aminobutyramide was obtained. Elemental analysis _{C 43 H 48 N 6 O 6} ClF · H 2 O theoretically:. C, 63.19; H, 6.17; N, 10.28 Found:. C, 63.45; H, 6.00; N, 10.39 1 H- NMR (CDCl ₃ ) δ: 1.43 (9H, s), 1.65-1.89 (8H, m), 2.
27-2.48 (4H, m), 3.01-3.10 (3H, m), 3.76 (2H, s), 4.2
9 (2H, d, J = 6.2Hz), 4.47 (2H, d, J = 5.6Hz), 5.25 (1H,
bs), 6.79 (1H, bs), 6.89-7.39 (15H, m), 9.11 (1H, bs). (2) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N '-[[4- (2-oxo-2,3-dihydro-1H-benzimidazol-1-yl) -1-piperazinyl] acetyl] From aminobutyramide, N- was obtained in the same manner as in Example 194 (3).
(2-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[[4- (2-oxo-2,3-
An amorphous solid of dihydro-1H-benzimidazol-1-yl) -1-piperazinyl] acetyl] aminobutyramide dihydrochloride was obtained. Elemental analysis: C ₃₈ H ₄₂ N ₆ O ₄ Cl ₃ F.H ₂ O Theoretical: C, 57.76; H, 5.61; N, 10.64. Found: C, 57.50; H, 5.75; N, 10.65. ¹ H-NMR (DMSO-d ₆ ) δ: 1.77-1.91 (4H, m), 2.12-2.28 (2H,
m), 2.74-2.89 (2H, m), 3.39-3.58 (4H, m), 3.79-3.87
(4H, m), 4.08 (2H, s), 4.28 (2H, s), 4.55 (1H, bs), 6.
86 (1H, d, J = 2.2Hz), 7.01-7.67 (14H, m), 8.49 (1H, b
s), 8.72 (2H, bs).

Example 242 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-[(4-biphenyloxy) acetyl]] aminobutylamide hydrochloride (1) N- (2-fluorobenzyl) -4- [N'-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N′-chloroacetyl] aminobutylamide and 4-phenylphenol were subjected to N- (2-fluorobenzyl) in the same manner as in Example 194 (2). Non-crystalline properties of) -4- [N '-[(4-biphenyloxy) acetyl] -N'-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutylamide A solid was obtained. Elemental analysis value C ₄₃ H ₄₃ N ₃ O ₆
Theory as ClF:. C, 68.65; H , 5.76; N, 5.59 Found:. C, 68.54; H, 5.60; N, 5.50 1 H-NMR (CDCl 3) δ: 1.41 (9H, s), 1.85 -1.92 (2H, m), 2.
28 (2H, t, J = 6.7Hz), 3.67-3.88 (2H, m), 4.27 (2H, d,
J = 4.2Hz), 4.44 (2H, d, J = 5.4Hz), 4.53 (2H, d, J = 2.0H
z), 5.13 (1H, bs), 6.52 (1H, bs), 6.84-7.54 (20H, m). (2) N- (2-fluorobenzyl) -4- [N '-[(4-biphenyloxy ) Acetyl] -N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl]] aminobutyramide was converted to N- (2
-Fluorobenzyl) -4- [N '-[2- [3- (aminomethyl) phenoxy] -4-chlorophenyl] -N'-[(4-biphenyloxy)
A non-crystalline solid of [acetyl] aminobutylamide hydrochloride was obtained. Elemental analysis: C ₃₈ H ₃₆ N ₃ O ₄ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 65.42; H, 5.35; N, 6.02. Found: C, 65.78; H, 5.31; N, 6.01 ^{. 1 H-NMR (DMSO-} d 6) δ: 1.69-1.75 (2H, m), 2.21 (2H, t, J
= 8.4Hz), 3.54-3.85 (2H, m), 4.02 (2H, s), 4.27 (2H,
s), 4.46 (1H, d, J = 15.1Hz), 4.63 (1H, d, J = 15.1Hz),
6.85-6.92 (3H, m), 7.11-7.59 (16H, m), 7.67 (1H, d, J
= 8.8Hz), 8.39 (2H, bs).

Example 243 N- (2-fluorobenzyl) -4- [N '-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(1-naphthalenesulfonyl)] aminobutylamide hydrochloride (1) 4- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (2.3 g, 5.0 mmol), 4-dimethylaminopyridine (1.
2 g, 10 mmol), 1-naphthalenesulfonyl chloride (2.3
g, 10 mmol) and a solution of tetrahydrofuran (20 ml) were stirred at 60 ° C. for 72 hours, then the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- (1-naphthalenesulfonyl) -N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4- Chlorophenyl]] aminobutyric acid ethyl ester (2.3 g, 71%) was obtained as an oil. Elemental analysis: C ₃₄ H ₃₇ N ₂ O ₇ ClS ・ 1 / 2H ₂ O Theoretical: C, 61.67; H, 5.78; N, 4.23. Found: C, 61.90; H, 5.62; N, 4.32. ¹ H-NMR (CDCl ₃ ) δ: 1.22 (3H, t, J = 7.0 Hz), 1.47 (9H,
s), 1.76-1.90 (2H, m), 2.41 (2H, t, J = 7.3Hz), 3.80 (2H
H, bs), 4.07 (2H, q, J = 7.0Hz), 4.18 (2H, d, J = 5.8H
z), 4.82 (1H, bs), 6.08 (1H, s), 6.21 (1H, d, J = 7.8H
z), 6.46 (1H, d, J = 2.2Hz), 6.97-7.16 (3H, m), 7.39-
7.54 (4H, m), 7.86 (1H, d, J = 7.4Hz), 8.01 (1H, d, J = 8.
4Hz), 8.14 (1H, dd, J = 2.2,7.4Hz), 8.49 (1H, d, J = 8.8
(2) Example 6 from 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl-N- (1-naphthalenesulfonyl)]] aminobutyric acid ethyl ester of
In the same manner as in (3), 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N
A non-crystalline solid of [-(1-naphthalenesulfonyl)] aminobutyric acid was obtained. Elemental analysis: C ₃₂ H ₃₃ N ₂ O ₇ ClS Theoretical: C, 61.
. 48; H, 5.32; N , 4.48 Found:. C, 61.16; H, 5.35; N, 4.41 1 H-NMR (CDCl 3) δ: 1.40 (9H, s), 1.85-1.95 (2H, m) , 2.
41 (2H, bs), 3.72 (1H, bs), 4.14 (2H, bs), 5.06 (1H, b
s), 5.86 (1H, d, J = 8.0Hz), 6.07-6.28 (1H, m), 6.46 (1
H, s), 6.63-6.87 (2H, m), 7.08 (2H, s), 7.40-7.54 (4
H, m), 7.91 (1H, bs), 8.05 (1H, d, J = 8.6Hz), 8.16 (1
H, d, J = 7.4Hz), 8.44 (1H, d, J = 8.8Hz).

