JP2000093180A - Protein participating in oxidation reaction of organic sulfur compound and gene coding for the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein participating in the oxidation reaction of organic sulfur compounds which contains a specific amino acid sequence, shows the function regulating the expression of benzothiophene oxidase group gene and is useful for the desulfurization from various petroleum products or the like and the purification of soil or waste water contaminated by organic sulfur compounds. SOLUTION: This protein is a new protein which is composed of the protein that contains the amino acid sequence represented by the formula and shows the function regulating the expression of benzothiophene oxidase group gene or the protein that contains the amino acid sequence modified by deleting, adding and/or substituting one or plural amino acids to the amino acid sequence represented by the formula and keeps the function regulating the expression of benzothiophene oxidase group gene and is useful in the desulfurization from crude oils in the field of petroleum purification or various petroleum products and the purification of soil or waste water contaminated by organic sulfur compounds. This protein is obtained by using genes of microorganisms belonging to the genus Pseudomonas, destroying the genes by ultraviolet ray irradiation or the like and separating the protein which has the function participating in benzothiophene oxidation activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a gene encoding a protein or an enzyme involved in the oxidation reaction of an organic sulfur compound. INDUSTRIAL APPLICABILITY The present invention relates to the fields of petroleum products and pharmaceuticals related to desulfurization of crude oil or various petroleum products in the field of petroleum refining, purification of soil or wastewater contaminated by organic sulfur compounds, and conversion of sulfur-containing compounds. Useful.

[0002]

2. Description of the Related Art Organic sulfur compounds contained in crude oil or various petroleum products cause serious environmental destruction such as pollution of air, soil and water, and it is desired to establish a solution in the petroleum refining industry and the like. ing. Regulations regarding the concentration of organic sulfur compounds in various petroleum products are expected to become more stringent in the future, and accordingly, the process of the oil refining stage needs to be reviewed. However,
In the case of more strict regulations, it is expected that the conventional technology for hydrodesulfurization of petroleum products using a chemical catalyst, which is already matured, will no longer be able to cope with the situation. Under these circumstances, in recent years, attention has been paid to the use of biodesulfurization technology using microorganisms as one of bioprocessing.

The great advantage of the biodesulfurization technology is that the reaction is carried out at normal temperature and normal pressure, so that the energy cost can be kept low and the safety of the process is high.
Since the conventional hydrodesulfurization method requires a process under high temperature and high pressure, there is a limit in cost and safety improvement. Furthermore, since the enzyme used as a biocatalyst in biodesulfurization is characterized by its high substrate specificity, the use of microorganisms having appropriate desulfurization catalytic activity makes it possible to use enzymes other than organic sulfur compounds in petroleum products subjected to desulfurization reactions. It is easy to minimize the adverse effects on the active ingredient.

[0004] Specifically, when a desulfurization reaction is carried out by a conventional hydrodesulfurization method, various aromatic ring compounds other than the organic sulfur compound which is the original target are also hydrogenated. There is a problem that the energy value is reduced. On the other hand, in biodesulfurization, it is easy to decompose only the target because of the high substrate specificity described above. Dibenzothiophene, benzothiophene, and their alkylated derivatives are known as hard-to-removable organic sulfur compounds abundantly contained in crude oil or various petroleum products, and these compounds are important targets for biodesulfurization. it is conceivable that. Many findings have been obtained on desulfurized bacteria of dibenzothiophene.

[0005] Isolation of various dibenzothiophene-degrading bacteria has been reported to date [Gallagher, JR et al.,
FEMS Microbiol. Lett. 107, 31-36 (1993); Izumi, Y.
et al., Appl.Environ.Microbiol . 60 , 223-226 (199
4); Laborde, ALet al., Appl. Environ. Microbiol.
34 , 783-790 (1977); Lee, MK, et al., Appl . Envi .
ron. Microbiol. 61 , 4362-4366 (1995); Malik, KA
Proc. Biochem. 13 , 10-12 (1978); Monticello, DJ e
t al., Appl.Environ.Microbiol . 49 , 756-760 (198
5); Omori T. et al., Appl. Environ. Microbiol. 58 ,
911-915 (1992); Sagardia, F. et al., Appl. Microbio
l.29 , 722-725 (1975); van Afferden, M. et al., Arc
h. Microbiol. 153, 324-328 (1990); Yamada, K. et a
l., Agric. Biol. Chem. 32, 840-845 (1968); and Koni
shi, J. et al., Appl. Envion. Microbiol. 63 , 3164-31
69 (1997)].

Among these, Rhodococcus sp. IGTS8 [Gallagher, JR et al.,
FEMS Microbiol. Lett. 107, 31-36 (1993)]; Corynebacterium sp. SY1
[Omori T. et al., Appl. Environ. Microbiol. 58 , 911
-915 (1992)]; Rhodococcus Supeshisu (Rhodococcus
sp.) D-1 [Izumi, Y. et al., Appl. Environ. Microbio
. l 60, 223-226 (1994) ]; (. Paenibacillus sp). and Penibashirusu-Supeshisu A11-2 [Konishi, J.etal, Ap
pl. Envion. Microbiol. 63, 3164-3169 (1997)], which specifically catalyzes a reaction that cleaves only the carbon-sulfur bond without breaking the carbon skeleton of dibenzothiophene. And has been shown to be suitable for use in the desulfurization process of dibenzothiophene from crude oil and various petroleum products.

[0007] Regarding the desulfurization reaction pathway of dibenzothiophene, Rhodococcus sp.
The most detailed analysis of IGTS8 has been performed, including purification of enzymes that catalyze the reaction and isolation of genes encoding them [Denome, SA et al., Appl.
Environ. Microbiol. 59 , 2837-2843 (1993); Denome,
SAet al., J. Bacteriol. 176 , 6707-6717 (1994);
Piddington, CSetal., Appl. Environ. Microbiol.
61, 468-475 (1995); Gray, KA et al., Nature Biot .
ech . 14 , 1705-1709 (1996); Oldfield, C. et al., Mic .
robiology143, 2961-2973 (1997)].

In the desulfurization reaction pathway of dibenzothiophene by IGTS8 strain, first, dibenzothiophene is oxidized to benzothiophene sulfone via benzothiophene sulfoxide by dszC (or soxC ) gene product, and then sulfone is converted to dszA (or soxA). ) The gene product is converted to 2- (2-hydroxybiphenyl) -benzenesulfinate (HPBS), and finally HPBS is converted to 2-hydroxybiphenyl by the dszB (or soxB ) gene product. The desulfurization reaction is completed. Also, dszA ( soxA ) and ds
The catalytic action of both zC ( soxC ) gene products requires reduced nicotinamide adenosine dinucleotide (NADH) -flavin mononucleotide (FMN) oxidoreductase, NADH, and reduced FMN (FMNH ₂ ).

On the other hand, as strains that metabolize benzothiophene, several types of Pseudomonas space ( Pseudo
monas sp.) oxidatively converts benzothiophene to benzothiophene sulfone [Fedorak, PMet a
l., Appl. Environ. Microbiol. 57, 932-940 (1991);
Kropp, KGet al., Environ. Sci. Technol. 28, 1348
-1356 (1994);... Kropp, KGet al, Appl Environ M
icrobiol. 60, 3624-3631 (1994)], Pseudomonas
Example in which Pseudomonas sp. WF505 and Bacillus sp. WF501 cooperate to desulfurize benzothiophene (JP-A-9-31007)
8) and Pseudomonas
sp.) Example of RE204 decomposing benzothiophene into various organic sulfur compounds [Eaton, RW et al., J. Bacteriol.
176 , 3992-4002 (1994)]. Among them, RE204 strain is considered to be unsuitable for use in the desulfurization process of benzothiophene from petroleum products because of its activity to decompose aromatic compounds widely.

On the other hand, the metabolic pathway of benzothiophene by strains WF501 and WF505 is currently the only known benzothiophene desulfurization reaction system, and its applicability to the biodesulfurization process of crude oil and various petroleum products is unknown. is important. In the desulfurization pathway of benzothiophene by these two strains, first, Pseudomonas space ( Pseudomonas
sp.) WF505 oxidizes benzothiophene to benzothiophene sulfide and then to benzothiophene sulfone, and the sulfone is further decomposed by Bacillus sp. WF501 to complete the desulfurization reaction. ing.

Benzothiophene has a very high solubility in water, whereas benzothiophene sulfone has a relatively high solubility in water. Therefore, in a two-phase oil-water system, benzothiophene is oxidized and converted to sulfone to transfer benzothiophene from the oil phase to the water phase with high efficiency, that is, to remove benzothiophene from the oil phase. (Japanese Patent Laid-Open No. 9-31007)
8). Therefore, when an oil-water two-phase reaction system is introduced into the desulfurization process of crude oil or petroleum products, the catalytic action of benzothiophene oxidation is considered to play a necessary and sufficient role in the biodesulfurization of benzothiophene. Can be As described above, despite the high importance of the use of benzothiophene oxidizing reactions for biodesulfurization of crude oil and various petroleum products, it is still a simple matter for genes of proteins or enzymes involved in benzothiophene oxidizing reactions. No reports on separation and analysis have been made.

[0012]

As described above, when a microbial catalyst is used in a biodesulfurization step of an organic sulfur compound such as benzothiophene or an alkylated derivative thereof contained in crude oil and various petroleum products, these organic compounds are used. It is important to analyze proteins or enzymes responsible for the activity of microorganisms that oxidize sulfur compounds. Accordingly, an object of the present invention is to provide a DNA fragment involved in the expression of benzothiophene oxidizing activity and a method for using the same.

[0013]

In order to solve the above-mentioned problems, the present invention provides (1) an amino acid sequence represented by SEQ ID NO: 19, which has a function of regulating the expression of a benzothiophene oxidase group gene. Protein or SEQ ID NO: 19
A protein having an amino acid sequence modified by deletion, addition and / or substitution of one or more amino acids in the amino acid sequence shown in (1) and maintaining a function of regulating the expression of a benzothiophene oxidase gene gene I do.

The present invention also relates to (2) a protein having the amino acid sequence of SEQ ID NO: 15 and having benzothiophene oxidizing activity, or a deletion of one or more amino acids in the amino acid sequence of SEQ ID NO: 15 , Addition and / or
Alternatively, there is provided a protein having an amino acid sequence modified by substitution and maintaining benzothiophene oxidizing activity. The present invention also relates to (3) a protein having the amino acid sequence shown in SEQ ID NO: 13 and controlling the activity of benzothiophene oxidase by carrying out the redox activity of a coenzyme, or the amino acid sequence shown in SEQ ID NO: 13 Has an amino acid sequence modified by deletion, addition and / or substitution of one or more amino acids and maintains the function of controlling the activity of benzothiophene oxidase by taking on the redox activity of a coenzyme Provides protein.

The present invention further provides (4) the above (1) to
A gene encoding the protein according to any one of (3) is provided. The present invention further provides (5) a vector comprising the gene according to (4). The present invention also provides (6) a host transformed with the vector of (5). The present invention further provides (7) a method for producing the protein according to any one of the above (1) to (3), wherein a gene encoding the protein is expressed in a host.

[0016]

BEST MODE FOR CARRYING OUT THE INVENTION The source of the gene in the present invention is not limited as long as it has an activity of oxidizing an organic sulfur compound such as benzothiophene, and is preferably a microorganism of the genus Pseudomonas. Pseudomonas Supeshisu (Pseudomonas sp as an example.
) WF505 strain (FERM P-15601). The isolation and properties of this strain are described in detail in JP-A-9-310078. In the present invention, a method for isolating a gene of a protein having a function involved in the expression of benzothiophene oxidizing activity from the above strain is specifically described in Example 1.

After isolating the gene, its nucleotide sequence is determined by a conventional method, the open reading frame is estimated, and the gene is involved in the expression of benzothiophene oxidizing activity by transposon mutagenesis or gene disruption experiments by ultraviolet irradiation. Functional proteins BtoR, BtoA and Bt
I found oB. These proteins BtoR, BtoA and BtoB at the amino acid level, D protein ThcR that control the expression of cytochrome P-450 gene of known proteins Rhodococcus Supeshisu (Rhodococcus sp.) (ThcB) , Trigonopsis variabilis (Trigonopsis variabilis) - amino acid oxidase, and kerato Arthrobacter Haintsui (Chelatobacter heintzii) nitrilotriacetate monooxygenase Component B (NmoB) and each
It was shown to have low homology of 29%, 18% and 19%. Therefore, it is understood that the above protein of the present invention is novel.

The invention provides, according to one aspect, SEQ ID NO:
A protein having the amino acid sequence shown in SEQ ID NO: 19 and having a function of regulating the expression of the benzothiophene oxidase gene group, a protein having the amino acid sequence shown in SEQ ID NO: 15 and having benzothiophene oxidizing activity, or being shown in SEQ ID NO: 13 The present invention relates to a protein having an amino acid sequence and controlling the activity of benzothiophene oxidase by carrying out the redox activity of a coenzyme. The above protein can be obtained, for example, as an expression product of a gene of Pseudomonas sp. Strain WF505.

In a protein, even if a region that does not constitute an active center in the amino acid sequence is modified by deletion or addition of one or more amino acids and / or substitution by another amino acid, the activity of the native protein is not changed. What is maintained is
It is well known to those skilled in the art. Therefore, the present invention provides a protein having the amino acid sequence shown in SEQ ID NO: 19 and having a function of regulating the expression of a benzothiophene oxidase group gene,
A protein having the amino acid sequence shown in SEQ ID NO: 15 and having benzothiophene oxidizing activity, a protein having the amino acid sequence shown in SEQ ID NO: 15 and controlling the activity of benzothiophene oxidase by carrying out the redox activity of a coenzyme Not only that, the amino acid sequence has an amino acid sequence modified by deletion or addition of one or more amino acid sequences and / or substitution by another amino acid,
In addition, the present invention also includes proteins having an amino acid sequence that maintains the functions relating to the expression of benzothiophene oxidizing activity. Genes encoding these modified proteins can be obtained, for example, by well-known methods for modifying specific sites in DNA, for example, PCR, site-directed mutagenesis, and the like.

When a DNA encoding an enzyme is isolated, a protein which is not completely identical to the nucleotide sequence of the isolated DNA, but which can hybridize thereto and has a similar protein function can be obtained. Encoding DNA is often obtained from nature. Therefore, the present invention is encoded by a DNA derived from a microorganism that hybridizes under stringent conditions with DNA of a coding region having the nucleotide sequence shown in SEQ ID NO: 18, 14 or 12, and is involved in the expression of benzothiophene oxidizing activity. And a protein having an amino acid sequence maintaining any of the above functions.

The origin of the DNA is as follows: Pseudomonas sp., Alcaligenes sp.
Spacis ( Alcaligenes sp.), Rhodococcus sp. ( Rhodococcus sp.), Bacillus sp. ( Bacillus sp.) And the like. As the above stringent conditions, specifically, for example, 2XSSC (20XSSC = 3
M NaCl, 0.3 M trisodium citrate)
After the reaction for 20 hours, washing with 2XSSC can be mentioned.

The present invention further includes a protein having a homology of 70% or more to the amino acid sequence shown in SEQ ID NO: 19, 15 or 12, and having a function relating to the expression of benzothiophene oxidizing activity. . The present invention also provides genes encoding the above various proteins, particularly DNA.
The present invention also provides a vector comprising the DNA as described above, particularly an expression vector. The present invention also provides a host cell transformed with the vector. Today, once a DNA encoding a specific amino acid sequence is obtained, it is easy for those skilled in the art to express the DNA in any host cell to obtain a peptide or protein having the amino acid sequence.

Examples of the host cell include microorganisms such as Escherichia coli and Pseudomonas sp.
), Alcaligenes Supeshisu (Alcaligenes sp.
), Bacillus sp., Rhodococcus sp., Yeast, and the like. The above-mentioned expression vector can be stably replicated in various hosts as described above, and can express and produce a target protein. These expression vectors have expression control sequences, for example, a promoter, which differs depending on the host.

[0024] For example, the promoters for bacterial hosts, T7 promoter, P _L promoter, Tac promoter, are well known and Lac promoter, etc., as the yeast cells for promoters, promoters of glycolytic enzyme genes, For example, AOX1 promoter, GAP promoter and the like are used. In producing the protein of the present invention, the transformed host cells are cultured in a medium selected according to the host cells, and if desired, the desired product may be collected from the culture. The protein can be collected according to a conventional method.

By using a part of the gene of the present invention in combination with another gene, for example, a benzothiophene sulfone-degrading gene, it is possible to more efficiently refractory benzothiophene and the like contained in crude oil or various petroleum products. Oxidative desulfurization process of organic sulfur compounds, and purification process of soil and wastewater contaminated by organic sulfur compounds such as benzothiophene.

[0026]

The protein encoded by the DNA fragment of the present invention is used in a process for oxidative desulfurization of a persistent organic sulfur compound contained in crude oil or various petroleum products, so that the protein in the crude oil or petroleum products can be effectively used. Substances causing environmental pollution can be effectively removed without affecting the components. Since the process is carried out at normal temperature and pressure, it is safer and cheaper than the conventional hydrodesulfurization process.

