JP2000139500A - Measuring of hiv gene by real time detection pcr, and primer and probe used therefor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new reversed side primer comprising an oligonucleotide having a specific base sequence and useful for accurate measurement of human immunodeficiency virus(HIV) gene, or the like, by real time detection PCR method. SOLUTION: This reversed side new primer is an oligonucleotide having a base sequence (T may be V) comprising continuing 15-47 bases in a base sequence represented by the formula and having a base sequence containing 21st carbon of the base sequence represented by the formula and is used for measuring HIV gene by real time detection PCR method, and the HIV measuring method using this new primer can measure HIV gene more accurately in higher sensitivity than conventional method and is useful for diagnosis of AIDS, or the like. The primer is obtained by considering to minimize the influence by multiform of HIV gene having many variations on detection sensitivity and setting the condition for detection in good sensitivity after repeating trials and errors.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for measuring human immunodeficiency virus (herein referred to as "HIV") by real-time detection PCR, and primers and probes.

[0002]

2. Description of the Related Art In real-time detection PCR, a PCR is carried out in the presence of a probe to which a reporter fluorescent dye and a quencher fluorescent dye are bound, thereby measuring the fluorescence intensity that increases in real time as the target nucleic acid is amplified. This is a technique for measuring a target nucleic acid in a sample, and a kit for this is also commercially available.

[0003] Hitherto, it has been proposed to measure HIV by real-time PCR (Tokuhei 6-50002).
1).

[0004]

However, the sensitivity of real-time PCR is significantly affected by the primers and probes used. It goes without saying that it would be advantageous to be able to measure HIV with higher sensitivity than previously reported methods.

Accordingly, an object of the present invention is to provide a method for measuring HIV which can measure HIV more sensitively and accurately than previously reported methods, and a primer and a probe which can be used for the method. .

[0006]

Means for Solving the Problems As a result of intensive studies, the present inventors have found that using specific primers and probes, real-time detection PCR can be used to accurately detect HIV with very high sensitivity and high reproducibility. They have found that they can be quantified and completed the present invention.

[0007] That is, the present invention relates to SEQ ID NO: 1
15 to 47 consecutive nucleotides in the nucleotide sequence shown in
An HIV gene obtained by real-time detection PCR, which is an oligonucleotide having a base sequence consisting of bases (T may be U) and having a base sequence containing the 21st C of the base sequence shown in SEQ ID NO: 1 And a reverse-side primer used for the measurement of Also,
The present invention relates to an oligonucleotide having a base sequence consisting of 15 to 44 consecutive bases among the base sequence represented by SEQ ID NO: 3 in the sequence listing, a reporter fluorescent dye,
A quencher fluorescent dye is bound, and when the reporter fluorescent dye is bound to the same probe as the quencher fluorescent dye, its fluorescence intensity is suppressed by fluorescence resonance energy transfer. And a probe used for measuring an HIV gene by a real-time detection PCR method, the fluorescence intensity of which is not suppressed when not bound to the same probe as the quencher fluorescent dye. Furthermore, the present invention relates to a base sequence consisting of consecutive 15 to 50 bases (where T may be U) of the base sequence shown in SEQ ID NO: 5 in the sequence listing, wherein the base sequence shown in SEQ ID NO: 5 A forward primer that is an oligonucleotide having a base sequence containing at least one of the 14th G and 17th G of the sequence, the reverse primer of the present invention, and the probe of the present invention. Using the HIV gene to be measured in the test sample as a template, performing reverse transcription PCR, and measuring the fluorescence from the reaction solution in real time.
Provided is a method for measuring a gene.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The reverse-side primer and probe of the present invention can be detected with high sensitivity in consideration of minimizing the influence on the detection sensitivity due to nucleotide sequence polymorphism in an HIV gene having many mutations. It is set by trial and error as follows.