(3) 4- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (1-
From naphthalenesulfonyl)] aminobutyric acid, N- (2-fluorobenzyl) -4- [N ′-[2- [3
-(tert-Butoxycarbonylaminomethyl) phenoxy]-
A non-crystalline solid of 4-chlorophenyl] -N '-(1-naphthalenesulfonyl)] aminobutylamide was obtained. Elemental analysis value C ₃₉ H
₃₉ N ₃ O ₆ ClF theoretically:. C, 63.97; H, 5.37; N, 5.74 Found:. C, 63.77; H, 5.39; N, 5.60 1 H-NMR (CDCl 3) δ: 1.46 (9H , s), 1.83 (2H, t, J = 7.0H
z), 2.35 (2H, t, J = 7.0Hz), 3.72-3.78 (2H, m), 4.17 (2
H, d, J = 2.2Hz), 4.47 (2H, d, J = 5.8Hz), 4.87 (1H, bs),
6.09-6.15 (2H, m), 6.15-6.27 (1H, s), 6.49 (1H, d, J =
2.2Hz), 6.96-7.55 (10H, m), 7.87 (1H, d, J = 7.4Hz),
8.02 (1H, d, J = 8.6Hz), 8.08 (1H, dd, J = 1.2,7.4Hz),
8.46 (1H, d, J = 8.6Hz). (4) N- (2-fluorobenzyl) -4- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl ] -N '-(1-Naphthalenesulfonyl)] aminobutyramide and N- (2-fluorobenzyl) -4- [N'-[2- [3- ( Aminomethyl) phenoxy]-
A non-crystalline solid of 4-chlorophenyl] -N '-(1-naphthalenesulfonyl)] aminobutylamide hydrochloride was obtained. Elemental analysis: C ₃₄ H ₃₂ N ₃ O ₄ Cl ₂ FS ・ 1 / 2H ₂ O Theoretical: C, 60.27; H,
. 4.91; N, 6.20 Found:. C, 60.48; H, 4.90; N, 6.07 1 H-NMR (DMSO-d 6) δ: 1.62-1.71 (2H, m), 2.21 (2H, t, J
= 5.4Hz), 3.66 (2H, s), 3.93 (2H, s), 4.25 (2H, d, J = 4.
6Hz), 6.28-6.31 (1H, m), 6.51 (1H, d, J = 1.2Hz), 6.80
(1H, s), 7.07-7.40 (7H, m), 7.50-7.66 (4H, m), 8.06-
8.13 (2H, m), 8.25 (1H, d, J = 8.0Hz), 8.30-8.50 (4H,
m).

Example 244 N- (2-Fluorobenzyl) -4- [N ′-[4-chloro-2- [4- (1-piperazinyl) phenoxy] phenyl] -N ′-(4-phenylbenzoyl) ] Aminobutylamide hydrochloride (1) Example 1 from 1- (4-hydroxyphenyl) piperazine
4- (4-tert-butoxycarbonylpiperazin-1-yl) phenol was synthesized in the same manner as in 8 (1). ¹ H-NMR (CDC
l ₃ ) δ: 1.49 (9H, s), 2.95-3.00 (2H, m), 3.55-3.60 (2
H, m), 6.03 (1H, bs), 6.74-6.97 (4H, m) .4-Chloro-2-
Fluoronitrobenzene (2.63 g, 15 mmol), 4- (4-tert-
Butoxycarbonylpiperazin-1-yl) phenol (4.
18 g, 15 mmol), potassium carbonate (2.07 g, 15 mmol) and N, N-
A mixture of dimethylformamide (50 ml) was stirred at 100 ° C. for 12 hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. The extract was washed with water and dried over anhydrous magnesium sulfate, and the solvent was distilled off. The residue was purified by silica gel column chromatography to give 4- [4- (5-chloro-2-nitrophenoxy) phenyl] piperazine-1-carboxylic acid tert-
Crystals of butyl ester (5.8 g, 89%) were obtained. Melting point 124-125 ° C Elemental analysis: C ₂₁ H ₂₄ N ₃ O ₅ Cl Theoretical: C, 58.13; H, 5.58; N, 9.68. Found: C, 57.98; H, 5.57; N, 9.56. ¹ H -NMR (CDCl ₃ ) δ: 1.49 (9H, s), 3.11-3.16 (4H, m), 3.
58-3.63 (4H, m), 6.87 (1H, d, J = 2.2Hz), 6.93-7.05 (4
H, m), 7.08 (1H, dd, J = 2.2,8.8Hz), 7.90 (1H, d, J = 8.8
(2) 4- [4- (5-chloro-2-nitrophenoxy) phenyl] piperazine-1-carboxylic acid tert-butyl ester (5.64 g, 1
To a solution of 3 mmol) in ethyl acetate (100 ml) was added 5% palladium on carbon (1.3 g). The obtained mixture was hydrogenated under normal temperature and normal pressure conditions. The catalyst was filtered off, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 4- [4- (2-amino-5-chlorophenoxy) phenyl] piperazine-1-carboxylic acid tert-butyl ester
(4.0 g, 76%) of crystals were obtained. Melting point 95-96 ° C ¹ H-NMR (CDCl ₃ ) δ: 1.49 (9H, s), 3.02-3.10 (4H, m), 3.
56-3.61 (4H, m), 3.84 (2H, bs), 6.68-6.72 (2H, m), 6.
77-6.93 (5H, m).

(3) 4- [4- (2-amino-5-chlorophenoxy)
[Phenyl] piperazine-1-carboxylic acid tert-butyl ester (3.8 g, 9.5 mmol), 4-bromobutyric acid ethyl ester
(2.7 ml, 19 mmol), potassium carbonate (1.3 g, 9.5 mmol) and
A mixture of N, N-dimethylformamide (30 ml) was added at 60 ° C for 72 hours.
Stirred for hours. After cooling, the reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [2- [4- (4-tert-
Butoxycarbonyl-1-piperazinyl) phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (3.5 g, 71
%) Oil was obtained. Elemental analysis C ₂₇ H ₃₆ N ₃ O ₅ theory as Cl:. C, 62.60; H , 7.00; N, 8.11 Found:. C, 62.55; H, 7.20; N, 7.85 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.0Hz), 1.49 (9H,
s), 1.88-2.02 (2H, m), 2.40 (2H, t, J = 7.1Hz), 3.03-
3.25 (6H, m), 3.56-3.61 (4H, m), 4.12 (2H, q, J = 7.0H
z), 4.29 (1H, bs), 6.55-6.76 (2H, m), 6.85-7.06 (5H,
m). (4) 4- [2- [4- (4-tert-butoxycarbonyl-1-piperazinyl) phenoxy] -4-chlorophenyl] aminobutyric acid ethyl ester (3.4 g, 6.5 mmol), 4-dimethylaminopyridine To a solution of (1.6 g, 13 mmol) in tetrahydrofuran (30 ml) was added 4-phenylbenzoyl chloride (2.2 g, 10 mmol). The reaction solution was stirred at room temperature for 5 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 4- [N- [2- [4- (4-
tert-butoxycarbonyl-1-piperazinyl)] phenoxy
A non-crystalline solid of ethyl-4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyrate (3.4 g, 74%) was obtained. Elemental analysis C ₄₀ H ₄₄ N ₃ O ₆ theory as Cl:. C, 68.80; H , 6.35; N, 6.02 Found:. C, 69.03; H, 6.36; N, 6.00 1 H-NMR (CDCl 3 ) δ: 1.24 (3H, t, J = 7.0Hz), 1.49 (9H,
s), 2.00 (2H, t, J = 7.5Hz), 2.48 (2H, t, J = 7.5Hz), 3.
01-3.10 (4H, m), 3.55-3.60 (4H, m), 3.80-3.90 (1H,
m), 4.06-4.13 (1H, m), 4.11 (2H, q, J = 7.0Hz), 6.48-
6.57 (3H, m), 6.79-6.85 (2H, m), 6.93-7.05 (1H, m),
7.21-7.48 (8H, m), 7.51-7.58 (2H, m).