Further, the protein encoded by the DNA fragment of the present invention is allowed to act on soil or wastewater contaminated with a hardly decomposable and poorly water-soluble organic sulfur compound, thereby converting the contaminant to water-soluble. Removal can be facilitated. Further, the protein encoded by the DNA fragment of the present invention can be used for the oxidative conversion of sulfur-containing compounds in the fields of the chemical industry and the pharmaceutical industry.

[0028]

EXAMPLES The present invention will be described more specifically with reference to examples. Example 1 DNA fragmentation involved in benzothiophene oxidation reaction
Isolation of fragments (1) Benzothi strain WF505 by transposon mutagenesis
Tn, a transposon with a neomycin resistance gene isolated from a strain deficient in offensive activity.
E. coli SM10 strain (pSUP1011 / SM10) harboring the plasmid pSUP1011 for transposon mutagenesis constructed using
imon, R., Priefer, U., and Puhler, A. BIO / TECHNOLO
GY1, 784-790 (1983)] in an LB medium (1% bactotryptone, 0.5% bactoeast extract containing 100 μg / ml neomycin sulfate (Wako Pure Chemical Industries, Ltd.)
5 ml of 1% NaCl), and cultured in a test tube with shaking at 37 ° C. overnight.

The resulting culture was centrifuged (8,000 rpm,
5 minutes) to recover 5 ml of 0.85%
Wash with NaCl aqueous solution and centrifuge again (8,000 rpm, 5 minutes)
The cells were collected and resuspended in a 0.85% aqueous NaCl solution. 10 μl of the obtained pSUP / SM10 suspension was placed on a nitrocellulose disc filter (Millipore # #) on an LB agar medium (1% bactotryptone, 0.5% bactoeast extract, 1% NaCl, 1.5% bactoagager).
HAWP01300), 10 μl of culture solution of WF505 strain in LB medium (in a test tube at 30 ° C., shaking overnight).
After spotting, both strains were conjugated by incubating at 30 ° C. overnight.

The cells grown on the disc filter are 1 m
l of 0.85% NaCl aqueous solution.
g / ml of sodium ampicillin (Wako Pure Chemical Industries, Ltd.) and 100 μg / ml of neomycin sulfate in LB agar medium and incubated at 30 ° C. for 2 days.
A transconjugant of UP1011 / SM10 and WF505 was obtained. PSUP1011 / SM10 obtained by transposon mutagenesis and
With respect to transconjugant with WF505, a mutant strain lacking benzothiophene oxidizing activity was screened by the following procedure.

50 μg / ml of ampicillin sodium and
Pick up each single colony of transconjugant obtained on LB agar medium containing 100 μg / ml neomycin sulfate,
2 ml of LB medium containing 50 μg / ml sodium ampicillin and 100 μg / ml neomycin sulfate was inoculated into a polypropylene centrifuge tube (Iwaki Glass # 22327-015).
The cells were cultured overnight at 150 ° C. with shaking (150 rpm). Centrifugation (3,500r
The cells collected from the cells were suspended in 2 ml of FS1 medium (Table 1), and normal tetradecane containing 200 ppm of 1-benzothiophene (hereinafter referred to as benzothiophene) (Wako Pure Chemical Industries, Ltd.) in a centrifuge tube. (Hereinafter tetradecane) (Wako Pure Chemical Industries, Ltd.) 400 μl and shake at 30 ° C overnight (150 rpm)
did.

After the reaction, the concentration of benzothiophene in the tetradecane phase was determined by gas chromatography mass spectrometry (GC
-MS) (Hewlett Packard, gas chromatography
The benzothiophene oxidizing activity of each transconjugant was measured by quantification using a Model 5890, mass spectrometer Model5972). Benzothiophene sulfone, a benzothiophene oxide generated in this reaction, is obtained by removing the cells by centrifuging the aqueous phase after the reaction,
The pH was adjusted to 1.8 with concentrated hydrochloric acid, extracted with an equal volume of ethyl acetate, and detected and quantified by GC-MS. By the above procedure, transconjugant between pSUP1011 / SM10 and WF505
As a result of screening 1,000 clones, one strain lacking benzothiophene oxidation activity was obtained. T5
-9-1.

(2) Benzothiophene oxidizing activity-deficient strain T5
The genome of the benzothiophene oxidizing mutant obtained by transposon mutagenesis contains the plasmid pSUP1011
It is conceivable that the transposon Tn5 derived from the wild-type WF505 strain was inserted into the gene region responsible for benzothiophene oxidation activity. Therefore, by cloning and DNA sequencing of the Tn5 insertion region on the T5-9-1 genome and comparing it with the DNA sequence of the same region in the wild strain, the gene responsible for the target benzothiophene oxidation activity was identified. Thought you could. Therefore, first, T5-9
The DNA fragment of the Tn5 insertion region was cloned from the genome of strain -1.

The method of Marmur [Marmur, J. J. Mol. Biol.
3, 208-218 (1961)]
After partially digesting DNA with Sau3 AI (Takara Shuzo), 10-4
Fractionation by 0% sucrose density gradient centrifugation according to the difference in molecular weight [Sam
brook, J. et al., MolecularCloning: A Laboratory Ma
nual 2nd ed. Cold Spring Habor Laboratory Press (19
89)], and a Sau3 AI partially digested DNA fragment having a length of about 10 kb was recovered. About 300 ng of the obtained DNA fragment and 100 ng of pUC118 BamHI digested DNA (Takara Shuzo) treated with Escherichia coli alkaline phosphatase were ligated using DNA Ligation Kit Ver.2 (Takara Shuzo) (16 ° C., 30 minutes). .

Escherichia coli JM was prepared using the ligation reaction solution obtained.
After transforming competent cell strain 109 (Takara Shuzo), spread on an LB agar medium containing 100 μg / ml neomycin sulfate and 50 μg / ml sodium ampicillin, and heat at 37 ° C.
For overnight. Since the neomycin resistance gene has been inserted into the T5 insertion region of the T5-9-1 strain genome, a plasmid clone having a DNA fragment containing this region grows on the neomycin-containing plate.
Thus, plasmid DNA containing the transposon insertion region was obtained from several transformants grown on the same plate.
Was obtained (named pUC-BTOTn), which was analyzed using various restriction enzymes.
A restriction map around the transposon insertion site on the strain genome was created.

(3) Benzothiophene oxidation activity of WF505 strain
Isolation of DNA fragment responsible for sex and determination of nucleotide sequence The gene responsible for the benzothiophene oxidation activity of the WF505 strain has a region corresponding to the transposon insertion site of the T5-9-1 strain genome or its vicinity in the genome of the strain. Is expected to be present in the T5-9-1 strain near the transposon insertion site cut out by the restriction enzyme StuI about 1.5k
Using the DNA fragment of b as a probe, WF
DNA fragment responsible for benzothiophene oxidation activity was isolated and analyzed from 505 strains.

The method of Marmur [Marmur, J. J. Mol. Biol.
3, 208-218 (1961)]
DNA obtained by partially digesting DNA with EcoR I (Takara Shuzo)
DNA fragments were fractionated by molecular weight difference by 10-40% sucrose gradient centrifugation [Sambrook, J. et al., Molecular Clonin
g: A Laboratory Manual 2nd ed. Cold Spring HaborLa
boratory Press (1989)], and a partially digested EcoR I DNA fragment of about 20 kb was recovered.

A cosmid vector pLAFR1 [Friedman, AM et al., Gene 18 , 289-29] treated with about 300 ng of the obtained DNA fragment and E. coli alkaline phosphatase (Takara Shuzo).
6 (1982)] (ATCC # 37167) with 100 ng of EcoR I digested DNA
Ligation was performed using Ligation Kit Ver.2 (Takara Shuzo) (26 ° C, 10 minutes). Using 4 μl of this reaction solution, in vitro using Gigapack II Gold (Stratagene)
It performed ro packaging, using resulting phage as WF505 strain genomic library.

Approximately 2,000 clones of the WF505 strain phage library were infected to Escherichia coli VCS257 strain, spread on an LB agar medium containing 12.5 μg / ml tetracycline hydrochloride (Nacalai Tesque), and incubated at 37 ° C. overnight. The obtained colonies were transferred to a nylon membrane (Hybond-N, Amersh
am) and filter paper (3M) soaked in 0.5N NaOH-1.5M NaCl
(Manufactured by Whatman Co., Ltd.) with the colony attached to the plate facing up for 5 minutes for lysis and denaturation of DNA, followed by immersion in 1 M Tris-Hcl (pH 7.5) -1.5 M NaCl. Neutralized by placing on filter paper for 5 minutes.

Further, the membrane was washed with a 2XSSC (20XSSC = 3M NaCl, 0.3M trisodium citrate) solution, air-dried, and then subjected to UV irradiation to fix the library DNA to the membrane. About the membrane obtained in this way, T5-9-1
Hybridization was performed using a DNA fragment of about 1.5 kb cut out from the vicinity of the transposon insertion site by StuI (Takara Shuzo) as a probe, followed by washing, exposure of an X-ray film, and development. ECLrandom for labeling, hybridization, and detection of probes
prime labelling and detection system, version II
(Amersham) was used. As a result of screening about 2,000 clones, one positive clone was obtained. This plasmid was named pBTO1, and the following analysis was performed.

The alkali-SDS method [Birnboim, HC et al.,
PBTO1 purified by Nucleic Acids Res. 7, 1523]
EcoR I (Takara Shuzo Co., Ltd.) As a result of digestion by the insert DNA of pBTO1 is about 20 kb, about 7.7 kb, was found to consist of about 2.5 kb, and about EcoR IDNA fragment of a length of 1.0 kb. Of these, about 7.7 kb, about 2.5 kb, and about 1.0 kb
Was subcloned into the EcoR I site of pUC118 and introduced into E. coli strain JM109. The plasmid DNA of each subclone was purified by the alkaline-SDS method, digested with EcoR I, and electrophoresed on a 0.8% agarose gel.
7 kb, 2.5 kb and 1.0 kb DNA fragments
Collected using EASYTRAP Ver.2 (Takara Shuzo).

The nucleotide sequence of these DNAs was determined by the shotgun method using Sau3 AI [Sambrook, J. et al., Molecular Cloni
ng: A Laboratory Manual 2nd ed. Cold Spring Habor
Laboratory Press (1989)]. Dye primer cycle sequencing ki
t (PERKIN ELMER) and DNA sequencer
I PRISM 377 (PERKIN ELMER / Applied Biosystems)
Was used. About 7.7 kb, about 2.5 kb, and about 1.0 kb DNA
5'-GGCTGAACCTGATT
CTG-3 '(SEQ ID NO: 24) and 5'-CAGGTGCTTCACGCT
Base sequence analysis was performed using CG-3 ′ (SEQ ID NO: 25) (synthesized by Takara Shuzo) as a primer and pBTO1 plasmid DNA as a template.

Analysis of the obtained DNA base sequence was performed using GeneWork
s (IntelliGenetics), MACVECTOR 6.0 (Oxford M
olecular Group), and AssemblyLIGN (Oxford Molec)
ularGroup). As a result of these analyses,
One of the EcoR IDNA fragment of about 1.0 kb, about 7.7 kb, it was found that are arranged in the order of approximately 2.5 kb. The determined DNA base sequence of 11279 bp is shown in SEQ ID NO: 1. Also, this DNA
The open reading frame (ORF) present in the region is shown in FIG.

In FIG. 1, 1, 2, and 3 are the results of reading the base sequence of SEQ ID NO: 1 while shifting the base sequence by one base from the 5′-end to the 3′-end. 6 is the nucleotide sequence of SEQ ID NO: 1 from the 3′-end to 5′-
This is the result of reading while shifting one base at a time in the terminal direction.
As a result of comparing the DNA base sequence and amino acid sequence of these ORFs with a database (Genbank), Table 1 and SEQ ID NO:
It was found that 11 ORFs shown in 2 to 23 showed homology to the already sequenced genes. ORF6-7, ORF4-9
And ORF2-16 set the start codon to avoid overlap with adjacent ORFs (Table 1, FIG. 1).

[0045]

[Table 1]

(4) Benzothiophene oxidation activity of WF505 strain
Identification of genes involved in sex WF50 among proteins encoded in the DNA base sequence in the preceding section
In order to identify those responsible for the benzothiophene oxidation activity of the five strains, the transposon insertion site on the genome of the benzothiophene oxidation activity-deficient strain T5-9-1 obtained by transposon mutagenesis was examined by the following procedure .

Using the plasmid pUC-BTOTn in which the transposon insertion region of the genome of the T5-9-1 strain was cloned as a template, 5′-TTTGCCAATTGGGCGGCGAC-DNA was prepared based on the DNA base sequence near the end of the transposable element Tn5. 3 '(SEQ ID NO:
26) The DNA base sequence was determined in the same manner as described above, using a primer having a base sequence of 26 (requested by Takara Shuzo for synthesis). As a result, it was found that ORF2-16 was disrupted by the transposon in the genome of the T5-9-1 strain (FIG. 2).

On the other hand, as another approach, an attempt was made to isolate a mutant strain with respect to benzothiophene oxidation activity of WF505 strain by ultraviolet irradiation. After appropriately diluting the WF505 strain LB medium culture solution (OD ₆₀₀ is about 0.3), spread the culture solution on the LB agar medium, and irradiate with ultraviolet light (using a germicidal lamp GL15 manufactured by Toshiba) from a distance of 30 cm for various times. went. After UV irradiation, cells
After culturing at 30 ° C. for 3 days, the survival rate of the bacteria was examined. Based on this, the UV irradiation time was set from 24 to 28 seconds (survival rate 0.01
% To 0.1%). Screening of the mutant strain of WF505 strain for benzothiophene oxidation activity was performed in the following procedure.

Each colony grown on the LB agar medium after ultraviolet irradiation was inoculated into 2 ml of the LB medium, and cultured in a polypropylene centrifuge tube at 30 ° C. overnight with shaking (150 rpm). The cells collected by centrifugation (3,500 rpm, 10 minutes)
Suspend in 2 ml of FS1 medium (Table 1), and in a centrifuge tube, overlay 400 ml of tetradecane containing 200 ppm of benzothiophene,
Shake (150 rpm) overnight at 30 ° C. After the reaction, the benzothiophene concentration in the tetradecane phase was determined by gas chromatography mass spectrometry (GC-MS) (Hewlwtt Packard, gas chromatography Model 5890, mass spectrometer Model 5972).
The benzothiophene oxidation activity of jugant was measured.

As a result of screening about 800 clones, one strain with reduced benzothiophene oxidation activity was obtained, and this strain was named UV3-42-7. The benzothiophene oxidation activity of UV3-42-7 was reduced to about 50% of that of the wild-type strain after 24 hours of reaction in the above-mentioned activity measurement system. This decrease in activity is thought to be due to the introduction of mutations in the DNA near the region where the gene was disrupted by the transposon on the T5-9-1 genome described above. Were examined for mutation sites on the genome.

The method of Marmur [Marmur, J. J. Mol. Biol.
3, 208-218 (1961)]. The DNA fragment obtained by partially digesting the high molecular weight DNA of the WF505 strain purified by Sau3 AI (Takara Shuzo) was subjected to 10-40% sucrose density gradient centrifugation. Fractionation [Sambrook, J. et al., Molecular Cloni
ng: A Laboratory Manual 2nd ed. Cold Spring Habor
Laboratory Press (1989)], and a partially digested Sau3 AI DNA fragment of about 20 kb was recovered.

A cosmid vector pLAFR1 [Friedman, AM, Long, SR, Brown, cosmid vector] treated with about 300 ng of the obtained DNA fragment and Escherichia coli alkaline phosphatase (Takara Shuzo) was used.
SE, Buikema, J., and Ausubel, FM Gene18 , 289-
296 (1982)] (ATCC # 37167 ) Bam HI (Takara Shuzo) digested DNA100
ng was ligated using DNA Ligation Kit Ver.2 (Takara Shuzo) (26 ° C., 10 minutes). 4 μl of this reaction solution
Using Gigapack II Gold (Stratagene)
After performing in vitro packaging, the obtained phage is
It was used as a 505 strain gene library.

Escherichia coli VCS257 strain was infected with about 1,000 clones of the WF505 strain phage library, spread on an LB agar medium containing 12.5 μg / ml tetracycline hydrochloride, and incubated at 37 ° C. overnight. The obtained colonies were transferred to a nylon membrane (Hybond-N, Amersham), and 0.5NN
Lysis and denaturation of DNA were performed on filter paper (3MM, Whatman) soaked in aOH-1.5M NaCl for 5 minutes with the colony attached face up, followed by 1M Tris-Hcl
(PH 7.5)-Neutralized by placing on the same filter paper soaked in -1.5 M NaCl for 5 minutes. Further, wash the membrane with 2XSSC (20XSSC = 3M NaCl, 0.3M trisodium citrate) solution, air-dry,
UV irradiation was performed to fix the library DNA to the membrane.