The reverse primer of the present invention is a nucleotide sequence consisting of 15 to 47 contiguous nucleotides (where T may be U) of the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing. 1. An oligonucleotide having a nucleotide sequence containing the 21st C of the nucleotide sequence shown in SEQ ID NO: 1, preferably 24 consecutive nucleotides among the eighth to 40th nucleotides in the nucleotide sequence shown in SEQ ID NO: 1.
It is an oligonucleotide having a sequence consisting of bases to 30 bases. Particularly preferred are those having a base sequence of 27 bases shown in SEQ ID NO: 2. The nucleotide sequence represented by SEQ ID NO: 2 corresponds to the 1474th nucleotide of the HIV1 genome (hereinafter referred to as “1
474 nt ”) to 1500 nt. The entire nucleotide sequence of the HIV1 genome is known, and is described in Adachi A. et al., J. Virol. 1992; 66: 3151-3154.

[0010] The probe of the present invention is a probe in which a reporter fluorescent dye and a quencher fluorescent dye described later are bound to an oligonucleotide. The oligonucleotide portion of the probe is an oligonucleotide having a base sequence consisting of 15 to 44 contiguous bases of the base sequence represented by SEQ ID NO: 3 in the sequence listing, and is preferably an oligonucleotide having a base sequence represented by SEQ ID NO: 3. It is an oligonucleotide having a sequence consisting of consecutive 25 to 31 bases among the fourth to 37th bases. Particularly preferred is an oligonucleotide having the base sequence shown in SEQ ID NO: 4 in the sequence listing. The nucleotide sequence represented by SEQ ID NO: 4 is from 1403 nt of the HIV1 genome.
It is equivalent to 1430nt.

When the reporter fluorescent dye is bound to the same probe as the quencher fluorescent dye, the fluorescence intensity of the reporter fluorescent dye is suppressed by fluorescence resonance energy transfer, and the same as the quencher fluorescent dye. When the probe is not bound to the probe, the fluorescence intensity is not suppressed. As the reporter fluorescent dye, a fluorescein-based fluorescent dye such as FAM (6-carboxy-fluorescein) is preferable, and as the quencher fluorescent dye, TAMRA (6-carboxy-fluorescein) is used.
Rhodamine-based fluorescent dyes such as tetramethyl-rhodamine) are preferred. These fluorescent dyes are known and can be used since they are contained in a commercially available kit for real-time detection PCR. The binding position of the reporter fluorescent dye and the quencher fluorescent dye is not particularly limited,
Usually, a reporter fluorescent dye is bound to one end (preferably the 5 'end) of the oligonucleotide portion of the probe, and a quencher fluorescent dye is bound to the other end. Incidentally, a method of binding a fluorescent dye to an oligonucleotide is known, for example, Nobl
e et al., (1984) Nuc. Acids Res. 12: 3387-3403 and I
yer et al., (1990) J. Am. Chem. Soc. 112: 1253-1254.
It is described in.

In the method of the present invention, the HIV to be measured in the test sample is prepared by using the forward primer, the reverse primer of the present invention, and the probe of the present invention.
Reverse transcription PCR (RT-PCR) is performed using the gene as a template, and the fluorescence from the reaction solution is measured in real time. The real-time detection PCR method itself is publicly known, and apparatuses and kits for the real-time detection PCR method are also commercially available. Therefore, the PCR can be performed using such commercially available apparatuses and kits.

The forward primer used in the method of the present invention has a nucleotide sequence consisting of 15 to 50 consecutive nucleotides in the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing.
(Where T may be U), which is an oligonucleotide having a base sequence containing at least one of the 14th G and 17th G of the base sequence shown in SEQ ID NO: 5, Preferably, it is an oligonucleotide having a sequence consisting of 27 to 33 consecutive bases from the eighth to 43rd bases of the base sequence shown in SEQ ID NO: 5. Particularly preferred are:
One having a base sequence of 30 bases shown in SEQ ID NO: 6 can be mentioned. The nucleotide sequence shown in SEQ ID NO: 6 corresponds to 1359 nt to 1388 nt of the HIV1 genome. The region of the HIV gene to which the oligonucleotide portion of the probe of the present invention hybridizes is close to and partially overlaps with the region to which the forward primer hybridizes, but when the reaction is actually performed, It is necessary to select a combination in which the regions where the forward primer and the probe hybridize do not overlap with each other.