(5) 4- [N- [2- [4- (4-tert-butoxycarbonyl-1-piperazinyl)] phenoxy-4-chlorophenyl]-
N- (4-phenylbenzoyl)] aminobutyric acid ethyl ester
(3.1 g, 4.5 mmol) in a solution of tetrahydrofuran (10 ml) and ethanol (10 ml) was added 1N aqueous sodium hydroxide solution (9
ml, 9 mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After washing the extract with water,
It was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure,
4- [N- [2- [4- (4-tert-butoxycarbonyl-1-piperazinyl)] phenoxy-4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (2.9 g, 96%) Crystals were obtained. Mp 192-193 ° C. Elemental analysis C ₃₈ H ₄₀ N ₃ O ₆ theory as Cl:. C, 68.10; H , 6.02; N, 6.27 Found:. C, 68.39; H, 6.11; N, 6.06 1 H -NMR (CDCl ₃ ) δ: 1.48 (9H, s), 1.95-2.04 (2H, m), 2.
51-2.56 (2H, m), 3.01-3.09 (4H, m), 3.54-3.59 (4H, m
m), 3.80-3.89 (1H, m), 4.07-4.21 (1H, m), 6.50-6.55
(3H, m), 6.78-7.07 (1H, m), 7.22-7.58 (10H, m). (6) 4- [N- [2- [4- (4-tert-butoxycarbonyl-1-piperazinyl) ] Phenoxy-4-chlorophenyl] -N- (4-phenylbenzoyl)] aminobutyric acid (1.3 g, 2.0 mmol), 2-fluorobenzylamine (0.27 ml, 2.4 mmol), diethyl cyanophosphate (0.33 ml, 2.4 mmol) , Triethylamine (0.33 m
1,2.4 mmol) and N, N-dimethylformamide (10 ml) were stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -4- [N '-[2- [4- (4-tert-butoxycarbonyl-1-piperazinyl) Phenoxy] -4-chlorophenyl] -N '
-(4-phenylbenzoyl)] aminobutyramide (1.4 g, 9
(0%) amorphous solid. Elemental analysis _{C 45 H 46 N 4 O 5} ClF theoretically:. C, 69.53; H, 5.96; N, 7.21 Found:. C, 69.50; H, 6.22; N, 7.12 1 H-NMR (CDCl 3 ) δ: 1.49 (9H, s), 1.94-2.01 (2H, m), 2.
40-2.44 (2H, m), 3.01-3.09 (4H, m), 3.55-3.60 (4H, m
m), 3.71-3.88 (1H, m), 4.14-4.27 (1H, m), 4.53 (2H,
d, J = 5.8Hz), 6.46-6.53 (3H, m), 6.77-6.84 (2H, m),
6.94-7.59 (16H, m). (7) N- (2-fluorobenzyl) -4- [N '-[2- [4- (4-tert-butoxycarbonyl-1-piperazinyl) phenoxy] -4- A 2N solution of [chlorophenyl] -N '-(4-phenylbenzoyl)] aminobutyramide (1.2 g, 1.5 mmol) in hydrogen chloride and ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -4- [N '-[4-chloro-2-
[4- (1-Piperazinyl) phenoxy] phenyl] -N ′-(4-phenylbenzoyl)] aminobutyramide dihydrochloride (1.0 g,
90%) of an amorphous solid was obtained. Elemental analysis: C ₄₀ H ₄₀ N ₄ O ₃ Cl ₃ F.H ₂ O Theoretical: C, 62.54; H, 5.51; N, 7.29. Found: C, 62.82; H, 5.75; N, 7.24. ¹ H-NMR (DMSO-d ₆ ) δ: 1.85-1.88 (2H, m), 2.25-2.32 (2H,
m), 3.23 (4H, bs), 3.37 (4H, bs), 3.82 (2H, s), 4.30
(2H, s), 6.40 (1H, s), 6.67-6.71 (2H, m), 6.98-7.67
(17H, m), 8.40 (1H, bs), 9.43 (1H, bs).

Example 245 N- (2-fluorobenzyl) -2- [N ′-[2- [3- (aminomethyl)
Phenoxy] -4-chlorophenyl] -N '-(4-phenylbenzoyl)] aminoacetamide hydrochloride (1) [3- (2-amino-5-chlorophenoxy) benzylcarbamic acid tert-butyl ester (5.2 g, 15 mmol), bromoacetic acid ethyl ester (3.3 ml, 30 mmol), potassium carbonate (2.1 g, 15 mmol) and N, N-dimethylformamide (30 m
The mixture of l) was stirred at 60 ° C. for 12 hours. After cooling the reaction solution,
Poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 2- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] aminoacetic acid ethyl ester (4.3 g, 66% )). Elemental analysis C ₂₂ H ₂₇ N ₂ O ₅ theory as Cl:. C, 60.76; H , 6.26; N, 6.44 Found:. C, 60.50; H, 6.24; N, 6.33 1 H-NMR (CDCl 3 ) δ: 1.28 (3H, t, J = 7.1Hz), 1.45 (9H,
s), 3.91 (2H, s), 4.22 (2H, q, J = 7.1Hz), 4.29 (2H, d,
J = 6.2Hz), 4.78 (1H, bs), 4.94 (1H, bs), 6.52 (1H, d,
J = 8.4Hz), 6.78 (1H, d, J = 2.6Hz), 6.81-7.05 (4H, m),
7.29 (1H, t, J = 7.8Hz). (2) 2- [2- [3- (tert-butoxycarbonylaminomethyl)
Phenoxy] -4-chlorophenyl] aminoacetic acid ethyl ester (1.7 g, 4.0 mmol), 4-dimethylaminopyridine (0.
To a solution of 98 g (8 mmol) in tetrahydrofuran (30 ml) was added 4-phenylbenzoyl chloride (1.7 g, 8 mmol).
The reaction solution was stirred at room temperature for 3 hours, poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N-
(4-Phenylbenzoyl)] aminoacetic acid ethyl ester
(1.3 g, 53%) of an amorphous solid was obtained. Elemental analysis _{C 35 H 35 N 2 O 6} Cl · 1 / 2H 2 O theoretically:. C, 67.35; H, 5.81; N, 4.49 Found:. C, 67.40; H, 5.93; N, 4.59 1 H-NMR (CDCl ₃ ) δ: 1.30 (3H, t, J = 7.2 Hz), 1.44 (9H,
s), 4.00-4.23 (3H, m), 4.28 (2H, d J = 5.4Hz), 4.84-5.
06 (2H, m), 6.67-6.73 (2H, m), 6.83 (1H, s), 6.91-6.9
5 (1H, m), 7.11 (1H, d, J = 8.4Hz), 7.27-7.48 (9H, m),
7.55-7.60 (2H, m).

(3) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-
Phenylbenzoyl)] aminoacetic acid ethyl ester (1.2
g, 2.0 mmol) in tetrahydrofuran (5 ml) and ethanol
(5 ml) in 1N aqueous sodium hydroxide solution (4 ml, 4 ml
mmol) was added. The resulting mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, acidified with 1N hydrochloric acid, and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. Concentrate under reduced pressure to give 2- [N
-[2- [3- (tert-Butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)]
An amorphous solid of aminoacetic acid (1.1 g, 92%) was obtained. Elemental analysis value C ₃₃ H ₃₁ N ₂ O ₆ Cl · 1 / 2H ₂ O
Theory as:. C, 66.29; H, 5.43; N, 4.69 Found:. C, 66.08; H, 5.51; N, 4.67 1 H-NMR (CDCl 3) δ: 1.43 (9H, s), 4.27 ( 2H, d, J = 5.6H
z), 4.50 (2H, bs), 4.90 (1H, bs), 4.99 (1H, bs), 6.68
(2H, s), 6.81 (1H, s), 6.92 (1H, d, J = 8.4Hz), 7.09 (1
H, d, J = 7.8Hz), 7.26-7.48 (9H, m), 7.54-7.59 (2H,
m). (4) 2- [N- [2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4-chlorophenyl] -N- (4-phenylbenzoyl)] aminoacetic acid (0.30 g, 0.5 mmol ), 2-fluorobenzylamine (0.07 ml, 0.6 mmol), diethyl cyanophosphate (0.08 ml, 0.6 mmol), triethylamine (0.08 ml,
A mixture of 0.6 mmol) and N, N-dimethylformamide (10 ml) was stirred at room temperature for 2 hours. The reaction solution was poured into water and extracted with ethyl acetate. After the extract was washed with water, it was dried over anhydrous magnesium sulfate. After concentration under reduced pressure, the residue was purified by silica gel column chromatography, and N- (2-fluorobenzyl) -2- [N '-[2- [3- (tert-butoxycarbonylaminomethyl) phenoxy] -4 A non-crystalline solid of [-chlorophenyl] -N '-(4-phenylbenzoyl)] aminoacetamide (0.29 g, 85%) was obtained. Elemental analysis: C ₄₀ H ₃₇ N ₃ O ₅ ClF · 1 / 2H ₂ O Theoretical: C, 68.32; H, 5.45; N, 5.98. Found: C, 68.54; H, 5.28; N, 5.91. ¹ H-NMR (CDCl ₃ ) δ: 1.43 (9H, s), 4.15 (2H, d, J = 6.8H
z), 4.51 (4H, bs), 4.82 (1H, bs), 6.29 (1H, d, J = 8.0H
z), 6.42 (1H, s), 6.54 (1H, d, J = 1.8Hz), 6.96-7.09 (3
H, m), 7.13-7.48 (13H, m), 7.54-7.59 (2H, m).