With respect to the membrane thus obtained, pB
After hybridization using about 2.5 kb EcoR IDNA fragment TO1 the probe, washed, exposed and developed X-ray film. ECL random prime lab for probe labeling, hybridization and detection
elling and detection system, version II (Amersham
Was used. As a result of screening about 1,400 clones, two positive clones were obtained (named pBTOM1 and pBTOM5). Of these, alkali-SDS method
[Birnboim, HC and Doly, J. Nucleic Acids Res. 7,
1523] using the pBTOM1 plasmid purified as a template and the following primers (requesting synthesis from Takara Shuzo Co., Ltd.) and a portion corresponding to positions 4070 to 8650 of the DNA sequence determined in the wild-type WF505 strain by the same method as described above. Was determined.

The primer used was 5'-CGTAGCCTTCTTCC
GCG-3 '(SEQ ID NO: 27), 5'-TCAACCTGCTCGCGCTC-
3 '(SEQ ID NO: 28), 5'-CTGCCCTTCATGCAGAC-3'
(SEQ ID NO: 29), 5'-GCAAGTCCTTGTCGCTC-3 '(SEQ ID NO: 30), 5'-GCGAGCGCTCGAGGTGC-3' (SEQ ID NO: 31), 5'-AGCGGCTGCGCAATCCG-3 '(SEQ ID NO:
32), 5'-TCGACCTCGGCGCCGTA-3 '(SEQ ID NO: 3)
3), 5'-GTCGACCATGCCTTCGCACGGCTGG-3 '(SEQ ID NO: 34), 5'-CTCGGCTGGTCGCACCGCCTCGACG-3' (SEQ ID NO: 35), 5'-CCCGCGCTGACCGTGACGGGACCGT-3 '
(SEQ ID NO: 36), 5'-GCCGATGCCTACCTGCGCGCCATCC-
3 '(SEQ ID NO: 37), 5'-GAGTCGCTGCGCTGCGAACCCAA
CG-3 '(SEQ ID NO: 38), 5'-CGCGCTCGCGGTGTTCGACT
GCGTG-3 '(SEQ ID NO: 39), 5'-CCGGCATCGTGCTGGCG
CAGGAGAT-3 '(SEQ ID NO: 40), 5'-CGTCTGCGTGGGCT
ACTACGGCGTG-3 '(SEQ ID NO: 41), 5'-CTGATGGCGCA
CGAGCGCAGCGTGG-3 '(SEQ ID NO: 42), 5'-GCTGGTGC
AGCTCACGCGCAACATG-3 '(SEQ ID NO: 43), 5'-GTGGC
GATGACGGCATAGCGCGACA-3 '(SEQ ID NO: 44), 5'-TG
CCGATCTTCACGATCAGATGCGG-3 '(SEQ ID NO: 45), 5
'-GCATCGGGCAGGTGCGCCTCGATGT-3' (SEQ ID NO: 46)
It is.

As a result of the DNA base sequence determination, UV3-42-7
Was the only mutation within the analyzed range where a mutation occurred at the C at position 8621 of the wild strain and changed to T. As a result, 11 of ORF2-16
The seventh amino acid was changed from proline to serine, which was interpreted as a decrease in the function of the protein encoded by ORF2-16 and a decrease in benzothiophene oxidation activity. ORF2-16 encodes a protein with a molecular weight of 36.6 kDa consisting of an estimated 332 amino acids.

[0057] As a result of the database search, the amino acid sequence of the protein, Rhodococcus Supeshisu (Rhodococcus
sp.), a protein that regulates the expression of the cytochrome P-450 gene (thcB) [ThgyR [Nagy, I., Schoofs, G., Compernoll
e, F., Proost, P., Vanderleyden, J., and de Mot,
R. J. Bacteriol. 177, 676-687 (1995)] and the protein XylS [Cases, which regulates the expression of the toluene and meta / para-xylene degrading enzyme genes (xyl genes) in Pseudomonas putida . I., de Lorenzo,
V., and Perez-Marti, J. Mol . Microbiol . 19, 7-17 (19
96)] and 29% and 19% homology, respectively. From this, the protein encoded by ORF2-16 is
It was strongly suggested that, as with ThcR and XylS, it plays a role in regulating the expression of neighboring genes (benzothiophene oxidation gene in the case of ORF2-16). So ORF2-16
It was named btoR gene.

Of the ORFs present near the btoR gene, those having a length sufficient to encode an enzyme protein include ORF2-18, ORF3-12, ORF5-5, ORF4-9, ORF6-7 and ORF6-7.
F6-6 and ORF6-5 were mentioned. Of these, ORF4-9
Since only the protein encoded by the ORF does not show high homology at least in part with known proteins, the following experiment was conducted by focusing on this ORF.

2059 bp containing ORF4-9 and ORF6-7 (DNA
Nucleotide sequence 5335-7394) ApaI DNA fragment is used as a broad host range vector
PMMB34 HpaI site subcloned vector DNA (pMMB
-Apa20) to transform the WF505 strain by electroporation, pick up four single colonies of the transformant obtained on LB agar medium containing 100 μg / ml neomycin sulfate, and transfer 2 ml of the medium was inoculated and cultured in a polypropylene centrifuge tube at 30 ° C. overnight with shaking (150 rpm). The cells collected by centrifugation (3,500 rpm, 10 minutes)
The suspension was suspended in 2 ml of FS1 medium (Table 1), and 800 μl of tetradecane containing 200 ppm of benzothiophene was overlaid in a centrifuge tube and shaken at 30 ° C. (150 rpm).

[0060]

[Table 2]

During the period from the start of the reaction to 10 hours, the concentration of benzothiophene in the tetradecane phase was measured by gas chromatography mass spectrum (GC-MS) (Hewlett Packard, Inc.).
The benzothiophene oxidizing activity of the transformant was examined by quantification using gas chromatography Model 5890, mass spectrometer Model 5972). At this time, the WF505 strain to which no cells were added and transformed with pMMB34 was used as a control. As a result, it was shown that the introduction of pMMB-ApaI enhances the benzothiophene oxidizing activity of the WF505 strain (FIG. 3), and the DNA fragment containing only ORF4-9 and ORF6-7 has the benzothiophene oxidizing activity. The information turned out to be coded.

The protein encoded by ORF4-9 is known as Trigonopsis variabilis ( Trigonopsis varis).
riabilis ) D-amino acid oxidase and amino acid sequence
It shows high homology only at the N-terminal 30 residue [Ganzalez,
FJ et al., Yeast 13 , 1399-1408 (1997)], which has only about 18% homology at the entire sequence level, and is therefore novel (Table 1, FIG. 4). On the other hand, the protein encoded by ORF6-7 shows high homology with a part of the component B gene (nmoB) product of the nitrilotriacetate monooxygenase of Chelatobacter heintzii (Xu, Y. et al.,
J. Bacteriol. 179 , 1112-1116 (1997)] (Table 2, FIG. 5).

NmoB is NADH: flavin mononucleotide (F
MN) has been shown to act as an oxidoreductase and assist in expressing the nitrilotriacetate oxidizing activity of the nmoA gene product. From the above facts, ORF4-9
It was concluded that the protein encoded by is a benzothiophene oxidase of interest and the expression of that gene is regulated by the btoR gene product. ORF4-
The gene corresponding to 9 was named btoA. Also, the protein encoded by ORF6-7 has a coenzyme redox activity,
It was suggested that the gene product, benzothiophene oxidase, might help. The gene corresponding to ORF6-7 was named btoB.

[0064]

