JP2000184893A - Simultaneous detection of citrus tatter leaf virus and citrus viroid by rt-pcr - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a nucleic acid primer set capable of simultaneously detecting citrus tatter leaf virus, citrus exocortis viroid, etc., by combining a plurality of nucleic acid primer pairs having specific base sequences, respectively. SOLUTION: This nucleic acid primer set for simultaneously detecting three or more of citrus tatter leaf virus, citrus exocortis viroid, citrus viroids I, II, III and IV comprises at least three nucleic acid primer pairs selected from a nucleic acid primer pair comprising a nucleic acid primer containing a base sequence of formula I and a nucleic acid primer containing a base sequence of formula II, a nucleic acid primer pair comprising a nucleic acid primer containing a base sequence of formula III and a nucleic acid primer containing a base sequence of formula IV, a nucleic acid primer pair comprising a nucleic acid primer containing a base sequence of formula V and a nucleic acid primer containing a base sequence of formula VI, a nucleic acid primer pair comprising a nucleic acid primer containing a base sequence of formula VII and a nucleic acid primer containing a base sequence of formula VIII, etc.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting a plant virus or viroid, and more particularly, to a citrus tartar virus (CT) having infectivity to citrus.
LV) and citrus viroids by RT-PCR.

[0002]

2. Description of the Related Art Citrus tartar virus (CTL)
V) is known as a pathogen causing abnormal grafting in karatachidai citrus. In addition, citrus viroids include citrus exocortis viroids (CEVd), which exhibit symptoms of peeling and dwarfing on the Karachichi rootstock, as well as citrus viroids (CVd) I, II, III, IV, V and VI. There is a viroid group. Among these viroids, CVdV and VI are newly discovered by the present inventors.

[0003] Several techniques have been developed for the diagnosis of these pathogen infections. As a method for diagnosing CTLV infection, diagnosis using antisera has been widely performed, and gene diagnosis based on its nucleotide sequence has also been reported (N. Yoshikawa et al., Ann. Phytopathol.
Soc. Jpn., 62, 119-124 (1996)). As a method for diagnosing citrus viroid infection, there is a report on individual genetic diagnosis based on individual nucleotide sequences other than CVdV and VI (X. Yang et al., Phytopathology,
82, 279-285 (1992), and Tatsuji Hataya, Plant Protection, No. 51
Vol. 4, 21-25 (1997)). Further, CEVd, CVdI
For I and III, a diagnosis has been reported in which two types of viroids are simultaneously detected using these mixed primers (M. Tessitori et al., Proc. 13th Conf. IOCV., IOCV, Ri
verside, 230-235 (1996)).

[0004] However, in citrus trees, many kinds of pathogens as described above often exist in one tree at the same time, and many trees are diagnosed at once.
In such a case, separately detecting one or two types of pathogens requires a lot of time, labor and cost. Therefore, a method for simultaneously detecting as many types of the above-mentioned pathogens as possible can be said to be very useful, and development of the method is desired.

[0005]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for simultaneously detecting three or more of the above viruses and viroids by using RT-PCR, which is one of the techniques for genetic diagnosis, and the method. An object of the present invention is to provide a set of nucleic acid primers that can be used for the above.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies to achieve the above object, and as a result, using RNA isolated from citrus tree as a template, CTLV, CEVd
And gene RNAs of CVdI, II, III, IV, V and VI
By performing RT-PCR using a nucleic acid primer set containing several types of nucleic acid primer pairs specific to
The present inventors have succeeded in simultaneously detecting and judging three or more kinds of the virus and viroid, thereby completing the present invention.

That is, the present invention provides (i) a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 4, (ii)
A nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 19 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 20, (iii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 7 and the sequence (Iv) a nucleic acid primer pair including a nucleic acid primer including the nucleotide sequence of SEQ ID NO: 9 and a nucleic acid primer pair including a nucleic acid primer including the nucleotide sequence of SEQ ID NO: 10; v) SEQ ID NO: 11
A nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 12 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 12,
(Vi) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 13 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 14, (vii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 16 And (viii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 17 and a nucleic acid primer pair comprising:
A citrus tarifavirus comprising at least three nucleic acid primer pairs selected from the group consisting of a nucleic acid primer pair with a nucleic acid primer comprising a base sequence of 8;
Provided is a nucleic acid primer set for simultaneously detecting citrus exocortis viroid and at least three of citrus viroids I, II, III, IV, V and VI.
The nucleic acid primer set is preferably (i) to
Includes all of the nucleic acid primer pairs of (viii).