(5) N- (2-fluorobenzyl) -2- [N '-[2- [3
-(tert-Butoxycarbonylaminomethyl) phenoxy]-
A solution of 4-chlorophenyl] -N ′-(4-phenylbenzoyl)] aminoacetamide (0.15 g, 0.35 mmol) in 2N hydrogen chloride in ethyl acetate (10 ml) was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure. The precipitated solid was collected by filtration, washed with ethyl ether, and N- (2-fluorobenzyl) -2- [N '-[2- [3
-(Aminomethyl) phenoxy] -4-chlorophenyl] -N '-(4
-Phenylbenzoyl)] aminoacetamide hydrochloride (0.15
g, 68%) of an amorphous solid. Elemental analysis: C ₃₅ H ₃₀ N ₃ O ₃ Cl ₂ F1 / 2 H ₂ O Theoretical: C, 65.73; H, 4.89; N, 6.57. Found: C, 65.44; H, 4.96; N, 6.48 ^{. 1 H-NMR (DMSO-} d 6) δ: 3.99-4.15 (3H, m), 4.38 (2H, s),
4.72 (1H, d, J = 16.4Hz), 6.68 (1H, s), 6.82 (1H, d, J =
7.0Hz), 7.14-7.50 (15H, m), 7.59-7.69 (3H, m), 8.44 (2
H, bs), 8.66 (1H, bs).

The pharmacological action of the compound of the present invention will be specifically described below, but it should not be construed that the invention is limited thereto. The genetic engineering method using E. coli is described in Molecular Cloning (T. Maniatis et al.), 198
The method described in the ninth edition was followed. (1) Cloning of Human Somatostatin Receptor Protein Subtype 1 (SSTR1) DNA Nucleotide sequence of a known human SSTR1 cDNA [Proc. Natl. Acad. Sci. ., US
A), Vol. 89, pp. 251-255, 1992], DNA oligomers S1-1 and S1-2 were synthesized. The sequence of S1-1 was 5′-GGTCGACCTCA
GCTAGGATGTTCCCCAATG-3 ′ (SEQ ID NO: 1), and the sequence of S1-2 is 5′-GGTC
GACCCGGGCTCAGAGCGTCGTGAT-
3 ′ (SEQ ID NO: 2). As a template, human chromosomal DNA (Clontech, Catalog No. CL6550)
-1) was used. To 0.5 ng of the DNA was added 25 pmol of each of the above DNA oligomers, and a polymerase chain reaction was carried out using 2.5 units of Pfu DNA polymerase (Stratagene). The composition of the reaction solution is the Pf
The instructions attached to the uDNA polymerase were followed. The reaction conditions were repeated at 35 cycles of 94 ° C. for 1 minute, 63 ° C. for 1 minute, and 75 ° C. for 2 minutes.
When the reaction solution was subjected to 1% agarose gel electrophoresis, a DNA fragment of a target size (about 1.2 kb) was specifically amplified. The DNA fragment was recovered from an agarose gel according to a conventional method, and pUC1 cleaved at the HincII site.
18 and transformed into competent cells, Escherichia coli JM109. A transformant having a plasmid containing the DNA fragment was selected, and an automatic nucleotide sequence analyzer ALF D using a fluorescent dye was selected.
Insert DNA with NA sequencer (Pharmacia)
When the nucleotide sequence of the fragment was confirmed, the amino acid sequence predicted from the nucleotide sequence completely matched the sequence described in the above-mentioned literature.

(2) Construction of Expression Plasmid for Human Somatostatin Receptor Protein Subtype 1 (SSTR1) DNA pAKKO-111 was used as an expression vector in CHO (Chinese hamster ovary) cells. pAK
KO-111 was constructed as follows. JP-A-5-076
No. 385, pTB1417 to Hind II
I and ClaI treatments allow the SRα promoter and p
A 1.4 kb DNA fragment containing an olyA addition signal was obtained. In addition, pTB348 [Biochemical and
Biophysical Research Communications (Biochem. Biophys. Res. Commun.), 128, 256
-264, 1985], a 4.5 kb DNA fragment containing the dihydrofolate reductase (DHFR) gene was obtained by treatment with ClaI and SalI. The ends of these DNA fragments were made blunt by treatment with T4 polymerase and ligated with T4 ligase to construct a pAKKO-111 plasmid. Next, the human human obtained in the above (1)
After digesting 5 μg of the plasmid having the SSTR1 DNA fragment with the restriction enzyme SalI, the mixture was subjected to 1% agarose gel electrophoresis to obtain 1.2 k of human SSTR1.
The DNA fragment of b was recovered. Then, 1 μg of the above-mentioned expression vector pAKKO-111 (5.5 kb) was added to SalI.
To create a cloning site for inserting the human SSTR1 DNA fragment. The expression vector fragment and the 1.2 kb DNA fragment were ligated using T4 DNA ligase, and the reaction solution was subjected to a calcium chloride method using Escherichia coli JM1.
09 and transformed into human SSTR1 from transformants.
An expression plasmid pA1-11-SSTR1 in which the DNA fragment was inserted in the forward direction with respect to the promoter was obtained. This transformant was transformed into Escherichia coli JM109 / pA-1.
-11-SSTR1 is displayed.

(3) CHO (dh) of human somatostatin receptor protein subtype 1 (SSTR1) DNA
Introduction and expression into fr ⁻ ) cells 1 × 10 ⁶ CHO (dhfr ⁻ ) cells were collected at a diameter of 8 cm.
Ham F containing 10% fetal bovine serum using a Petri dish
The cells were cultured for 24 hours in 12 medium, and the cells were added to the human SSTR1 cDNA expression plasmid 1 pA-
10 μg of 1-11-SSTR1 was added to the calcium phosphate method (Cellfect Transfection Kit; Pharmacia).
a)). Twenty-four hours after the introduction, the medium was changed to DMEM medium containing 10% dialyzed fetal bovine serum, and cells forming colonies with this medium (that is, DHFR + cells) were selected. Further, the selected cells were cloned from a single cell by the limiting dilution method, and the somatostatin protein activity was measured by the following method. Human SSTR cDNA
The expression cell line was added to a measuring buffer [50 mM Tris-HCl, 1
mM EDTA, 5 mM magnesium chloride, 0.1%
BSA, 0.2 mg / ml bacitracin, 10 μg
/ Ml leupeptin, 1 μg / ml pepstatin,
200 units / ml of aprotinin (pH 7.
5)] and increase the cell number to 2 × 10 ⁴ per 200 μl.
Adjusted to individual. Dispense 200 μl into tubes and add 5 nM
[ ¹²⁵ I] -Somatostatin-14 (2000 Ci / m
mol, Amersham) and add 2 μl.
Incubation was performed at 5 ° C for 60 minutes. In addition, a tube to which 2 μl of somatostatin-14 (10 ⁻⁴ M) was added was also incubated to measure the amount of non-specific binding (NSB). Washing buffer [50 mM Tris-HCl, 1 mM EDTA, 5 mM magnesium chloride (p
H7.5)] (1.5 ml), and the mixture was filtered through a GF / F glass fiber filter (Whatman), and the same buffer (1.
5 ml). [ ¹²⁵ I] of the filter paper was measured with a γ-counter. Thus, a cell line with high somatostatin binding property, SSTR1-8-3, was selected.

