ITVR20110239A1 - SEQUENCES OF MICRORNA IDENTIFIED IN POPULATIONS AND EMATICAL SUB-POPULATIONS - Google Patents

Description

MICRORNA SEQUENCES IDENTIFIED IN HEMATIC POPULATIONS AND SUB-POPULATIONS

TECHNICAL FIELD OF INVENTION

The present invention relates to the identification of new small-sized RNAs which are new microRNAs present in blood cells.

STATE OF THE PRIOR ART

MicroRNAs (hereafter simply referred to as miRs) are small single-stranded RNA molecules, approximately 21-23 nucleotides in length, which regulate gene expression primarily by binding to the 3'-untranslated regions of specific messenger RNAs (mRNAs) , as described by Fabian MR, Sonenberg N, Filipowicz W, in â € œRegulation of mRNA translation and stability by microRNAsâ €, Annu Rev Biochem, 2010; 79: 351-379.

MiRs are not translated into proteins, ie they are non-coding RNAs. They are processed from primary transcripts known as pri-miRNAs to short hairpin structures called pre-miRNAs and finally to functional miRs.

Since each miR is capable of modulating the expression of multiple genes, their overall impact on regulating normal cell phenotypes is potentially enormous.

In recent years, miRs have been shown to intervene in various processes, including early development, cell proliferation, apoptosis and cell differentiation. Furthermore, alterations in the expression, structure and function of miRs are known to play a role in several diseases including cancer.

Like other transcriptional units, a significant subset of all miRs encoded in the genome is likely to exhibit tissue-specific expression. Therefore, a thorough understanding of the role of miRs in any normal or pathological process requires the identification of the complete set of miRs, also called "miRnome", expressed in the tissue under examination.

In the most recent version of the miRBase Sanger at http://www.mirbase.org, as described by GriffithsJones S, Saini HK, van Dongen S, Enright AJ in â € œmiRBase: tools for microRNA genomicsâ €, Nucleic Acids Res, 2008; 36: D154-158, a total of 1733 human and 1178 murine miRs have been identified and deposited to date.

However, current methods of identifying miRs are not sensitive enough to detect miRs that are expressed in a few cells within a tissue. Hence, it is likely that many specific miRs for a given cell type have not yet been identified, supporting the need to analyze miRs profiles from purified cell populations.

AIMS OF THE INVENTION

An object of the present invention is to improve the prior art.

Another object of the present invention is to define small RNAs which are new miRs specific for given blood cell populations.

Another object of the present invention is to define small RNAs which are produced by T-cell leukemia virus type 1 (HTLV-1).

Furthermore, an aim of the present invention is to study the newly identified miRs in order to understand their effects on the differentiation of normal cells.

Another aim of the present invention is to study the newly identified miRs in order to understand their role in haematological diseases. Another object of the invention is to define miRs which serve as markers for haematological diseases.

Another object of the present invention is to constitute a microRNA array comprising small RNAs which are new miRs specific for defined hematological cell populations.

Furthermore, in one version of the invention, the aim is to provide a method of correlating the expression level of at least one of the small RNAs that are new specific miRs for defined populations of haematological cells in malignant haematological neoplasms, in particular with the development of haematological neoplasms and / or with the histology of the haematological tumor and / or with the differentiation of the haematological tumor and / or with the survival of the patient.

In another version of the invention, the goal is to provide new drug targets, in order to prevent the proliferation of one or more hematological tumors. Such targets will comprise at least one isolated 17-25 nucleotide RNA molecule characterized by being a hematological cell specific or HTLV-1 specific miR and ranging from SEQ ID NO: 1-699.

FORMS OF IMPLEMENTATION OF THE INVENTION

The present invention relates to new small RNA molecules. These new small RNAs are new microRNAs, hereinafter referred to as miRs.

These miRs are 17-25 nucleotides long.

These miRs were isolated from the analyzed hematological cell populations, in particular leukocyte populations, as better indicated below.

The identification of small RNA specific for a cell type is essential to understand their effects on the differentiation of normal cells and will represent the basis for studying their aberrant expression in pathologies.