Further, the present invention provides a nucleic acid primer pair comprising: (i) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 4; ) SEQ ID NO: 5 or SEQ ID NO: 19
A nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 20; and (iii) a nucleic acid primer comprising the nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 or SEQ ID NO: 21. A nucleic acid primer pair with the nucleic acid primer containing the nucleotide sequence, (iv) a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 1
A nucleic acid primer pair with a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 11, (v) a nucleic acid primer pair with a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 12 and (vi) (Vii) a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 15 and a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 15;
And (viii) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 17 and a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 18. By examining whether or not the amplification is performed by an amplification treatment using at least three types of nucleic acid primer pairs, citrus tarifavirus, citrus exocortis viroid and citrus viroids I, II, III, IV, A method is provided for simultaneously detecting at least three of said viruses and viroids, comprising simultaneously determining the presence or absence of at least three of V and VI. In the above method, preferably, citrus tarifavirus, citrus exocortis viroid and citrus viroids I, II, III, IV, V and VI are simultaneously used, preferably using all of the nucleic acid primer pairs (i) to (viii). To detect. The nucleic acid derived from the test plant is preferably a cDNA of an RNA present in the test plant.

Further, the present invention relates to (i) a nucleic acid primer pair of a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 4; A nucleic acid primer pair comprising a nucleic acid primer comprising a base sequence and a nucleic acid primer comprising a base sequence of SEQ ID NO: 6 or SEQ ID NO: 20, (iii) a nucleic acid primer comprising a base sequence of SEQ ID NO: 7 and a base comprising SEQ ID NO: 8 or SEQ ID NO: 21 A nucleic acid primer pair with a nucleic acid primer containing a sequence, (iv) a nucleic acid primer pair with a nucleic acid primer containing a nucleotide sequence of SEQ ID NO: 9 and a nucleic acid primer containing a nucleotide sequence of SEQ ID NO: 10, and (v) a nucleotide sequence of SEQ ID NO: 11 And a nucleic acid primer pair comprising a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 12 and (v
i) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 13 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 14, (vii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 16 And (viii) a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 17 and a nucleic acid primer pair having the nucleotide sequence of SEQ ID NO: 17
At least three nucleic acid primer pairs selected from the group consisting of a nucleic acid primer pair and a nucleic acid primer pair comprising the nucleotide sequence of: Citrus tartavirus, Citrus exocortis viroid and Citrus viroid I, II, III, IV, A kit for simultaneous detection of at least three types of V and VI is provided. The kit preferably contains all of the nucleic acid primer pairs (i) to (viii).

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. 1. Method of the Invention In the method of the invention, citrus tarifavirus (C
TLV), Citrus exocortis viroid (CE
Vd) and citrus viroid (CVd) I, II, II
Using a nucleic acid primer pair specific to each of I, IV, V and VI, at least three types of the virus and viroid are simultaneously detected from the test plant. The test plant is not particularly limited and may be any type of plant, but is preferably a citrus tree. "Citrus"
Generally, it means a plant belonging to the Rutaceae Rutaceae subfamily ( Rutaceae Lignosae ), and examples thereof include Unshu mandarin orange, orange, and Karatachi.

[0011] Nucleic acid primer pairs specific to each of the above viruses and viroids can be designed based on the base sequences of the respective genomes. CTLV,
Examples of the nucleotide sequences of the genomes of CEVd and CVdI, II, III and IV include those already reported, and those nucleotide sequences are registered in GenBank with the access numbers shown in Table 1 below. I have. When a plurality of sequences are registered, it is preferable to design a nucleic acid primer pair based on a region where no mutation is found between the sequences.