(4) Cloning of Human Somatostatin Receptor Protein Subtype 2 (SSTR2) DNA The base sequence of a known human SSTR2 cDNA [Proceding of the National Academy of Science USA (Proc. Natl. Acad.Sci., US
A), Vol. 89, pp. 251-255, 1992] to synthesize DNA oligomers PT-1 and PT-2. The sequence of PT-1 is 5'-GGTCGACACCA
TGGACATGGCGGATGAG-3 ′ (SEQ ID NO: 3), and the sequence of PT-2 is 5′-GGTCG
ACAGTTCAGACTACTGGTTTGG-3 '
(SEQ ID NO: 4). Human pituitary cDNA (Clontech, catalog number 7173-1) was used as a template. To 1 ng of the cDNA, 25 pmol of each of the DNA oligomers was added, and a polymerase chain reaction was carried out using 2.5 units of Taq DNA polymerase (Takara Shuzo Co., Ltd.). The composition of the reaction solution was in accordance with the instructions attached to the Taq DNA polymerase. Reaction conditions are 94 ° C
For 30 seconds, at 52 ° C. for 20 seconds, and at 72 ° C. for 60 seconds.
As a cycle, 30 cycles were repeated. Reaction solution 1
When electrophoresed on a% agarose gel, a DNA fragment of the target size (about 1.1 kb) was specifically amplified. The DNA fragment was recovered from an agarose gel according to a conventional method, and pUC118 cleaved at a Hinc II site.
And transformed into competent cells, Escherichia coli JM109. The D
Two transformants (No. 5 and No. 7) having the plasmid containing the NA fragment were selected, and the base of the inserted DNA fragment was selected using an automatic base sequence analyzer 373A DNA sequencer (manufactured by Applied Biosystems) using a fluorescent dye. After confirming the sequence, it was confirmed that the sequence between SalI and BstPI of No. 5 strain was 77
No. 1 point mutation was confirmed in the sequence of the 0 base fragment.
One point mutation was confirmed in the sequence of the 360 base fragment between BstPI and SalI of the strain. So, No.5 strain Bs
tPI-SalI fragment and BstPI-Sal of No. 7 strain
The remaining fragment except for I was purified by agarose electrophoresis, and a plasmid was constructed by connecting these fragments by a ligation reaction. When the nucleotide sequence of the DNA fragment inserted into this plasmid was confirmed, it completely matched the sequence described in the above-mentioned literature.

(5) Construction of Expression Plasmid for Human Somatostatin Receptor Protein Subtype 2 (SSTR2) DNA As an expression vector in CHO (Chinese hamster ovary) cells, pAKKO-111 described in (2) above was used.
Was used. The human SSTR2cD obtained in the above (4)
5 μg of the plasmid having the NA fragment was digested with the restriction enzyme SalI.
After digestion with, a 1% agarose gel electrophoresis was performed to recover a 1.1 kb DNA fragment encoding human SSTR2. And the expression vector pAKKO-11
1 (5.5 kb) was digested with SalI, and
A cloning site for inserting the STR2 DNA fragment was created. The expression vector fragment and 1.1 kb DN
The A fragment was ligated using T4 DNA ligase, and the reaction mixture was introduced into E. coli JM109 by the calcium chloride method.
C01 was obtained. This transformant is designated as Escherichia coli JM109 / pAC01.

(6) CHO (dh) of human somatostatin receptor protein subtype 2 (SSTR2) DNA
Introduction and expression into fr ⁻ ) cells 1 × 10 ⁶ CHO (dhfr ⁻ ) cells were collected at a diameter of 8 cm.
Ham F containing 10% fetal bovine serum using a Petri dish
After culturing for 24 hours in a 12-medium medium, the human SSTR2 cDNA expression plasmid pAC0 obtained in the above (5) was added to the cells.
1, 10 μg of calcium phosphate method (Cell Phect Trans
fection Kit; Pharmacia). Twenty-four hours after the introduction, the medium was changed to a DMEM medium containing 10% dialyzed fetal bovine serum, and cells forming colonies in this medium (that is, DHFR ⁺ cells) were selected. Furthermore, the selected cells were cloned from a single cell by the limiting dilution method, and a cell line highly expressing human SSTR2, SSTR2
-HS5-9 was selected.

(7) Cloning of Human Somatostatin Receptor Protein Subtype 3 (SSTR3) DNA The nucleotide sequence of a known human SSTR3 cDNA [Molecular Endocrinol.
2136-2142, 1992].
Oligomers, S3-1 and S3-2, were synthesized. S3-
The sequence of 1 is 5'-GGTCGACCTCCAACCAT
GGACATGCTTCATC-3 '(SEQ ID NO: 5)
And the sequence of S3-2 is 5′-GGTCCGACTT.
TCCCCAGGCCCCTACAGGGTA-3 ′ (SEQ ID NO: 6). As a template, human chromosomal DNA
(Clontech, catalog number CL6550-1) was used. To 0.5 ng of the DNA, 25 pmol of each of the DNA oligomers was added, and a polymerase chain reaction was performed using 2.5 units of Pfu DNA polymerase (Stratagene). The reaction solution composition followed the instructions attached to Pfu DNA polymerase. The reaction conditions are 9
One cycle of 4 ° C. for 1 minute, 63 ° C. for 1 minute, and 75 ° C. for 2 minutes was repeated for 35 cycles. 1% reaction solution
Electrophoresis on an agarose gel revealed that a DNA fragment of the desired size (about 1.3 kb) was specifically amplified. The amino acid sequence predicted from the nucleotide sequence completely matched the sequence described in the literature.

(8) Construction of Expression Plasmid for Human Somatostatin Receptor Protein Subtype 3 (SSTR3) DNA The pAKKO-111 described in (2) above was used as an expression vector in CHO cells. Plasmid 5 μl containing the human SSTR3 DNA fragment obtained in (7) above
g was digested with the restriction enzyme SalI and subjected to 1% agarose gel electrophoresis to encode human SSTR3.
A 3 kb DNA fragment was recovered. Then, 1 μg of the expression vector pAKKO-111 (5.5 kb) was added to Sa.
After digestion with I1, a cloning site for inserting the human SSTR3 DNA fragment was created. The expression vector and a 1.3 kb DNA fragment were ligated using T4 DNA ligase, and the reaction mixture was subjected to a calcium chloride method using Escherichia coli JM.
109, and human / SSTR3
An expression plasmid pA1-11-SSTR3 in which the DNA fragment was inserted in the forward direction with respect to the promoter was obtained. This transformant was transformed into Escherichia col
i) Displayed as JM109 / pA-1-11-SSTR3.