In the present invention, the role of miRs has been analyzed in two biological contexts:

1) normal lymphoid differentiation and B and T lymphomagenesis / leukemogenesis; And

2) myelo-monocytic differentiation normal and during neoplastic growth.

The approach followed was aimed at isolating the complete set of miRs expressed in these cells.

Small RNA libraries have been generated as reported in Lau NC, Lim LP, Weinstein EG, Bartel DP in â € œAn abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegansâ €, Science, 2001; 294: 858-862.

However, the procedure for preparing a small RNA library has been modified to accommodate a new sequencing technology that allows direct sequencing of PCR products through 454 Life Sciences nanosequencing technology.

This procedure guarantees the sequencing of thousands of sequences in 2-3 hours and avoids the step of generating and analyzing bacterial colonies. This approach generated large datasets in a short time and with significantly reduced costs. The second generation 454 Genome Sequencer FLX is capable of producing 100 Mb of reads (i.e. sequences) with 99.5% accuracy and an average length of over 250 bases.

The generation of libraries of small RNAs for the definition of miRs by means of the original procedure or modified in a different way than that previously indicated can be obtained without departing from the protective aims of the present invention.

In order to define their specific miRs, the following human leukocyte cell populations were examined:

Table 1

# Cellular type

1 CD4 <+> T lymphocytes, positive selection

2 CD4 <+> stimulated T cells, positive selection,

3 CD4 + T lymphocytes, negative selection

4 CD4 <+> stimulated T cells, negative selection,

5 HTLV-1 infected C91PL T cell line

6 HTLV-1 infected MT-2 T cell line

7 CD8 <+> peripheral T lymphocytes

8 Immature CD4 <+> / CD8 <+> thymocytes

9 Total population of thymocytes (not separated)

10 CD14 <+> (monocytes / macrophages)

11 CD15 <+> (granulocytes)

12 eosinophils

13 CD14 <+> / CD16 <-> (resident monocytes)

14 CD14 <low> / CD16 <+> (inflammatory monocytes)

In order to define their specific miRs, the following mouse leukocyte cell populations were examined:

Table 2

# Cellular type

1 CD11b <+> from spleen Balb / c (non-suppressive myeloid cells)

2 CD11b <+> from spleen of 4T1 tumor-bearing mice (myeloid suppressor cells)

3 CD11b <+> from tumor of 4T1 tumor-bearing mice (myeloid suppressor cells)

The experiments reported below, by way of explanation but not limited to the present invention, concern a method used for the isolation and identification of miRs in the cell populations of leukocytes reported above. However, additional cell populations or leukocyte cell populations isolated in different ways can also be used. Furthermore, in accordance with the present invention, various conventional techniques of cell biology, molecular biology, microbiology, recombinant DNA and immunology can be used, together with other techniques commonly present in laboratory practice.

Isolation of RNA from purified leukocyte populations and cell lines

Peripheral CD4 <+> T lymphocytes were isolated by negative or positive selection from peripheral blood mononuclear cell samples, here referred to as PBMC, from healthy donors, obtained by separation of the buffy coat fraction with Ficoll-Hypaque.

For the negative selection, a part of the PBMC sample was immediately processed using the MACS CD4 <+> T cell Isolation Kit II (Miltenyi Biotec), lysate and the RNA was extracted. The remaining PBMCs were cultured in a complete RPMI medium (1x10 <6> cells / ml) supplemented with 100 micrograms / ml of phytohemagglutinin, also called PHA, for 48 hours followed by 48 hours in the presence of 50 U / ml of interleukin- 2 (IL -2) and then processed with the MACS CD4 <+> T cell Isolation Kit II. In this way, the cell populations indicated respectively with 3 and 4 in table 1 were obtained. For the positive selection, the entire PBMC sample was immediately treated with MACS CD4 Microbeads (Miltenyi). One half of the resulting CD4 <+> cell sample was immediately lysed and the RNA was extracted. The other half was cultured, stimulated with PHA followed by IL-2, and then collected for RNA extraction. In this way, the cell populations indicated respectively with 1 and 2 in Table 1 were obtained.

Cell lines C91PL and MT-2, which are HTLV-1 chronically infected T cell lines, were maintained in RPMI medium supplemented with 10% fetal bovine serum, glutamine, penicillin and streptomycin.