[0012]

[Table 1]

The nucleotide sequences of CVdV and VI include, for example, those determined by the present inventors. The nucleotide sequences are shown in SEQ ID NOs: 1 and 2, respectively, but are not limited thereto. . The design of the nucleic acid primer pair is performed in consideration of the characteristics of the detection method to be used. For example, when finally detecting by electrophoresis,
The number of bases between each nucleic acid primer pair can be adjusted so that the bands derived from the virus or viroid to be simultaneously detected do not overlap each other. Further, even for a nucleic acid primer pair that hybridizes to a plurality of viruses or viroids under analysis conditions, it may be used if the number of bases between the nucleic acid primer pairs is sufficiently different between the viruses or viroids. it can. However, in such a case, a large number of bands (noise) other than the target band can be obtained in the detection by the electrophoresis method, and the accuracy of the detection may be reduced. Therefore, nucleic acid primers that hybridize to a certain virus or viroid under analysis conditions are preferably designed so as not to hybridize to another virus or viroid under the same conditions. As described above, since a person skilled in the art can design an appropriate nucleic acid primer pair, the nucleotide sequence of each nucleic acid primer is not limited to a specific nucleotide sequence. Specific examples thereof include, for example, the following Table 2 And the base sequence shown in the following.

[0014]

[Table 2]

In Table 2, a nucleic acid primer pair consisting of CTLV-AP and CTLV-AM can detect CTLV, a nucleic acid primer pair consisting of CEV-AP2 and CEV-AM2 can detect CEVd, and CBLV -AP2 and CBLV-CM
Can detect CVdI, a nucleic acid primer pair consisting of CB2-AP and CB2-CM can detect CVdVI, and a nucleic acid primer pair consisting of CV2-AP and CV2-AM can detect CVdII. Nucleic acid primer pair consisting of CV3-AP and CV3-AM can detect CVdIII, CV4-AP4 and CV4-AM3
Can detect CVdIV, and a nucleic acid primer pair consisting of CB3-AP and CB3-AM6 can detect CVdV. Where CEV
To detect d, CEV-AP3 can be used instead of CEV-AP2, and CEV-AM3 can be used instead of CEV-AM2. Since these nucleic acid primers contain a base sequence having higher conservation between mutants, they are advantageous in reducing the risk of assay omission. Similarly, to detect CVdI, CBLV-CM2 can be used instead of CBLV-CM described above, and the nucleic acid primer is also advantageous in reducing the risk of missing assays for similar reasons. .

The simultaneous detection of three or more types of virus and viroid is performed by checking whether or not nucleic acid derived from a test plant is amplified by an amplification treatment using three or more types of the above-described nucleic acid primer pairs. The nucleic acid derived from the test plant is not particularly limited as long as it is a nucleic acid contained in the test plant or a nucleic acid derived therefrom, and is preferably a nucleic acid derived from the RNA contained in the test plant. cDNA. The nucleic acid derived from the above-mentioned test plant can be obtained by a known nucleic acid extraction method. Such a nucleic acid extraction method may be carried out using a commercially available kit. In the case of extracting total RNA from a test plant, for example, IS
OGEN (manufactured by Nippon Gene) can be used. The site of the test plant used for nucleic acid extraction may be any site as long as it contains a nucleic acid, but is preferably a shoot portion.

When the above cDNA is used as a nucleic acid derived from the above-mentioned test plant, RNA is extracted from the test plant as described above, and then the RN is extracted by a known method.
It is good to synthesize cDNA from A. Such a cDNA
The synthesis can also be performed using a commercially available kit such as the First-Strand cDNA Synthesis Kit (Amersham Pharmacia Biotech).

The above-mentioned amplification treatment is usually performed by PCR (polymerase chain reaction). In the PCR, the above-described nucleic acid primer pair can be used. Other reagents, reaction conditions (reaction temperature, reaction time, etc.)
A person skilled in the art can make an appropriate choice. Such a PCR can be performed using a known device.