[Sequence list] SEQUENCE LISTING <110> Tonen Corporation <120> Protein participating in oxidation of sulfur-containing organic compounds and genes encoding the same <160> <210> 1 <211> 11276 <212> DNA <213> Pseudomonas sp . WF505 <221> Exon <222> <221> Intron <222> <400> 1 gaattcgcgc ttgtggccgc cctcgacctt gccgccgagc tggtgcgcca tggtctgcat 60 gccgtaccag atgccgagca cgggaatgcc gaggtcgaac acggcctgcg ggcacttgtc 120 ggtggtctcc tcgtacacgc tggcatggct gcccgagagg atcacgccct tgagatggcc 180 gtcggccgcg tactcgcgca cccattcgtc gctgacgtcg cagggatgca cttcgctgag 240 cacatgggcc tcgcgcacgc ggcgcgcgat gagctgggtg acctgcgagc cgaaatcgag 300 gatgaggatc ttgtcgtgtt gcatgggcgg ggactcagag cgttgaaatg tcgaacagcc 360 ggacgcccgc ttgcggcgcg gcctggatga gttgctcgtc gaaggtggcg agcggaagac 420 cgagcgagcg cgcgagccag aggtagcccg cggcatagag cgacacgccg gcatcgatgg 4 80 cgacggcgag cacggccttg tgctgggccg gcgcgagctc gtgcagctcg acgcgatggc 540 ggatggcatc gagcacgctc cacaggccct cgacggccga cgagggaatg cggccgctgc 600 gcacgccgtt ggcgatgacg ttggcgcact cccactgcca ggcattgggc gcctgcggct 660 cgacctcgtc gcggcggatg gcggcgtaga gcctgcgcgt gtgttcgttg gcgtggtcgg 720 gcagcagcca ggcggcggtg accgaggcat ccatcacgaa ggcggtcatg gctggcggcc 780 ctggttcagc agcgcgcggg ccgaggtgcc cggaaggatg gctgcatgca gcgcgtcgat 840 ctggcccagt tcgcgcgcga tctgctcgtc ggtgatgacc ggcttgcgcc gcaccggcag 900 catgcgcacc acctccttgc cgtggcgggt gatgcgcacc tcctcgccct tctcgaccga 960 gtcgatcagg gccgagaagt tgttcttggc ttcagcgatg ccgatggatt gcattggggc 1020 cagaaaattt gaatctggcc cgaattctaa acctgatctg gcccgacttt caaggtctgg 1080 ccagaatcag gttcagccac cgcgttactc ggcgcggtag ttcggcgctt ccttcgtgat 1140 ctgcacgtcg tggacgtggc tctcgcggat gccggcggtg gtgatctcga cgaactcggc 1200 cttgttcttc atctcttcga tggtgccgca gccgcagtag cccatgctgg cgcgaacgcc 1260 gccggccatc tggtagatga tcgagacgat cgagcccttg tagggcacgc ggccctcgat 1320 gccctcgggcacgagcttgt cggtgttggg attgccggtg gtcgattcct ggaagtaccg 1380 gtcggcactg ccctgctgca tcgcgccgat ggagcccatg ccgcggtagc tcttgtagct 1440 gcggccctgg tacagcacga tctcgccggg cgcctcttcg gtgccggcga acatgctgcc 1500 catcatcacg gtgctggcgc cggccgcgat ggccttggcg atgtcgcccg agtagcgcac 1560 gccgccgtcg gagatcagcg gcacgccgct gccgtgcagc gcggtggcga cgctgtcgac 1620 cgccatgatc tgcggcacgc ccacgccggc cacgatgcgg gtggtgcaga tggagcccgg 1680 gccgatgccg accttgaccg cgtcggcacc ggcctcggcc agcgcgcgcg cggcgtcgcc 1740 ggtggcgatg ttgccgccga tcacgtcgat ctgcggatag ttctgcttga cccagcgcac 1800 gcgctcgatc acgcccttgc tgtggccgtg cgccgtgtcg accacgatgg catcgacgcc 1860 ggccttgacc agtgcctcga cgcgctcctc ggtgccctcg cccacgccga ccgccgcgcc 1920 cacgcgcagg cggcccgagg catcgcgcgc ggcgttgggg aaggtggtct gcttggtgat 1980 gtccttgacg gtgatcaggc ccttgagctc ccagtcgctg ttgatcacga gcaggcgttc 2040 gagcttgtgc ttgttgagca gcgccttggc ctcggccagc gtggtgccgt cgggcacggt 2100 gatcagccgg tcgcgctgcg tcatgatctc gctcacgggc acgtcgtagc ggttctcgaa 2160 gcgcaggtcg cgcccg gtca cgatgccgac cacccggccg gcgtcgacca ccgggaagcc 2220 cgagatgccg agctggtccg acagcgccat cacctgccgc accgagtgcg tgggcgtgat 2280 caccaccgga tcgcgcagca cgcccgattc gtagcgcttg accttggcca cttcggcggc 2340 ctgctgctgc gcggtgaggt tcttgtgcac gatcccgatg ccgccttcct gcgcgatggc 2400 gatcgcgagg cgggcttcgg tcacggtgtc catcgccgcc gagacgagcg ggatgttcag 2460 cgtgatgttt cgggagaatt tggtggcgag ggaggtgtcc ttgggcagga cctgggagaa 2520 cgctggcacc agcaacacat cgtcgaaggt gagcgctttg ccgagaaggc gcatgggtga 2580 ggctccaaaa gacggattgt aacgaggccg cggggtatgc tgccgggctc accgcggctc 2640 ggccccgcgc ggtgcgggcc tatcgcccgc cccgttgcct cccgcgtcgc catttgccca 2700 ctgcccggcc tccggaccgc ggcgaaaacc aatcactgcc tgttgcaaaa cgtaaggcat 2760 cgctagactt gcgccccatg aagttcctgc tcagcctcct gctcggatcg atctgcctgc 2820 tgcccctggc cgcggacgcc caatggcaat ggatcgacaa gaacggcaag aaggtcttca 2880 gcgaccagcc gccgccgacc gacattcccg agaagaacat cgtgcgtcgc gccggcccgc 2940 cggcgcgcac cggctcgggc gtggcggcgc ccgagggcac ggccaccacc gacaagggcg 3000 ccgaggcacc gcctgcgcca g ccgcgccga aggcgccgac ggtcgacaag gacctcgagg 3060 aaaagacaaa gaaggccgag gccgacgaga aggccaagca ggcggccgag gccgcgaagc 3120 tcgccaaggc caaggccgag aactgcagcc gcgctcgcga gagcaaggcc accatggaca 3180 gcggcatgcg catcgcgcgc gtcaacgcca agggcgagcg cgagatcctc gacgacaacc 3240 agcgcgtggc cgagcagcgc cggctgcagt cggtgatcga cagcgactgc aagtaagccg 3300 cgccgagggg ctcagtaccc cgccttgccg cccttgcgcc ggttcgcgaa cagcccggtg 3360 ccgcgcgcgc cctgctgctg gaagcgctcg cgccgcgcca ccttcgggtc gacctcgagc 3420 gcgcggcaca gctcgacgcg gtcgccgtct tcgagcgcat cgtcccaatc ggcggtccgg 3480 ccccagatgc cgggcgtcat cgtctcgcgc caatcgagcg cgggaaagcg ctgcatcagc 3540 gtgctggcgc ggatcgcatc gttcacggtg gcgcccgcgg ccaggcgcag cggctcctcg 3600 aacacctcgc gcggtgccgg cgagcagctc agggtcacct cgatcatcgg tgcttcaagg 3660 cgcgccgtag acctgctcgg cgcgcttgac gaaggcctcg accaggctcg aggcgatggt 3720 gtcgaacacc ggccccacga gggcctgcag cgcgaagttg ctgaagccgt agctcaggtg 3780 cagctcgacg cggcaggcgc gctcgccgcc ctcgcccacc ggcacgaatt tccagtggcc 3840 gtcgagattg gagaacggcc cgtcgac cag cttgagctgc acctcgcggc cgggcacatg 3900 ggtgttgcgc gtggtgaagc tctggtgcag gcccgcgaag gccaggccga cctcggcggt 3960 catgccggcc tcgtcctgct cgatgacgcg cgccttgtcg caccagggca ggaactgggg 4020 gtacttcgcc acatcggtga ccagcgcgta catctcttcg gcgctgtacc agatgagaac 4080 ggacttgttg actgttttca ttgaatcgga tcgagagacc gattcattgt agggagcctc 4140 cgtggctccc tcctctcgcg ggacgggagc ccgctctcta gtccagccct ctcagcccga 4200 acgcgaccag gccgccatca gcgtgttcga gggctgcgtc tcgtcgagca gcttgcgtgc 4260 ggtttcgacg ccggccaccg gcaggccctt cggatcgagc agccccacct gcaccagcac 4320 gctggcctgg tcccagtaga tgtgctcgtg gtagagcttg tcgccgcgga acttcacgat 4380 cgccaccagc ggaatctcca ccggcctgcc cgtgggcgcc acgccgggca gcagccagtc 4440 gatctcgcag gtatgggtga agctgaacag gatctcgtcg acgatctgcg tcgcgcccac 4500 ggtgcgcgag atcggcacga gccgcgtgtc gggcggattg ctgttcacga aatggtgctg 4560 gtagaagcgg ctcagcatcg cgtgccccac gccgccggtc atggtcggga tgtggttgac 4620 gtagggctcg gccaccatgg tggccatggt gtcggccacg ttgcgggtcg cgaactcgta 4680 ctcgcagtgc ttgtcccaca gcgccgagaa gt cgtaatgc ggacccatct cgcggcggaa 4740 cgcggccacg ctgcgctcgt gcgccatcag cgccgaaggc ttgtggtagt ggtcgccgcc 4800 cagccgtgcg aaggcatggt cgacgcccgg atagacatag agctcgcacc cgggccgcgc 4860 accgagcgtc tcgacgatgc gcgagcgcgc ctcgggcggg cagaagccgt cgagctcggg 4920 gatgtgcagc accagccggc cctggatgcg gtcggcctcc tcgagccgct gctcgatgcc 4980 cacgccgtag tagcccacgc agacgtcggc gtcggtgcgg caggccgcga ggtaggcgag 5040 tttgccgccc atgcagaagc ccagcacgcc ggccttgccc tgctgctcgg gcagcgagcg 5100 cagcagcgcc agcgaagcag ccaggtcctc ggtgcccttg tcctcgtcga agcctttgta 5160 gagcgcgaag gccttctgcc agtcgtcggg cgcatagccg agctcgacct cgggctgctg 5220 gcgccagaac agatcgggcg cgagcaccac gtagccttct tccgcgtagt agtcggccac 5280 ctgccgcatg gtggcgttga cgccgaagat ctcctgcgcc agcacgatgc cggggccctt 5340 gcccgaggcc ggggtggcga ggtaggcgcg gaagctgcca ctgccgtcga tggccggcac 5400 ctgcagccag cggcccttct gagctgtcat gtctttctcc ttgttccgaa tctctgagtc 5460 gtggggtggt acggccggcg ctcaggccgg cacgcactcg tcgcgcaggg tggtgaactg 5520 gccgcaggca tagagcagcg gcaggccctg cgcgtcgg tg atgcgcgcgg ccttgacctc 5580 gccgatcagc atcgcgtggc tgtgcgccac catcatctcg tcgaccacgc agtcgaacac 5640 cgcgagcgcg ccgcgcagca cgggcgcgcc ggtcaccagc gtctcccagt gcgcgggatc 5700 gaagcgctcg ccggcctcgc cctggcgcga gaaggccagc gccagcgccg actggtcgag 5760 cgcgagcagg ttgaccgcca tgcggcggct ctgcgcgatg gtgcggaagc tgctgccctg 5820 caggttgacg caggccagga tgcgcgcggg ctcggccgag aacgaggtca cggccgtggc 5880 cgtgagtccc acgggcgtct gcccgtcggt gctcgtgacc acggtcacgg cgccgaccag 5940 gcagcgcatg gcgcgccgga agtcgcccgc gcccacgttg ggttcgcagc gcagcgactc 6000 gatggcccgg aactcgccgc gcatggtcag gccgcctccg gttgcggcgc cagcgagcgc 6060 aggtaggcgc tgctcgcgtc gggcgtcatg aagaactcgg cgtagtcgcg cggatcgttg 6120 aagccgttga cgaagcgccg tgccacggcc gcgttgccct gggccgcgcc cagcacctcg 6180 agcacgtgcg ggggcggcgg ctgcaacatc gcgttggtcc attcgacgac gtggcgcgca 6240 tagcgccaat agccgtcgaa ggccgactgc atgaagtccg cgtcgaaggc gtcctcgccc 6300 tgcgcgagga tggcgcgcag gtaggcatcg gcgcacttgg cggcgttgtt cgagccctgg 6360 ccggtgatcg ggtcgttgag gcacaccacg tcgcccatgc cga gcacggc gcggcccgag 6420 ggcagccgcc cgaccggctt gcgcaccgtg ggcgcgaagc ggccggccag aatgccgttg 6480 tcgtcggtca ggcgcacgtc gcggcagcgc tcggcctccc agggcgtgaa ggtgtcgagg 6540 atcgacagcg agcgctcgag gtgctgcgcg ggcgtcttca cgtcggccca gcagtccatc 6600 gggccgccgg gcacgccctc gaacaccatg atctcgcacg gtcccgtcac ggtcagcgcg 6660 gggaacacga agtactcgcc gacgccgggg atcaggttga agttgacggc cgagtactcg 6720 gggcgcggcg tcatgccgtg cacgtaggtc agggccagcg cgcgctgcgg cttgtcgtag 6780 ggcgagcgtt gcgcgtcacg ttcgaacatc tgcgcgatct cgcccttgcc ggcggccacg 6840 atcaccaggt cgtgcgactg ggtccagcgc tcgaggtcct cgatgcccgc gtcctggaac 6900 aggatctgcc cgccgcgctc ctcgaaggtc ttcatccagg ccggcacctt cacgcgctgg 6960 tcgaccgagc gcgcgggcgc gtcgaggcgg tgcgaccagc cgagcagctt ctcgccgggc 7020 ttctcgggat gcggcacggc gaagccgatg ccctcgaccg gcgggcaggc gtcggcccac 7080 tggtcgatgc cgaggtcgcg ctcgatccgc aggctggcgt cgaacatgca ctggctcgac 7140 atcacgcggc cggttgcgat gtcctcggcg ctgcggttcg agaccacggt cacctcgtgg 7200 ccctcgcgct ggaggcccag cgccagttgc aggcccgact ggcccgcgc c gacgatcatg 7260 aaacggcgcg gcttggcgcc ctgcgatgcg atgttgctca tgggtatgcc tcgttcgtgg 7320 gtgggatgaa gaaagggtgc gccggccgcc ttcaggccgc gagcttggga atggccggct 7380 cgccctgctc cgggcccagg gccgaatagc cgccgtccac ggcccagtcg gcgccggtga 7440 cgaacgaggc cttgtgcgag cacaggaagg ccaccacgtg gccgacctcg accgggtcgc 7500 cgacgcggcc gagcatgtgg aagggccggg ccaccgcgtc ggtcttggcg cggttgccgc 7560 cggtgagctg gtccatcacg gccgaccagg tccagcccgg cgagacggaa ttgacgcgca 7620 cgttcatcgc cgccaggtcc agcgccatgt tgcgcgtgag ctgcaccagc gcggccttgc 7680 tcaccggata gagccagcgg ccggtctggg ccacgcccga ggagatcgag gtgaagttga 7740 cgatggcgcc gccgcccgcg gtctgcatga agggcagcgt ggcacgcgcc atcatcacgg 7800 ccgagaccac gttgacgtcg agcgcggtct gccattcgcc gcgcggcgag gccaggccgt 7860 tgtcgaggta gctgcaggcc aggttcacga gcgcgtggat gcggccctcg gcatcggccg 7920 cctgctcgac gcaggcctgc acggcggcgt cgtcggtgat gtcggtggcg atgaatttcg 7980 caccgatctc gcgcgccacc gcctcgccgc gcgccacgtc gatgtcggcc agcaccacgc 8040 gtgcaccggc atcgcgcagg caacgggcca cgcccgcacc gatgagggtc gcgc caccgg 8100 tgacgagcac cgtcctgtcc tgcaagtcct tgtcgctcat gccttttctc ctggttggtc 8160 ccgttgtcaa ttgcttgcag ttactttaga tttgaaggat tcagacccca atccggattg 8220 cgcagccgct gtccgcaaaa cgcatttatt cgctgccccc acgccgcccc gcatggaaca 8280 cgctgtcgct gcatcggcct cgcttcccct gtcgcgctat gccgtcatcg ccacgcccga 8340 cctcgacgag gcgcgcgacg aggtggcgcg catcttctgt ccgcaccggc tgcacctcgg 8400 gcacggcagc tcgcgcttcg acgcgcgcca tcacgtcgcg ccgctgggcg acatctcgct 8460 gaactacgtg cagtacggcg ccgaggtcga gatcgatccc ggctgcctcg gcgacttcta 8520 tctgctgcag atcccgctca ggggcaacgc ccgcatcgag tgggccggcc gctccttcac 8580 ctccgacgcg caccgcgcct cgctggcctc gccgagccag ccgctgcgca tgcgctgggg 8640 cgacgacacg ccgcatctga tcgtgaagat cggcaaggcg gtggtgcagc gccactggga 8700 gtcgctgtgc ggcgagccgg ccggcgcgcg gccgctcgaa ttcgagcccg agatcgcgct 8760 cgacgagggc gcgggcgcga gcgtgaagca cctggtggag ttcctcgcgc aggagctctc 8820 gtgcggccgc acgccgctga ccacgccctt cctggcccag gccgaatcgg gcctgatcca 8880 caccctgctg ggccagttgc cgcacaacca gagcgcgcgc ctgggcgccg agcgcggcga 8940 cgtctcgccg cgcgcgctgc gccgggcccg cgagtacatc gaggcgcacc tgcccgatgc 9000 gctcacggtc gacgagatcg cctcggccag cgggttgtgc gtgcgcagcc tgcaggtggc 9060 gttccgccag catgcgggcc agacgccgat ggcctacctg cgcgagcggc ggctgctcgc 9120 ggtgcacgag cgcctgagcg agccgggcgc cgacaccacc gtgacctcgg tcgcgctgca 9180 gttcggcttc gcccacctcg gacgcttcgc gcaagactac gcgcggcgct tcggcgaatc 9240 gccccatcgc acgctgcagc ggcagcgctg aaggcacctg ctgccacttt catagaatcc 9300 acgccctgtg catgccgggc ggttgtccgg gcgccatgcg cccccaaatg acaacgatgg 9360 ccaccaagaa acaagacacc tcctcccgca tcgccgacaa caagaaggcg gcgtacaact 9420 atttcttcga agaacgcttc gaggccggca tggtgctgga aggctgggaa gtgaaggcgc 9480 tgcgcgaagg caaggtgcag ctcaccgacg gctacgtggt gatccgcgac ggcgagatgt 9540 tcgtgctggg ctgccagatc aacccgctca agagcgcctc gacccacgtg acgcccgact 9600 cggtgcgcac caagaagctg ctgctgcaca aggaggagat ccgccgcctg accggcaagg 9660 tcgagcagaa gggctacacc ctggtgccgc tgaacctgca ctggaaggcc ggcaaggtga 9720 agtgcgagat cgcgctggcc aagggcaagg ccgagcacga caagcgcgac accatcaagg 9780 accgcgaagg caagcgcgaa gtcgagcgcg cgatgaagag ccgcagccgc tgagccgcgg 9840 cgttcgcgct ttttttgcgc ggccatggaa taaacgcggc gccgcgggcg ttcatgcagg 9900 tgtcgccgga tcgtccggcg ccacaaccag gagctcttcc atgccgctga cctcacgccg 9960 ccttcccttc ctcgccgcca cgctgctggc cgccggtttc ctctcgctgc ccgccgcggc 10020 ccaacccaag gccgccgacg gcgccctggt cggccccagc ggcatgaccc tctacacctt 10080 cgacaaggac acggccggca acggcaagtc ggtctgcaac ggccagtgcg ccaccaactg 10140 gccgccatac atggcggccg atggcgacaa ggccgcgggc gacttcagca tcgtcacgcg 10200 cgacgacggc aagaagcagt gggccgccaa gggctggccg ctgtactact ggatcaagga 10260 cacgaagccc ggcgacaaga ccggcgacgg cgtcaacggc agctggaaga ccgccaagcc 10320 ctgagcccgg gccttcccgc cttccatgga cgcccgccag ctcgccccgc acattcccgg 10380 cctgcgccgc tatgcgcgcg cgctgaccgg caatgcctgg gccgccgacg acctggtgca 10440 ggacacgctc gagcgtgcct gcagcaagtg gcggctgtgg gtggcgggca gcgacctgcg 10500 cgcctggctg ttcgcgatca tgcacaacct cttcgcgagc caggtgcgcc gcgcgccgcc 10560 gccgcatgcg gccgtgtcgc tcgacgaact gccgcccgaa cagcagggcg gcgtcgaccc 1 0620 cggccgcgac cacggcgtgc gcctcgacct gcagcgctgc ctgctgcagc tgccggaaga 10680 gcaacgcgcc gtgctgctgc tggtgacgct cgaagacctg tcttatgccg aggtcgcgaa 10740 ggtgctcggc attccgctgg gcaccgtgat gtcgcggctg tcgcgcgccc gcgtgcggct 10800 gcaggaactg ctcgacggcg cggccgtagc cggcacgtcg gcgggcacac tggcgggcag 10860 tacggccccg cgccccggcc tgcgccgcct caagtaacgt catgaaccgc cccgccccgc 10920 ccccttccga cgacgacctg cacgcctggg tcgacggcca gctcgcgccc gagcgccgcg 10980 ccgccatcga ggccgcgctg gcggacgatc cggccctcgc ggcccgggtc tcgctctggc 11040 aggcgcagcg cgacacgctg cggcaactgc atgccgagct gctccatgaa cccgcgccgg 11100 cccacctgtc ggccgtgctc gaacgcgagg ccgcgccgcg cgacggctgg tggcgctggg 11160 gtggcatcgc ggccggcctg ctggtcgcct tcggcgccgg ctggctcggc aacgcccaat 11220 ggagcgccac ccagcgcccg ggcaccgcgc tggcgcgtgc gccggcggtg cgcgaattc 11279

<210> 2 <211> 750 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF6-1 <400> 2 atg cct cgg tca ccg ccg cct ggc tgc tgc ccg acc acg cca acg aac 48 Met Pro Arg Ser Pro Pro Pro Gly Cys Cys Pro Thr Thr Pro Thr Asn 1 5 10 15 aca cgc gca ggc tct acg ccg cca tcc gcc gcg acg agg tcg agc cgc 96 Thr Arg Ala Gly Ser Thr Pro Pro Ser Ala Ala Thr Arg Ser Ser Arg 20 25 30 agg cgc cca atg cct ggc agt ggg agt gcg cca acg tca tcg cca acg 144 Arg Arg Pro Met Pro Gly Ser Gly Ser Ala Pro Thr Ser Ser Pro Thr 35 40 45 gcg tgc gca gcg gcc gca ttc cct cgt cgg ccg tcg agg gcc tgt gga 192 Ala Cys Ala Ala Ala Ala Phe Pro Arg Arg Pro Ser Arg Ala Cys Gly 50 55 60 gcg tgc tcg atg cca tcc gcc atc gcg tcg agc tgc acg agc Tcg Cycgc Cyg Met Pro Ser Ala Ile Ala Ser Ser Cys Thr Ser Ser Arg 65 70 75 80 cgg ccc agc aca agg ccg tgc tcg ccg tcg cca tcg atg ccg gcg tgt 288 Arg Pro Ser Thr Arg Pro Cys Se r Pro Ser Pro Ser Met Pro Ala Cys 85 90 95 cgc tct atg ccg cgg gct acc tct ggc tcg cgc gct cgc tcg gtc ttc 336 Arg Ser Met Pro Arg Ala Thr Ser Gly Ser Arg Ala Arg Ser Val Phe 100 105 110 cgc tcg cca cct tcg acg agc aac tca tcc agg ccg cgc cgc aag cgg 384 Arg Ser Pro Pro Ser Thr Ser Asn Ser Ser Arg Pro Arg Arg Lys Arg 115 120 125 gcg tcc ggc tgt tcg aca ttt caa cgc tct gag tcc ccg atg ca ca 432 Ala Ser Gly Cys Ser Thr Phe Gln Arg Ser Glu Ser Pro Pro Met Gln 130 135 140 cac gac aag atc ctc atc ctc gat ttc ggc tcg cag gtc acc cag ctc 480 His Asp Lys Ile Leu Ile Leu Asp Phe Gly Ser Gln Val Thr Gln Leu 145 150 155 160 atc gcg cgc cgc gtg cgc gag gcc cat gtg ctc agc gaa gtg cat ccc 528 Ile Ala Arg Arg Val Arg Glu Ala His Val Leu Ser Glu Val His Pro 165 170 175 tgc gac gtc gg gac gac gag ga gtg cgc gag tac gcg gcc gac ggc cat 576 Cys Asp Val Ser Asp Glu Trp Val Arg Glu Tyr Ala Ala Asp Gly His 180 185 190 ctc aag ggc gtg atc ctc tcg ggc agc cat gcc agc gtg tac gag Gag 624 Ile L eu Ser Gly Ser His Ala Ser Val Tyr Glu Glu 195 200 205 acc acc gac aag tgc ccg cag gcc gtg ttc gac ctc ggc att ccc gtg 672 Thr Thr Asp Lys Cys Pro Gln Ala Val Phe Asp Leu Gly Ile Pro Val 210 215 220 ctc ggc atc tgg tac ggc atg cag acc atg gcg cac cag ctc ggc ggc 720 Leu Gly Ile Trp Tyr Gly Met Gln Thr Met Ala His Gln Leu Gly Gly 225 230 235 240 aag gtc gag ggc ggc cac aag cgcga g Glu Gly Gly His Lys Arg Glu Phe 245 250