In this way, the cell populations indicated respectively with 5 and 6 of table 1 were obtained.

After informed consent, thymus samples were obtained as surgical tissue scraps from 35 pediatric patients undergoing cardiac surgery. The CD4 <+> / CD8 <+> thymocyte subsets were purified, with a purification percentage greater than 95%, by flow cytometric cell sorting after triple labeling with anti-CD2, anti-CD4 and anti -CD8. Cell sorting was done with a FACSVantage Cell Sorter.

In this way, the cell population indicated with 8 in table 1 was obtained.

The total unseparated thymocyte population corresponds to sample 9 of table 1.

Peripheral CD8 <+> T cells were isolated from PBMC by immunomagnetic separation (Miltenyi Biotec) to a purity greater than 85%.

The resulting peripheral CD8 <+> T cells correspond to sample 7 in Table 1.

Granulocytes were isolated under endotoxin-free conditions from a healthy donor buffy coat by centrifugation on Ficoll-Paque Plus. No monocytes were identified in the neutrophil preparations, as revealed by the May-GrÃ1⁄4nwald-Giemsa stain. Neutrophils were further purified with magnetic negative selection using a custom blend containing antibodies CD3, CD19, CD36, CD49d, CD56 and glycophorin A (StemCell Technologies). Briefly, the cells (10 <8> / mL) were resuspended in a buffer containing a phosphate-based saline buffer (PBS) with 2% fetal bovine serum (FCS) and 1 mM ethylenediaminetetraacetic acid (EDTA) integrated with the EasySep Enrichment Custom Cocktail for 15 min. EasySep Magnetic Nanoparticles were added and incubated at room temperature for 10 min. Cells were separated in a magnetic field (2 x 5 min) and resuspended in RPMI medium supplemented with 10% FCS with low endotoxin level. By flow cytometry, it was estimated that the neutrophil preparation thus obtained has a purity higher than 98%.

The CD15 <+> granulocyte population corresponds to sample 11 of table 1.

Monocytes / macrophages were isolated from buffy coats of healthy donors by density gradient Ficoll-Hypaque centrifugation, and purified and enriched by positive immunomagnetic separation with CD14 <+> beads (Miltenyi, Biotech), as indicated by the manufacturer.

Flow cytometry analysis has shown that over 97% of the cells obtained are positive for CD14.

The CD14 <+> monocyte / macrophage population corresponds to sample 10 in Table 1.

Two sub-populations and CD14 <+> of monocytes were also analyzed, namely cells / CD16 <-> and CD14 <+> / CD16 <+>. These two circulating monocyte populations are considered the precursors of inflammatory human macrophages (sample 14 in table 1) and resident (sample 13 in table 1).

Eosinophils were isolated under endotoxin-free conditions from buffy coats of healthy donors by centrifugation on Ficoll-Paque Plus. Eosinophils were purified and enriched using the EasySep Negative Human Eosinophil (Stemcell technology) kit, as indicated by the manufacturer. The resulting purified eosinophil population corresponds to sample 12 in Table 1.

For CD11b <+> samples, tumor-bearing or tumor-free mice were sacrificed, and their tumors and spleens collected under sterile conditions. Single-cell suspensions were prepared, and the cells were isolated with magnetic beads conjugated with mouse monoclonal anti-mouse / human (anti-mouse / human) CD11b <+> (Miltenyi Biotec) antibodies. Cells were washed with buffer to remove unbound antibody and isolated on VarioMACS (Miltenyi Biotec) columns according to the manufacturer's instructions. The purity of the cell populations was assessed by flow cytometry and exceeds 90%.

The resulting cell populations are shown as samples 1, 2 and 3 in Table 2.