The amplification product obtained by the above amplification treatment can be detected by a known method such as electrophoresis. Those skilled in the art can appropriately select conditions and the like necessary for performing such a method. When detection is carried out by electrophoresis, the above-mentioned fragments specific to the virus and viroid can be confirmed as fragments having different migration degrees, and depending on the presence or absence of these specific fragments, the preservation of each virus and viroid is possible. Can be confirmed.

When the PCR was carried out using the nucleic acid primer pairs shown in Table 2, about 455 bases for CTLV, about 370 bases for CEVd, and about 370 bases for CVd
About 230 bases for I and about 30 bases for CVdII
0 bases, about 285 bases for CVdIII, CVdIV
About 210 bases for CVdV
For the base and CVdVI, an amplified fragment of about 250 bases is detected.

2. Kits of the Invention Kits of the invention include CTLV, CEVd and CVd.
It includes at least three nucleic acid primer pairs selected from nucleic acid primer pairs specific to each of I, II, III, IV, V and VI. By using the kit of the present invention, at least three kinds of the virus and the viroid can be simultaneously detected from a test plant.

The kit of the present invention may further comprise, if necessary,
RNA extraction reagents such as ISOGEN, chloroform, isopropanol and ethanol, reverse transcriptase, MgCl ₂ , RNA
PCR buffer, RNase Free dH ₂ O 2.5 ml, dNTP mixture,
Reverse transcription reaction reagents (excluding primers) such as RNase inhibitor, MgCl ₂ , RNA PCR buffer, sterile distilled water,
It may contain a PCR reaction reagent (excluding primers) such as DNA polymerase, a staining agent, and a detection reagent such as an electrophoresis gel. Further, the kit of the present invention may include instructions for detecting the above virus and viroid using various primers and various reagents.

[0023]

The present invention will be described more specifically with reference to the following examples. However, these examples are for explanation, and do not limit the technical scope of the present invention. [Example 1] CTLV and 7 types of RT-PCR
Kitkiwiroid (CEVd, CVdI, II, III, IV,
V and VI) (1) CTLV and three citrus viroids (CVdII, III)
And V) -infected etroglytron, and CTL
V and 7 kinds of citrus viroids (CEVd, CVdI, I
Simultaneous detection of CTLV and seven citrus viroids was carried out for etologcitrons infected with I, III, IV, V and VI). In the control group, the above detection was carried out for healthy etorogcitron. The infection of citrus trees with various viruses or viroids was performed by grafting.

The new shoots of the citrus tree to be tested
0.1 g was collected, and total RNA was extracted from this shoot sample using ISOGEN (manufactured by Nippon Gene) according to the instructions. 1 μl of this total RNA extract (about 1 μl of total RNA)
g) was incubated at 95 ° C. for 5 minutes and then rapidly cooled to denature the heat to eliminate the secondary structure of RNA. Using this solution, First-Strand cDNA Synthesi
Using s Kit (manufactured by Amersham Pharmacia Biotech), cDNA was synthesized according to the instructions using the attached random hexamer.

Next, using the cDNA as a template,
A primer set consisting of 16 nucleic acid primers having the nucleotide sequences shown in SEQ ID NOs: 3 to 18 in Table 2, and
PCR was performed using Ampli Taq Gold (Perkin Elmer) according to the instructions. This PCR was performed at 94 ° C. using DNA Thermal Cycler Model 480 (Perkin Elmer).
10 cycles at -62 ° C for 10 seconds -72 ° C for 10 seconds, 34 cycles of 94 ° C for 30 seconds (denaturation) -62 ° C for 10 seconds (annealing) -72 ° C for 10 seconds (extension), and One cycle of the reaction was performed at 72 ° C. for 5 minutes and at −15 ° C. for 5 minutes.

The PCR product obtained as described above is
After loading onto a 6% polyacrylamide gel together with an NA size marker, and electrophoresis at 80 V for 1 hour and 45 minutes, the cells were stained by silver staining. The thus obtained electrophoretic photograph is shown in FIG. In FIG. 1, about 455 bases for CTLV, about 370 bases for CEVd,
About 230 bases for CVdI, about 3 bases for CVdII
00 bases, about 285 bases for CVdIII, CVdIV
These viroids could be detected by confirming the presence or absence of a specific fragment of about 210 bases in the case of CVdV, about 170 bases in the case of CVdV, and about 250 bases in the case of CVdVI.