(9) CHO (dh) of human somatostatin receptor protein subtype 3 (SSTR3) DNA
Introduction and expression into fr ⁻ ) cells 1 × 10 ⁶ CHO (dhfr ⁻ ) cells were transferred to an
Ham F containing 10% fetal bovine serum using a Petri dish
After culturing for 24 hours in 12 medium, the cells were added to the human SSTR3 DNA expression plasmid pA-1 obtained in (5) above.
10 μg of 11-SSTR3 was introduced by the calcium phosphate method. Twenty-four hours after the introduction, the medium was changed to a DMEM medium containing 10% dialyzed fetal bovine serum, and cells forming colonies in this medium (that is, DHFR ⁺ cells) were selected. Further, the selected cells were cloned from single cells by the limiting dilution method, and the somatostatin receptor protein expression ability of these cells was measured by the binding assay described in (3) above. Thus, a cell line with high somatostatin binding activity, SSTR3-15-
19 was selected.

(10) Cloning of Human Somatostatin Receptor Protein Subtype 4 (SSTR4) DNA Base sequence of known human SSTR4 DNA [Proceding of the National Academy of Sciences USA (Proc. Natl. Acad.Sci., US
A), 90, 4196-4200, 1993], DNA oligomers S4-1 and S4-2 were synthesized. The sequence of S4-1 is 5'-GGCTCGAGT
CACATCATGCGCCCCCCTCG-3 ′ (SEQ ID NO: 7), and the sequence of S4-2 is 5′-GGGC
TCGAGCTCTCCAGAAGGTGGGTGG-
3 ′ (SEQ ID NO: 8). As a template, human chromosomal DNA (Clontech, Catalog No. CL6550)
-1) was used. To 0.5 ng of the DNA, 25 pmol of each of the DNA oligomers was added, and a polymerase chain reaction was performed using 2.5 units of Pfu DNA polymerase (Stratagene). The composition of the reaction solution is PfuD
The instructions attached to the NA polymerase were followed. The reaction conditions were 35 cycles, with 1 cycle at 94 ° C., 1 minute at 66 ° C., and 2 minutes at 75 ° C. When the reaction solution was subjected to 1% agarose gel electrophoresis, a DNA fragment of a target size (about 1.2 kb) was specifically amplified. When the nucleotide sequence of the DNA fragment was confirmed by the method described in the above (1), the amino acid sequence predicted from the nucleotide sequence was completely identical to the sequence described in the literature.

(11) Construction of Expression Plasmid for Human Somatostatin Receptor Protein Subtype 4 (SSTR4) DNA The pAKKO-111 described in (2) above was used as an expression vector in CHO cells. Plasmid 5 having the human SSTR4 DNA fragment obtained in (10) above
After digesting μg with the restriction enzyme Xhol, 1% agarose gel electrophoresis was performed to recover a 1.2 kb DNA fragment encoding human SSTR4. Then, 1 μg of the above-described expression vector pAKKO-111 (5.5 kb) was digested with SalI to prepare a cloning site for inserting a human SSTR4 DNA fragment. The expression vector fragment and the 1.2 kb DNA fragment were ligated using T4 DNA ligase, and the reaction mixture was introduced into Escherichia coli JM109 by the calcium chloride method.
An expression plasmid pA1-11-SSTR4 in which the STR4 DNA fragment was inserted in the forward direction with respect to the promoter was obtained. This transformant was transformed into Escheric
hia coli) JM109 / pA-1-11-SSTR4.

(12) CHO (d) of human somatostatin receptor protein subtype 4 (SSTR4) DNA
Introduction and expression into hfr ⁻ ) cells CHO (dhfr ⁻ ) cells 1 × 10 ⁶ cells were collected at a diameter of 8 cm.
Ham F containing 10% fetal bovine serum using a Petri dish
After culturing for 24 hours in a 12-medium medium, the human SSTR4 DNA expression plasmid pA-1 obtained in the above (8) was added to the cells.
11-SSTR4, 10 μg was introduced by the calcium phosphate method. Twenty-four hours after the introduction, the medium was changed to a DMEM medium containing 10% dialyzed fetal bovine serum, and cells forming colonies in this medium (that is, DHFR ⁺ cells) were selected. Further, the selected cells were cloned from single cells by the limiting dilution method, and the somatostatin receptor protein expression ability of these cells was measured by the binding assay described in (3) above. Thus, a cell line with high somatostatin binding activity, SSTR4-1-2,
Was selected.

(13) Cloning of Human Somatostatin Receptor Protein Subtype (SSTR5) DNA Base sequence of known human SSTR5 cDNA [Biochem.
Biophys. Res. Commun., 195, 844-852.
P. 1993], a DNA oligomer, S5-
1 and S5-2 were synthesized. The sequence of S5-1 is 5′-
GGTCGACCACCCATGGAGCCCCTGTTT
CCC-3 ′ (SEQ ID NO: 9), and the sequence of S5-2 is 5′-CCGTCGACACTCTCACAGCT.
TGCTGG-3 ′ (SEQ ID NO: 10). As a template, human chromosomal DNA (Clontech, catalog number CL6550-1) was used. 0.5 ng of the DNA
25 pmol of each of the DNA oligomers was added to
1. Pfu DNA polymerase (Stratagene Co., Ltd.)
The polymerase chain reaction was performed using 5 units. The reaction solution composition followed the instructions attached to Pfu DNA polymerase. The reaction conditions were 35 cycles, with 1 cycle at 94 ° C., 1 minute at 66 ° C., and 2 minutes at 75 ° C. When the reaction solution was subjected to electrophoresis on a 1% agarose gel, DNA of a target size (about 1.1 kb) was obtained.
The fragment was specifically amplified. When the nucleotide sequence of the DNA fragment was confirmed by the method described in the above (1), the amino acid sequence predicted from the nucleotide sequence was completely identical to the sequence described in the literature.

(14) Construction of Expression Plasmid for Human Somatostatin Receptor Protein Subtype 5 (SSTR5) DNA The pAKKO-111 described in (2) above was used as an expression vector in CHO cells. Plasmid 5 having the human SSTR5 DNA fragment obtained in (13) above
After digesting μg with the restriction enzyme SalI, 1% agarose gel electrophoresis was performed to recover a 1.1 kb DNA fragment encoding human SSTR5. Then, 1 μg of the above-mentioned expression vector pAKKO-111 (5.5 kb) was digested with SalI to prepare a cloning site for inserting a human SSTR5 DNA fragment. The expression vector fragment and the 1.1 kb DNA fragment were ligated using T4 DNA ligase, and the reaction mixture was introduced into Escherichia coli JM109 by the calcium chloride method.
An expression plasmid pA1-11-SSTR5 in which the STR5 DNA fragment was inserted in the forward direction with respect to the promoter was obtained. This transformant was transformed into Escheric
hia coli) JM109 / pA-1-11-SSTR5.

(15) CHO (d) of human somatostatin receptor protein subtype 5 (SSTR5) DNA
Introduction and expression into hfr ⁻ ) cells CHO (dhfr ⁻ ) cells 1 × 10 ⁶ cells were collected at a diameter of 8 cm.
Ham F containing 10% fetal bovine serum using a Petri dish
After culturing for 24 hours in 12 medium, the human SSTR5 cDNA expression plasmid pA-
5-11 μS of 1-11-SSTR was introduced by the calcium phosphate method. Twenty-four hours after the introduction, the medium was changed to a DMEM medium containing 10% dialyzed fetal bovine serum, and cells forming colonies in this medium (that is, DHFR ⁺ cells) were selected. Further, the selected cells were cloned from single cells by the limiting dilution method, and the somatostatin receptor protein expression ability of these cells was measured by the binding assay described in (3) above. Thus, a cell line with high somatostatin binding activity, SSTR5-32-
4 was selected.