<210> 3 <211> 250 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF6-1 <400> 2 Met Pro Arg Ser Pro Pro Pro Gly Cys Cys Pro Thr Thr Pro Thr Asn 1 5 10 15 Thr Arg Ala Gly Ser Thr Pro Pro Ser Ala Ala Thr Arg Ser Ser Arg 20 25 30 Arg Arg Pro Met Pro Gly Ser Gly Ser Ala Pro Thr Ser Ser Pro Thr 35 40 45 Ala Cys Ala Ala Ala Ala Phe Pro Arg Arg Pro Ser Arg Ala Cys Gly 50 55 60 Ala Cys Ser Met Pro Ser Ala Ile Ala Ser Ser Cys Thr Ser Ser Arg 65 70 75 80 Arg Pro Ser Thr Arg Pro Cys Ser Pro Ser Pro Ser Met Pro Ala Cys 85 90 95 Arg Ser Met Pro Arg Ala Thr Ser Gly Ser Arg Ala Arg Ser Val Phe 100 105 110 Arg Ser Pro Pro Ser Thr Ser Asn Ser Ser Arg Pro Arg Arg Lys Arg 115 120 125 Ala Ser Gly Cys Ser Thr Phe Gln Arg Ser Glu Ser Pro Pro Met Gln 130 135 140 His Asp Lys Ile Leu Ile Leu Asp Phe Gly Ser Gln Val Thr Gln Leu 145 150 155 160 Ile Ala Arg Arg Val Arg Glu Ala His Val Leu Ser Glu Val His Pro 165 170 175 Cys Asp Val Ser Asp Glu Trp Val Arg Glu Tyr Ala Ala Asp Gly His 180 185 190 Leu Lys Gly Val Ile Leu Ser Gly Ser His Ala Ser Val Tyr Glu Glu 195 200 205 Thr Thr Asp Lys Cys Pro Gln Ala Val Phe Asp Leu Gly Ile Pro Val 210 215 220 Leu Gly Ile Trp Tyr Gly Met Gln Thr Met Ala His Gln Leu Gly Gly 225 230 235 240 Lys Val Glu Gly Gly His Lys Arg Glu Phe 245 250

<210> 4 <211> 1470 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF6-3 <400> 4 atg cgc ctt ctc ggc aaa gcg ctc acc ttc gac gat gtg ttg ctg ctg gtg 48 Met Arg Leu Leu Gly Lys Ala Leu Thr Phe Asp Asp Val Leu Leu Val 1 5 10 15 cca gcg ttc tcc cag gtc ctg ccc aag gac acc tcc ctc gcc acc aaa 96 Pro Ala Phe Ser Gln Val Leu Pro Lys Asp Thr Ser Leu Ala Thr Lys 20 25 30 ttc tcc cga aac atc acg ctg aac atc ccg ctc gtc tcg gcg gcg atg 144 Phe Ser Arg Asn Ile Thr Leu Asn Ile Pro Leu Val Ser Ala Ala Met 35 40 45 gac acc gtg acc gaa gcc cgc ctc gcg atc gcc atc gcg cag gaa ggc 192 Asp Thr Val Thr Glu Ala Arg Leu Ala Ile Ala Ile Ala Gln Glu Gly 50 55 60 ggc atc ggg atc gtg cac aag aac ctc acc gcg cag cag cag gcc Gly 240 Gly Ile Val His Lys Asn Leu Thr Ala Gln Gln Gln Ala Ala 65 70 75 80 gaa gtg gcc aag gtc aag cgc tac gaa tcg ggc gtg ctg cgc gat ccg 288 Glu Val Ala Lys Val Lys Arg Tyr Glu Ser Gly Val Leu Arg Asp Pro 85 90 95 gtg gtg atc acg ccc acg cac tcg gtg cgg cag gtg atg gcg ctg tcg 336 Val Val Ile Thr Pro Thr His Ser Val Arg Gln Val Met Ala Leu Ser 100 105 110 gac cag ctc ggc atc tcg ggc ttc ccg gtg gtc gac gcc ggc cgg gtg 384 Asp Gln Leu Gly Ile Ser Gly Phe Pro Val Val Asp Ala Gly Arg Val 115 120 125 gtc ggc atc gtg acc ggg cgc gac ctg cgac gc ctg cgac gc ctg cgac gc 432 Val Gly Ile Val Thr Gly Arg Asp Leu Arg Phe Glu Asn Arg Tyr Asp 130 135 140 gtg ccc gtg agc gag atc atg acg cag cgc gac cgg ctg atc acc gtg 480 Val Pro Val Ser Glu Ile Met Thr Gln Arg Asp Arg Leu Ile Thr Val 145 150 155 160 ccc gac ggc acc acg ctg gcc gag gcc aag gcg ctg ctc aac aag cac 528 Pro Asp Gly Thr Thr Leu Ala Glu Ala Lys Ala Leu Leu Asn Lys His 165 170 175 aag ctc gaa cgc ctg ctg ctg atc aac agc gac tgg gag ctc aag ggc 576 Lys Leu Glu Arg Leu Leu Val Ile Asn Ser Asp Trp Glu Leu Lys Gly 180 185 190 ctg atc acc gtc aag gac atc acc aag cag acc acc ttc ccc aac gcc 624 Leu Ile Thr Val Ly s Asp Ile Thr Lys Gln Thr Thr Phe Pro Asn Ala 195 200 205 gcg cgc gat gcc tcg ggc cgc ctg cgc gtg ggc gcg gcg gtc ggc gtg 672 Ala Arg Asp Ala Ser Gly Arg Leu Arg Val Gly Ala Ala Val 220 ggc gag ggc acc gag gag cgc gtc gag gca ctg gtc aag gcc ggc gtc 720 Gly Glu Gly Thr Glu Glu Arg Val Glu Ala Leu Val Lys Ala Gly Val 225 230 235 240 gat gcc atc gtg gtc gac acg ggccacg aag ggc gtg atc 768 Asp Ala Ile Val Val Asp Thr Ala His Gly His Ser Lys Gly Val Ile 245 250 255 gag cgc gtg cgc tgg gtc aag cag aac tat ccg cag atc gac gtg atc 816 Glu Arg Val Arg Trp Val Lys Gln Asn Tyr Pro Gln Ile Asp Val Ile 260 265 270 ggc ggc aac atc gcc acc ggc gac gcc gcg cgc gcg ctg gcc gag gcc 864 Gly Gly Asn Ile Ala Thr Gly Asp Ala Ala Arg Ala Leu Ala Glu Ala 275 280 gggg gtc aag gtc ggc atc ggc ccg ggc tcc atc tgc acc 912 Gly Ala Asp Ala Val Lys Val Gly Ile Gly Pro Gly Ser Ile Cys Thr 290 295 300 acc cgc atc gtg gcc ggc gtg ggc gtg ccg cag atc atg gc A rg Ile Val Ala Gly Val Gly Val Pro Gln Ile Met Ala Val Asp 305 310 315 320 agc gtc gcc acc gcg ctg cac ggc agc ggc gtg ccg ctg atc tcc gac 1008 Ser Val Ala Thr Ala Leu His Gly Ser Gly Val Pro Leu Ile Ser Asp 325 330 335 ggc ggc gtg cgc tac tcg ggc gac atc gcc aag gcc atc gcg gcc ggc 1056 Gly Gly Vally Tyr Ser Gly Asp Ile Ala Lys Ala Ile Ala Ala Gly 340 345 345 350 gcc agc acc ggg atg atg ttc gcc ggc acc gaa gag gcg 1104 Ala Ser Thr Val Met Met Gly Ser Met Phe Ala Gly Thr Glu Glu Ala 355 360 365 ccc ggc gag atc gtg ctg tac cag ggc cgc agc tac aag agc tac cgc 1152 Pro Gly Glu Tyr Gln Gly Arg Ser Tyr Lys Ser Tyr Arg 370 375 380 ggc atg ggc tcc atc ggc gcg atg cag cag ggc agt gcc gac cgg tac 1200 Gly Met Gly Ser Ile Gly Ala Met Gln Gln Gly Ser Ala Asp Arg Tyr 400 395 390 ttc cag gaa tcg acc acc ggc aat ccc aac acc gac aag ctc gtg ccc 1248 Phe Gln Glu Ser Thr Thr Gly Asn Pro Asn Thr Asp Lys Leu Val Pro 405 410 415 gag ggc atc gag ggc cgc gtg ccc tac aag ggc tg gtc tcg atc 1296 Glu Gly Ile Glu Gly Arg Val Pro Tyr Lys Gly Ser Ile Val Ser Ile 420 425 430 atc tac cag atg gcc ggc ggc gtt cgc gcc agc atg ggc tac tgc ggc 1344 Ile Tyr Gln Met Ala Gly Gly Ser Met Gly Tyr Cys Gly 435 440 445 tgc ggc acc atc gaa gag atg aag aac aag gcc gag ttc gtc gag atc 1392 Cys Gly Thr Ile Glu Glu Met Lys Asn Lys Ala Glu Phe Val Glu Ile 450 455 460 acc accgcc ggc cgc gag agc cac gtc cac gac gtg cag atc acg 1440 Thr Thr Ala Gly Ile Arg Glu Ser His Val His Asp Val Gln Ile Thr 465 470 475 480 480 aag gaa gcg ccg aac tac cgc gcc gag taa 1470 Lys Glu Ala Pro Asn Tyr Ala Glu 485

<210> 5 <211> 489 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF6-3 <400> 5 Met Arg Leu Leu Gly Lys Ala Leu Thr Phe Asp Asp Val Leu Leu Val 1 5 10 15 Pro Ala Phe Ser Gln Val Leu Pro Lys Asp Thr Ser Leu Ala Thr Lys 20 25 30 Phe Ser Arg Asn Ile Thr Leu Asn Ile Pro Leu Val Ser Ala Ala Met 35 40 45 Asp Thr Val Thr Glu Ala Arg Leu Ala Ile Ala Ile Ala Gln Glu Gly 50 55 60 Gly Ile Gly Ile Val His Lys Asn Leu Thr Ala Gln Gln Gln Ala Ala 65 70 75 80 Glu Val Ala Lys Val Lys Arg Tyr Glu Ser Gly Val Leu Arg Asp Pro 85 90 95 Val Val Ile Thr Pro Thr His Ser Val Arg Gln Val Met Ala Leu Ser 100 105 110 Asp Gln Leu Gly Ile Ser Gly Phe Pro Val Val Asp Ala Gly Arg Val 115 120 125 Val Gly Ile Val Thr Gly Arg Asp Leu Arg Phe Glu Asn Arg Tyr Asp 130 135 140 Val Pro Val Ser Glu Ile Met Thr Gln Arg Asp Arg Leu Ile Thr Val 145 150 155 160 Pro Asp Gly Thr Thr Leu Ala Glu Ala Lys Ala Leu Leu Asn Lys His 165 170 175 Lys Leu Glu Arg Leu Leu Val Ile Asn Ser Asp Trp Glu Leu Lys Gly 180 185 190 Leu Ile Thr Val Lys Asp Ile Thr Lys Gln Thr Thr Phe Pro Asn Ala 195 200 205 Ala Arg Asp Ala Ser Gly Arg Leu Arg Val Gly Ala Ala Val Gly Val 210 215 220 Gly Glu Gly Thr Glu Glu Arg Val Glu Ala Leu Val Lys Ala Gly Val 225 230 235 240 Asp Ala Ile Val Val Asp Thr Ala His Gly His Ser Lys Gly Val Ile 245 250 255 Glu Arg Val Arg Trp Val Lys Gln Asn Tyr Pro Gln Ile Asp Val Ile 260 265 270 Gly Gly Asn Ile Ala Thr Gly Asp Ala Ala Arg Ala Leu Ala Glu Ala 275 280 285 Gly Ala Asp Ala Val Lys Val Gly Ile Gly Pro Gly Ser Ile Cys Thr 290 295 300 Thr Arg Ile Val Ala Gly Val Gly Val Pro Gln Ile Met Ala Val Asp 305 310 315 320 Ser Val Ala Thr Ala Leu His Gly Ser Gly Val Pro Leu Ile Ser Asp 325 330 335 Gly Gly Val Arg Tyr Ser Gly Asp Ile Ala Lys Ala Ile Ala Ala Gly 340 345 350 Ala Ser Thr Val Met Met Gly Ser Met Phe Ala Gly Thr Glu Glu Ala 355 360 365 Pro Gly Glu Glu Ile Val Leu Tyr Gln Gly Arg Ser Tyr Lys Ser Tyr Arg 370 375 380 Gly Met Gly Ser Ile Gly Ala Met Gln Gln Gly Ser Ala Asp Arg Tyr 385 390 395 400 400 Phe Gln Glu Ser Thr Thr Gly Asn Pro Asn Thr Asp Lys Leu Val Pro 405 410 415 Glu Gly Ile Glu Gly Arg Val Pro Tyr Lys Gly Ser Ile Val Ser Ile 420 425 430 Ile Tyr Gln Met Ala Gly Gly Val Arg Ala Ser Met Gly Tyr Cys Gly 435 440 445 Cys Gly Thr Ile Glu Glu Met Lys Asn Lys Ala Glu Phe Val Glu Ile 450 455 460 Thr Thr Ala Gly Ile Arg Glu Ser His Val His Asp Val Gln Ile Thr 465 470 475 480 Lys Glu Ala Pro Asn Tyr Arg Ala Glu 485

<210> 6 <211> 336 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF4-5 <400> 6 atg atc gag gtg acc ctg agc tgc tcg ccg gca ccg cgc gag gtg ttc 48 Met Ile Glu Val Thr Leu Ser Cys Ser Pro Ala Pro Arg Glu Val Phe 1 5 10 15 gag gag ccg ctg cgc ctg gcc gcg ggc gcc acc gtg aac gat gcg atc 96 Glu Glu Pro Leu Arg Leu Ala Ala Gly Ala Thr Val Asn Asp Ala Ile 20 25 30 cgc gcc agc acg ctg atg cag cgc ttt ccc gcg ctc gat tgg cgc gag 144 Arg Ala Ser Thr Leu Met Gln Arg Phe Pro Ala Leu Asp Trp Arg Glu 35 40 45 acg atg acg ccc ggc atc tgg ggc cgg acc gcc gat tgg gac gat gcg 192 Thr Met Thr Pro Gly Ile Trp Gly Arg Thr Ala Asp Trp Asp Asp Ala 50 55 60 ctc gaa gac ggc gac cgc gtc gag ctg tgc cgc gcg ctc Lec gag Gp Asc 240 Gly Asp Arg Val Glu Leu Cys Arg Ala Leu Glu Val Asp 65 70 75 80 ccg aag gtg gcg cgg cgc gag cgc ttc cag cag cag cag ggc gcg cgc ggc 288 Pro Lys Val Ala Arg Arg Glu Ar g Phe Gln Gln Gln Gly Ala Arg Gly 85 90 95 acc ggg ctg ttc gcg aac cgg cgc aag ggc ggc aag gcg ggg tac tga 336 Thr Gly Leu Phe Ala Asn Arg Arg Lys Gly Gly Lys Ala Gly Tyr 100 105 110

<210> 7 <211> 111 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF4-5 <400> 7 Met Ile Glu Val Thr Leu Ser Cys Ser Pro Ala Pro Arg Glu Val Phe 1 5 10 15 Glu Glu Pro Leu Arg Leu Ala Ala Gly Ala Thr Val Asn Asp Ala Ile 20 25 30 Arg Ala Ser Thr Leu Met Gln Arg Phe Pro Ala Leu Asp Trp Arg Glu 35 40 45 Thr Met Thr Pro Gly Ile Trp Gly Arg Thr Ala Asp Trp Asp Asp Ala 50 55 60 Leu Glu Asp Gly Asp Arg Val Glu Leu Cys Arg Ala Leu Glu Val Asp 65 70 75 80 Pro Lys Val Ala Arg Arg Glu Arg Phe Gln Gln Gln Gly Ala Arg Gly 85 90 95 Thr Gly Leu Phe Ala Asn Arg Arg Lys Gly Gly Lys Ala Gly Tyr 100 105 110

<210> 8 <211> 447 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF6-5 <400> 8 atg aaa aca gtc aac aag tcc gtt ctc atc tgg tac agc gcc gaa gag 48 Met Lys Thr Val Asn Lys Ser Val Leu Ile Trp Tyr Ser Ala Glu Glu 1 5 10 15 atg tac gcg ctg gtc acc gat gtg gcg aag tac ccc cag ttc ctg ccc 96 Met Tyr Ala Leu Val Thr Asp Val Ala Lys Tyr Pro Gln Phe Leu Pro 20 25 30 tgg tgc gac aag gcg cgc gtc atc gag cag gac gag gcc ggc atg acc 144 Trp Cys Asp Lys Ala Arg Val Ile Glu Gln Asp Glu Ala Gly Met Thr 35 40 45 gcc gag gtc ggc ctg gcc ttc gcg ggc ctg cac cag agc ttc acc acg 192 Ala Glu Val Gly Leu Ala Phe Ala Gly Leu His Gln Ser Phe Thr Thr 50 55 60 cgc aac acc cat gtg ccc ggc cgc gag gtg cag ctc aag ctg Asc gac 240g His Val Pro Gly Arg Glu Val Gln Leu Lys Leu Val Asp 65 70 75 80 ggg ccg ttc tcc aat ctc gac ggc cac tgg aaa ttc gtg ccg gtg ggc 288 Gly Pro Phe Ser Asn Leu Asp Gl y His Trp Lys Phe Val Pro Val Gly 85 90 95 gag ggc ggc gag cgc gcc tgc cgc gtc gag ctg cac ctg agc tac ggc 336 Glu Gly Gly Glu Arg Ala Cys Arg Val Glu Leu His Leu Ser Tyr Gly 100 105 110 ttc ag aac ttc gcg ctg cag gcc ctc gtg ggg ccg gtg ttc gac acc 384 Phe Ser Asn Phe Ala Leu Gln Ala Leu Val Gly Pro Val Phe Asp Thr 115 120 125 atc gcc tcg agc ctg gtc gag gcc ttc gtc gag cag gag cagcagg 432 Ile Ala Ser Ser Leu Val Glu Ala Phe Val Lys Arg Ala Glu Gln Val 130 135 140 tac ggc gcg cct tga 447 Tyr Gly Ala Pro 145