Example 2 CTL by RT-PCR
V and 7 kinds of citrus viroids (CEVd, CVdI, I
I, III, IV, V and VI) (2) Nagasaki Lemon, Nagasaki Shiranui, Kumamoto Shiranui, Wakayama Shiranui,
For the citrus trees of the shoot tip graft Shiranui, Nagasaki Ueno Saki, Fukuoka Ito Saki, Ehime Kiyomi, Shizuoka Unshu, Kumamoto Orange, Okinawa Tankan, Fukuoka Orange and Shizuoka Tanzero, C
Simultaneous detection of TLV and 7 kinds of citrus viroids was performed. In the control group, the above detection was carried out for healthy etorogcitron.

The new shoots of citrus tree to be tested
0.1 g was collected, and total RNA was extracted from this shoot sample using ISOGEN (manufactured by Nippon Gene) according to the instructions. 1 μl of this total RNA extract (about 1 μl of total RNA)
g) was incubated at 95 ° C. for 5 minutes and then rapidly cooled to denature the heat to eliminate the secondary structure of RNA. Using this solution, First-Strand cDNA Synthesi
Using s Kit (manufactured by Amersham Pharmacia Biotech), cDNA was synthesized according to the instructions using the attached random hexamer.

Next, using the cDNA as a template,
PCR was performed using a primer set consisting of 16 kinds of primers used in Example 1 and Ampli Taq Gold (Perkin Elmer) according to the instruction manual. This PCR is
Using NA Thermal Cycler Model 480 (Perkin Elmer), one cycle of 94 ° C for 10 minutes -62 ° C for 10 seconds -72 ° C for 10 seconds, 94 ° C for 30 seconds (denaturation) -6
34 cycles of 2 ° C. for 10 seconds (annealing) -72 ° C. for 10 seconds (extension), and 72 ° C. for 5 minutes-15 minutes
One cycle of the reaction was carried out at 5 ° C. for 5 minutes.

The PCR product obtained as described above is
After loading onto a 6% polyacrylamide gel together with an NA size marker, and electrophoresis at 80 V for 1 hour and 45 minutes, the cells were stained by silver staining. FIG. 2 shows the electrophoresis photograph thus obtained. In FIG. 2, about 370 bases for CEVd, about 230 bases for CVdI,
About 300 bases for CVdII, about 285 bases for CVdIII, about 210 bases for CVdIV, CVdV
About 170 bases for CVdVI and about 25 bases for CVdVI.
These viroids could be detected by confirming the presence or absence of a specific fragment of 0 base. In this example, CTLV was not detected.

Example 3 CTL by RT-PCR
V and 7 kinds of citrus viroids (CEVd, CVdI, I
Simultaneous detection of I, III, IV, V and VI) (3) In the primer set used in Examples 1 and 2, CEV-AP3, CE instead of CEV-AP2, CEV-AM2 and CBLV-CM
Using a primer set in which V-AM3 and CBLV-CM2 were mixed, the same detection as in Examples 1 and 2 was performed. as a result,
The same results as in each example were obtained (data not shown).

[0032]

Industrial Applicability The present invention enables the simultaneous detection of citrus tarifavirus (CTLV) and citrus viroid, greatly reducing the cost, labor and time required to detect these pathogens. Further, according to the present invention,
Since early diagnosis and quick seedling test of citrus trees infected with the above pathogens are possible, it becomes easy to supply viroid-free citrus seedlings.