Generation of small RNA libraries

Total RNA was isolated using TRIzol (Invitrogen). RNA quality was assessed by electrophoresis using the RNA 6000 Nano Assay LabChip Kit and the Agilent 2100 Bioanalyzer, and the RNA concentration was measured using a NanoDrop spectrophotometer. A 10 microgram aliquot of each total RNA preparation was labeled with a 23 nucleotide RNA tracer labeled with <32> P (tracer oligo RNA called "# 909") and then subjected to polyacrylamide gel electrophoresis (PAGE) 15% denaturing, with an aliquot of molecular weights for RNA previously labeled with <32> P (<32> P-labeled Decade RNA ladder). The presence of the RNA tracer allowed the visualization of each modification and purification after exposure of the gel to a phosphorimaging screen (Storm, GE Healthcare). Species migrating in the 17-25 nucleotide size range were excised from the gel, eluted and precipitated in ethanol. The RNA was then modified by adding a 17 nucleotide (nt) linker called "IDT Cloning Linker 1" (IDT) at the 3 'end with the RNA ligase (GE Healthcare), and purified in PAGE through a 12% denaturing gel. Subsequently, it was modified with a second 17 nt oligonucleotide linker called "17.93R" at the 5 'end, and purified again in PAGE through a 10% denaturing gel.

The resulting modified RNA was back-transcribed and PCR amplified in a preparation for 454 sequencing according to a protocol provided by Dr. G. Hannon (Cold Spring Harbor Laboratory) with minor modifications as follows.

The RNA was back-transcribed using the Superscript II reverse transcriptase (Invitrogen) and an anti-sense primer complementary to the 3 'linker called "# 914 RT".

The resulting cDNA was amplified in PCR with DNA polymerase Platinum Taq (Invitrogen) with a specific primer for linker 5â € ™ named "# 913" and primer "# 914 RT", specific for linker 3 '. The PCR products were purified through a 12% non-denaturing polyacrylamide gel and digested with PacI (New England Biolabs) to eliminate the cDNA complementary to the RNA tracer used, which contains a PacI site.

The digestion mix was PAGE through a 12% non-denaturing gel to eliminate digested tracer molecules.

The DNA obtained was subjected to a second round of PCR using sense and antisense primers A and B specific for the 5 'and 3' linkers, respectively. Primer A contains an additional identification sequence or â € œtagâ €, which is indicated as underlined in the primer list below. The use of a specific primer A for each cell population allowed the sequencing of various samples at the same time, accelerating the sequencing phase: the tag made it possible to select the reads relating to a given sequenced library.

The PCR product was purified by PAGE, digested again with PacI, and again purified in gel as described above.

The obtained samples were subjected to mass sequencing 454.

Oligonucleotides used to modify small RNAs and trace their migration into denaturing PAGE:

ï ‚donor oligo end 3 'called â € œIDT Cloning Linker 1â € (SEQ ID NO: 700):

5'Appctgtaggcaccatcaat3ddc

Note: blocked at the 3 'end with ddC; adenylactivated at the 5 'end.

ï ‚· acceptor oligo end 5 called â € œ17.93Râ € (SEQ ID NO: 701):

5â € ™ atcgtaggcaccugaaa 3â € ™

Note: DNA-RNA hybrid; RNA written in italics

ï ‚oligo Tracer RNA named â € œ # 909â € (SEQ ID NO: 702):

5 'ugucaguuuguuaauuaacccaa 3'

Note: modified with a 5 'phosphate group

Primers used in RT-PCR to generate libraries:

ï ‚Reverse transcription: named â € œ # 914 RTâ € (SEQ ID NO: 703):

5â € ™ attgatggtgcctacag 3â € ™

ï ‚First round of PCR:

- Sense primer named â € œ # 913â € (SEQ ID NO: 704):

5â € ™ atcgtaggcacctgaaa 3â € ™

- Antisense primer called â € œ # 914 RTâ €

ï ‚· Second round of PCR:

- Sense primer called â € œA0â € (SEQ ID NO: 705):

5â € ™ gcctccctcgcgccatcagatcgtaggcacctgaaa 3â € ™

- Sense primer called â € œA1â € (SEQ ID NO: 706):

5â € ™ gcctccctcgcgccatcagtagcatcgtaggcacctgaaa 3â € ™

- Sense primer called â € œA2â € (SEQ ID NO: 707):

5â € ™ gcctccctcgcgccatcagcgtaatcgtaggcacctgaaa 3â € ™

- Sense primer called â € œA3â € (SEQ ID NO: 708):

5â € ™ gcctccctcgcgccatcagatcgatcgtaggcacctgaaa 3â € ™

- Sense primer called â € œA4â € (SEQ ID NO: 709):

5â € ™ gcctccctcgcgccatcagtcagatcgtaggcacctgaaa 3â € ™

- Antisense primer called â € œBâ € (SEQ ID NO: 710):

5â € ™ gccttgccagcccgctcagattgatggtgcctacag 3â € ™

Identification of small RNA sequences through bioinformatics analysis

The sequences of the reads were subjected to computational analysis to identify known and new microRNAs.

