ITRM930551A1 - PROCEDURE FOR IN VITRO PROPAGATION OF THE HEPATITIS C VIRUS IN NON-LYMPHOBLASTOID ANIMAL CELL CULTURES AND RELATED PRODUCT - Google Patents

Description

DESCRIPTION

accompanying a patent application for industrial invention entitled:

"Procedure for the in vitro propagation of the Hepatitis C virus in non-lymphoblastoid animal cell cultures and relative product"

The present invention relates to a process for the in vitro serial propagation of the Hepatitis C virus in non-lymphoblastoid animal cell cultures and relative product.

Pi? in particular, the invention relates to a method for propagating the HCV virus in cell cultures to be used for the preparation of its immunogenic antigens, or for the preparation of diagnostic kits, or for the evaluation of antiviral agents.

The hepatitis C virus? has recently been identified as the main causative agent responsible for post-transfusional and sporadic forms of non-A non-B hepatitis (Hollinger & Lin, 1992). Despite acute HCV hepatitis manifests itself with a symptomatology of lesser severity? compared to the forms of hepatitis A and B, in about 50% of cases the acute HCV infections evolve towards chronic forms? persistent, and about one fifth of chronic infection cases undergo liver cirrhosis. Furthermore, ? chronic HCV infection? found to be statistically significantly associated with the development of primary liver cancer in Europe, Japan and the United States (Plagemann, 1991). There are no known natural hosts of the infection other than humans. Attempts to cultivate HCV in vitro in cell cultures and in vivo in small laboratory animals have either consistently failed or have not proved conclusive (Reyes & Baroudy, 1991). However, the infection can? be parenterally transmitted to the chimpanzee, in which it causes a spectrum of clinical manifestations ranging from complete absence of symptoms to acute febrile jaundice.

The complete viral particles, with a diameter of about 60nm, consist of a protein capsid with a diameter of about 30nm, surrounded by a lipid envelope (Bradley et al, 1985; He et al, 1987; Abe et al, 1989; Takahashi et al , 1992). Infectivity of the virus? found to be sensitive to chloroform treatment {Bradley et al, 1983; Feinstone et al, 1983) and heating to 60? C for 30 min (Purcell et al, 1985).

The RNA of the virus? was initially cloned using a chimpanzee plasma sample? particularly rich in infectious particles (Choo et al. 1989). Afterwards, ? The genome sequence of at least seven different HCV strains has been identified (Kato et al., 1990; Choo et al., 1991; Inchaupse et al., 1991; Okamoto et al., 1991, 1992; Takamizawa et al., 1991 ; Chen et al., 1992).

Do not ? A system for the replication of the virus in non-lymphoblastoid cell cultures in vitro has still been developed, which would allow to acquire the knowledge of virus biology essential for obtaining rapid progress in the diagnosis and therapy of the infection. Recently, Shimizu et al (1992) obtained in vitro infection of a human T-cell lymphoblastoid lineage, already? infected with murine leukemia retrovirus, M0LT-4a, without obtaining serial propagation, but rather showing the presence of the HCV genome sporadically and intermittently.

The only known model of experimental in vivo infection, the chimpanzee ?,? extremely expensive, difficult to find, and also demanding in terms of the ethics of animal experimentation.

Patent application EP 414475 relates to an in vitro cultivation method of HCV in eukaryotic cells. However, the description concerns the detection of viral replicative intermediates in peripheral blood mononuclear cells of hepatitis patients. No method of infection and in vitro cultivation of HCV is reported.

The authors of the present invention have carried out numerous attempts to adapt the virus to growth in cell cultures and have succeeded in developing a procedure for the infection, by HCV, of non-lymphoblastoid cells in culture and for the propagation of the virus in vitro. , which allows to overcome the problems of the prior art.

The possibility? to cultivate HCV in cell cultures in vitro opens new perspectives for the study of the mechanisms of viral replication, for the production of infecting viruses and viral antigens, for the development of assays of? infectivity? of the virus, and for the identification of substances with activity? antiviral, with important implications for the study of virus biology, for the diagnosis and treatment of HCV infection.