The reaction is carried out using a solution containing test HIV RNA, the above-mentioned forward primer, reverse-side primer and the above-mentioned probe, heat-resistant DNA polymerase (which also has reverse transcriptase activity), dATP, dGTP, dCTP and dTTP. Prepare and perform. Using dUTP instead of dTTP and adding uracil-N-glycosylase (UNG) is preferable because contaminating DNA from the previous PCR product can be degraded. Specific conditions for the reaction are described in detail in the Examples below. In addition, as a test sample, HIV
May be included, for example, a body fluid such as serum. Preparation of HIV RNA can be performed in the same manner as in the case of conventional RT-PCR, and is also specifically described in Examples below.

In the reaction, first, cDNA is synthesized using HIV RNA as a template, and then DNA is amplified by PCR using this cDNA as a template. Amplified DNA
Contains a region complementary to the probe, so that the probe hybridizes to the single-stranded amplified DNA. In the state where the probe is completely hybridized, when the elongation using the single-stranded DNA to which the probe is hybridized as a template occurs, the probe is hydrolyzed from the 5 ′ terminal side by the exonuclease activity of DNA polymerase. As a result of this decomposition, the reporter fluorescent dye and the quencher fluorescent dye bound to the oligonucleotide portion of the probe are separated, and the fluorescence from the reporter fluorescent dye suppressed by the fluorescence resonance energy transfer caused by the quencher fluorescent dye is reduced. The fluorescence intensity increases. On the other hand, when HIV RNA is not present in the test sample, amplification of the DNA does not occur, so that the probe does not hybridize to the DNA and is therefore not hydrolyzed by the DNA polymerase. Therefore, the fluorescence from the reporter fluorescent dye remains suppressed by the quencher fluorescent dye, and the fluorescence intensity does not increase. Therefore, by measuring the fluorescence intensity, the R
It is possible to detect NA.

In the method of the present invention, the fluorescence intensity is measured in real time. That is, while measuring the fluorescence intensity, the PC
Perform the R reaction. The measured fluorescence intensity exceeds the detection limit after a certain number of cycles and increases rapidly. Then, as the amount of HIV RNA in the test sample increases, the fluorescence intensity rapidly increases with a smaller number of cycles. Therefore, by examining the number of cycles after which the rapid increase in the fluorescence intensity starts, the quantitative measurement of HIV RNA in the test sample can be performed. More specifically, for example, HC
By setting a threshold of 10 times the standard deviation of the fluorescence intensity of each cycle (for example, 3 to 15 cycles) in a negative control containing no VRNA as a threshold, and examining the number of cycles in which the fluorescence intensity exceeds this threshold, the test sample can be accurately detected HIV RNA in the sample can be quantitatively measured. That is, when the horizontal axis is the common logarithm of the number of HIV RNAs in the test sample and the vertical axis is the number of cycles when the threshold value is exceeded,
Since the measurement results are almost completely on a straight line, if a calibration curve is prepared, it is possible to quantitatively measure the amount of HIV RNA in the test sample by examining how many cycles the threshold value is exceeded. Therefore, according to the method of the present invention, the conventional R
As in T-PCR, there is no need to perform an operation to check the amplification by performing electrophoresis after PCR, which is very simple.

[0017]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below more specifically based on embodiments. However, the present invention is not limited to the following examples.

Example 1 1 Synthesis of Primer Having a base sequence consisting of 30 bases shown in SEQ ID NO: 6
A 30-mer oligo DNA was chemically synthesized and used as a forward primer. In addition, a 27-mer oligo DNA having a base sequence of 27 bases shown in SEQ ID NO: 2 was chemically synthesized and used as a reverse primer.

2 Preparation of Probe The probe has a base sequence consisting of 28 bases shown in SEQ ID NO: 4.
A 28-mer oligo DNA was chemically synthesized. 5 'of this oligo DNA
FAM was bound to the end and TAMRA was bound to the 3 'end by the method described in the above-mentioned literature, and used as a probe.

3 Preparation of Synthetic RNA A plasmid containing the gag region of the HIV gene was prepared, and using this as a template, RNA was synthesized using T7 polymerase, and 1.0 × 10
To prepare a 10-fold dilution series from ⁷ to 1.0 × 10 ⁰ copies / [mu] l.