First, the 5 'and 3' portions of sequences corresponding to the linkers and PCR primers used to generate the libraries were removed from the raw sequences and the resulting sequences, untagged (de-tagged), of 17- 25 nt.

These sequences were mapped into the human and mouse genomes, allowing at most a mismatch or a gap.

Sequences with more than 50 different loci on the genome and low-complexity sequences, probably derived from repetitive elements, were discarded.

The genomic region of 90 nt at the 5 'and 3' of each sequence was added to construct a "premicroRNA", which was tested to assess the likelihood of forming a hairpin structure.

The sequences that passed the secondary structure test were then filtered to exclude those mapping to known non-coding RNA gnomic positions, thus excluding sno-RNA, snRNA, rRNA and tRNA.

The sequences that passed this test, the so-called "clean sequences", were compared with known human miRs using the UCSC microRNA hairpin database and the Sanger miRBASE.

In these steps, 2 jumps (gaps) and 2 mismatches were allowed in order to take into account possible events of RNA modifications. This step allowed to divide the sequences into known miRs and new miRs candidates.

The sequences of the second category were compared with the known microRNAs of other species present in the Sanger miRBASE, in which 2 gaps and 2 mismatches were allowed in order to distinguish between "homologues" and "new miRs candidates. ".

The sequences of the second group have been classified both according to their conservation in 17 species considered by the PHAST software and including Homo sapiens, various other mammals, chicken, vertebrate fish, Xenopus, and according to their genomic position, to determine an external position with respect to to existing genes, i.e. intergenic, or within existing genes, i.e. intragenic.

The intragenic sequences were further classified based on their position within exons or introns of the coding or non-coding genes.

The sequences identified in human leukocyte populations correspond to the sequences from SEQ ID NO. 1 up to SEQ ID NO. 368. The sequences identified in mouse leukocyte cell populations correspond to the sequences from SEQ ID NO. 369 up to SEQ ID NO. 697.

To identify the viral miRs, the "de-tagged" sequence set was compared with the whole genome of HTLV-1 (Genbank accession no. J02029 M33896). Sequences with 90% or greater overlap with HTLV-1 and with a maximum of 2 gaps and a maximum of 2 mismatches were further analyzed. The resulting HTLV-1 sequences correspond to the SEQ ID NO sequences.

698 and SEQ ID NO. 699.

Verification of the expression of the small RNA sequences corresponding to new miR candidates

A small number of the new sequences were analyzed by Northern blotting or RT-PCR performed on RNA isolated from PBMC as described by Fulci V, Chiaretti S, Goldoni M, et al. in â € œQuantitative technologies establish a novel microRNA profile of chronic lymphocytic leukemiaâ €, Blood. 2007; 109: 4944-4951, from Sharbati-Tehrani S, Kutz-Lohroff B, Bergbauer R, Scholven J, Einspanier R in â € œmiR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sampleâ € in BMC Mol Biol.

2008; 9: 34 and da Basso K, Sumazin P, Morozov P, et al â € œIdentification of the human mature B cell miRNomeâ € in Immunity. 2009; 30: 744-752. The expression of 10 sequences was verified in PBMC using this approach.

However, to complete a more massive validation, and also to define a biological role for the new sequences, complementary probes have been spotted on arrays.

These arrays were used to detect small RNAs present in CD4 <+> T cells and HTLV-1 infected C91PL and MT-2 cell lines, the same sources of biological samples used for the generation of small RNA libraries 1-6 . The RNA was labeled with a fluorochrome using the miRCURY LNA microRNA Power Labeling Kit (Exiqon) and hybridized to custom arrays according to the manufacturer's instructions. The images were acquired with the Agilent scanner and subjected to bio-computer analysis. Comparing data from custom arrays with sequences from libraries facilitates the identification of new small RNAs that are actually expressed in specific cell types.