Experimental Example 1 Preparation of CHO Cell Membrane Fraction Containing Human Somatostatin Receptor Human somatostatin receptor expressing CHO cell line, SS
TR1-8-3, SSTR2-HS5-9, SSTR3
-15-19, SSTR4-1-2, or SSTR
5-32-4 (10 ⁹⁾ was centrifuged and resuspended in phosphate was added 5 mM EDTA buffered saline (PBS-EDTA). A cell homogenate buffer (10 mM NaHCO ₃ , 5 mM EDTA, pH =
7.5) was added, and the mixture was homogenized using a Polytron homogenizer. The supernatant obtained by centrifugation at 400 × g for 15 minutes was further centrifuged at 100,000 × g for 1 hour,
A precipitate of the membrane fraction was obtained. The precipitate was added to 2 ml of assay buffer (25 ml of Tris-HCl, 1 ml of EDTA, 0.1 ml
1% BSA (bovine serum albumin), 0.25 ml P
MSF, 1 μg / ml pepstatin, 20 μg / ml leupeptin, 10 μg / ml phosphoramidon, pH
= 7.5) and centrifuged at 100,000 xg for 1 hour. The membrane fraction collected as a precipitate was suspended again in 20 ml of assay buffer, aliquoted, stored at -80 ° C, and thawed at each use.

Experimental Example 2 Measurement of ¹²⁵ I-Somatostatin Binding Inhibition Rate The membrane fraction prepared in Example 1 was diluted with an assay buffer to 3 μg / ml, and 173 μl was dispensed into tubes. 2 μl of compound dissolved in DMSO and 200 pM
Of radiolabeled somatostatin ( ¹²⁵ I-somatostatin: Amersham) was added simultaneously. To determine maximum binding, 2 μl of DMSO and 200 μl
A reaction solution was prepared by adding 25 μl of M ¹²⁵ I-somatostatin. Also, to measure non-specific binding,
2 μl of 100 μM somatostatin dissolved in DMSO
And a reaction mixture containing 25 μl of 200 pM ¹²⁵ I-somatostatin. After reacting at 25 ° C for 60 minutes, the reaction solution was subjected to suction filtration using a polyethylene imine-treated Whatman glass filter (GF-B). After filtration, it remained on the filter paper using a γ-counter.
The radioactivity of ¹²⁵ I-somatostatin was measured. Formula PBM = (B-NSB) / (B O -NSB) × 100 (PBM: Percent Maximum Binding, B: radioactivity when compound was added, B _O: maximum binding radioactivity, NS
B: non-specific binding radioactivity) was calculated to determine the binding rate (%) of each test substance. The binding ratio was determined by changing the concentration of the test substance, and the concentration (IC ₅₀ value) of the test substance that inhibited 50% binding was calculated from the Hill plot. The reactivity (IC ₅₀ value, μM) of each of the compounds shown below to each human somatostatin receptor, as determined by the above method, showed an activity of 10 μM or less for any of the human somatostatin receptors. Compound of Example 1 Compound of Example 2 Compound of Example 3 Compound of Example 4 Compound of Example 5 Compound of Example 6 Compound of Example 7 Compound of Example 8 Compound of Example 9 Compound of Example 9 Compound of Example 10 Compound of Example 11 Compound of Example 12 Compound of Example 13 Compound of Example 14 Compound of Example 15

Compound of Example 19 Compound of Example 20 Compound of Example 22 Compound of Example 23 Compound of Example 24 Compound of Example 26 Compound of Example 27 Compound of Example 29 Compound of Example 30 Example Compound of 31 Compound of Example 32 Compound of Example 33 Compound of Example 34 Compound of Example 35 Compound of Example 36 Compound of Example 37 Compound of Example 38 Compound of Example 39 Compound of Example 40 Compound of Example 40 Compound of 41 Compound of Example 42 Compound of Example 43 Compound of Example 44 Compound of Example 45 Compound of Example 46 Compound of Example 47 Compound of Example 48

Compound of Example 49 Compound of Example 50 Compound of Example 51 Compound of Example 52 Compound of Example 53 Compound of Example 54 Compound of Example 55 Compound of Example 56 Compound of Example 57 Example Compound of 58 compound of example 59 compound of example 60 compound of example 61 compound of example 62 compound of example 63 compound of example 64 compound of example 65 compound of example 66 compound of example 67 compound example Compound of 68 Compound of Example 69 Compound of Example 70 Compound of Example 71 Compound of Example 72 Compound of Example 74 Compound of Example 75 Compound of Example 76

Compound of Example 77 Compound of Example 79 Compound of Example 80 Compound of Example 82 Compound of Example 83 Compound of Example 84 Compound of Example 86 Compound of Example 87 Compound of Example 89 Example Compound of 90 Compound of Example 92 Compound of Example 93 Compound of Example 94 Compound of Example 95 Compound of Example 96 Compound of Example 98 Compound of Example 99 Compound of Example 101 Compound of Example 102 Example Compound of 103 Compound of Example 104 Compound of Example 105 Compound of Example 106 Compound of Example 107 Compound of Example 108 Compound of Example 109 Compound of Example 110 Compound of Example 111 Compound of Example 112 Example Compounds from 113 to 245

[0295]

The compound (I) of the present invention or a salt thereof is
Since it has an excellent somatostatin receptor function regulating action and low toxicity, it can be a safe preventive / therapeutic drug for diseases associated with this action.

[0296]

[Sequence List] <110> Takeda Chemical Industries, Ltd. <120> Aromatic Amine Derivatives, their Production Method and Agents <130> A98200 <150> JP 10-298940 <151> 1998-10-20 <160> 10 <210 > 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> <400> 1 GGTCGACCTC AGCTAGGATG TTCCCCAATG 30

<210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> <400> 2 GGTCGACCCG GGCTCAGAGC GTCGTGAT 28

<210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> <400> 3 GGTCGACACC ATGGACATGG CGGATGAG 28

<210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> <400> 4 GGTCGACAGT TCAGATACTG GTTTGG 26

<210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> <400> 5 GGTCGACCTC AACCATGGAC ATGCTTCATC 30

<210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> <400> 6 GGTCGACTTT CCCCAGGCCC CTACAGGTA 29

<210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> <400> 7 GGCTCGAGTC ACCATGAGCG CCCCCTCG 28

<210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 8 GGGCTCGAGC TCCTCAGAAG GTTGGTGG
27

<210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> <400> 9 GGTCGACCAC CATGGAGCCC CTGTTCCC 28

<210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> <400> 10 CCGTCGACAC TCTCACAGCT TGCTGG 26

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 31/343 A61K 31/343 31/381 31/381 31/39 31/39 31/40 31/40 31 / 404 31/404 31/4045 31/4045 31/4184 31/4184 31/426 31/426 31/44 31/44 31/4406 31/4406 31/445 31/445 31/472 31/472 31/4725 31/4725 31/495 31/495 31/496 31/496 A61P 3/10 A61P 3/10 43/00 111 43/00 111 C07C 237/06 C07C 237/06 255/60 255/60 C07D 209/08 C07D 209/08 209/14 209/14 209/16 209/16 211/62 211/62 213/56 213/56 217/08 217/08 217/22 217/22 217/24 217/24 235/26 235 / 26 B 277/36 277/36 295/12 295/12 Z 295/22 295/22 A 307/68 307/68 307/81 307/81 327/04 327/04 333/20 333/20 409/12 409 / 12 // C12N 5/10 C12N 5/00 B 15/09 ZNA 15/00 ZNAA (72) Inventor Yoshihiro Sakano Osaka Prefecture Takatsuki Meishin-cho, 17-17 SQUARE support - cycle No. 202

Claims (21)

