JP2000184882A - New amylase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new alkali liquefying type amylase having high residual activity after treating at a specific pH, temperature and time in the presence of EDTA or EGTA and a resistance to a chelating agent and useful for a detergent mixing component, etc., for increasing detergency, etc. SOLUTION: This new alkali liquefying type amylase has >=70% residual activity after treating at pH 10, at 45 deg.C for 30 m in the presence of 1-100 mM EDTA or EGTA and has a high resistance to a chelating agent degrading α-1,4 glucoside bonding of starch, amylose, amylopectin and their partially degraded material without affecting to pullulan and useful as a detergent formulation component, etc. The new amylase is obtained by culturing a microorganism Bacillus sp. KSM-K36 strain (FERM P-16816) belonging to genus Bacillus, adding ammonium sulfate so as the supernatant to have 80% saturated concentration, recovering the resultant precipitate, separating and purifying with an anion exchange column chromatography or a gel filtration column chromatography.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an alkali liquefied amylase having a high chelating agent resistance and useful as a detergent component.

[0002]

2. Description of the Related Art α-amylase is used in a wide variety of industrial fields such as starch, brewing, textile, pharmaceutical and food industries, and its suitability for use in detergents is high. It is known and is also used as a detergent-enhancing ingredient in detergents for automatic dishwashers and clothing (Enzymes in Detergency, P203. Marcel
Dekker Inc., New York (1995)).

[0003] As the liquefying α- amylase having the optimum acting Useful alkaline side as detergent, the present inventors have found previously Bacillus sp (Bacillus s
p.) A strain derived from the KSM-1378 (FERM BP-3048) strain was known (WO94 / 26881).
Recently, an α-amylase having an optimum pH in the vicinity of 8-8.5 has been disclosed (WO95 / 2639), which is very similar in properties and structure to the amylase of the KSM-1378 strain. there were.

On the other hand, the detergent contains a chelating agent such as phosphoric acid, citric acid or zeolite in order to remove calcium or the like, which is a washing disturbing ion, from the washing solution, and liquefied α-amylase is inactivated by EDTA. HANDOBOOK OF AMYLASES AND RELATED ENZY
MES, P43. The Amylase Research Society of Japan (19
88)]. The aforementioned Bacillus sp. KSM-1378
Inhibition of enzyme activity by a chelating agent was also observed for alkaline liquefied α-amylase derived from (FERM BP-3048) strain, and its effect was not necessarily sufficient when it was added to detergents for automatic dishwashers and clothing. Was. The optimum action pH is moderately acidic, but it is active even when alkaline, and Bacillus, which is currently most commonly used as a component in detergents for automatic dishwashers and clothes, is used.
Regarding liquefied α-amylase derived from licheniformis (Termamyl and Duramil, both manufactured by Novo),
The chelating agent resistance performance was not sufficient. Among the liquefied amylases known so far, those which are not affected by the chelating agent include liquefied α-amylase (W) derived from a strain of the genus Pyrococcus.
O90 / 11352) and α-amylase (WO96 / 02633) derived from a strain of the genus Sulfolobus which are effective in the liquefaction process of starch. The optimum action pH of these enzymes is pH 4-6 and pH 2.5, respectively. ~ 4.
5, which did not work under alkaline conditions and was not suitable as a component of a detergent.

Accordingly, the present invention provides an alkali liquefied amylase which has a higher chelating agent resistance than conventional detergent amylase and is useful as a detergent component, and a detergent composition containing the same. The purpose is to do.

[0006]

According to the present invention, there is provided a method for manufacturing a medium comprising 1 to 100 mM.
PH10, 45 ° C in the presence of EDTA or EGTA
An alkaline liquefied amylase having a residual activity of 70% or more after treatment for 30 minutes is provided.

The present invention also provides a DNA fragment encoding the alkaline liquefied amylase. Furthermore, the present invention provides a detergent composition containing the alkaline liquefied amylase.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, an alkaline α-amylase refers to an enzyme having an optimum pH in an alkaline region. Neutral refers to a pH range of 6 to 8, and alkaline refers to a higher range. Furthermore, HANDBOOK OF AMYLAS
ES AND RELATED ENZYMES [P40-41. The Amylase
As described in Research Society of Japan (1988)], the liquefied form refers to a substance that degrades starch and starch-based polysaccharides at high random.

The enzyme of the present invention is an alkaline liquefied amylase having a residual activity of 70% or more after treatment at pH 10, 45 ° C. for 30 minutes in the presence of 1 to 100 mM EDTA or EGTA, and the residual activity is 80% or more. Is preferred, and 9
0% or more is more preferable.

The enzyme of the present invention may have the above-mentioned chelating agent resistance, but preferably has the following properties 1) and 2), particularly preferably has the properties 1) to 5). 1) Optimum action pH Optimum action pH exceeds 8.0 (soluble starch as substrate, 50
C. for 15 minutes). 2) Action The α-1,4 glucoside bond of starch, amylose, amylopectin and their partially decomposed products is degraded, and glucose (G1), maltose (G2), maltotriose (G3), maltotetraose ( G4),
Maltopentaose (G5), maltohexaose (G
6) and maltoheptaose (G7). However, it does not act on pullulan. 3) pH stability (Britton-Robinson buffer) Shows a residual activity of 70% or more in the pH range of 6.5 to 11.0 under treatment conditions at 40 ° C. for 30 minutes. 4) Working temperature range and optimum working temperature It works over a wide range of 20 to 80 ° C, and the optimum working temperature is 50 to 80 ° C.
60 ° C. 5) Temperature stability in 50 mM glycine sodium hydroxide buffer (pH 10)
It shows a residual activity of 80% or more at 40 ° C and a residual activity of about 60% even at 45 ° C after treatment for 30 minutes.

[0011] Examples of the enzyme of the present invention include SEQ ID NO: 1
Or those having the amino acid sequence described in 2, or an amino acid sequence in which one or more of these amino acids have been substituted, deleted or added. The range of the substitution, deletion or addition is preferably 80% or more of homology, particularly preferably 90% or more. The homology was determined by the Lipman-Pearson method (S
cience, 227, 1435 (1985)).

[0012] The enzyme of the present invention is produced, for example, by culturing a bacterium belonging to the genus Bacillus and collecting the bacterium from the culture. Examples of such producing bacteria include KSM-K36 strain and KSM-K38 having the following mycological properties.
Strains.

