ITRM20090214A1 - KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES - Google Patents
KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES Download PDFInfo
- Publication number
- ITRM20090214A1 ITRM20090214A1 IT000214A ITRM20090214A ITRM20090214A1 IT RM20090214 A1 ITRM20090214 A1 IT RM20090214A1 IT 000214 A IT000214 A IT 000214A IT RM20090214 A ITRM20090214 A IT RM20090214A IT RM20090214 A1 ITRM20090214 A1 IT RM20090214A1
- Authority
- IT
- Italy
- Prior art keywords
- virus
- seq
- primers
- influenza
- human
- Prior art date
Links
- 241000700605 Viruses Species 0.000 title claims description 15
- 241000712461 unidentified influenza virus Species 0.000 claims description 23
- 238000000034 method Methods 0.000 claims description 16
- 108091034117 Oligonucleotide Proteins 0.000 claims description 11
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 9
- JLCPHMBAVCMARE-UHFFFAOYSA-N [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(6-aminopurin-9-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate Polymers Cc1cn(C2CC(OP(O)(=O)OCC3OC(CC3OP(O)(=O)OCC3OC(CC3O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)C(COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3CO)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)O2)c(=O)[nH]c1=O JLCPHMBAVCMARE-UHFFFAOYSA-N 0.000 claims description 6
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 230000003612 virological effect Effects 0.000 claims description 6
- 239000000203 mixture Substances 0.000 claims description 5
- 108020004707 nucleic acids Proteins 0.000 claims description 5
- 102000039446 nucleic acids Human genes 0.000 claims description 5
- 150000007523 nucleic acids Chemical class 0.000 claims description 5
- 238000003757 reverse transcription PCR Methods 0.000 claims description 5
- 238000003745 diagnosis Methods 0.000 claims description 3
- 238000000605 extraction Methods 0.000 claims description 3
- 238000000338 in vitro Methods 0.000 claims description 3
- 239000000523 sample Substances 0.000 claims description 3
- 108090000790 Enzymes Proteins 0.000 claims description 2
- 102000004190 Enzymes Human genes 0.000 claims description 2
- 108010001336 Horseradish Peroxidase Proteins 0.000 claims description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 2
- 239000012472 biological sample Substances 0.000 claims description 2
- 230000002255 enzymatic effect Effects 0.000 claims description 2
- 201000010740 swine influenza Diseases 0.000 description 7
- 206010022000 influenza Diseases 0.000 description 5
- 230000009385 viral infection Effects 0.000 description 5
- 230000004544 DNA amplification Effects 0.000 description 3
- 241000712431 Influenza A virus Species 0.000 description 3
- 241000282898 Sus scrofa Species 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- 206010069767 H1N1 influenza Diseases 0.000 description 2
- 208000009620 Orthomyxoviridae Infections Diseases 0.000 description 2
- 241000725681 Swine influenza virus Species 0.000 description 2
- 108020000999 Viral RNA Proteins 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 1
- 108060003393 Granulin Proteins 0.000 description 1
- 101710154606 Hemagglutinin Proteins 0.000 description 1
- 241000282412 Homo Species 0.000 description 1
- 101001091371 Homo sapiens Kallikrein-8 Proteins 0.000 description 1
- 241001500351 Influenzavirus A Species 0.000 description 1
- 102000011931 Nucleoproteins Human genes 0.000 description 1
- 108010061100 Nucleoproteins Proteins 0.000 description 1
- 101710093908 Outer capsid protein VP4 Proteins 0.000 description 1
- 101710135467 Outer capsid protein sigma-1 Proteins 0.000 description 1
- 101710176177 Protein A56 Proteins 0.000 description 1
- 238000010802 RNA extraction kit Methods 0.000 description 1
- 101710172711 Structural protein Proteins 0.000 description 1
- 241000282887 Suidae Species 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000013060 biological fluid Substances 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000000470 constituent Substances 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 239000000185 hemagglutinin Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 208000037797 influenza A Diseases 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000005580 one pot reaction Methods 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 239000008194 pharmaceutical composition Substances 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 230000010076 replication Effects 0.000 description 1
- 230000000241 respiratory effect Effects 0.000 description 1
- 210000002345 respiratory system Anatomy 0.000 description 1
- 238000010839 reverse transcription Methods 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 230000000405 serological effect Effects 0.000 description 1
- 238000010561 standard procedure Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 108091035539 telomere Proteins 0.000 description 1
- 102000055501 telomere Human genes 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Labeling Devices (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Description
Descrizione della domanda di brevetto per invenzione industriale dal titolo:"Kit per l'identificazione di virus influenzali" Description of the patent application for industrial invention entitled: "Kit for the identification of influenza viruses"
Campo dell'invenzione Field of the invention
La presente invenzione si riferisce a un kit per l'identificazione di virus influenzali, in particolare per l'identificazione del nuovo virus influenzale umano A/H1N1 di origine suina. The present invention relates to a kit for the identification of influenza viruses, in particular for the identification of the new human influenza virus A / H1N1 of porcine origin.