[Claims] (1) Formula (I) [In the formula, ring A is an aromatic ring which may have a substituent; ring B is a cyclic hydrocarbon group which may have a substituent; Z is a ring which may have a substituent R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent or an acyl group; R ² is an amino group which may be substituted D is a bond or a divalent group;
E is -CO-,-CON (R ^a )-,-COO-,-N (R ^a ) CON (R ^b )-,-N (R ^a ) COO
-,-N (R ^a ) SO ₂ -,-N (R ^a )-,-O-,-S-,-SO- or -SO _2- (R ^a , R
^b independently represents a hydrogen atom or a hydrocarbon group which may have a substituent); G represents a bond or a divalent group;
L has (1) a bond or (2) an i) C _1-6 alkyl group, ii) a halogeno-C _1-6 alkyl group, iii) a phenyl group, iv) a benzyl group, and v) a substituent. Vi) an optionally substituted hydroxy group, and vii) a C _1-6 alkyl group, an optionally substituted phenyl group or an optionally substituted substituent. It may have 1 to 5 substituents selected from a carbamoyl group or a thiocarbamoyl group, each of which may be substituted with a heterocyclic group, and may be via -O- or -S-.
X represents an oxygen atom, a sulfur atom which may be oxidized, a nitrogen atom which may have a substituent or a divalent hydrocarbon group which may have a substituent; Y is 2
Represents a hydrogen atom, an oxygen atom or a sulfur atom, and ‥‥‥ indicates that R ² and an atom on the B ring may form a ring. Or a salt thereof. 2. The compound according to claim 1, wherein L is an alkylene group which may be via -O- and may be substituted by a C _1-6 alkyl group. 3. The compound according to claim 1, wherein L is a C _1-6 alkylene group. (4) R ² is (1) an unsubstituted amino group, (2) piperidyl group or (3) (i) benzyl, (ii) C _1-6 alkyl optionally substituted with amino or phenyl, (iii) (Mono-
Or di-C _1-6 alkyl) -carbamoyl or -thiocarbamoyl, (iv) C _1-6 alkoxy-carbonyl,
having one or two substituents selected from (v) C _1-6 alkyl-sulfonyl, (vi) piperidylcarbonyl and (vii) C _1-6 alkyl-carbonyl optionally substituted with halogen or amino. The compound according to claim 1, which is an optionally substituted amino group. 5. The compound according to claim 1, wherein R ² is an unsubstituted amino group. 6. The compound according to claim 1, wherein A is a benzene ring or a pyridine ring which may have a substituent. 7. The compound according to claim 1, wherein B is a benzene ring which may have a substituent. 8. The compound according to claim 1, wherein E is -CON (R ^a )-. 9. The compound according to claim 1, wherein X is an oxygen atom. 10. The method according to claim 1, wherein D is a C _1-6 alkylene group.
A compound as described. 11. The method according to claim 1, wherein G is a C _1-6 alkylene group.
A compound as described. 12. The compound according to claim 1, wherein G represents a divalent hydrocarbon group which may have a substituent, and ring B does not form a nitrogen-containing heterocyclic ring with R ² . 13. E is -CON (R ^a )-, G is a divalent hydrocarbon group which may have a substituent, Y is two hydrogen atoms, and R ¹ is an acyl group. ^2. The compound according to claim 1, wherein each of the rings does not form a nitrogen-containing heterocyclic ring with R ² . 14. A is a benzene ring or a pyridine ring, each of which may have a substituent; a benzene ring or a cyclohexane ring, wherein the ring B may be each substituted with a C _1-6 alkoxy, or a bond with R ^2. tetrahydroisoquinoline ring or isoindoline ring formed by; Z is halogen, formyl, halogeno -C _1-6 alkyl, C _1-6
C _6-14 aryl group optionally having 1 to 3 substituents selected from alkoxy, C _1-6 alkyl-carbonyl, oxo and pyrrolidinyl, C _3-10 cycloalkyl group, piperidyl group, thienyl Group, furyl group,
Pyridyl group, a thiazolyl group, an indanyl group or indolyl group; D is C _1-6 alkylene group; G is a bond or phenylene may also contain, and a C _1-6 alkylene optionally substituted by phenyl, group; R ¹ there) hydrogen atom, b) (1) halogen, (2) nitro, (3) C _1-6 alkyl -
From carbonyl, C _6-14 aryl-carbonyl, C _1-6 alkyl, C _1-6 alkyloxy-carbonyl, C _7-14 aralkyloxy-carbonyl, C _1-6 alkyl-sulfonyl and C _6-14 aryl-sulfonyl Selected amino, optionally having one or two substituents, (4) (i) hydroxy, C _1-6 alkyl-carbonyl, C _6-14 aryl-carbonyl, carboxy or C _1-6 alkoxy-
C _1-6 alkyl optionally substituted with carbonyl, (i
i) phenyl optionally substituted with hydroxy, (iii)
Benzoyl or (iv) hydroxy optionally substituted with mono- or di-C _1-6 alkylamino-carbonyl, (5) C _3-6 cycloalkyl, (6) hydroxy or halogeno-C _1-6 alkyl. Optionally substituted phenyl and (7) a C _1-6 alkyl group optionally substituted by a substituent selected from thienyl, furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl, C _2-6 alkenyl group, C _6-14 aryl group, C _{7 - 14} aralkyl group, or c) an acyl group; the R ²
(1) unsubstituted amino group, (2) piperidyl group or (3) (i) benzyl, (ii) C _1-6 alkyl optionally substituted with amino or phenyl, (iii) mono- or di- C _1-6 alkyl-carbamoyl or -thiocarbamoyl, (iv) C
1 or 2 selected from _1-6 alkoxy-carbonyl, (v) C _1-6 alkyl-sulfonyl, (vi) piperidylcarbonyl and (vii) C _1-6 alkyl-carbonyl optionally substituted with halogen or amino. An amino group optionally having three substituents; E is -CO-, -CON
( ^Ra )-, -N ( ^Ra ) CO- ( ^Ra is a hydrogen atom or C
_1-6 alkyl group) and L may be via -O-,
The compound according to claim 1, which is a C _1-6 alkylene group which may be substituted with a C _1-6 alkyl. 15. Z is a phenyl group optionally substituted by halogen; D is a C _1-6 alkylene group; G is a C _1-6 alkylene group; R ¹ is a) (1) hydroxy, (2) phenyl , (3) thienyl, furyl, thiazolyl, indanyl, indolyl or benzyloxycarbonylpiperidyl and (4) C
_1-6 alkyl-carbonyl, C _6-14 aryl-carbonyl, C _1-6 alkyl-sulfonyl or C _6-14 aryl-sulfonyl, each substituted with a substituent selected from amino which may be substituted. A C _1-6 alkyl group or a C _7-14 aralkyl group or i) an acyl group;
² is an unsubstituted amino group; E is -CON (R ^a )-; L is C
The compound according to claim 1, wherein the _1-6 alkylene group and Y are two hydrogen atoms. (16) a prodrug of the compound of (1) or a salt thereof; 17. A compound of the formula (IIa) [In the formula, R ^2a may be protected, an amino group which may be substituted, and other symbols are as defined in claim 1. And a reactive derivative or a salt thereof represented by the formula (III): [The symbols in the formula are as defined in claim 1. By reacting with a compound of the formula (Ia-a) [The symbols in the formula are as defined above. Wherein the compound represented by the formula (Ia) is optionally subjected to a deprotection reaction. [The symbols in the formula are as defined above. ] Or a salt thereof. 18. A pharmaceutical composition comprising the compound according to claim 1 or a salt thereof. 19. The pharmaceutical composition according to claim 18, which is a somatostatin receptor function regulator. 20. The pharmaceutical composition according to claim 19, wherein the somatostatin receptor function regulator is a somatostatin receptor agonist. 21. The pharmaceutical composition according to claim 18, which is an agent for preventing or treating diabetes, obesity, diabetic complications or intractable diarrhea.