The in vitro cultivation and propagation system of the HCV virus allows the production of infecting viruses and viral antigens, which are essential for the preparation of an inactivated vaccine and to highlight the direct antibody response against the native antigens of the virus. Through the search for reactivity? antibody directed against native viral antigens, also containing conformational epitopes, produced in cell cultures,? It is possible to identify a much higher percentage of subjects that have come into contact with HCV than that identifiable with the serological tests currently in use, based on the use of synthetic peptides and antigens obtained by means of recombinant DNA technology. The quantity of infectious virus and viral antigens produced by cell cultures pu? be increased, instead? infecting the cells by passive adsorption of the virus, introducing the virions inside them with the method of electroporation (Bidawid-Woodroffe et al, 1992).

Adaptation to growth in cell cultures can? also cause a reduction of the pathogenicity? of viruses and lead to the selection of attenuated strains, usable as live viral vaccines. The repeated passage in cell cultures, which involves a considerable reduction in virulence, is in fact the means by which the attenuated vaccines commonly used in humans have been obtained up to now. Furthermore, associated with the adaptation of HCV to growth in cell cultures, genetic mutations can be detected in the 5'UTR region, in the vicinity. of the internal region of attack of the ribosomes (Tsukiyama-Kohara et al, 1992), similar to those recently demonstrated in the corresponding region of the hepatitis A virus (Day et al, 1992).

Is it also possible to develop simple and low-cost systems for the test of infectiousness? viral. There? allows both to quickly identify natural or synthetic substances with antiviral action, and to measure the quantity? of infecting virus present in clinical samples. There? would lead to an evaluation of the recent demonstration of viral RNA not only in the blood, but also in the ascitic fluid, saliva, seminal fluid and urine of patients (Liou et al, 1992).

A simple infectivity assay system? viral also allows you to highlight any activity? neutralizer in the serum of convalescent patients and experimentally infected animals, with interesting perspectives of passive immunotherapy using specific anti-HCV immunoglobulins

Therefore, the present invention relates to a method for the propagation of HCV viruses in non-lymphoblastoid mammalian cell cultures comprising the following steps:

- incubation of a sample of HCV virus with said cells for a period of time such that adsorption of a quantity is obtained. infecting HCV to said cells;

- washing of said cells;

- incubation of said cells in conditions suitable for their growth;

- removal of the culture medium and / or of said cells comprising HCV virus.

In an alternative embodiment, said incubation of a sample of HCV virus? replaced by introduction of HCV virus into said cells by electroporation.

Preferably said steps are carried out in the presence of serum-free culture medium.

Preferably, said HCV virus detection occurs by searching for genomic viral RNA or its replicative intermediates.

According to a preferred embodiment of the invention said sample for said incubation or for said introduction by electroporation comprises said culture medium comprising HCV virus or a cellular used of said cells infected with HCV.

Preferably said non-lymphoblastoid mammalian cells are included in the following group: monkey kidney cultures (vervet); human fibroblast cultures; solid lines of monkey kidney. Pi? preferably said monkey kidney cultures are secondary cultures.

The present invention will come now described in its illustrative but non-limiting examples, with reference to the following figures in which:

Figure 1 represents the result of a nested PCR search for HCV-specific RNA in secondary cultures of monkey kidney inoculated with serum from a patient affected by hepatitis C. Panel A: detection by ethidium bromide staining of the agarose gel. Panel B: hybridization of the amplifiers, transferred from the gel onto a nitrocellulose membrane, with an oligonucleotide probe labeled with 32p ^ Amplification of HCV RNA at polarity? positive: uninfected cultures (column 1), 2 weeks inoculated cultures (column 2), infected patient serum (column 6). Amplification of RNA to polarity? negative: uninfected cultures (column 3), 2-week inoculated cultures (column 4), infected patient serum (column 5). M, marker (?? 174 DNA Hae II);

Figure 2 represents a diagram of the passage of HCV on secondary cell cultures of monkey kidney.