[0013]

[Table 1]

Based on the above studies on mycological properties,
Bergey's Manual of Systematic Bac
teriology, Williams & Wilkins, United States of Am
erica (1986)] and Genus Bacillus [The Genus Ba
cillus , Agricultural Research Service, Washington,
As a result of a comparative study with reference to DC (1973)], both strains are recognized to be a member of the genus Bacillus , which is a spore bacillus. However, since both strains cannot grow in the neutral region and show good growth exclusively in the high alkaline region,
Belongs to the so-called Alkaliphilic microorganism,
It is distinguished from conventional neutral-grown Bacillus bacteria.
Furthermore, microbiological and physiological properties were compared with those of known alkalophilic Bacillus [Microbiol., 141, 1745 (1995)]. As a result, KSM-K36 strain and KSM-K38 strain were consistent with any of known alkalophilic Bacillus. Therefore, these strains were determined to be new strains, and KSM-K36 strain and KSM
-K38 strains, respectively, No. 16816 (FERM P
No. 16816) and No. 16817 (FERM P-1)
6817).

In order to obtain the alkaline liquefied amylase of the present invention using the above-mentioned microorganism, the medium may be inoculated with the microorganism and cultured according to a conventional method. Since it is an alkalophilic bacterium, the pH of the medium is alkaline. Desirably. The desired alkali liquefied amylase can be collected from the culture thus obtained. This culture supernatant can be used as it is, but if necessary, salting-out method,
A crude enzyme can be obtained by a separation method such as a precipitation method or an ultrafiltration method, and further purified and crystallized by a known method to be used as a purified enzyme.

The following is an example of the method for purifying the alkaline liquefied amylase of the present invention. About the culture supernatant, (1)
By ammonium sulfate precipitation, (2) DEAE-Toyopearl (manufactured by Tosoh Corporation) column chromatography, and (3) gel filtration, polyacrylamide gel electrophoresis (gel concentration 10%) and sodium dodecyl sulfate (SDS) electrophoresis were performed. A purified enzyme giving one band can be obtained.

Furthermore, the alkaline liquefied amylase of the present invention can be obtained, for example, by obtaining a gene encoding the alkaline liquefied amylase of the present invention and a vector plasmid containing the same, and then using the plasmid to obtain a suitable microorganism, preferably It can also be obtained by transforming a Bacillus bacterium and culturing it. Examples of the gene encoding the alkaline liquefied amylase of the present invention include those having the nucleotide sequences shown in SEQ ID NOS: 3 and 4.

As described above, the alkali liquefied amylase of the present invention has an optimum action pH on the alkali side and has a high chelating agent resistance, and is particularly useful as an enzyme for blending detergents. In addition, KSM-K36 strain and KSM-K3
Amylases derived from eight strains also have stronger oxidizing agent resistance, and thus can be added to a detergent containing an oxidizing agent such as a bleaching agent. The amount of the enzyme of the present invention in the detergent is 0.00
1-5% by weight is preferred.

The detergent composition of the present invention may contain a known detergent component in addition to the above-mentioned alkaline liquefied amylase.
26881, page 5, upper right column, line 14 to lower right column, second
Those described in line 9, for example, surfactants, chelating agents, alkali agents and inorganic salts, bleaching agents, fluorescent agents and the like can be used.

The surfactant is contained in the detergent composition in an amount of 0.5 to 6%.
0% by weight (hereinafter simply referred to as%), particularly preferably 10 to 45% for a powdery detergent composition and 20 to 50% for a liquid detergent composition. When the detergent composition of the present invention is a bleach detergent or a detergent for automatic dishwashers, the surfactant is generally 1 to 10%,
Preferably 1-5% is blended. The divalent metal ion scavenger is incorporated in an amount of 0.01 to 50%, preferably 5 to 40%. The alkali agent and the inorganic salt are blended in an amount of 0.01 to 80%, preferably 1 to 40%. 0.001 for anti-recontamination agent
-10%, preferably 1-5%. In addition to the amylase of the present invention, protease, cellulase, protopectinase, pectinase, lipase, hemicellulase,
β-glycosidase, glucose oxidase, cholesterol oxidase and the like can be used. These enzymes are 0.001-5%, preferably 0.1-3%
Be blended. Bleaching agents (eg hydrogen peroxide, percarbonate, etc.)
Is preferably 1 to 10%. When using a bleaching agent, a bleaching activator (activator) is used in an amount of 0.01 to 10%.
%. Examples of the fluorescent agent include a biphenyl type fluorescent agent (for example, Tinopearl CBS-X) and a stilbene type fluorescent agent (for example, DM type fluorescent dye). The fluorescent agent is 0.
It is preferable to add 001 to 2%.

The form of the above-mentioned detergent composition can be, for example, a liquid, a powder, a granule or the like. This detergent composition can be used as a detergent for clothes, a detergent for automatic dishwashers, a drainpipe detergent, a denture detergent, a bleaching agent and the like.

[0022]

EXAMPLES The enzyme activity was measured according to the following method using the following buffers. pH 4.5 to 6.0 Acetate buffer pH 6.0 to 8.0 Potassium phosphate buffer pH 9.0 to 10.5 Glycine sodium hydroxide buffer pH 10.0 to 12.0 Carbonate buffer pH 4.0 to 12 2.0 Britton-Robinson buffer