<210> 9 <211> 148 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF6-5 <400> 9 Met Lys Thr Val Asn Lys Ser Val Leu Ile Trp Tyr Ser Ala Glu Glu 1 5 10 15 Met Tyr Ala Leu Val Thr Asp Val Ala Lys Tyr Pro Gln Phe Leu Pro 20 25 30 Trp Cys Asp Lys Ala Arg Val Ile Glu Gln Asp Glu Ala Gly Met Thr 35 40 45 Ala Glu Val Gly Leu Ala Phe Ala Gly Leu His Gln Ser Phe Thr Thr 50 55 60 Arg Asn Thr His Val Pro Gly Arg Glu Val Gln Leu Lys Leu Val Asp 65 70 75 80 Gly Pro Phe Ser Asn Leu Asp Gly His Trp Lys Phe Val Pro Val Gly 85 90 95 Glu Gly Gly Glu Arg Ala Cys Arg Val Glu Leu His Leu Ser Tyr Gly 100 105 110 Phe Ser Asn Phe Ala Leu Gln Ala Leu Val Gly Pro Val Phe Asp Thr 115 120 125 Ile Ala Ser Ser Leu Val Glu Ala Phe Val Lys Arg Ala Glu Gln Val 130 135 140 Tyr Gly Ala Pro 145

<210> 10 <211> 1239 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF6-6 <400> 10 atg aca gct cag aag ggc cgc tgg ctg cag gtg ccg gcc atc gac ggc 48 Met Thr Ala Gln Lys Gly Arg Trp Leu Gln Val Pro Ala Ile Asp Gly 1 5 10 15 agt ggc agc ttc cgc gcc tac ctc gcc acc ccg gcc tcg ggc aag ggc 96 Ser Gly Ser Phe Arg Ala Tyr Leu Ala Thr Pro Ala Ser Gly Lys Gly 20 25 30 ccc ggc atc gtg ctg gcg cag gag atc ttc ggc gtc aac gcc acc atg 144 Pro Gly Ile Val Leu Ala Gln Glu Ile Phe Gly Val Asn Ala Thr Met 35 40 45 cgg cag gtg gcc gac tac tac gcg gaa gaa ggc tac gtg gtg ctc gcg 192 Arg Gln Val Ala Asp Tyr Tyr Ala Glu Glu Gly Tyr Val Val Leu Ala 50 55 60 ccc gat ctg ttc tgg cgc cag cag ccc gag gtc gag ctc gc Proc Phe Trp Arg Gln Gln Pro Glu Val Glu Leu Gly Tyr Ala 65 70 75 80 ccc gac gac tgg cag aag gcc ttc gcg ctc tac aaa ggc ttc gac gag 288 Pro Asp Asp Trp Gln Lys Ala Phe Ala Leu Tyr Lys Gly Phe Asp Glu 85 90 95 gac aag ggc acc gag gac ctg gct gct tcg ctg gcg ctg ctg cgc tcg 336 Asp Lys Gly Thr Glu Asp Leu Ala Ala Ser Leu Ala Leu Leu Arg Ser 100 ctg ccc gag cag cag ggc aag gcc ggc gtg ctg ggc ttc tgc atg ggc 384 Leu Pro Glu Gln Gln Gly Lys Ala Gly Val Leu Gly Phe Cys Met Gly 115 120 125 ggc aaa ctc gcc tac ctc gcg gcc tg gtc tgc 432 Gly Lys Leu Ala Tyr Leu Ala Ala Cys Arg Thr Asp Ala Asp Val Cys 130 135 140 gtg ggc tac tac ggc gtg ggc atc gag cag cgg ctc gag gag gcc gac 480 Val Gly Tyr Tyr Gly Val Gly Arle Glu Leu Glu Glu Ala Asp 145 150 155 160 cgc atc cag ggc cgg ctg gtg ctg cac atc ccc gag ctc gac ggc ttc 528 Arg Ile Gln Gly Arg Leu Val Leu His Ile Pro Glu Leu Asp Gly Phe 165 170 175 tggcgg cgc tcg cgc atc gtc gag acg ctc ggt gcg cgg 576 Cys Pro Pro Glu Ala Arg Ser Arg Ile Val Glu Thr Leu Gly Ala Arg 180 185 190 ccc ggg tgc gag ctc tat gtc tat ccg ggc gtc gac cat gcc ttg Cys Glu Leu Tyr Val Tyr Pro Gly Val Asp His Ala Phe Ala 195 200 205 cgg ctg ggc ggc gac cac tac cac aag cct tcg gcg ctg atg gcg cac 672 Arg Leu Gly Gly Asp His Tyr His Lys Pro Ser Ala Leu Met Ala His 210 215 220 gag cgc agc gtg gcc gcg ttc cgc cgc gag atg ggt ccg cat tac gac 720 Glu Arg Ser Val Ala Ala Phe Arg Arg Glu Met Gly Pro His Tyr Asp 225 230 235 240 ttc tcg gcg ctg tgg gac aag tac gag ttc gcg acc cgc 768 Phe Ser Ala Leu Trp Asp Lys His Cys Glu Tyr Glu Phe Ala Thr Arg 245 250 255 aac gtg gcc gac acc atg gcc acc atg gtg gcc gag ccc tac gtc aac 816 Asn Val Ala Asp Thr Met Ala Thr Met Val Ala Glu Pro Tyr Val Asn 260 265 270 cac atc ccg acc atg acc ggc ggc gtg ggg cac gcg atg ctg agc cgc 864 His Ile Pro Thr Met Thr Gly Gly Val Gly His Ala Met Leu Ser Arg 275 280 280 285 ttc tac cag cac cat ttc gtg aac agc aat ccg ccc gac acg cgg ctc 912 Phe Tyr Gln His His Phe Val Asn Ser Asn Pro Pro Asp Thr Arg Leu 290 295 300 gtg ccg atc tcg cgc acc gtg ggc gcg acg cag atc gtc gac Val Pro Ile Ser Arg Thr Val Gly Ala Thr Gln Ile Val Asp Glu Ile 305 310 315 320 ctg ttc agc ttc acc cat acc tgc gag atc gac tgg ctg ctg ccc ggc 1008 Leu Phe Ser Phe Thr His Thr Cys Glu Ile Asp Trp Leu Leu Pro Gly 325 330 335 gtg gcg ccc acg ggc agg ccg gtg gag att ccg ctg gtg gcg atc gtg 1056 Val Ala Pro Thr Gly Arg Pro Val Glu Ile Pro Leu Val Ala Ile Val 340 345 350 aag ttc cgc ggc gac agag cac gag cac atc tac tgg gac cag 1104 Lys Phe Arg Gly Asp Lys Leu Tyr His Glu His Ile Tyr Trp Asp Gln 355 360 365 gcc agc gtg ctg gtg cag gtg ggg ctg ctc gat ccg aag ggc ctg Valg A115 Gln Val Gly Leu Leu Asp Pro Lys Gly Leu Pro 370 375 380 gtg gcc ggc gtc gaa acc gca cgc aag ctg ctc gac gag acg cag ccc 1200 Val Ala Gly Val Glu Thr Ala Arg Lys Leu Leu Asp Glu Thr Gln Pro 385 390 395 400 tcg aac acg ctg atg gcg gcc tgg tcg cgt tcg ggc tga 1239 Ser Asn Thr Leu Met Ala Ala Trp Ser Arg Ser Gly 405 410

<210> 11 <211> 412 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF6-6 <400> 11 Met Thr Ala Gln Lys Gly Arg Trp Leu Gln Val Pro Ala Ile Asp Gly 1 5 10 15 Ser Gly Ser Phe Arg Ala Tyr Leu Ala Thr Pro Ala Ser Gly Lys Gly 20 25 30 Pro Gly Ile Val Leu Ala Gln Glu Ile Phe Gly Val Asn Ala Thr Met 35 40 45 Arg Gln Val Ala Asp Tyr Tyr Ala Glu Glu Gly Tyr Val Val Leu Ala 50 55 60 Pro Asp Leu Phe Trp Arg Gln Gln Pro Glu Val Glu Leu Gly Tyr Ala 65 70 75 80 Pro Asp Asp Trp Gln Lys Ala Phe Ala Leu Tyr Lys Gly Phe Asp Glu 85 90 95 Asp Lys Gly Thr Glu Asp Leu Ala Ala Ser Leu Ala Leu Leu Arg Ser 100 105 110 Leu Pro Glu Gln Gln Gly Lys Ala Gly Val Leu Gly Phe Cys Met Gly 115 120 125 125 Gly Lys Leu Ala Tyr Leu Ala Ala Cys Arg Thr Asp Ala Asp Val Cys 130 135 140 Val Gly Tyr Tyr Gly Val Gly Ile Glu Gln Arg Leu Glu Glu Ala Asp 145 150 155 160 Arg Ile Gln Gly Arg Leu Val Leu His Ile P ro Glu Leu Asp Gly Phe 165 170 175 Cys Pro Pro Glu Ala Arg Ser Arg Ile Val Glu Thr Leu Gly Ala Arg 180 185 190 Pro Gly Cys Glu Leu Tyr Val Tyr Pro Gly Val Asp His Ala Phe Ala 195 200 205 Arg Leu Gly Gly Asp His Tyr His Lys Pro Ser Ala Leu Met Ala His 210 215 220 Glu Arg Ser Val Ala Ala Phe Arg Arg Glu Met Gly Pro His Tyr Asp 225 230 235 240 Phe Ser Ala Leu Trp Asp Lys His Cys Glu Tyr Glu Phe Ala Thr Arg 245 250 255 Asn Val Ala Asp Thr Met Ala Thr Met Val Ala Glu Pro Tyr Val Asn 260 265 270 His Ile Pro Thr Met Thr Gly Gly Val Gly His Ala Met Leu Ser Arg 275 280 285 Phe Tyr Gln His His Phe Val Asn Ser Asn Pro Pro Asp Thr Arg Leu 290 295 300 Val Pro Ile Ser Arg Thr Val Gly Ala Thr Gln Ile Val Asp Glu Ile 305 310 315 320 Leu Phe Ser Phe Thr His Thr Cys Glu Ile Asp Trp Leu Leu Pro Gly 325 330 335 Val Ala Pro Thr Gly Arg Pro Val Glu Ile Pro Leu Val Ala Ile Val 340 345 350 Lys Phe Arg Gly Asp Lys Leu Tyr His Glu His Ile Tyr Trp Asp Gln 355 360 365 Ala Ser Val Leu Val Gln Val Gly Leu Leu AspPro Lys Gly Leu Pro 370 375 380 Val Ala Gly Val Glu Thr Ala Arg Lys Leu Leu Asp Glu Thr Gln Pro 385 390 395 400 400 Ser Asn Thr Leu Met Ala Ala Trp Ser Arg Ser Gly 405 410

<210> 12 <211> 543 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF6-7 <400> 12 atg cgc ggc gag ttc cgg gcc atc gag tcg ctg cgc tgc gaa ccc aac 48 Met Arg Gly Glu Phe Arg Ala Ile Glu Ser Leu Arg Cys Glu Pro Asn 1 5 10 15 gtg ggc gcg ggc gac ttc cgg cgc gcc atg cgc tgc ctg gtc ggc gcc 96 Val Gly Ala Gly Asp Phe Arg Arg Ala Cys Leu Val Gly Ala 20 25 30 gtg acc gtg gtc acg agc acc gac ggg cag acg ccc gtg gga ctc acg 144 Val Thr Val Val Thr Ser Thr Asp Gly Gln Thr Pro Val Gly Leu Thr 35 40 45 gcc acg gcc gtg acc tcg ttc tcg gcc gag ccc gcg cgc atc ctg gcc 192 Ala Thr Ala Val Thr Ser Phe Ser Ala Glu Pro Ala Arg Ile Leu Ala 50 55 60 tgc gtc aac ctg cag ggc agc agc ttc cgc acc atc gcg cag Cyc Valsgcc 240 Leu Gln Gly Ser Ser Phe Arg Thr Ile Ala Gln Ser Arg 65 70 75 80 cgc atg gcg gtc aac ctg ctc gcg ctc gac cag tcg gcg ctg gcg ctg 288 Arg Met Ala Val Asn Leu Leu Ala Leu Asp Gln Ser Ala Leu Ala Leu 85 90 95 gcc ttc tcg cgc cag ggc gag gcc ggc gag cgc ttc gat ccc gcg cac 336 Ala Phe Ser Arg Gln Gly Glu Ala Gly Glu Arg Phe Asp Pro Ala His 100 105 t gag acg ctg gtg acc ggc gcg ccc gtg ctg cgc ggc gcg ctc gcg 384 Trp Glu Thr Leu Val Thr Gly Ala Pro Val Leu Arg Gly Ala Leu Ala 115 120 125 gtg ttc gac tgc gtg gtc gac gag atg atg atg atg atg atc atg gcg 432 Val Phe Asp Cys Val Val Asp Glu Met Met Val Ala His Ser His Ala 130 135 140 atg ctg atc ggc gag gtc aag gcc gcg cgc atc acc gac gcg cag ggc 480 Met Leu Ile Gly Glu Val Lys Ala Ala Ala Arg Ile Thr Asp Ala Gln Gly 145 150 155 160 ctg ccg ctg ctc tat gcc tgc ggc cag ttc acc acc ctg cgc gac gag 528 Leu Pro Leu Leu Tyr Ala Cys Gly Gln Phe Thr Thr Leu Arg Asp Glu 165 170 175 tgc gtg gcc 543 Cys Val Pro Ala 180

<210> 13 <211> 180 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF6-7 <400> 13 Met Arg Gly Glu Phe Arg Ala Ile Glu Ser Leu Arg Cys Glu Pro Asn 1 5 10 15 Val Gly Ala Gly Asp Phe Arg Arg Ala Met Arg Cys Leu Val Gly Ala 20 25 30 Val Thr Val Val Thr Ser Thr Asp Gly Gln Thr Pro Val Gly Leu Thr 35 40 45 Ala Thr Ala Val Thr Ser Phe Ser Ala Glu Pro Ala Arg Ile Leu Ala 50 55 60 Cys Val Asn Leu Gln Gly Ser Ser Phe Arg Thr Ile Ala Gln Ser Arg 65 70 75 80 Arg Met Ala Val Asn Leu Leu Ala Leu Asp Gln Ser Ala Leu Ala Leu 85 90 95 Ala Phe Ser Arg Gln Gly Glu Ala Gly Glu Arg Phe Asp Pro Ala His 100 105 110 Trp Glu Thr Leu Val Thr Gly Ala Pro Val Leu Arg Gly Ala Leu Ala 115 120 125 Val Phe Asp Cys Val Val Asp Glu Met Met Val Ala His Ser His Ala 130 135 140 Met Leu Ile Gly Glu Val Lys Ala Ala Arg Ile Thr Asp Ala Gln Gly 145 150 155 160 Leu Pro Leu Leu Tyr Ala Cys Gly Gln Phe T hr Thr Leu Arg Asp Glu 165 170 175 Cys Val Pro Ala 180