4 Preparation of Reaction Solution The above primer, probe and Perkin Elmer TaqMan EZ
RT-PCR Core Reagentkit (trade name, manufactured by Perkin Elmer)
Was used to prepare a reaction solution shown in Table 1 below per one reaction tube.

[0022]

[Table 1]

5 Real-time detection PCR Perkin Elmer Microamp Optical Tube (trade name, Perkin
40 μl of the above reaction solution was added per one (Elmer), and 10 μl of the above synthetic RNA was added thereto. Cap (PerkinElmer Opt
CAP) and then ABI PRISM 7700 Sequence Detecti
The system was set on an On System (trade name, manufactured by Perkin Elmer) and reacted under the following conditions. The fluorescence intensity was measured at each cycle of PCR and data was collected.

[0024] This PCR cycle was repeated 53 times.

6 Results FIG. 1 shows the results of plotting the number of cycles on the horizontal axis and the change in fluorescence intensity on the vertical axis. In FIG. 1, the copy number of HIV RNA in the sample is shown near each line. For each test sample, no change is observed in the fluorescence intensity until after a certain number of cycles, but it can be seen that the fluorescence intensity sharply increases after a certain number of cycles. The number of cycles at which the rapid increase in the fluorescence intensity starts depends on the HI in the test sample.
It can be seen that the larger the V RNA copy number, the smaller the value. In the real-time PCR, 3 to 15 of the negative control performed on the sample containing no HIV RNA was used.
Using 10 times the standard deviation of the fluorescence intensity in the cycle as a threshold value, the number of cycles exceeding the threshold value (that is, the number of cycles when the fluorescence intensity starts to rapidly increase) was determined. RNA
FIG. 2 shows a plot in which the common logarithm of the copy number is plotted on the horizontal axis and the cycle number exceeding the threshold is plotted on the vertical axis. As shown in FIG. 2, there is a linear relationship between the common logarithm of the RNA copy number and the cycle number exceeding the threshold (correlation coefficient 0.9.
9), by measuring the above cycle number,
It was revealed that HIV RNA can be quantitatively measured.

Example 2 1 Preparation of test HIV RNA To 200 μl of each serum of AIDS patient, 300 μl of 1 solution (Protein denaturing solution) of 1 solution of SepaGene RV-R (trade name, reagent for nucleic acid extraction manufactured by Sanko Junyaku Co.), 2 solutions (Buffer solution) 300 μl was added and stirred, 600 μl of 3 solution (extractant) was added, and the mixture was stirred for 10 minutes and allowed to stand at −20 ° C. for 10 minutes. After centrifugation at 12000 × g for 15 minutes, an equal volume of isopropanol was added to the aqueous phase, the mixture was allowed to stand at 4 ° C. for 5 minutes, and then centrifuged at 12000 × g for 20 minutes. Then, wash twice with 1 ml of 75% ethanol,
The cells were dissolved in 20 µl of DTT-treated water containing RTT inhibitor and DEPC, and stored at -80 ° C until measurement.

2 Measurement by real-time detection PCR A reaction solution having the same composition as in Example 1 was prepared using the same probes and primers as in Example 1. Perkin Elmer Microamp
For each Optical Tube, 40 μl of this reaction solution was added, and 10 μl of the above-described RNA solution derived from the test serum was added thereto, and the reaction was carried out in the same manner as in Example 1, and the fluorescence was measured at each cycle. On the other hand, a commercial product utilizing the conventional RT-PCR method (Amplicor HIV Mo
nitor (trade name, manufactured by Roche)), the copy number of HIV RNA was measured for the same test sample. FIG. 3 shows the correlation between the measured values obtained by both methods. As shown in FIG. 3, the measurement results obtained by the method of the present invention correlated well with the results obtained by the conventional method, and it became clear that measurement could be performed with higher sensitivity.
According to the present invention, it has become possible to measure HIV with high sensitivity, accurately and simply.