[Method for Measuring Amylase Activity] Reagent Preparation Method (Preparation Method of 1% Soluble Starch Aqueous Solution) 5 g of soluble starch (derived from potato, manufactured by Sigma) was suspended in 400 mL of ion-exchanged water, and heated and dissolved in boiling water for about 10 minutes while stirring. Make up to 500 mL with exchanged water. (250 mM glycine sodium hydroxide buffer (pH 10)
Preparation method) 9.38 g of glycine (special grade, manufactured by Wako Pure Chemical Industries, Ltd.) is dissolved in about 300 mL of ion-exchanged water, and the pH is adjusted to 10 with a 5N aqueous sodium hydroxide solution using a pH meter. Further, the volume is adjusted to 500 mL with ion-exchanged water. (Preparation method of DNS reagent) 8 g of sodium hydroxide (special grade, manufactured by Wako Pure Chemical Industries, Ltd.) is dissolved in 300 mL of ion-exchanged water. 2.5 g of 3,5-dinitrosalicylic acid (DNS, special grade manufactured by Wako Pure Chemical Industries, Ltd.) is gradually added and dissolved therein. DNS
Is completely dissolved, and 150 g of sodium potassium tartrate (special grade, manufactured by Wako Pure Chemical Industries, Ltd.) is added. After complete dissolution, the volume is adjusted to 500 mL with ion-exchanged water. (Preparation method of glucose solution for preparing calibration curve) Using glucose standard solution (for photoelectric, manufactured by Wako Pure Chemical Industries, Ltd.) and ion-exchanged water,
Prepare glucose solutions of 1, 2, 3, 4, 5 (μmol / 0.1 mL). 2. Assay for Amylase Activity (Dilution of Enzyme Solution) The purified enzyme was subjected to a 10 mM sodium glycine hydroxide buffer (pH) so that δ absorbance [= (absorbance of sample) − (absorbance of blank)] was 0.6 or less.
Dilute in 10). (Measurement of sample) A 1% aqueous solution of soluble starch was placed in a test tube.
5 mL, 250 mM glycine sodium hydroxide buffer (pH 1
0) 0.2 mL of ion-exchanged water and 0.2 mL of ion-exchanged water are added (hereinafter abbreviated as a substrate solution), and this is preheated in a 50 ° C water bath for about 5 minutes. After preheating, 0.1 mL of an appropriately diluted enzyme solution is added and reacted at 50 ° C. for 15 minutes. After completion of the reaction, DN
Add 1.0 mL of S reagent, heat and color in boiling water for 5 minutes, immediately put in ice water and cool. After cooling, 4.0 mL of ion-exchanged water is added, mixed, and the absorbance at 535 nm is measured. (Measurement of blank) Put 0.9 mL of the substrate solution into a test tube,
To this is added 1.0 mL of DNS reagent. In addition, the enzyme solution 0.
Add 1 mL, heat and color in boiling water for 5 minutes, immediately put in ice water and cool. After cooling, 4.0 mL of ion-exchanged water is added, mixed, and the absorbance at 535 nm is measured. (Preparation of calibration curve) 0.9 mL of the substrate solution is placed in a test tube, and 1.0 mL of the DNS reagent is added thereto. Further, 0.1 mL of a glucose solution for preparing a calibration curve of each concentration is added, and the mixture is heated and colored in boiling water for 5 minutes, immediately put into ice water and cooled. After cooling,
4.0 mL of ion-exchanged water is added, mixed, and the absorbance at 535 nm is measured. The concentration of glucose solution (μmo
l / 0.1 mL), the absorbance is taken on the vertical axis, the slope is determined by the least squares method, and the conversion coefficient (F) is calculated according to the following equation. Conversion coefficient (F) = [1 / slope] × [1/15] × [10
00 / 0.1] A calibration curve is created for each activity measurement. (Calculation of activity) The titer of the enzyme refers to the amount of the enzyme that produces reducing sugars equivalent to 1 μmol of glucose per minute as 1 unit (U).
And is calculated according to the following equation. Amylase activity (U / L) = [δ absorbance] × [conversion coefficient (F)] × [enzyme dilution ratio]

[Chelating Agent Performance Test Method] (Preparation of EDTA Solution) EDTA (manufactured by Sigma) 9.3
g was dissolved in about 80 mL of ion-exchanged water, and the pH was adjusted to 8 with about 5 N aqueous sodium hydroxide using a pH meter. Further, a 250 mM EDTA solution is prepared by adjusting the volume to 100 mL with ion-exchanged water. Next, this is diluted with ion-exchanged water to prepare 10 to 100 mM EDTA. After dissolving 9.5 g of EGTA (manufactured by Sigma) in about 80 mL of ion-exchanged water, use a pH meter to obtain about 5 N
The pH is adjusted to 8 with an aqueous solution of sodium hydroxide. Further, the volume is adjusted to 100 mL with ion-exchanged water to 25
Prepare a 0 mM EGTA solution. Next, this is diluted with ion-exchanged water to prepare a 10 to 100 mM EGTA solution. (Test method for chelating agent resistance performance) In the case of treatment with 1 mM EDTA, 40 ° C., 30 minutes, 0.1 mL of 10 mM EDTA solution, 0.2 mL of 250 mM sodium glycine hydroxide buffer (pH 10), 0.1 mL of ion-exchanged water And preheat in a 45 ° C. water bath for about 5 minutes. After preheating, 0.1 mL of an enzyme solution appropriately diluted with 10 mM glycine sodium hydroxide buffer (pH 10) is added, and the mixture is kept at 45 ° C. for 30 minutes. 30 minutes later, 50
The treatment solution was added to 0.9 mL of the substrate solution preheated in a water bath at 0 ° C.
Add 1 mL, and measure the remaining enzyme activity according to the amylase activity measurement method.

[Oxidizing agent resistance test method] Hydrogen peroxide (30% aqueous hydrogen peroxide, manufactured by Wako Pure Chemical Industries) 0.06
7 mL, 250 mM sodium glycine hydroxide buffer (pH 1
0) 0.2 mL and 0.633 mL of ion-exchanged water were added, and 30
Preheat in a water bath at about 5 minutes. After preheating, 0.1 mL of an enzyme solution appropriately diluted with 10 mM glycine sodium hydroxide buffer (pH 10) is added, and the mixture is incubated at 30 ° C. for 60 minutes. After 60 minutes, 0.2 mL of the treatment solution is added to a test tube containing 1 μL of catalase (derived from bovine liver, manufactured by Boehringer Mannheim) previously prepared in ice water to inactivate hydrogen peroxide and stop the reaction. Thereafter, 0.1 mL of this reaction termination treatment solution is added to 0.9 mL of the substrate solution preheated in a 50 ° C. water bath, and the remaining enzyme activity is measured according to the amylase activity measurement method. [Protein quantification method] The protein was obtained from Bio-Rad Protein Assay Kit II (catalog number 500-
0002), the bovine serum albumin attached to the kit was quantified as a standard protein according to a standard assay method.

Example 1 Screening of Alkaline Liquefied Amylase Having Chelating Agent-Resistant Performance About 0.5 g of soil was suspended in sterilized water and heated at 80 ° C. for 15 minutes. The supernatant of this heat treatment solution was appropriately diluted with sterile water, and applied to an agar medium for separation (medium A). Then
This was cultured at 30 ° C. for 2 days to form a colony. Those that formed a transparent zone based on starch dissolution around the settlement were selected and isolated as amylase-producing bacteria. Further, the isolated bacteria were inoculated on the medium B, and aerobically shake-cultured at 30 ° C. for 2 days. After the cultivation, the supernatant of the centrifuged suspension was measured for chelating agent (EDTA) resistance and, further, the optimum pH was measured to screen the alkaline liquefied amylase-producing bacteria of the present invention.