L'invenzione è anche relativa a un set di primers specifici per la determinazione del virus dell'influenza, in particolare il virus dell'influenza suina, e al loro utilizzo per l'identificazione del virus dell'influenza. The invention also relates to a set of specific primers for the determination of the influenza virus, in particular the swine flu virus, and their use for the identification of the influenza virus.
Arte nota Known art
L'infezione da virus influenzale normalmente si presenta con sintomi molto simili a quelli di altri virus che affliggono il sistema respiratorio. Di conseguenza i metodi correnti, reperibili in commercio, per la determinazione della presenza di una infezione da virus influenzale si limitano perlopiù alla semplice distinzione della presenza o meno di un virus influenzale in un campione rispetto ad altri virus respiratori, riconoscendo se il ceppo influenzale eventualmente presente è di gruppo A o B senza ulteriori accertamenti. Influenza virus infection usually presents with symptoms very similar to those of other viruses affecting the respiratory system. Consequently, the current methods, available on the market, for the determination of the presence of an influenza virus infection are mostly limited to the simple distinction of the presence or absence of an influenza virus in a sample from other respiratory viruses, recognizing whether the influenza strain possibly present is group A or B without further investigation.
Il presentarsi nell'uomo di una nuova infezione da virus influenzale di tipo A derivato dai suini pone un problema di diagnosi veloce e certa, in particolare a seguito della segnalazione da parte dall'Organizzazione Mondiale della Sanità della possibilità molto alta di pandemia e di potenziale pericolo per la salute pubblica mondiale. The appearance in humans of a new influenza virus type A derived from pigs poses a problem of fast and certain diagnosis, in particular following the reporting by the World Health Organization of the very high possibility of a pandemic and potential danger to world public health.
I metodi più rapidi e affidabili attualmente in uso per il riconoscimento dell'influenza umana si basano sull’utilizzo di tecniche molecolari. Primers specifici per proteine costitutive del virus influenzale sono utilizzati per la produzione con tecniche di amplificazione genica di frammenti di DNA di derivazione virale che possono essere facilmente sequenziati permettendo un veloce riconoscimento del tipo di ceppo presente in un paziente, in particolare se il ceppo è di tipo A o B (Sintchenko et al. (2002) J. Clin Vir. 25: 15-21; Wright et al. (1995) J. Clin. Microbiol. 33: 1180-1184; Poddar et al. (2002) J. Virol. Methods 99: 63-70; Smith A.B. et al. (2002) J. Clin Vir. 28: 51-58). Inoltre la tipizzazione virale mediante riconoscimento dei sottotipi dell’emoagglutinina (H) e della neuroamminidasi (N) tramite metodi sierologici è di non grande praticità applicativa e di fatto riservata ai soli laboratori di riferimento (McIntosh K. (1996) "Diagnostic Virology" in: Fields Virology 3° edizione, a cura di Fields B.N., Knipe D.M. e Howley P.M., Lippincott-Raven, Philadelphia) The fastest and most reliable methods currently in use for the recognition of human influence are based on the use of molecular techniques. Specific primers for influenza virus constituent proteins are used for the production with gene amplification techniques of virally derived DNA fragments that can be easily sequenced allowing quick recognition of the type of strain present in a patient, particularly if the strain is of type A or B (Sintchenko et al. (2002) J. Clin Vir. 25: 15-21; Wright et al. (1995) J. Clin. Microbiol. 33: 1180-1184; Poddar et al. (2002) J . Virol. Methods 99: 63-70; Smith A.B. et al. (2002) J. Clin Vir. 28: 51-58). In addition, viral typing by recognizing the subtypes of hemagglutinin (H) and neuroaminidase (N) by serological methods is not very practical in application and in fact reserved only for reference laboratories (McIntosh K. (1996) "Diagnostic Virology" in : Fields Virology 3rd edition, edited by Fields B.N., Knipe D.M. and Howley P.M., Lippincott-Raven, Philadelphia)
I metodi sopra descritti non sono attualmente applicabili al virus influenzale di origine suina, a causa delle differenze nelle sequenze geniche fra virus umano e virus suino. Infatti tra le caratteristiche distintive di questo agente viene riportata la sua non tipizzabilità con i metodi molecolari basati sui primers finora in uso a tale scopo. Ciò costringe gli addetti ai lavori all'utilizzo di tecniche di sequenziamento di segmenti significativi del genoma del nuovo virus utilizzando a tale scopo primers appositamente disegnati tenedo conto delle caratteristiche uniche di questo nuovo agente. The methods described above are not currently applicable to the swine influenza virus, due to the differences in gene sequences between human and porcine viruses. In fact, one of the distinctive characteristics of this agent is its non-typability with the molecular methods based on the primers so far used for this purpose. This forces the experts to use sequencing techniques of significant segments of the new virus genome using for this purpose specially designed primers taking into account the unique characteristics of this new agent.