<210> 14 <211> 1275 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF4-9 <400> 14 atg agc aac atc gca tcg cag ggc gcc aag ccg cgc cgt ttc atg atc 48 Met Ser Asn Ile Ala Ser Gln Gly Ala Lys Pro Arg Arg Phe Met Ile 1 5 10 15 gtc ggc gcg ggc cag tcg ggc ctg caa ctg gcg ctg ggc ctc cag cgc 96 Val Gly Ala Gly Gln Le Gly Leu Gln Leu Gly Leu Gln Arg 20 25 30 gag ggc cac gag gtg acc gtg gtc tcg aac cgc agc gcc gag gac atc 144 Glu Gly His Glu Val Thr Val Val Ser Asn Arg Ser Ala Glu Asp Ile 35 40 45 gca acc ggc cgc gtg atg tcg agc cag tgc atg ttc gac gcc agc ctg 192 Ala Thr Gly Arg Val Met Ser Ser Gln Cys Met Phe Asp Ala Ser Leu 50 55 60 cgg atc gag cgc gac ctc ggc atc gac cag tgg gcc gac gcc tgc ccg 240 Ar Arg Asp Leu Gly Ile Asp Gln Trp Ala Asp Ala Cys Pro 65 70 75 80 ccg gtc gag ggc atc ggc ttc gcc gtg ccg cat ccc gag aag ccc ggc 288 Pro Val Glu Gly Ile G ly Phe Ala Val Pro His Pro Glu Lys Pro Gly 85 90 95 gag aag ctg ctc ggc tgg tcg cac cgc ctc gac gcg ccc gcg cgc tcg 336 Glu Lys Leu Leu Gly Trp Ser His Arg Leu Asp Ala Pro Ala Arg Ser 100 105 110 gtc gac cag cgc gtg aag gtg ccg gcc tgg atg aag acc ttc gag gag 384 Val Asp Gln Arg Val Lys Val Pro Ala Trp Met Lys Thr Phe Glu Glu 115 120 125 cgc ggc ggg cag atc ctg ttc cag gac gc gg atc gg atc ctc gag 432 Arg Gly Gly Gln Ile Leu Phe Gln Asp Ala Gly Ile Glu Asp Leu Glu 130 135 140 cgc tgg acc cag tcg cac gac ctg gtg atc gtg gcc gcc ggc aag ggc 480 Arg Trp Thr Gln Ser His Asp Leu Val Ala Ala Gly Lys Gly 145 150 155 160 gag atc gcg cag atg ttc gaa cgt gac gcg caa cgc tcg ccc tac gac 528 Glu Ile Ala Gla Mln Pet Glu Arg Asp Ala Gln Arg Ser Pro Tyr Asp 165 170 175 aag ccg cag ctg gcc ctg acc tac gtg cac ggc atg acg ccg 576 Lys Pro Gln Arg Ala Leu Ala Leu Thr Tyr Val His Gly Met Thr Pro 180 185 190 cgc ccc gag tac tcg gcc gtc aac ttc aac ctg atc ccc ggc gtc gg Glu Tyr Ser Ala Val Asn Phe Asn Leu Ile Pro Gly Val Gly 195 200 205 gag tac ttc gtg ttc ccc gcg ctg acc gtg acg gga ccg tgc gag atc 672 Glu Tyr Phe Val Phe Pro Ala Leu Thr Val Thr Gly Pro Cys Glu Ile 210 215 220 atg gtg ttc gag ggc gtg ccc ggc ggc ccg atg gac tgc tgg gcc gac 720 Met Val Phe Glu Gly Val Pro Gly Gly Pro Met Asp Cys Trp Ala Asp 225 230 235 240 gtg aag acg ccc gcg cag cacg cg ctg tcg atc ctc gac 768 Val Lys Thr Pro Ala Gln His Leu Glu Arg Ser Leu Ser Ile Leu Asp 245 250 255 acc ttc acg ccc tgg gag gcc gag cgc tgc cgc gac gtg cgc ctg acc 816 Thr Phe Thr Pro Trp Glu Glu Glu Arg Cys Arg Asp Val Arg Leu Thr 260 265 270 270 gac gac aac ggc att ctg gcc ggc cgc ttc gcg ccc acg gtg cgc aag 864 Asp Asp Asn Gly Ile Leu Ala Gly Arg Phe Ala Pro Thr Val Arg Lys 275 280 g cc 285 cgg ctg ccc tcg ggc cgc gcc gtg ctc ggc atg ggc gac 912 Pro Val Gly Arg Leu Pro Ser Gly Arg Ala Val Leu Gly Met Gly Asp 290 295 300 gtg gtg tgc ctc aac gac ccg atc acc ggc cag ag cg ag cg ag agVal Val Cys Leu Asn Asp Pro Ile Thr Gly Gln Gly Ser Asn Asn Ala 305 310 315 320 gcc aag tgc gcc gat gcc tac ctg cgc gcc atc ctc gcg cag ggc gag 1008 Ala Lys Cys Ala Asp Ala Tyr Leu Arg Ala Ile A Gln Gly Glu 325 330 335 gac gcc ttc gac gcg gac ttc atg cag tcg gcc ttc gac ggc tat tgg 1056 Asp Ala Pla Ashe Ala tgg acc aac gcg atg ttg cag ccg 1104 Arg Tyr Ala Arg His Val Val Glu Trp Thr Asn Ala Met Leu Gln Pro 355 360 365 ccg ccc ccg cac gtg ctc gag gtg ctg ggc gcg gcc cag ggc aac gcg Val Pro Pro Leu Glu Val Leu Gly Ala Ala Gln Gly Asn Ala 370 375 380 gcc gtg gca cgg cgc ttc gtc aac ggc ttc aac gat ccg cgc gac tac 1200 Ala Val Ala Arg Arg Phe Val Asn Gly Phe Asn Asp Pro Arg Asp Tyr 400 gcc gag ttc ttc atg acg ccc gac gcg agc agc gcc tac ctg cgc tcg 1248 Ala Glu Phe Phe Met Thr Pro Asp Ala Ser Ser Ala Tyr Leu Arg Ser 405 410 415 ctg gcg ccg caa ccg gag gcg gga tga la Pro Gln Pro Glu Ala Ala 420

<210> 15 <211> 424 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF4-9 <400> 15 Met Ser Asn Ile Ala Ser Gln Gly Ala Lys Pro Arg Arg Phe Met Ile 1 5 10 15 Val Gly Ala Gly Gln Ser Gly Leu Gln Leu Ala Leu Gly Leu Gln Arg 20 25 30 Glu Gly His Glu Val Thr Val Val Ser Asn Arg Ser Ala Glu Asp Ile 35 40 45 Ala Thr Gly Arg Val Met Ser Ser Gln Cys Met Phe Asp Ala Ser Leu 50 55 60 Arg Ile Glu Arg Asp Leu Gly Ile Asp Gln Trp Ala Asp Ala Cys Pro 65 70 75 80 Pro Val Glu Gly Ile Gly Phe Ala Val Pro His Pro Glu Lys Pro Gly 85 90 95 Glu Lys Leu Leu Gly Trp Ser His Arg Leu Asp Ala Pro Ala Arg Ser 100 105 110 Val Asp Gln Arg Val Lys Val Pro Ala Trp Met Lys Thr Phe Glu Glu 115 120 125 Arg Gly Gly Gln Ile Leu Phe Gln Asp Ala Gly Ile Glu Asp Leu Glu 130 135 140 Arg Trp Thr Gln Ser His Asp Leu Val Ile Val Ala Ala Gly Lys Gly 145 150 155 160 Glu Ile Ala Gln Met Phe Glu Arg Asp Ala Gln Arg Ser Pro Tyr Asp 165 170 175 Lys Pro Gln Arg Ala Leu Ala Leu Thr Tyr Val His Gly Met Thr Pro 180 185 190 Arg Pro Glu Tyr Ser Ala Val Asn Phe Asn Leu Ile Pro Gly Val Gly 195 200 205 Glu Tyr Phe Val Phe Pro Ala Leu Thr Val Thr Gly Pro Cys Glu Ile 210 215 220 Met Val Phe Glu Gly Val Pro Gly Gly Pro Met Asp Cys Trp Ala Asp 225 230 235 240 Val Lys Thr Pro Ala Gln His Leu Glu Arg Ser Leu Ser Ile Leu Asp 245 250 255 Thr Phe Thr Pro Trp Glu Ala Glu Arg Cys Arg Asp Val Arg Leu Thr 260 265 270 Asp Asp Asn Gly Ile Leu Ala Gly Arg Phe Ala Pro Thr Val Arg Lys 275 280 285 Pro Val Gly Arg Leu Pro Ser Gly Arg Ala Val Leu Gly Met Gly Asp 290 295 300 Val Val Cys Leu Asn Asp Pro Ile Thr Gly Gln Gly Ser Asn Asn Ala 305 310 315 320 Ala Lys Cys Ala Asp Ala Tyr Leu Arg Ala Ile Leu Ala Gln Gly Glu 325 330 335 Asp Ala Phe Asp Ala Asp Phe Met Gln Ser Ala Phe Asp Gly Tyr Trp 340 345 350 Arg Tyr Ala Arg His Val Val Glu Trp Thr Asn Ala Met Leu Gln Pro 355 360 365 Pro Pro Pro His Val Leu Glu Val Leu Gly AlaAla Gln Gly Asn Ala 370 375 380 Ala Val Ala Arg Arg Phe Val Asn Gly Phe Asn Asp Pro Arg Asp Tyr 385 390 395 400 Ala Glu Phe Phe Met Thr Pro Asp Ala Ser Ser Ala Tyr Leu Arg Ser 405 410 415 Leu Ala Pro Gln Pro Glu Ala Ala 420

<210> 16 <211> 789 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF5-5 <400> 16 atg agc gac aag gac ttg cag gac agg acg gtg ctc gtc acc ggt ggc 48 Met Ser Asp Lys Asp Leu Gln Asp Arg Thr Val Val Leu Val Thr Gly Gly 1 5 10 15 gcg acc ctc atc ggt gcg ggc gtg gcc cgt tgc ctg cgc gat gcc ggt 96 Ala Thr Leu Ile Gly Ala Gly Val Ala Arg Cys Leu Arg Asp Ala Gly 20 25 30 gca cgc gtg gtg ctg gcc gac atc gac gtg gcg cgc ggc gag gcg gtg 144 Ala Arg Val Val Leu Ala Asp Ile Asp Val Ala Arg Gly Glu Ala Val 35 40 45 gcg cgc gg atg aaa ttc atc gcc acc gac atc acc gac gac 192 Ala Arg Glu Ile Gly Ala Lys Phe Ile Ala Thr Asp Ile Thr Asp Asp 50 55 60 gcc gcc gtg cag gcc tgc gtc gag cag gcg gcc gat gcc gag ggc cgc 240 Ala Ala Val Gln Ala Cys Val Glu Gln Ala Ala Asp Ala Glu Gly Arg 65 70 75 80 atc cac gcg ctc gtg aac ctg gcc tgc agc tac ctc gac aac ggc ctg 288 Ile His Ala Leu Val Asn Leu Ala Cys Ser Tyr Leu Asp Asn Gly Leu 85 90 95 gcc tcg ccg cgc ggc gaa tgg cag acc gcg ctc gac gtc aac gtg gtc 336 Ala Ser Pro Arg Gly Glu Trp Gln Thr Ala Leu Asp Val Asn Val Val 100 105 110 tc gcc gtg atg atg gcg cgt gcc acg ctg ccc ttc atg cag acc gcg 384 Ser Ala Val Met Met Ala Arg Ala Thr Leu Pro Phe Met Gln Thr Ala 115 120 125 ggc ggc ggc gcc atc gtc aac ttc acc tcg atc tcc tc gc gcc 432 Gly Gly Gly Ala Ile Val Asn Phe Thr Ser Ile Ser Ser Gly Val Ala 130 135 140 cag acc ggc cgc tgg ctc tat ccg gtg agc aag gcc gcg ctg gtg cag 480 Gln Thr Gly Arg Trp Leu Tyr Pro Val Ser Lys Ala Ala Leu Val Gln 145 150 155 160 ctc acg cgc aac atg gcg ctg gac ctg gcg gcg atg aac gtg cgc gtc 528 Leu Thr Arg Asn Met Ala Leu Asp Leu Ala Ala Met Asn Val Arg Val 165 170 175 tatgcc cct tgg acc tgg tcg gcc gtg atg gac cag ctc 576 Asn Ser Val Ser Pro Gly Trp Thr Trp Ser Ala Val Met Asp Gln Leu 180 185 190 acc ggc ggc aac cgc gcc aag acc gac gcg gtg gcc cgg ccc ttc cac 624 Thr Gly Gly Asn Arg Ala Lys Thr Asp Ala Val Ala Arg Pro Phe His 195 200 205 atg ctc ggc cgc gtc ggc gac ccg gtc gag gtc ggc cac gtg gtg gcc 672 Met Leu Gly Arg Val Gly Asp Pro Val Glu Val Gly His Val Val Ala 210 215 220 ttc ctg tgc tcg cac aag gcc tcg ttc gtc acc ggc gcc gac tgg gcc 720 Phe Leu Cys Ser His Lys Ala Ser Phe Val Thr Gly Ala Asp Trp Ala 225 230 235 240 gtg gac ggc ggc tat tcg gcc ccg gg gg ggc gag ccg gcc 768 Val Asp Gly Gly Tyr Ser Ala Leu Gly Pro Glu Gln Gly Glu Pro Ala 245 250 255 att ccc aag ctc gcg gcc tga 789 Ile Pro Lys Leu Ala Ala 260

<210> 17 <211> 262 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF5-5 <400> 17 Met Ser Asp Lys Asp Leu Gln Asp Arg Thr Val Leu Val Thr Gly Gly 1 5 10 15 Ala Thr Leu Ile Gly Ala Gly Val Ala Arg Cys Leu Arg Asp Ala Gly 20 25 30 Ala Arg Val Val Leu Ala Asp Ile Asp Val Ala Arg Gly Glu Ala Val 35 40 45 Ala Arg Glu Ile Gly Ala Lys Phe Ile Ala Thr Asp Ile Thr Asp Asp 50 55 60 Ala Ala Val Gln Ala Cys Val Glu Gln Ala Ala Asp Ala Glu Gly Arg 65 70 75 80 Ile His Ala Leu Val Asn Leu Ala Cys Ser Tyr Leu Asp Asn Gly Leu 85 90 95 Ala Ser Pro Arg Gly Glu Trp Gln Thr Ala Leu Asp Val Asn Val Val 100 105 110 Ser Ala Val Met Met Ala Arg Ala Thr Leu Pro Phe Met Gln Thr Ala 115 120 125 Gly Gly Gly Ala Ile Val Asn Phe Thr Ser Ile Ser Ser Gly Val Ala 130 135 140 Gln Thr Gly Arg Trp Leu Tyr Pro Val Ser Lys Ala Ala Leu Val Gln 145 150 155 160 Leu Thr Arg Asn Met Ala Leu Asp Leu Ala A la Met Asn Val Arg Val 165 170 175 Asn Ser Val Ser Pro Gly Trp Thr Trp Ser Ala Val Met Asp Gln Leu 180 185 190 Thr Gly Gly Asn Arg Ala Lys Thr Asp Ala Val Ala Arg Pro Phe His 195 200 205 Met Leu Gly Arg Val Gly Asp Pro Val Glu Val Gly His Val Val Ala 210 215 220 Phe Leu Cys Ser His Lys Ala Ser Phe Val Thr Gly Ala Asp Trp Ala 225 230 235 240 Val Asp Gly Gly Tyr Ser Ala Leu Gly Pro Glu Gln Gly Glu Pro Ala 245 250 255 Ile Pro Lys Leu Ala Ala 260

<210> 18 <211> 999 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF2-16 <400> 18 atg gaa cac gct gtc gct gca tcg gcc tcg ctt ccc ctg tcg cgc tat 48 Met Glu His Ala Val Ala Ala Ser Ala Ser Leu Pro Leu Ser Arg Tyr 1 5 10 15 gcc gtc atc gcc acg ccc gac ctc gac gag gcg cgc gac gag gtg gcg 96 Ala Val Ile Ala Thr Pro Asp Leu Asp Glu Ala Arg Asp Glu Val Ala 20 25 30 cgc atc ttc tgt ccg cac cgg ctg cac ctc ggg cac ggc agc tcg cgc 144 Arg Ile Phe Cys Pro His Arg Leu His Leu Gly His Gly Ser Ser Arg 35 40 45 ttc gac gcg cgc cat cac gtc gcg ccg ctg ggc gac atc tcg ctg aac 192 Phe Asp Ala Arg His His Val Ala Pro Leu Gly Asp Ile Ser Leu Asn 50 55 60 tac gtg cag tac ggc gcc gag gtc gag atc gat ccc ggc tgc Tc Gc gtc Gc gtc ggccgc Tyr Gly Ala Glu Val Glu Ile Asp Pro Gly Cys Leu Gly 65 70 75 80 gac ttc tat ctg ctg cag atc ccg ctc agg ggc aac gcc cgc atc gag 288 Asp Phe Tyr Leu Leu Gl n Ile Pro Leu Arg Gly Asn Ala Arg Ile Glu 85 90 95 tgg gcc ggc cgc tcc ttc acc tcc gac gcg cac cgc gcc tcg ctg gcc 336 Trp Ala Gly Arg Ser Phe Thr Ser Asp Ala His Arg Ala Ser Leu Ala 100 105 110 tcg ccg agc cag ccg ctg cgc atg cgc tgg ggc gac gac acg ccg cat 384 Ser Pro Ser Gln Pro Leu Arg Met Arg Trp Gly Asp Asp Thr Pro His 115 120 125 ctg atc gtg aag atc ggc aag gcg gtg gtg cag gag tcg 432 Leu Ile Val Lys Ile Gly Lys Ala Val Val Gln Arg His Trp Glu Ser 130 135 140 ctg tgc ggc gag ccg gcc ggc gcg cgg ccg ctc gaa ttc gag ccc gag 480 Leu Cys Gly Glu Pro Ala Gly Ala Arg Glu Phe Glu Pro Glu 145 150 155 160 atc gcg ctc gac gag ggc gcg ggc gcg agc gtg aag cac ctg gtg gag 528 Ile Ala Leu Asp Glu Gly Ala Gly Ala Ser Val Lys His Leu Val Glu 165 170 175 g ttc gc ctc tcg tgc ggc cgc acg ccg ctg acc acg ccc 576 Phe Leu Ala Gln Glu Leu Ser Cys Gly Arg Thr Pro Leu Thr Thr Pro 180 185 190 ttc ctg gcc cag gcc gaa tcg ggc ctg atc cac acc ctg ggg ggg ggg gg Ala G ln Ala Glu Ser Gly Leu Ile His Thr Leu Leu Gly Gln 195 200 205 ttg ccg cac aac cag agc gcg cgc ctg ggc gcc gag cgc ggc gac gtc 672 Leu Pro His Asn Gln Ser Ala Arg Leu Gly Ala Glu Arg Gly Asp 215 220 tcg ccg cgc gcg ctg cgc cgg gcc cgc gag tac atc gag gcg cac ctg 720 Ser Pro Arg Ala Leu Arg Arg Ala Arg Glu Tyr Ile Glu Ala His Leu 225 230 235 240 ccc gat gcg ctc gc gc gg gc gc gcc agc ggg ttg tgc 768 Pro Asp Ala Leu Thr Val Asp Glu Ile Ala Ser Ala Ser Gly Leu Cys 245 250 255 gtg cgc agc ctg cag gtg gcg ttc cgc cag cat gcg ggc cag acg ccg 816 Val Arg ASa Leu Gln Arg Gln His Ala Gly Gln Thr Pro 260 265 270 atg gcc tac ctg cgc gag cgg cgg ctg ctc gcg gtg cac gag cgc ctg 864 Met Ala Tyr Leu Arg Glu Arg Arg Leu Leu Ala Val His Glu Arg Leu 275 280 ag ggc gcc gac acc acc gtg acc tcg gtc gcg ctg cag ttc 912 Ser Glu Pro Gly Ala Asp Thr Thr Val Thr Ser Val Ala Leu Gln Phe 290 295 300 ggc ttc gcc cac ctc gga cgc ttc gcg caa gac tac gcg cgg cgg cgg 960Gly Phe Ala His Leu Gly Arg Phe Ala Gln Asp Tyr Ala Arg Arg Phe 305 310 315 320 ggc gaa tcg ccc cat cgc acg ctg cag cgg cag cgc tga 999 Gly Glu Ser Pro His Arg Thr Leu Gln Arg Gln Arg 325 330