By the above-mentioned method, Bacillus sp. Strain KSM-K36 and Bacillus sp. Strain KSM-K38 were obtained.

[0028]

Example 2 KSM-K36 strain and KSM-
Cultivation of K38 Strain KSM-K36 strain or K
The SM-K38 strain was inoculated and aerobically shake-cultured at 30 ° C for 2 days. Amylase activity (pH
As a result of measuring 8.5), 1177 U and 557 U of activity were found per 1 L of the culture solution, respectively.

Example 3 Purification of Liquefied Alkaline Amylase of the Present Invention Bacillus sp. KSM-K3 obtained in Example 2
Ammonium sulfate was added to the culture supernatants of the six strains so that the concentration became 80% saturated, and the mixture was stirred.
10 mM Tris-HCl buffer containing 7 mM CaCl ₂ (pH 7.
5) and dialyzed against the same buffer overnight. The obtained dialysis solution was applied to a DEAE-Toyopearl 650M column equilibrated with the same buffer, and O-1M was prepared using the same buffer.
The protein was eluted with a concentration gradient of sodium chloride. The active fraction is dialyzed against the same buffer, and the active fraction obtained by gel filtration column chromatography is dialyzed against the above buffer to obtain polyacrylamide gel electrophoresis (gel concentration 1).
0%) and sodium dodecyl sulfate (SDS) electrophoresis, yielding a purified enzyme giving a single band.
In addition, a purified enzyme was obtained from the culture supernatant of the Bacillus sp. KSM-K38 strain in the same manner.

Example 4 Performance of the alkaline liquefied amylase of the present invention in chelating agent resistance The purified product of the alkaline liquefied amylase of the present invention (hereinafter referred to as the purified product) obtained from the culture supernatant of the KSM-K36 strain and the KSM-K38 strain in Example 3 (K36 and K38, respectively)), the resistance to various chelating agents was measured.

1) Resistance to EDTA and EGTA 10 mM sodium glycine hydroxide buffer in 50 mM sodium glycine hydroxide buffer (pH 10) containing EDTA (Sigma) or EGTA (Sigma) having a final concentration of 0 to 100 mM. A purified enzyme appropriately diluted with a liquid (pH 10) is added, the mixture is treated at a predetermined temperature (30 ° C., 40 ° C., and 45 ° C.) for 30 minutes, and then the amylase activity measurement method [50]
Using mM mM glycine sodium hydroxide buffer (pH 10)]. As controls, termamyl and duramil, which are amylase derived from Bacillus licheniformis (both purified from granules manufactured by Novo) were used. As a result, as shown in FIGS. 1 and 2, both K36 and K38 were not affected by the high concentrations of EDTA and EGTA at all, indicating that they had a high level of performance in comparison with Termamill and Duramill. .

2) Resistance to citric acid and zeolite Trisodium citrate dihydrate having a final concentration of 0 to 0.5% (special grade manufactured by Wako Pure Chemical Industries) or synthetic zeolite A-3
A purified enzyme appropriately diluted with 10 mM sodium glycine hydroxide buffer (pH 10) was added to 50 mM sodium glycine hydroxide buffer (pH 10) containing (manufactured by Wako Pure Chemical Industries, Ltd.). (45 ° C.) for 30 minutes, and then the residual enzyme activity was measured according to the amylase activity measurement method [using 50 mM glycine sodium hydroxide buffer (pH 10)].

The results showed that both K36 and K38 were not affected at all by citric acid and zeolite (FIGS. 3 to 6).

Example 5 Working pH and Optimum Working pH of the Alkaline Liquefied Amylase of the Present Invention Various buffers having a final concentration of 50 mM [acetate buffer (pH 4.5 to 4.5)
6.0), potassium phosphate buffer (pH 6.0-8.0).
0), glycine sodium hydroxide buffer (pH 9.0-1)
0.5) and carbonate buffer (pH 10.0 to 12.0)] and K36 and K38 according to the amylase activity measurement method.
Was measured, and the maximum activity was defined as 100%, and the relative activity was shown. The results (FIGS. 7 and 8) show that both pH
It works in the range of 6.0 to 10.0, and the optimum working pH is 8.0.
９9.0. The pH was shown by measuring the measured value of the reaction solution.

Example 6 Oxidant resistance and enzyme specific activity of the alkaline liquefied amylase of the present invention 10 mM glycine in 50 mM glycine sodium hydroxide buffer (pH 10) containing 2% (580 mM) final concentration of H ₂ O _2. Enzymes (K36, K38, Termamyl and Duramil) appropriately diluted with a sodium hydroxide buffer (pH 10) are added, the mixture is treated at 30 ° C. for 60 minutes, and an amylase activity measurement method [50 mM glycine sodium hydroxide buffer Using a liquid (pH 10)]. The oxidant resistance performance was indicated by residual activity, where the activity before treatment was 100%.

As a result (FIG. 9), both K36 and K38 maintain a residual activity of 70% or more, particularly 94% or more, even after treatment at pH 10, 30 ° C. for 60 minutes in the presence of 2% H ₂ O _2. It was confirmed that the composition had sufficient oxidant resistance performance. In addition, the enzyme activity values in a reaction at pH 10, 50 ° C. for 15 minutes (using soluble starch as a substrate) and the specific enzyme activities of K36 and K38 calculated from the amount of protein measured with a protein assay kit (manufactured by Bio-Rad),
4300 U / mg and 3600 U / mg (Table 2). Both enzymes have a specific activity of 3000 U / mg or more, and are oxidant resistant enzymes constructed by protein engineering (LAMY M202T (WO98 / 44126)). And Duramil). Therefore, the alkali liquefied amylase of the present invention is superior in terms of the amount of the compound in detergents and in industrial fermentation production.

[0039]

[Table 2]

Example 7 Other Enzymatic Properties of the Alkaline Liquefied Amylases (K36 and K38) of the Present Invention Analysis of both purified enzymes revealed the following characteristics.