[0033]

[Sequence List] SEQUENCE LISTING <110> Tohru Maotani, Director-General of National Institute of Fruit Tree Science, Ministry Of Agriculture, Forestry And Fisheries <120> Simultaneous Detection of Citrus Tatter Leaf Virus and 7 Citrus Viroid Species <130> P99- 0487 <150> JP 10-288954 <151> 1998-10-12 <160> 18 <170> PatentIn Ver. 2.0 <210> 1 <211> 331 <212> RNA <213> Citrus Viroid V <400> 1 cggaggaaac uccguguggu uccugugggu caccccccgg cacccucuaa agaaaagaaa 60 gguaaggaga acucaccugu cgucgucgac gaaggcaugu gagcuucaaa cucgaugaag 120 agcgucagcg gacggccucu gagacgagcg auggacagua gagcucgucu cuaccagucg 180 cgugcugacu cucacgccca cccgcacggc ugcuccgaga gugagagcuc ucugccgcua 240 gucgagcgga cuccagagug acucucccac ccuauuuuca gcggagagcc ggcgguggag 300 uccccagggu aaaacacgau ugguguuucc c 331 <210> 2 <211> 327 <212> RNA <213> Citrus Viroid VI <400> 2 cggagacuuc uugugguucc uguggugaca ccccucagcc cuaccugcga aagaaaaaag 60 ucauuagaag gcgccagagg agacugagcg gucgucccccacgaaggcuc cucagucgca 120 gagcgccgcu ggaucac gccuccggug gaaaacgaag auucgucuuc aauuucugua 180 accggaccgg ucuccuucgg ccgccgagcg cugguugccg cuagucgagc ggacuuccgu 240 cucuacccuc ccgaggcgcu uuucucacug accgacucg ucag ag ccag ug ccag ucag ucag ucag ucag cc : Designed oligonucleotide based on the sequence of Citrus Tatter Leaf Virus gene <400> 3 cctgaattga aaacctttgc tgccactt 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Tatter Leaf Virus gene <400> 4 tagaaaaacc acactaaccc ggaaatgc 28 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Exocortis Viroid gene <400> 5 gggaaacctg gaggaagtcg aggt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonuc leotide based on the sequence of Citrus Exocortis Viroid gene <400> 6 cggggatccc tgaaggactt cttc 24 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid I gene <400> 7 tccccttcac ccgagcgctg c 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid I gene <400> 8 acgaccagtc agctcctctg 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid VI gene <400> 9 ctgtaaccgg accggtctcc ttc 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid VI gene <400> 10 acgaccgctc agtctcctct 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Descript ion of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid II gene <400> 11 ggcaactctt ctcagaatcc agc 23 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid II gene <400> 12 ccggggctcc tttctcaggt aagt 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid III gene <400> 13 ctccgctagt cggaaagact ccgc 24 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid III gene <400> 14 tcaccaactt agctgccttc gtc 23 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid IV gene <400> 15 tctggggaat ttctctgcgg gacc 24 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid IV gene <400> 16 tctatctcag gtcgcgaagg aagaagc 27 <210> 17 <211> 23 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid V gene <400> 17 cgtcgacgaa ggcatgtgag ctt 23 <210> 18 <211> 25 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid V gene <400> 18 gtccgctcga ctagcggcag agagc 25 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Exocortis Viroid gene <400> 19 ggaaacctgg aggaagtcga g 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220 > <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Ex ocortis Viroid gene <400> 20 ccggggatcc ctgaaggact t 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed oligonucleotide based on the sequence of Citrus Viroid I gene <400> 21 tcgacgacga ccagtcagct 20

[0034]

[Sequence List Free Text]

[0035]

[SEQ ID NOS: 3 and 4] These are oligonucleotides designed based on the sequence of the citrus terrestrial virus gene.

[0036]

[SEQ ID NOS: 5 and 6] These are oligonucleotides designed based on the sequence of the Citrus exocortis viroid gene.

[0037]

[SEQ ID NOS: 7 and 8] Oligonucleotides designed based on the sequence of Citrus viroid I gene.

[0038]

[SEQ ID NOS: 9 and 10] These are oligonucleotides designed based on the sequence of the citrus viroid VI gene.

[0039]

[SEQ ID NOS: 11 and 12] These are oligonucleotides designed based on the sequence of the citrus viroid II gene.

[0040]

[SEQ ID NOS: 13 and 14] These are oligonucleotides designed based on the sequence of the Citrus viroid III gene.