Clinical material To inoculate cell cultures? used the serum of a symptomatic patient with chronic HCV infection. The sample, subjected to titration by PCR, appears to contain about 10? genomes, corresponding to 10? unit? infecting chimpanzees ?, for me. The material ? to be considered particularly rich in viral particles, since? commonly the serum titer of viraemic patients hovers around the genomes per mi. The patient's serum, as soon as it is separated from the blood clot,? divided into aliquots and stored at -70? C.

Cell cultures - Secondary cell cultures of monkey kidney (vervet) and human fetal lung diploid fibroblast cultures are set up. The following solid lines are also used: Vero (monkey kidney, ATCC CCL70), CV-1 (monkey kidney, ATCC CCL81), HEpG2 (human hepatoblastoma) and 2.2.15 (hepatitis B virus replicating HepG2 clone ), Li7A (hepatoma). The cellular material? prepared following the procedures commonly used in virology, and known to those skilled in the art (Schmidt, 1979). Eagle's Minimum Essential Medium and Dulbecco's modified Minimum Essential Medium are used as culture media, enriched with 10% fetal calf serum, thermo-inactivated for growth and 2% fetal calf serum for maintenance. After the inoculation of the cultures? added medium without any addition of whey. Said culture media are commercially available. The cultures are implanted, in growth medium, in polystyrene flasks, and incubated at 37? C. Once the confluence is reached, the cultures are incubated in maintenance medium, at 37 ° C. The cultures are inoculated with the sample, diluted 1: 5 in serum-free medium, in the ratio of about 5ml for each culture in a 25 cm2 flask. After an adsorption period of about 18h at 37 ° C on an oscillating platform, at about 60 oscillations per minute, the inoculum? removed, the cell mat? washed repeatedly (5-7 times) with serum-free medium, and the cultures are incubated at 37? C, after addition of serum-free medium (approximately 5ml per flask). At different intervals from the moment of inoculation, the cultures are used for the search for genomic viral RISIA or for replicative intermediates of HCV and for the passage of the virus. The virus? past undiluted, using the cultures after having frozen and thawed once, with a procedure similar to that used to inoculate (and flasks with the clinical sample.

Demonstration of the presence of viral RNA - From inoculated cell samples, from uninoculated negative controls, and from the respective culture medium, the RNA is extracted according to the method of Nalpas et al (1992), using cytoplasmic cell extracts prepared according to the method of Kawasaki et al (1988) or directly the "pellets" obtained from the ultracentrifugation of the culture medium for 60 min at 100,000 g. For PCR, the untranslated region 5'UTR, highly conserved in the different HCV strains, is selected as the target sequence (Okamoto et al, 1990). A nested reaction is carried out, using the method described by Novati et al (1992). The search for replicative intermediates takes place following the method of Fong et al (1991) using, to initiate the retro-transcription reaction of the viral RNA into cDNA, the external sense primer. The reverse transcriptase? inactivated at 95 ° C for 60 min. For PCR the external triggers OU1 (antisense) and OU2 (sense) are used, and the internal triggers INI (antisense) and IN2 (sense), the sequence of which? shown in Table 1.

Table 1

Oligonucleotides used for the detection of HCV RNA untranslated region 5'UTR

Name Sense Pos. Sequence (5'-3 ')

OU1 303-322 TGCACGGTCTACGAGACCTC

0U2 65- 84 GCCATGGCGTTAGTATGAGT

IN1 280-299 GGGCACTCGCAAGCACCCTA

IN2 88-97 GTGCAGCCTCCAGGACCCCC

YES 121-157 CCATAGTGGTCTGCGGAA

CCGTGAGTACACCGGAAT

The products amplified by PCR are identified after electrophoretic separation on 2% agarose gel, staining with ethidium bromide, and transfer to nitrocellulose membrane, by means of hybridization with the 32p # SI-labeled oligonucleotide probe followed by autoradiography.