(1) Action In each case, they decompose α-1,4 glucosidic bonds of starch, amylose, amylopectin and their partially decomposed products,
Glucose (G1) and maltose (G
2) produce maltotriose (G3), maltotetraose (G4), maltopentaose (G5), maltohexaose (G6) and maltoheptaose (G7). However, it does not act on pullulan. (2) pH stability (Britton-Robinson buffer)
It shows a residual activity of 70% or more in the range of 11.0. (3) Working temperature range and optimum working temperature Both work in a wide range of 20 to 80 ° C, and the optimum working temperature is 50 to 60 ° C. (4) Temperature stability The temperature was changed in a 50 mM glycine sodium hydroxide buffer solution (pH 10), and the conditions of deactivation were examined by treating at each temperature for 30 minutes. It showed residual activity, and showed about 60% residual activity even at 45 ° C. (5) Molecular weight In each case, the molecular weight measured by sodium dodecyl sulfate polyacrylamide gel electrophoresis was 55,000 ±.
5,000. (6) Isoelectric point In each case, the isoelectric point measured by the isoelectric focusing method is around 4.2. (7) Influence of surfactant Sodium linear alkylbenzene sulfonate, sodium alkyl sulfate, sodium polyoxyethylene alkyl sulfate, sodium α-olefin sulfonate, sodium α-sulfonated fatty acid ester, sodium alkyl sulfonate, In a 0.1% solution of various surfactants such as SDS, soap and sophthanol, pH
Even when treated at 10, 30 ° C. for 30 minutes, almost no activity is inhibited (the residual activity rate is 90% or more). (8) Influence of Metal Salts In the presence of various metal salts, treatment was performed at pH 10 and 30 ° C. for 30 minutes to examine the effects. K36 is inhibited by 1 mM Mn ²⁺ (inhibition rate about 95%), 1 mM Hg ²⁺ , Be ²⁺
And Cd ²⁺ (inhibition rate 30-40)
%). K38 is inhibited by 1 mM Mn ²⁺ (inhibition rate about 75%) and slightly inhibited by 1 mM Sr ²⁺ and Cd ²⁺ (inhibition rate about 30%). (9) N-terminal amino acid sequence The N-terminal amino acid sequence of both amylase was converted to a protein-kenser (ABI) 477A by the Endman degradation method [Edman, P., Acta Chem. Scand., 4, 283, (1948)]. As a result of using Asp-Gly-Leu-Asn-Gly-Th
It was found to have the sequence of r-Met-Met-Gln-Tyr-Tyr-Glu-Trp-His-Leu.

Example 8 Evaluation of Detergent Detergency of the Alkaline Liquefied Amylase of the Present Invention for an Automatic Dishwasher The alkaline liquefied amylase of the present invention (K36 and K3
The cleaning evaluation of 8) with the automatic dishwashing detergent was performed under the following conditions. Separately, a detergent containing no enzyme of the present invention was used as a control. 1) Preparation of a contaminated dish After boiling in boiling tap water, apply 1 mL of oatmeal (manufactured by Quaker) in a solution form by adding tap water to a magnetic dish, dry at room temperature for about 3 hours, and until immediately before use. 5 ℃
(Semi-closed state). Three washes were used for one washing. 2) Washing conditions-Model used: Matsushita Electric Co., Ltd. fully automatic dishwasher NP-
810 ・ Washing temperature: The temperature is gradually raised from the water temperature to about 55 ° C.・ Washing water; tap water ・ Detergent concentration: 0.2% by weight ・ Washing time: about 20 minutes for washing → about 20 minutes for rinsing (standard course) ・ Amount of circulating water during washing: 3.5 L 3) Detergent composition (% Weight%) 2.2% Pluronic L-61, sodium carbonate 2
4.7%, sodium bicarbonate 24.7%, sodium percarbonate 10.0%, No. 1 sodium silicate 12.0% and trisodium citrate 20.0%, polypropylene glycol 3002.2%, silicone KST-04 (Manufactured by Toshiba Silicone Co., Ltd.) 0.2%, Sokaran CP-45 (B
(ASF) 4.0%. 4) Amount of enzyme to be added Glycine-sodium hydroxide buffer (pH 1)
0), the activity value of the purified enzyme obtained in Example 3 was measured by the above-mentioned amylase activity measurement method, and 1
50 U was added. 5) Detergency Evaluation Method An iodine solution was applied to the washed dishes, and the color due to the iodine-starch reaction was visually determined.

As a result, when the detergent containing the enzyme of the present invention was used, dirt could be completely removed, and the cleaning performance was extremely excellent as compared with the case where the detergent containing the enzyme of the present invention was not used.

Example 9 Saito and Miura [Biochim. Biophys. Acta, 72, 61
9 (1961)] and the KS-K36 strain and KS
Using chromosomal DNA of M-K38 strain as a template, it is highly conserved in liquefied amylase derived from known Bacillus bacteria.
Met-Gln-Tyr-Phe-Glu-Trp sequence, and Trp-Phe-Lys-Pro-L
As a result of performing PCR using two kinds of oligonucleotide primers designed based on the eu-Tyr sequence according to a conventional method, an amplified DNA fragment of about 1.0 kb was obtained in each case. The nucleotide sequences of both DNA fragments were analyzed, and then the upstream and downstream DNA fragments of both fragments were subjected to reverse PCR (T. Triglia et al., Nucleic Acids Res., 16, 81 (1988)).
And a PCR in vitro cloning kit (manufactured by Boehringer Mannheim), and its nucleotide sequence was analyzed. As a result, in both strains, the only open reading frame (ORF) encoding the 501 amino acid residues shown in SEQ ID NOS: 1 and 2 was found in the gene region of about 1.7 kb, and the amino-terminal region was found. (Amino acid numbers Asp1 to Leu15) are represented by KSM-K
It was revealed that the amino acid sequences completely corresponded to the amino terminal sequences (15 amino acid residues) of amylase K36 and K38 purified from cultures of the 36 strain and the KSM-K38 strain. The determined K36 and K38 amylase genes had the nucleotide sequences shown in SEQ ID NOs: 3 and 4, respectively.

Example 10 By PCR using the chromosomal DNA of both strains as a template, from the start codon 0.7 kb upstream to the stop codon 0.1 kb.
The 1.7 kb DNA fragment to the downstream was amplified and introduced into Bacillus subtilis ISW1214 strain using shuttle vector pHY300PLK (manufactured by Yakult Honsha). All of the obtained recombinant B. subtilis strains produced amylase in the culture solution in liquid culture. Amylase was purified from the culture supernatant by the method described in Example 3 and its characteristics were analyzed. The characteristics were well consistent with those of the amylase purified from the culture solutions of the KSM-K36 strain and the KSM-K38 strain. The optimum pH for action was observed at pH 8-9, and at pH 10, it was found to have a specific activity of about 4000 U / mg and to have high resistance to chelating agents and oxidizing agents. .