Example 3 Real-time PCR was carried out in the same manner as in Example 1 using the primers and probes used in Example 1 and various combinations of primers and probes described in the literature. In this example, "Literature 1" means protein nucleic acid enzyme 41: 686-695, 1996, and "Patent 1"
Means the above-mentioned Japanese Translation of PCT International Publication No. 6-500021.

The base sequences of the primers and probes used are shown below.

Forward side primer 1 5 ′ AGTGGGGGGACATCAAGCAGC
CATGCAAAT 3 'forward primer 2 5' AGT T GG A GGACATCAAGCAGC
CATGCAAAT 3 '

Reverse side primer 15 ′ TGCTATGTCACTTCCCCTTGG
TTCTCT 3 'reverse primer 2 5' TGCTATGTCA G TTCCCCTTGG
TTCTCT 3 '

Probe 1 5 'TCAATGAGGAAGCTGCAGAATG
GGATAG 3 'probe 2 5' GAGACCA TCAATGAGGAAGCTGCAGAATG
GGAT 3 '

The forward primer 1 (SEQ ID NO: 6) is a primer described in Patent 1, and is also a primer used in the method of the present invention. The forward-side primer 2 is a primer described in Reference 1. The reverse side primer 1 is a primer of the present invention (SEQ ID NO: 2), and the reverse side primer 2 is a primer other than the present invention described in Reference 1 and Patent 1.
Probe 1 is the probe of the present invention (SEQ ID NO: 4),
The probe 2 is a probe described in Document 1 and Patent 1 and not included in the present invention.

To compare the sensitivity of the detection system with each primer and probe, real-time PCR was performed for each combination.
Was measured in the same manner as in Example 1.

Set 1 forward primer 1, reverse primer 1, probe 1 (combination of the present invention) set 2 forward primer 1, reverse primer 2, probe 1 set 3 forward primer 1, reverse primer 1, probe 2 Set 4 Forward primer 2, reverse primer 2, probe 2 (combination of literature 1) Set 5 Forward primer 1, reverse primer 2, probe 2 (combination of patent 1)

The results of measurement using 1 × 10 ⁸ to 1 × 10 ¹ copy of synthetic RNA are shown in Table 2 below. The values of sets 2, 3, 4, and 5 are quantitative values when the values according to set 1 are used as quantitative standard values.

[0037]

[Table 2] (For example, “E + 08” means “× 10 ⁸ ”)

As a result, 1 × 10 ¹ copies of HIV RNA could not be detected in all of the sets 2, 3, 4, and 5, and all the sets had a lower sensitivity than the set 1 in 1 × 10 ² copies or more. Was. Therefore, set 1 can detect HIV RNA with the highest sensitivity. Comparison between Set 1 and Set 2 shows the effect of the reverse primer of the present invention. Comparison between Set 1 and Set 3 shows the effect of the probe of the present invention. Also, a comparison between Set 1 and Set 4 or Set 5 reveals that the method of the present invention is more sensitive than the methods described in the literature and the patent publication.

[0039]

According to the present invention, there are provided reverse primers and probes used for measuring HIV with high sensitivity by real-time PCR, and a method for measuring HIV gene with high sensitivity by real-time PCR. According to the present invention, HIV can be detected with higher sensitivity and accuracy than before.
Since the gene can be measured, it is expected to greatly contribute to the diagnosis of AIDS and the like.

[0040]

[Sequence List] SEQUENCE LISTING <110> SRL, INC. <120> Realtime-detecting PCR for measuring HIV gene and primers and probe bes used therefor <130> 98580 <160> 9

<210> 1 <211> 47 <212> DNA <213> HIV <400> 1 tagtagttcc tgctatgtca cttccccttg gttctctcat ctggcct 47

<210> 2 <211> 27 <212> DNA <213> HIV <400> 2 tgctatgtca cttccccttg gttctct 27

<210> 3 <211> 44 <212> DNA <213> HIV <400> 3 agaccatcaa tgaggaagct gcagaatggg atagattgca tcca 44

<210> 4 <211> 28 <212> DNA <213> HIV <400> 4 tcaatgagga agctgcagaa tgggatag 28

<210> 5 <211> 50 <212> DNA <213> HIV <400> 5 tgctaaacac agtgggggga catcaagcag ccatgcaaat gttaaaagag 50