Similar analyzes will be performed for the other biological samples.

The present study added new members to the class of small non-coding RNAs, in particular new miRs.

The present invention also refers to the miR array containing the probes complementary to the miRs molecules specific for haematological cells: SEQ ID NO sequences. 1-697. These miR arrays are suitable for a variety of studies, including diagnostic and / or pathological ones.

In particular, the miR array can be used to correlate the expression level of at least one of the miRs included in it with the development of haematological tumors, in terms of tumor histology, patient differentiation and / or survival, etc.

In one version of the invention, the miR array is used for studies on the regulatory activity of at least one of the miRs included in it in order to analyze the impact of its overexpression or inhibition of expression under conditions of pathologies of leukocyte cells.

In another version of the invention, the miR array can be used to compare the expression of at least one of the miRs with the proteomics and / or phosphoproteomics profiles of haematological cells under haematological conditions against control data .

The new arrays are suitable for the analysis of a full spectrum of haematological malignancies including Hodgkin's lymphoma, B- and T-cell leukemias and non-Hodgkin's lymphomas, myeloid leukemias and myeloid dysplasia syndromes, as well as other diseases . At least one of the miRs indicated in the present invention has further applications in oncology, since some of the new sequences can show distinct expression profiles in neoplastic cells of the haematological type compared to the normal cell. These sequences could then serve as markers that can be used to classify and / or group patients with hematological tumors.

In a further version of the invention, the isolated small RNA molecules according to the present invention can be used as markers in order to establish a correlation between clinical results, such as patient survival and / or response to therapy, and expression level of at least one of the miRs of the invention.

In another version of the invention, at least one of the miRs of the present invention can regulate the expression of specific genes in haematological tumors.

In another version of the invention, the small RNA sequences produced by HTLV-1, which correspond to SEQ ID NO. 698 and NO ID SEQ. 699, represent markers of viral infection and can influence the expression of viral and cellular mRNAs.

In a further version, the invention relates to a pharmaceutical composition for preventing the proliferation of one or more hematological tumors, comprising at least one isolated molecule of small RNA corresponding to a miR of NO SEQ ID. 1-697.

The invention also relates to the use of this pharmaceutical composition for the manufacture of a medicament for the prevention or treatment of a hematological tumor.

The present invention thus conceived can be modified and have further embodiments that fall within the protective scope of the present invention.

Claims (21)