[0046]

The alkaline liquefied amylase of the present invention comprises:
Compared with the detergent amylase known so far, it has higher chelating agent resistance. Also, the optimum working pH is above 8. Therefore, the alkaline liquefied amylase of the present invention can be used in an extremely wide range of industrial fields such as a process for processing starch in an alkaline region. In particular, it can be used advantageously by blending it with a detergent for automatic dishwashers containing a chelating agent, a detergent for clothing, a bleaching agent, and the like,
It is of great industrial significance.

[0047]

[Sequence List] SEQUENCE LISTING <110> KAO CORPORATION <120> Novel Amylase <130> P05631012 <160> 4 <210> 1 <211> 501 <212> PRT <213> Bacillus sp. <400> 1 Met Lys Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe Pro 5 10 15 Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr Tyr 20 25 30 Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His Asp 35 40 45 Asp Ala Glu Ala Leu Ser Asn Ala Gly Ile Thr Ala Ile Trp Ile Pro 50 55 60 Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr 65 70 75 80 Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr 85 90 95 Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu Lys 100 105 110 Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys Leu 115 120 125 Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro Ser 130 135 140 Asn Arg Trp Gln Asp Ile Ser Gly Val Tyr Thr Ile Asp Ala Trp Thr 145 150 155 160 Gly Phe Asp Phe Pro Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys Trp 165 170 175 Arg Trp Phe His Phe As n Gly Val Asp Trp Asp Gln Arg Tyr Gln Glu 180 185 190 Asn His Leu Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg Val Asp 195 200 205 Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp Phe 210 215 220 Ser His Pro Glu Val Gln Glu Glu Leu Lys Asp Trp Gly Ser Trp Phe 225 230 235 240 Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys His 245 250 255 Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg Ser Glu 260 265 270 Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp Val 275 280 285 Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser Leu 290 295 300 Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Lys Gln Gly 305 310 315 320 Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu Ala 325 330 335 His Pro Ile His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln Pro 340 345 350 Gly Glu Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu Ala 355 360 365 Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe Tyr 370 375 380 Gly Asp Tyr Tyr Gly Ile Pr o Asn Asp Asn Ile Ser Ala Lys Lys Asp 385 390 395 400 Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr Gly Thr 405 410 415 Gln His Asp Tyr Phe Asp His Trp Asp Ile Val Gly Trp Thr Arg Glu 420 425 430 Gly Thr Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asn 435 440 445 Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Gln Gln His Ala Gly 450 455 460 Gln Thr Trp Thr Asp Leu Thr Gly Asn His Ala Ala Ser Val Thr Ile 465 470 475 480 Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val Ser 485 490 495 Val Tyr Val Asn Gln 500

<210> 2 <211> 501 <212> PRT <213> Bacillus sp. <400> 2 Met Arg Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe Pro 5 10 15 Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr Tyr 20 25 30 Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His Asp 35 40 45 Asp Ala Ala Ala Leu Ser Asp Ala Gly Ile Thr Ala Ile Trp Ile Pro 50 55 60 Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr 65 70 75 80 Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr 85 90 95 Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu Lys 100 105 110 Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys Met 115 120 125 Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro Thr 130 135 140 Asn Arg Trp Gln Asp Ile Ser Gly Ala Tyr Thr Ile Asp Ala Trp Thr 145 150 155 160 Gly Phe Asp Phe Ser Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys Trp 165 170 175 Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr Gln Glu 180 185 190 Asn His Ile Phe Arg Phe Al a Asn Thr Asn Trp Asn Trp Arg Val Asp 195 200 205 Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp Phe 210 215 220 Ser His Pro Glu Val Gln Asp Glu Leu Lys Asp Trp Gly Ser Trp Phe 225 230 235 240 Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys His 245 250 255 Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg Asn Glu 260 265 270 Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp Val 275 280 285 Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser Leu 290 295 300 Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Gln Gln Gly 305 310 315 320 Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu Ala 325 330 335 His Pro Met His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln Pro 340 345 350 Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu Ala 355 360 365 Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe Tyr 370 375 380 Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys Lys Asp 385 390 390 395 400 Met Ile Asp Glu Leu Leu Leu As p Ala Arg Gln Asn Tyr Ala Tyr Gly Thr 405 410 415 Gln His Asp Tyr Phe Asp His Trp Asp Val Val Gly Trp Thr Arg Glu 420 425 430 Gly Ser Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asn 435 440 445 Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Arg Gln Asn Ala Gly 450 455 460 Gln Thr Trp Thr Asp Leu Thr Gly Asn Asn Gly Ala Ser Val Thr Ile 465 470 475 480 Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val Ser 485 490 495 Val Tyr Val Asn Gln 500