È comunque estremamente importante trovare una modalità semplice e, soprattutto, veloce e precisa per la determinazione della presenza dei virus influenzali, in particolare di quello di origine suina, come strumento potente ed efficace di controllo della diffusione di detti virus. However, it is extremely important to find a simple and, above all, fast and precise method for determining the presence of influenza viruses, in particular that of swine origin, as a powerful and effective tool for controlling the spread of said viruses.
Sommario dell'invenzione Summary of the invention
Sono stati ora sintetizzati dei nuovi primers (SEQ ID NO 1, 2, 3, 4, 5 e 6) altamente specifici per la proteina costitutiva del nucleo del virus dell'influenza (NP), in particolare quella di origine suina, che permettono di superare i problemi di rilevazione ed identificazione veloce e sicura di detto virus, come sopra descritto. New primers have now been synthesized (SEQ ID NO 1, 2, 3, 4, 5 and 6) highly specific for the constitutive protein of the influenza virus (NP) nucleus, in particular that of porcine origin, which allow to overcome the problems of fast and safe detection and identification of said virus, as described above.
È pertanto oggetto della presente invenzione un kit contenente almeno uno di detti primers scelti fra (SEQ ID NO 1, 2, 3, 4, 5, 6) per la determinazione del virus dell'influenza, in particolare quella di origine suina, con tecniche di amplificazione genica (RT-PCR e Real Time PCR) e sequenziamento. Particolarmente preferiti sono i primers che corrispondono alle sequenze SEQ ID NO 1 e 2 della nucleoproteina (NP; SEQ ID NO 9 e 10 ). Therefore, the subject of the present invention is a kit containing at least one of said primers selected among (SEQ ID NO 1, 2, 3, 4, 5, 6) for the determination of the influenza virus, in particular that of swine origin, with techniques of gene amplification (RT-PCR and Real Time PCR) and sequencing. Particularly preferred are primers which correspond to the SEQ ID NO 1 and 2 sequences of the nucleoprotein (NP; SEQ ID NO 9 and 10).
Sono altresì oggetto della presente invenzione composizioni farmaceutiche e per uso diagnostico comprendenti almeno uno dei primers corripondenti alle SEQ ID NO 1-6 e relative miscele, in particolare i primers corrispondenti alle SEQ ID NO 1-2 della NP. Also object of the present invention are pharmaceutical compositions and compositions for diagnostic use comprising at least one of the primers corresponding to the SEQ ID NO 1-6 and relative mixtures, in particular the primers corresponding to the SEQ ID NO 1-2 of the NP.
È ulteriore oggetto della presente invenzione l'utilizzo di detti primers per la determinazione del virus dell'influenza, in particolare quella di origine suina. A further object of the present invention is the use of said primers for the determination of the influenza virus, in particular that of swine origin.
Altri oggetti risulteranno evidenti dalla descrizione dettagliata dell'invenzione. Other objects will become apparent from the detailed description of the invention.
Descrizione dettagliata dell'invenzione I metodi molecolari correntemente in uso per la determinazione in vitro dei virus influenzali in fluidi biologici comprendono gli stadi di: Detailed description of the invention The molecular methods currently in use for the in vitro determination of influenza viruses in biological fluids include the steps of:
(a) Estrazione degli acidi nucleici dal campione; (a) Extraction of nucleic acids from the sample;
(b) Amplificazione delle sequenze nucleotidiche comprese fra gli oligonucleotidi secondo le rivendicazioni 1-2; (b) Amplification of the nucleotide sequences comprised between the oligonucleotides according to claims 1-2;
(c) Sequenziamento dell'amplificato di cui allo stadio (b) (c) Sequencing of the amplifier referred to in step (b)
(d) Confronto della sequenza ottenuta nello stadio (c) con sequenze virali note. (d) Comparison of the sequence obtained in step (c) with known viral sequences.