CLAIMS 1. Isolated molecule of small RNA of 17-25 nucleotides characterized by the fact of being a specific microRNA molecule for haematological cells corresponding to a sequence selected among the sequences SEQ ID: 1-699. 2. Isolated small RNA molecule according to claim 1, wherein said microRNA is specific for leukocyte cell populations. Isolated small RNA molecule according to claim 1 or 2, wherein said leukocyte cell populations are isolated from human mononuclear cells from peripheral blood or human cell lines. Isolated small RNA molecule according to any one of the preceding claims, wherein said leukocyte cell populations comprise at least one of the following humans: CD4 T cells, stimulated CD4 <+> T cells, peripheral CD8 <+> T cells, immature thymocytes CD4 <+> / CD8 <+>, total population of thymocytes, monocyte / macrophage cells CD14 <+>, granulocytes CD15 <+>, eosinophils, resident monocytes CD14 <+> / CD16, inflammatory monocytes CD14 <low> / CD16 <+>, HTLV-1 infected T cell C91PL line, HTLV-1 infected T cell MT-2 line. 5. Isolated small RNA molecule according to claim 1 or 2, wherein said leukocyte cell populations are isolated from mice. The isolated small RNA molecule according to claim 5, wherein the mouse isolated leukocyte cell populations comprise at least one of the following populations: non-suppressive CD11b <+> myeloid cells obtained from spleen of Balb / c mice, CD11b <myeloid cells +> suppressors obtained from the spleen of mice carrying 4T1 tumor, myeloid cells CD11b <+> suppressors obtained from the tumor of mice bearing 4T1 tumor. 7. Isolated molecule of small RNA according to claims 1-4, wherein said microRNA corresponds to a sequence selected among the sequences SEQ ID NO: 1-368. 8. Isolated molecule of small RNA according to claims 5 or 6, wherein said microRNA corresponds to a sequence selected among the sequences SEQ ID NO: 369-697. Small RNA isolated molecule according to any one of the preceding claims, wherein at least one of said microRNA is used for the production of a microRNA array. 10. MicroRNA array comprising at least one probe complementary to the isolated 17-25 nucleotide small RNA molecule, characterized by being a blood cell specific microRNA molecule corresponding to a sequence selected from SEQ ID: 1-699 specific sequences for leukocyte cell populations according to one of the preceding claims 1-9. 11. Correlation method of the expression level of at least one of the microRNAs according to one of claims 1-9 in a haematological neoplasm, in order to correlate the expression level of at least one microRNA with the development of the haematological neoplasm and / or with the ™ histology of the haematological tumor, and / or with the differentiation of the haematological tumor, and / or with the survival of the patient, including the following phases: - provide a microRNA array comprising at least one probe complementary to the isolated 17-25 nucleotide small RNA molecule corresponding to a microRNA molecule specific for hematological cells or specific for HTLV-1 comprising at least one sequence selected from the SEQ ID NO sequences: 1-699, - obtain a sample from a haematological neoplasm suitable for hybridization with these probes, - hybridizing said suitable sample on said microRNA array resulting in a hybridization level, - detect said hybridization level of said sample on said microRNA array, - correlating said level of hybridization with a specific development phase of said haematological neoplasm. Method according to claim 11, wherein said hematological neoplasm comprises a tumor of at least one of the following types: Hodgkin's lymphoma, B- and T-cell leukemias and non-Hodgkin's lymphomas and, myeloid leukemias and myeloid dysplasia syndromes, other pathologies of haematological type. Method according to claim 11 or 12, wherein said step of correlating said hybridization level comprises correlating the upregulation or downregulation of said microRNA in said pathological haematological condition on the basis of control samples and determining the regulatory activity of said microRNA. Method according to any one of claims 11-13, wherein said correlating step comprises correlating said hybridization level with the proteomic and / or phosphoproteomic profiles of haematological cells under conditions of haematological pathology, in comparison with control samples, determining the regulation of said at least one microRNA on at least one identified post-translation modification in a protein of at least one of said hematological neoplasms. 15. Isolated molecule of small RNA of 17-25 nucleotides characterized in that it is a microRNA molecule specific for hematological cells or specific for HTLV-1 comprising a sequence selected among the sequences SEQ ID NO: 1-699 according to any one of the claims 1-9, for use as a marker of a hematological tumor. 16. Isolated molecule of small RNA according to the preceding claim, wherein said marker is used for the classification and / or grouping of hematological tumors. 17. Isolated molecule of small RNA according to claim 15 or 16, wherein said marker is used to establish a correlation between clinical results, in terms of patient survival and / or response to therapy, and the expression level of at least one of called microRNAs. 18. Isolated molecule of small RNA of 17-25 nucleotides characterized by being a microRNA molecule specific for haematological cells or specific for HTLV-1 comprising a sequence selected among the sequences SEQ ID NO: 1-699, for the use as a marker of viral infection. 19. Isolated molecule of small RNA of 17-25 nucleotides characterized in that it is a microRNA molecule specific for hematological cells or specific for HTLV-1 comprising a sequence selected among the sequences SEQ ID NO: 1-699 according to any one of the claims 1-18, for use as a regulator of gene expression in a haematological tumor. 20. Pharmaceutical composition for preventing the proliferation of one or more hematological tumors comprising at least one isolated molecule of small RNA of 17-25 nucleotides characterized by being a microRNA molecule specific for hematological cells or specific for HTLV-1 and comprising a sequence selected from the sequences SEQ ID NO: 1-699. 21. Use of the pharmaceutical composition according to the preceding claim for the manufacture of a medicament for the prevention or treatment of a hematological tumor.