<210> 3 <211> 1650 <212> DNA <213> Bacillus sp. <400> 3 cttgaatcat tatttaaagc tggttatgat atatgtaagc gttatcatta aaaggaggta 60 tttg atg aaa aga tgg gta gta gca atg ctg gca gtg tt tttttt Lys Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe 5 10 15 cct tcg gta gta gtt gca gat ggc ttg aat gga acg atg atg cag tat 157 Pro Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr 20 25 30 tat gag tgg cat cta gag aat gat ggg caa cac tgg aat cgg ttg cat 205 Tyr Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His 35 40 45 gat gat gcc gaa gct tta agt aat gcg ggt att aca gct att tgg ata 253 Asp Asp Ala Glu Ala Leu Ser Asn Ala Gly Ile Thr Ala Ile Trp Ile 50 55 60 ccc cca gcc tac aaa gga aat agt cag gct gat gtt ggg tat ggt gca 301 Pro Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala 65 70 75 tac gac ctt tat gat tta ggg gag ttt aat caa aaa ggt acc gtt cga 349 Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg 80 85 90 95 acg aaa tac ggg aca aag gct cag ctt gag cga gct ata ggg tcc cta 397 Thr Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu 100 105 110 aag tcg aat gat atc aat gtt tat ggg gat gtc gta atg aat cat aaa 445 Lys Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys 115 120 125 tta gga gct gat ttc acg gag gca gtg caa gct gtt caa gta aat cct 493 Leu Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro 130 135 140 tcg aac cgt tgg cag gat att tca ggt gtc tac acg att gat gca tgg 541 Ser Asn Arg Trp Gln Asp Ile Ser Gly Val Tyr Thr Ile Asp Ala Trp 145 150 155 acg gga ttt gac ttt cca ggg cgc aac aat gcc tat tcc gat ttt aaa 589 Thr Gly Phe Asp Phe Pro Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys 160 165 170 175 tgg aga tgg ttc cat ttt aat ggc gtt gac tgg gat caa cgc tat caa 637 Trp Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr Gln 180 185 190 gaa aac cat ctt ttt cgc ttt gca aat acg aac tgg aac tgg cga gtg 685 Glu Asn His Leu Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg Val 195 200 205 gat gaa gag aat ggt aat tat gac tat tta tta gga tcg aac att gac 733 Asp Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp 210 215 220 ttt agc cac cca gag gtt caa gag gaa tta agg gat tag agc tgg 781 Phe Ser His Pro Glu Val Gln Glu Glu Leu Lys Asp Trp Gly Ser Trp 225 230 235 ttt acg gat gag cta gat tta gat ggg tat cga ttg gat gct att aag 829 Phe Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys 240 245 250 255 cat att cca ttc tgg tat acg tca gat tgg gtt agg cat cag cga agt 877 His Ile Pro Phe Trp Tyr Thr Ser Ser Asp Trp Val Arg His Gln Arg Ser 260 265 270 270 gaa gca gac caa gat tta ttt gtc gta ggg gag tat tgg aag gat gac 925 Glu Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp 275 280 285 gta ggt gct ctc gaa ttt tat tta gat gaa atg aat tgg gag atg tct 97 Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser 290 295 300 cta ttc gat gtt ccg ctc aat tat aat ttt tac cgg gct tca aag caa 1021 Leu Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Lys G n 305 310 315 ggc gga agc tat gat atg cgt aat att tta cga gga tct tta gta gaa 1069 Gly Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu 320 325 330 335 gca cat ccg att cat gca gtt acg ttt gtt gat aat cat gat act cag 1117 Ala His Pro Ile His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln 340 345 350 cca gga gag tca tta gaa tca tgg gtc gct gat tgg ttt aag cca ctt 1165 Pro Gly Glu Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu 355 360 365 gct tat gcg aca atc ttg acg cgt gaa ggt ggt tat cca aat gta ttt 1213 Ala Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe 370 375 380 tac ggt gac tac tat ggg att cct aac gat aac att tca gct aag aag 1261 Tyr Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys Lys 385 390 395 gat atg att gat gag ttg ctt gat gca cgt caa aat tac gca ggc 1309 Asp Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr Gly 400 405 410 415 aca caa cat gac tat ttt gat cat tgg gat atc gtt gga tgg aca aga 1357 Thr Gln His Asp Tyr Phe Asp His Trp Asp Ile Val Gly Trp Thr Arg 420 425 430 gaa ggt aca tcc tca cgt cct aat tcg ggt ctt gct act att atg tcc 1405 Glu Gly Thr Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser 435 440 445 aat ggt cct gga gga tca aaa tgg atg tac gta gga cag caa cat gca 1453 Asn Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Gln Gln His Ala 450 455 460 gga caa acg tgg aca gat tta act ggc aat cac gcg gcg tcg gtt acg 1501 Gly Thr Trp Thr Asp Leu Thr Gly Asn His Ala Ala Ser Val Thr 465 470 475 att aat ggt gat ggc tgg ggc gaa ttc ttt aca aat gga gga tct gta 1549 Ile Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val 480 485 490 495 tcc gtg tat gtg aac caa taataaaaag ccttgagaag ggattcctcc ctaactca 1605 Ser Val Tyr Val Asn Gln 500 aggctttctt tatgtcgttt agctcaacgc ttctacgaag cttta 1650

<210> 4 <211> 1745 <212> DNA <213> Bacillus sp. <400> 4 aactaagtaa catcgattca ggataaaagt atgcgaaacg atgcgg gaaaaaa ctgcgcaact 60 actagcactc ttcagatt catattacctatt ttttccaaaa atgacatgattactaaaccacctt ttttccaaaa atgacatgattactattg tgg gta gta gca atg ttg gca gtg tta ttt tta 231 Met Arg Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu 5 10 ttt cct tcg gta gta gtt gca gat gga ttg aac ggt acg atg atg cag 279 Phe Pro Ser Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln 15 20 25 30 tat tat gag tgg cat ttg gaa aac gac ggg cag cat tgg aat cgg ttg 327 Tyr Tyr Gyr Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu 35 40 45 cac gat gat gcc gca gct ttg agt gat gct ggt att aca gct att tgg 375 His Asp Asp Ala Ala Ala Leu Ser Asp Ala Gly Ile Thr Ala Ile Trp 50 55 60 att ccg cca gcc tac aaa ggt aat agt cag gcg gat gtt ggg tac ggt 423 Ile Pro Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly 65 70 75 gca tac gat ctt ta t gat tta gga gag ttc aat caa aag ggt act gtt 471 Ala Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val 80 85 90 cga acg aaa tac gga act aag gca cag ctt gaa cga gct att ggg tcc 519 Arg Thr Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser 95 100 105 110 ctt aaa tct aat gat atc aat gta tac gga gat gtc gtg atg aat cat 567 Leu Lys Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His 115 120 125 aaa atg gga gct gat ttt acg gag gca gtg caa gct gtt caa gta aat 615 Lys Met Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn 130 135 140 cca acg aat cgt tgg cag gat att tca ggt gcc tac acg att gat gcg 663 Pro Thr Asn Arg Trp Gln Asp Ile Ser Gly Ala Tyr Thr Ile Asp Ala 145 150 155 tgg acg ggt ttc gac ttt tca ggg cgt aac aac gcc tat tca gat ttt 711 Trp Thr Gly Phe Asp Phe Ser Gly Arg Asn Asn Ala Tyr Ser Asp Phe 160 165 170 aag tgg aga tgg ttc cat ttt aat ggt gtt gac tgg gat cag cgc tat 759 Lys Trp Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr 175 180 185 190 caa ga a aat cat att ttc cgc ttt gca aat acg aac tgg aac tgg cga 807 Gln Glu Asn His Ile Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg 195 200 205 gtg gat gaa gag aac ggt aat tat gat tac ctg tta ggatc atc 855 Val Asp Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile 210 215 220 gac ttt agt cat cca gaa gta caa gat gag ttg aag gat tgg ggt agc 903 Asp Phe Ser His Pro Glu Val Gln Asp Glu Leu Lys Asp Trp Gly Ser 225 230 235 tgg ttt acc gat gag tta gat ttg gat ggt tat cgt tta gat gct att 951 Trp Phe Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile 240 245 250 aaa cat att cca ttc tgg tat aca tct gat tgg gtt cgg cat cag cgc 999 Lys His Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg 255 260 265 270 aac gaa gca gat caa gat tta ttt gtc gta ggg gaa tat tgg aag gat 1047 Asn Glu Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp 275 280 285 gac gta ggt gct ctc gaa ttt tat tta gat gaa atg aat tgg gag atg 1095 Asp Val Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Mlu 295 300 tct cta ttc gat gtt cca ctt aat tat aat ttt tac cgg gct tca caa 1143 Ser Leu Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Gln 305 310 315 caa ggt gga agc tat gat atg cgt aat att tta cga gga tct tta gta 1191 Gln Gly Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val 320 325 330 gaa gcg cat ccg atg cat gca gtt acg ttt gtt gat aat cat gat act 1239 Glu Ala His Pro Met His Ala Val Thr Phe Val Asp Asn His Asp Thr 335 340 345 350 350 cag cca ggg gag tca tta gag tca tgg gtt gct gat tgg ttt aag cca 1287 Gln Pro Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro 355 360 365 ctt gct tat gcg aca att ttg acg cgt gaa ggt ggt tat cca aat gta 1335 Leu Ala Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val 370 375 380 ttt tac ggt gat tac tat ggg att cct aac gat aac att tca gct aaa Phe Tyr Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys 385 390 395 aaa gat atg att gat gag ctg ctt gat gca cgt caa aat tac gca tat 1431 Lys Asp Met Ile Asp Glu Leu Leu Asp Ala Arg Gln A sn Tyr Ala Tyr 400 405 410 ggc acg cag cat gac tat ttt gat cat tgg gat gtt gta gga tgg act 1479 Gly Thr Gln His Asp Tyr Phe Asp His Trp Asp Val Val Gly Trp Thr 415 420 425 430 agg gaa gga tct tcc tcc aga cct aat tca ggc ctt gcg act att atg 1527 Arg Glu Gly Ser Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met 435 440 445 tcg aat gga cct ggt ggt tcc aag tgg atg tat gta gga cgt cag aat 1575 Ser Asn Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Arg Gln Asn 450 455 460 gca gga caa aca tgg aca gat tta act ggt aat aac gga gcg tcc gtt 1623 Ala Gly Gln Thr Trp Thr Asp Leu Thr Gly Asn Asn Gly Ala Ser Val 465 470 475 aca att aat ggc gat gga tgg ggc gaa ttc ttt acg aat gga gga tct 1671 Thr Ile Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser 480 485 490 gta tcc gtg tac gtg aac caaccagacaag cc Val Ser Val Tyr Val Asn Gln 495 500 ctcaaggctt tctttatgt 1745