<210> 6 <211> 30 <212> DNA <213> HIV <400> 6 agtgggggga catcaagcag ccatgcaaat 30

<210> 7 <211> 30 <212> DNA <213> HIV <400> 7 agttggagga catcaagcag ccatgcaaat 30

<210> 8 <211> 27 <212> DNA <213> HIV <400> 8 tgctatgtca g ttccccttg gttctct 27

<210> 9 <211> 33 <212> DNA <213> HIV <400> 9 gagaccatca atgaggaagc tgcagaatgg gat 33

[Brief description of the drawings]

FIG. 1. HIV in various test samples by the method of the present invention.
FIG. 4 is a diagram showing the relationship between the number of PCR cycles and the change in fluorescence intensity when RNA was measured.

FIG. 2: Common logarithm of the copy number of HIV RNA for various test samples and HI in the test samples by the method of the present invention.
FIG. 9 is a diagram showing the relationship between the change in fluorescence intensity and the number of cycles in which the change in fluorescence intensity exceeds a threshold value when RNA of V was measured.

FIG. 3 is a diagram showing a correlation between HIV RNA copy numbers measured by the method of the present invention and a conventional RT-PCR method.

 ──────────────────────────────────────────────────続 き Continuing on the front page (72) Inventor Ryuji Kawaguchi 51 Komiyacho, Hachioji-shi, Tokyo F-term in SRL Hachioji Laboratory Co., Ltd. (Reference) 4B024 AA11 AA20 CA01 CA09 CA11 CA20 HA13 HA14 4B063 QA01 QA18 QA19 QQ03 QQ10 QQ52 QR08 QR12 QR42 QR56 QR62 QS25 QS34 QX02

Claims (7)

[Claims] 1. A nucleotide sequence consisting of 15 to 47 consecutive nucleotides (where T may be U) of the nucleotide sequence shown in SEQ ID NO: 1 of the sequence listing, wherein the nucleotide sequence is represented by SEQ ID NO: 1. Real-time detection PCR, which is an oligonucleotide having a nucleotide sequence containing the 21st C of
Reverse primer used for measurement of HIV gene by the method. 2. A continuous 24 of the eighth to forty bases of the base sequence shown in SEQ ID NO: 1 in the sequence listing.
The primer according to claim 1, which is an oligonucleotide having a sequence consisting of bases to 30 bases. 3. The primer according to claim 1, which is an oligonucleotide having the base sequence shown in SEQ ID NO: 2 in the sequence listing. 4. A reporter fluorescent dye and a quencher fluorescent dye are bound to an oligonucleotide having a continuous base sequence of 15 to 44 bases in the base sequence shown in SEQ ID NO: 3 in the sequence listing. The reporter fluorescent dye, when the reporter fluorescent dye is bound to the same probe as the quencher fluorescent dye, the fluorescence intensity is suppressed by fluorescence resonance energy transfer, the same probe as the quencher fluorescent dye A probe used for measurement of an HIV gene by a real-time detection PCR method, wherein the fluorescence intensity is not suppressed in a state not bound to the DNA. 5. The oligonucleotide according to claim 1, wherein the oligonucleotide has a sequence consisting of consecutive 25 to 31 bases from the fourth to 37th bases of the base sequence shown in SEQ ID NO: 3 in the sequence listing. Item 7. The probe according to Item 4. 6. The probe according to claim 5, wherein the oligonucleotide is an oligonucleotide having a base sequence shown in SEQ ID NO: 4 in the sequence listing. 7. A base sequence consisting of 15 to 50 consecutive bases of the base sequence shown in SEQ ID NO: 5 in the sequence listing.
(Where T may be U), which is an oligonucleotide having a base sequence containing at least one of the 14th G and 17th G of the base sequence shown in SEQ ID NO: 5. An HIV gene to be measured in a test sample, using the side primer, the reverse side primer according to any one of claims 1 to 3, and the probe according to any one of claims 4 to 6. Is used as a template to perform reverse transcription PCR, and the fluorescence from the reaction solution is measured in real time.
Method for measuring IV gene.