Using the PCR technique? possible to identify the presence of small quantities? of viruses released into the culture medium from monkey secondary kidney cultures at different times after inoculation (Table 2). Uninoculated monkey kidney cultures used as controls were consistently negative for the presence of the viral genome. The human hepatoma cell lines used: HepG2, 2.2.15, and Li7A also tested negative up to 24 days after inoculation.

Table 2

Release of HCV from cell cultures

PCR culture on the extract of ultracentrifuged cell medium pellets within days of infection

1 8 12 24

Secondary kidney - of monkey

Secondary kidney - monkey HCV

Li7A {hepatoma) -HCV

HepG2 HCV - (hepatoblastoma)

2.2.1 5 (clone of -HepG2) HCV

In cell extracts of secondary monkey kidney cultures? The presence of HCV-specific RNA can be detected up to 24 days after inoculation (Table 3). The presence of genomic RNA? also found in cellular extracts of human diploid fibroblasts, CV-1 and VERO obtained 2 weeks after inoculation.

Table 3

Detection of HCV Genomic RNA in Cell Culture PCR Culture on Extract from Cell Pellets at Cell Days of Infection

Secondary kidney

of monkey

Secondary kidney

of monkey

HCV

Diploid ND ND human fibrobfasts

Human Fibroblasts ND ND diploid HCV

CV-1 ND ND

CV-1 HCV ND ND

TRUE ND ND

TRUE HCV ND ND

ND: not determined

Is viral RNA injected into monkey kidney cells? present both as a chain with polarity? positive, genomic, and as a negative chain, antigenomic, as shown in Fig. 1. The detection of the antigenomic chain of HCV RNA at the cellular level demonstrates the presence of the so-called replicative intermediates, that is? of RNA complementary to genomic RNA that are produced during the intermediate stages of viral replication. Said replicative intermediates were not highlighted in the serum sample used as inoculum, and therefore are to be considered the consequence of the viral replication process. However, ? It has recently been shown that replicative intermediates are found in the liver and peripheral leukocytes, but not in the serum of HCV infected subjects (Miiller et al, 1993).

It is also possible to serially pass the virus three times on monkey kidney cultures, using the cell lysates obtained by freezing and thawing the cultures after having collected them four weeks after infection, as illustrated in the diagram of Fig. 2.

The present invention? has been described with specific reference to some of its preferred embodiments, but? it is to be understood that variations and / or modifications may be made by those skilled in the art without thereby departing from the relative scope of protection.

BIBLIOGRAPHY

? Abe K, Kurata T, Shikata T (1989) Non-A, non-B hepatitis: visualization of virus-like parti cles from chimpanzee and human sera. Arch Virol 104: 351-355.

? Bidawid-Woodroffe S, Sullivan-Tailyour G, Roig-Farran P, Garnett HM (1992) Increased cytomegalovirus

Claims (7)

CLAIMS 1. Method for the propagation of HCV viruses in non-lymphoblastoid mammalian cell cultures comprising the following steps: - incubation of a sample of HCV virus with said cells for a period of time such that adsorption of a quantity is obtained. infecting HCV to said cells; - washing of said cells; - incubation of said cells in conditions suitable for their growth; - removal of the culture medium and / or of said cells comprising HCV virus. Method for propagating HCV viruses according to claim 1 wherein said incubation of a sample of HCV virus? replaced by introduction of HCV virus into said cells by electroporation. Method for the propagation of HCV viruses according to any one of the preceding claims in which said steps are carried out in the presence of serum-free culture medium. 4. Method for the propagation of HCV viruses according to any one of the preceding claims in which said detection of HCV virus occurs by searching for genomic viral RNA or its replicative intermediates. Method for propagating HCV viruses according to any one of the preceding claims wherein said sample for said incubation or for said introduction by electroporation comprises said culture medium comprising HCV virus or a cell lysate of said HCV infected cells. Method for the propagation of HCV viruses according to any one of the preceding claims wherein said non-lymphoblastoid mammalian cells are included in the following group: monkey kidney (vervet) cultures; human fibroblast cultures; solid lines of monkey kidney. 7. A method for propagating HCV viruses according to claim 6 wherein said monkey kidney cultures are secondary cultures.