[Brief description of the drawings]

FIG. 1 is a drawing showing the relationship between the EDTA treatment concentration and the residual activity of alkaline liquefied amylase (K36 and K38) of the present invention and known detergent amylase.

FIG. 2 is a graph showing the relationship between the EGTA treatment concentration and the residual activity of alkaline liquefied amylase (K36 and K38) of the present invention and known detergent amylase.

FIG. 3 is a drawing showing the relationship between the concentration of zeolite treated alkaline liquefied amylase K36 of the present invention and residual activity.

FIG. 4 is a drawing showing the relationship between the concentration of citric acid treated alkaline liquefied amylase K36 of the present invention and the residual activity.

FIG. 5 is a graph showing the relationship between the concentration of zeolite treated alkaline liquefied amylase K38 of the present invention and residual activity.

FIG. 6 is a drawing showing the relationship between the concentration of citric acid treatment of alkaline liquefied amylase K38 of the present invention and residual activity.

FIG. 7 is a drawing showing the relationship between the reaction pH and the relative activity of the alkaline liquefied amylase K36 of the present invention.

FIG. 8 is a drawing showing the relationship between the reaction pH and the relative activity of the alkaline liquefied amylase K38 of the present invention.

FIG. 9 is a drawing showing the relationship between the H ₂ O ₂ treatment time and the residual activity of the alkaline liquefied amylase (K36 and K38) of the present invention and the known detergent amylase.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (Reference) C12R 1:07) (72) Inventor Yasuhiro Hayashi 2606 Kabane-cho, Akaba, Kaga-cho, Haga-gun, Tochigi Prefecture Kao Corporation Research Laboratory (72) Invention Kazuaki Igarashi 2606, Kabane-cho, Akaga-cho, Haga-gun, Tochigi Pref. In Kao Co., Ltd. (72) Inventor Keiji Endo 2606, Kabane-cho, Akabane-cho, Haga-gun, Tochigi pref. In Kao Co., Ltd. (72) Inventor Katsuya Ozaki, Haga-gun, Tochigi pref. 2606 Akabane, Ichigai-cho F-term in Kao Corporation Research Laboratory (Reference) 4B024 AA03 AA05 BA13 CA01 CA20 DA07 EA04 FA15 GA11 GA19 HA03 4B050 CC01 CC03 DD02 EE01 FF03E FF04E FF05E FF11E FF12E FF13E KK02 KK04 KK14 EC04

Claims (5)

[Claims] 1. EDTA or EGT of 1 to 100 mM
An alkaline liquefied amylase having a residual activity of 70% or more after treatment at pH 10, 45 ° C. for 30 minutes in the presence of A. 2. The liquefied alkaline amylase according to claim 1, which further has the following enzymatic properties. 1) Optimum action pH Optimum action pH exceeds 8.0 (soluble starch as substrate, 50
C. for 15 minutes). 2) Action The α-1,4 glucoside bond of starch, amylose, amylopectin and their partially decomposed products is degraded, and glucose (G1), maltose (G2), maltotriose (G3), maltotetraose ( G4),
Maltopentaose (G5), maltohexaose (G
6) and maltoheptaose (G7). However, it does not act on pullulan. 3) pH stability (Britton-Robinson buffer) Shows a residual activity of 70% or more in the pH range of 6.5 to 11.0 under treatment conditions at 40 ° C. for 30 minutes. 4) Working temperature range and optimum working temperature It works over a wide range of 20 to 80 ° C, and the optimum working temperature is 50 to 80 ° C.
60 ° C. 5) Temperature stability in 50 mM glycine sodium hydroxide buffer (pH 10)
It shows a residual activity of 80% or more at 40 ° C and a residual activity of about 60% even at 45 ° C after treatment for 30 minutes. 3. The alkaline liquefied amylase according to claim 1, which has an amino acid sequence having 80% or more homology with the amino acid sequence represented by SEQ ID NO: 1 or 2. 4. A DNA fragment encoding the alkaline liquefied amylase according to any one of claims 1 to 3. 5. A detergent composition comprising the alkaline liquefied amylase according to claim 1.