[0041]

[SEQ ID NOS: 15 and 16] Oligonucleotides designed based on the sequence of Citrus viroid IV gene.

[0042]

[SEQ ID NOS: 17 and 18] These are oligonucleotides designed based on the sequence of the Citrus viroid V gene.

[0043]

[SEQ ID NOS: 19 and 20] Oligonucleotides designed based on the sequence of the Citrus exocortis viroid gene.

[0044]

[SEQ ID NO: 21] This is an oligonucleotide designed based on the sequence of citrus viroid I gene.

[Brief description of the drawings]

FIG. 1 shows CTLV and CEVd performed by the method of the present invention.
6 is an electrophoretic photograph showing the results of simultaneous detection of CVdI, II, III, IV, V and VI.

FIG. 2 shows CTLV and CEVd performed by the method of the present invention.
6 is an electrophoretic photograph showing the results of simultaneous detection of CVdI, II, III, IV, V and VI.

Claims (7)

[Claims] 1. A nucleic acid primer pair comprising: (i) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 4; (ii) comprising the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 19 Nucleic acid primer and SEQ ID NO: 6
Or (iii) a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 7 and a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 21 ,
(Iv) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 9 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 10, (v) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 11 and the nucleotide sequence of SEQ ID NO: 12 (Vi) a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 13 and a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 14, (vi)
i) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 15 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 16, and (viii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18 Comprising at least three nucleic acid primer pairs selected from the group consisting of nucleic acid primer pairs and nucleic acid primer pairs,
Citrus tartar virus, citrus exocortis viroid and citrus viroids I, II, II
A nucleic acid primer set for simultaneously detecting at least three of I, IV, V and VI. 2. The nucleic acid primer set according to claim 1, comprising all of the nucleic acid primer pairs (i) to (viii). 3. A nucleic acid primer pair comprising: (i) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 4; Or a nucleic acid primer pair of a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 19 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 20,
(Iii) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 7 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 21, and (iv) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 9; A nucleic acid primer pair with a nucleic acid primer containing 10 base sequences, (v)
A nucleic acid primer pair of a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 11 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 12, (vi) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 13 and a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 14 A nucleic acid primer pair with a primer, (vii) a nucleic acid primer pair with a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 15 and a nucleic acid primer containing a nucleotide sequence of SEQ ID NO: 16, and (viii) a nucleic acid containing the nucleotide sequence of SEQ ID NO: 17 By examining whether or not the amplification is performed by an amplification treatment using at least three types of nucleic acid primer pairs selected from the group consisting of a primer and a nucleic acid primer pair including a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 18, the test plant Tartar virus, citrus exocortis viroid and mosquito Kitsuuiroido I, II, II
A method for simultaneously detecting at least three types of said virus and viroid, comprising simultaneously determining the presence or absence of at least three types of I, IV, V and VI. 4. Use of all of the nucleic acid primer pairs (i) to (viii) described above,
4. The method according to claim 3, wherein citrus exocortis viroid and citrus viroids I, II, III, IV, V and VI are simultaneously detected. 5. The method according to claim 3, wherein the nucleic acid derived from the test plant is a cDNA of an RNA present in the test plant. 6. A nucleic acid primer pair comprising: (i) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 4; (ii) a nucleotide primer comprising the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 19 Nucleic acid primer and SEQ ID NO: 6
Or (iii) a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 7 and a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 21 ,
(Iv) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 9 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 10, (v) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 11 and the nucleotide sequence of SEQ ID NO: 12 (Vi) a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 13 and a nucleic acid primer pair of a nucleic acid primer containing the nucleotide sequence of SEQ ID NO: 14, (vi)
i) a nucleic acid primer pair comprising a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 15 and a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 16, and (viii) a nucleic acid primer comprising the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18 Comprising at least three nucleic acid primer pairs selected from the group consisting of nucleic acid primer pairs and nucleic acid primer pairs,
Citrus tartar virus, citrus exocortis viroid and citrus viroids I, II, II
A kit for simultaneous detection of at least three kinds of I, IV, V and VI. 7. The kit according to claim 6, comprising all of the nucleic acid primer pairs (i) to (viii).