<210> 19 <211> 332 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF2-16 <400> 19 Met Glu His Ala Val Ala Ala Ser Ala Ser Leu Pro Leu Ser Arg Tyr 1 5 10 15 Ala Val Ile Ala Thr Pro Asp Leu Asp Glu Ala Arg Asp Glu Val Ala 20 25 30 Arg Ile Phe Cys Pro His Arg Leu His Leu Gly His Gly Ser Ser Arg 35 40 45 Phe Asp Ala Arg His His Val Ala Pro Leu Gly Asp Ile Ser Leu Asn 50 55 60 Tyr Val Gln Tyr Gly Ala Glu Val Glu Ile Asp Pro Gly Cys Leu Gly 65 70 75 80 Asp Phe Tyr Leu Leu Gln Ile Pro Leu Arg Gly Asn Ala Arg Ile Glu 85 90 95 Trp Ala Gly Arg Ser Phe Thr Ser Asp Ala His Arg Ala Ser Leu Ala 100 105 110 Ser Pro Ser Gln Pro Leu Arg Met Arg Trp Gly Asp Asp Thr Pro His 115 120 125 Leu Ile Val Lys Ile Gly Lys Ala Val Val Gln Arg His Trp Glu Ser 130 135 140 Leu Cys Gly Glu Pro Ala Gly Ala Arg Pro Leu Glu Phe Glu Pro Glu 145 150 155 160 Ile Ala Leu Asp Glu Gly Ala Gly Ala Ser Val Lys His Leu Val Glu 165 170 175 Phe Leu Ala Gln Glu Leu Ser Cys Gly Arg Thr Pro Leu Thr Thr Pro 180 185 190 Phe Leu Ala Gln Ala Glu Ser Gly Leu Ile His Thr Leu Leu Gly Gln 195 200 205 Leu Pro His Asn Gln Ser Ala Arg Leu Gly Ala Glu Arg Gly Asp Val 210 215 220 Ser Pro Arg Ala Leu Arg Arg Ala Arg Glu Tyr Ile Glu Ala His Leu 225 230 235 240 Pro Asp Ala Leu Thr Val Asp Glu Ile Ala Ser Ala Ser Gly Leu Cys 245 250 255 Val Arg Ser Leu Gln Val Ala Phe Arg Gln His Ala Gly Gln Thr Pro 260 265 270 Met Ala Tyr Leu Arg Glu Arg Arg Leu Leu Ala Val His Glu Arg Leu 275 280 285 285 Ser Glu Pro Gly Ala Asp Thr Thr Val Thr Ser Val Ala Leu Gln Phe 290 295 300 Gly Phe Ala His Leu Gly Arg Phe Ala Gln Asp Tyr Ala Arg Arg Phe 305 310 315 320 Gly Glu Ser Pro His Arg Thr Leu Gln Arg Gln Arg 325 330

<210> 20 <211> 486 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF3-12 <400> 20 atg aca acg atg gcc acc aag aaa caa gac acc tcc tcc cgc atc gcc 48 Met Thr Thr Met Ala Thr Lys Lys Gln Asp Thr Ser Ser Arg Ile Ala 1 5 10 15 gac aac aag aag gcg gcg tac aac tat ttc ttc ttc gaa gaa cgc ttc gag 96 Asp Asn Lys Lys Ala Ala Tyr Asn Tyr Phe Phe Glu Glu Arg Phe Glu 20 25 30 gcc ggc atg gtg ctg gaa ggc tgg gaa gtg aag gcg ctg cgc gaa ggc 144 Ala Gly Met Val Leu Glu Gly Trp Glu Val Lys Ala Leu Arg Glu Gly 35 40 45 aag gtg cag ggc tac gtg gtg atc cgc gac ggc gag atg 192 Lys Val Gln Leu Thr Asp Gly Tyr Val Val Ile Arg Asp Gly Glu Met 50 55 60 ttc gtg ctg ggc tgc cag atc aac ccg ctc aag agc gcc tcgac Acc c Gly Cys Gln Ile Asn Pro Leu Lys Ser Ala Ser Thr His 65 70 75 80 gtg acg ccc gac tcg gtg cgc acc aag aag ctg ctg ctg cac aag gag 288 Val Thr Pro Asp Ser Val Arg Thr Lys Lys Leu Leu Leu His Lys Glu 85 90 95 gag atc cgc cgc ctg acc ggc aag gtc gag cag aag ggc tac acc ctg 336 Glu Ile Arg Arg Leg Thr Gly Lys Val Glu Gln Lys Gly Tyr Thr Leu 100 105 110 gtg ccg ctg aac ctg cac tgg aag gcc ggc aag gtg aag tgc gag atc 384 Val Pro Leu Asn Leu His Trp Lys Ala Gly Lys Val Lys Cys Glu Ile 115 120 125 gcg ctg gcc aag ggc aag gcc gag cac gac aag cg aag 432 Ala Leu Ala Lys Gly Lys Ala Glu His Asp Lys Arg Asp Thr Ile Lys 130 135 140 gac cgc gaa ggc aag cgc gaa gtc gag cgc gcg atg aag agc cgc agc 480 Asp Arg Glu Gly Lys Arg Glu Val Lys Ser Arg Ser 145 150 155 160 cgc tga 486 Arg

<210> 21 <211> 161 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF3-12 <400> 21 Met Thr Thr Met Ala Thr Lys Lys Gln Asp Thr Ser Ser Arg Ile Ala 1 5 10 15 Asp Asn Lys Lys Ala Ala Tyr Asn Tyr Phe Phe Glu Glu Arg Phe Glu 20 25 30 Ala Gly Met Val Leu Glu Gly Trp Glu Val Lys Ala Leu Arg Glu Gly 35 40 45 Lys Val Gln Leu Thr Asp Gly Tyr Val Val Ile Arg Asp Gly Glu Met 50 55 60 Phe Val Leu Gly Cys Gln Ile Asn Pro Leu Lys Ser Ala Ser Thr His 65 70 75 80 Val Thr Pro Asp Ser Val Arg Thr Lys Lys Leu Leu Leu His Lys Glu 85 90 95 Glu Ile Arg Arg Leu Thr Gly Lys Val Glu Gln Lys Gly Tyr Thr Leu 100 105 110 Val Pro Leu Asn Leu His Trp Lys Ala Gly Lys Val Lys Cys Glu Ile 115 120 125 Ala Leu Ala Lys Gly Lys Ala Glu His Asp Lys Arg Asp Thr Ile Lys 130 135 140 Asp Arg Glu Gly Lys Arg Glu Val Glu Arg Ala Met Lys Ser Arg Ser 145 150 155 160 Arg

<210> 22 <211> 552 <212> DNA <213> Pseudomonas sp. WF505 <223> Nucleotide sequence of ORF2-18 <400> 22 atg gac gcc cgc cag ctc gcc ccg cac att ccc ggc ctg cgc cgc tat 48 Met Asp Ala Arg Gln Leu Ala Pro His Ile Pro Gly Leu Arg Arg Tyr 1 5 10 15 gcg cgc gcg ctg acc ggc aat gcc tgg gcc gcc gac gac ctg gtg cag 96 Ala Arg Ala Leu Thr Gly Asn Ala Trp Ala Ala Asp Asp Leu Val Gln 20 25 30 gac acg ctc gag cgt gcc tgc agc aag tgg cgg ctg tgg gtg gcg ggc 144 Asp Thr Leu Glu Arg Ala Cys Ser Lys Trp Arg Leu Trp Val Ala Gly 35 40 45 agc gac ctg cgc tcc ctg ttc gcg atc atg cac aac ctc ttc gcg 192 Ser Asp Leu Arg Ala Trp Leu Phe Ala Ile Met His Asn Leu Phe Ala 50 55 60 agc cag gtg cgc cgc gcg ccg ccg ccg cat gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gtc Arg Arg Ala Pro Pro Pro His Ala Ala Val Ser Leu Asp 65 70 75 80 gaa ctg ccg ccc gaa cag cag ggc ggc gtc gac ccc ggc cgc gac cac 288 Glu Leu Pro Pro Glu Gl n Gln Gly Gly Val Asp Pro Gly Arg Asp His 85 90 95 ggc gtg cgc ctc gac ctg cag cgc tgc ctg ctg cag ctg ccg gaa gag 336 Gly Val Arg Leu Asp Leu Gln Arg Cys Leu Leu Gln 100 Leu Glu caa cgc gcc gtg ctg ctg ctg gtg acg ctc gaa gac ctg tct tat gcc 384 Gln Arg Ala Val Leu Leu Leu Val Thr Leu Glu Asp Leu Ser Tyr Ala 115 120 125 gag gtc gcg aag gtg ctc ggc atg ccc tcg cgg 432 Glu Val Ala Lys Val Leu Gly Ile Pro Leu Gly Thr Val Met Ser Arg 130 135 140 ctg tcg cgc gcc cgc gtg cgg ctg cag gaa ctg ctc gac ggc gcg gcc 480 Leu Ser Arg Ala Arg Val Arlu Leu Gln Leu Asp Gly Ala Ala 145 150 155 160 gta gcc ggc acg tcg gcg ggc aca ctg gcg ggc agt acg gcc ccg cgc 528 Val Ala Gly Thr Ser Ala Gly Thr Leu Ala Gly Ser Thr Ala Pro Arg 165 170 175 ccc ggc cg ctc aag taa 552 Pro Gly Leu Arg Arg Leu Lys 180

<210> 23 <211> 183 <212> PRT <213> Pseudomonas sp. WF505 <223> Amino acid sequence encoded by ORF2-18 <400> 23 Met Asp Ala Arg Gln Leu Ala Pro His Ile Pro Gly Leu Arg Arg Tyr 1 5 10 15 Ala Arg Ala Leu Thr Gly Asn Ala Trp Ala Ala Asp Asp Leu Val Gln 20 25 30 Asp Thr Leu Glu Arg Ala Cys Ser Lys Trp Arg Leu Trp Val Ala Gly 35 40 45 Ser Asp Leu Arg Ala Trp Leu Phe Ala Ile Met His Asn Leu Phe Ala 50 55 60 Ser Gln Val Arg Arg Ala Pro Pro Pro His Ala Ala Val Ser Leu Asp 65 70 75 80 Glu Leu Pro Pro Glu Gln Gln Gly Gly Val Asp Pro Gly Arg Asp His 85 90 95 Gly Val Arg Leu Asp Leu Gln Arg Cys Leu Leu Gln Leu Pro Glu Glu 100 105 110 Gln Arg Ala Val Leu Leu Leu Val Thr Leu Glu Asp Leu Ser Tyr Ala 115 120 125 Glu Val Ala Lys Val Leu Gly Ile Pro Leu Gly Thr Val Met Ser Arg 130 135 140 Leu Ser Arg Ala Arg Val Arg Leu Gln Glu Leu Leu Asp Gly Ala Ala 145 150 155 160 Val Ala Gly Thr Ser Ala Gly Thr Leu Ala Gly Ser Thr Ala Pro Arg 165 170 175 Pro Gly Leu Arg Arg Leu Lys 180

<210> 24 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 24 ggctgaacct gattctg 17

<210> 25 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 25 caggtgcttc acgctcg 17

<210> 26 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 26 tttgccaatt gggcggcgac 20

<210> 27 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 27 cgtagccttc ttccgcg 17

<210> 28 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 28 tcaacctgct cgcgctc 17

<210> 29 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 29 ctgcccttca tgcagac 17

<210> 30 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 30 gcaagtcctt gtcgctc 17

<210> 31 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 31 gcgagcgctc gaggtgc 17

<210> 32 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 32 agcggctgcg caatccg 17

<210> 33 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 33 tcgacctcgg cgccgta 17

<210> 34 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 34 gtcgaccatg ccttcgcacg gctgg 25

<210> 35 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 35 ctcggctggt cgcaccgcct cgacg 25

<210> 36 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 36 cccgcgctga ccgtgacggg accgt 25

<210> 37 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 37 gccgatgcct acctgcgcgc catcc 25

<210> 38 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 38 gagtcgctgc gctgcgaacc caacg 25

<210> 39 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 39 cgcgctcgcg gtgttcgact gcgtg 25

<210> 40 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 40 ccggcatcgt gctggcgcag gagat 25

<210> 41 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 41 cgtctgcgtg ggctactacg gcgtg 25

<210> 42 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 42 ctgatggcgc acgagcgcag cgtgg 25

<210> 43 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 43 gctggtgcag ctcacgcgca acatg 25

<210> 44 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 44 gtggcgatga cggcatagcg cgaca 25

<210> 45 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 45 tgccgatctt cacgatcaga tgcgg 25

<210> 46 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 46 gcatcgggca ggtgcgcctc gatgt 25

[Brief description of the drawings]

FIG. 1 consists of 11279 bp shown in SEQ ID NO: 1.
FIG. 3 is a diagram showing the position of an open reading frame (ORF) estimated from the nucleotide sequence of a DNA region.

FIG. 2 shows strain T5-9 lacking benzothiophene oxidation activity.
FIG. 1 is a diagram showing a transposon insertion site on the genome of -1.

FIG. 3 shows that the length including the btoA and btoB genes is 2059.
FIG. 2 shows that the ApaI DNA fragment of bp (DNA base sequence 7396-8968) encodes a protein having benzothiophene oxidation activity.

FIG. 4 is a diagram comparing the amino acid sequences of a protein encoded by ORF4-9 (btoA) and D-amino acid oxidase.

FIG. 5 shows a protein encoded by ORF6-7 (btoB) and Chelatobacter heintz
It is a figure which compared the amino acid sequence of the protein which the component B gene (nmoB) of nitrilotriacetate monooxygenase of ii ) encoded.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C10G 32/00 B09B 3/00 ZABE (C12N 15/09 ZNA C12R 1:38) (C12N 1/21 C12R 1 : 19) (C12N 9/02 C12R 1:19) (72) Inventor Shinichi Kajie 1-3-1 Nishitsurugaoka, Oi-machi, Iruma-gun, Saitama F-term in Tonen Research Laboratory 4B024 AA03 AA17 BA08 CA01 CA07 DA06 4B050 CC03 DD02 DD20 4B065 AA26X AA26Y AA99Y AB01 BA02 CA28 CA55 4D040 DD01 DD16

Claims (7)

[Claims] 1. A protein having an amino acid sequence represented by SEQ ID NO: 19 and having a function of regulating the expression of a benzothiophene oxidase gene, or a deletion of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 19. A protein having an amino acid sequence modified by loss, addition and / or substitution and maintaining a function of regulating the expression of a benzothiophene oxidase gene gene. 2. A protein having the amino acid sequence shown in SEQ ID NO: 15 and having benzothiophene oxidizing activity, or deletion, addition and / or substitution of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 15 A protein having an amino acid sequence modified by the above and maintaining benzothiophene oxidizing activity. 3. A protein having the amino acid sequence shown in SEQ ID NO: 13 and controlling the activity of benzothiophene oxidase by carrying out the redox activity of a coenzyme, or 1 or 2 in the amino acid sequence shown in SEQ ID NO: 13. A protein having an amino acid sequence modified by deletion, addition and / or substitution of a plurality of amino acids and maintaining the function of controlling the activity of benzothiophene oxidase by taking on the redox activity of a coenzyme. A gene encoding the protein according to any one of claims 1 to 3. 5. A vector comprising the gene according to claim 4. 6. A host transformed by the vector according to claim 5. 7. The method for producing a protein according to any one of claims 1 to 3, wherein a gene encoding the protein is expressed in a host.