I campioni biologici possono essere, per esempio, tamponi naso-faringei, sangue, saliva e sputo. Biological samples can be, for example, nasopharyngeal swabs, blood, saliva and spit.
Gli inventori, basandosi sulla propria esperienza nel campo delle infezioni virali, in particolare dell'infezione da virus influenzali, sono riusciti a selezionare, secondo metodiche standard note agli esperti nel ramo, degli oligonucleotidi primer (SEQ ID NO 1 e 2) che codificano per sequenze interne alla sequenza della NP, della proteina di matrice M (SEQ ID NO 3 e 4) e della proteina non strutturale NS (SEQ ID NO 5 e 6) del virus dell'influenza suina, sulla base della sequenza genomica pubblicata sulla piattaforma web GISAID degli isolati 04 e 05 di detto virus (SEQ ID NO 9-13) Le sequenze sono appresso indicate: Based on their experience in the field of viral infections, in particular influenza virus infection, the inventors were able to select, according to standard methods known to those skilled in the art, primer oligonucleotides (SEQ ID NO 1 and 2) which code for sequences within the sequence of the NP, of the matrix protein M (SEQ ID NO 3 and 4) and of the non-structural protein NS (SEQ ID NO 5 and 6) of the swine influenza virus, based on the genomic sequence published on the web platform GISAID of isolates 04 and 05 of said virus (SEQ ID NO 9-13) The sequences are indicated below:
SEQ ID NO 1: 5’ atg gcg tct caa ggc acc a 3’ (NP primer forward) pos 1-19 SEQ ID NO 1: 5 'atg gcg tct caa ggc acc a 3' (NP primer forward) pos 1-19
SEQ ID NO 2: 5’ cct cct gtt ttc tta ggg tc 3’ (NP primer reverse) pos 281-262 SEQ ID NO 2: 5 'cct cct gtt ttc tta ggg tc 3' (NP primer reverse) pos 281-262
SEQ ID NO 3: 5’ gtg ctg gct agc act acg gca aa 3’ (M-primer forward) pos 528-550 SEQ ID NO 3: 5 'gtg ctg gct agc act acg gca aa 3' (M-primer forward) pos 528-550
SEQ ID NO 4: 5’ agc tag gat gag tcc caa tag ttc t 3’ (M-primer reverse) pos 663-639 SEQ ID NO 4: 5 'agc tag gat gag tcc caa tag ttc t 3' (M-primer reverse) pos 663-639
SEQ ID NO 5: 5’ aaa gcg aac ttc agt gta at 3’ (NS1-primer forward) pos 391-410 SEQ ID NO 5: 5 'aaa gcg aac ttc agt gta at 3' (NS1-primer forward) pos 391-410
SEQ ID NO 6: 5’ gaa ggt aat ggt gaa att t 3’ (NS1-primer reverse) pos 494-476 SEQ ID NO 6: 5 'gaa ggt aat ggt gaa att t 3' (NS1-primer reverse) pos 494-476
SEQ ID NO 7: 5’ aaa atc atg gcg tcc caa gg 3’ (primers forward NP influenza A umana di routine) SEQ ID NO 7: 5 'aaa atc atg gcg tcc caa gg 3' (primers forward NP human influenza A routine)
SEQ ID NO 8: 5’ cct cca gtt ttc tta gga tc 3’ (primer reverse NP influenza A umana di routine) SEQ ID NO 8: 5 'cct cca gtt ttc tta gga tc 3' (routine human NP influenza A reverse primer)
SEQ ID NO 9: >EPI176482 | NP | A/California/04/2009 | EPI_ISL_29573 | FJ966083 | H1N1 atggcgtctcaaggcaccaaacgatcatatgaacaaatggagactggtggggagcgccag gatgccacagaaatcagagcatctgtcggaagaatgattggtggaatcgggagattctac atccaaatgtgcactgaactcaaactcagtgattatgatggacgactaatccagaatagc ataacaatagagaggatggtgctttctgcttttgatgagagaagaaataaatacctagaa gagcatcccagtgctgggaaggaccctaagaaaacaggaggacccatatatagaagagta gacggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagagtttgg cgccaagcaaacaatggcgaagatgcaacagcaggtcttactcatatcatgatttggcat tccaacctgaatgatgccacatatcagagaacaagagcgcttgttcgcaccggaatggat cccagaatgtgctctctaatgcaaggttcaacacttcccagaaggtctggtgccgcaggt gctgcggtgaaaggagttggaacaatagcaatggagttaatcagaatgatcaaacgtgga atcaatgaccgaaatttctggaggggtgaaaatggacgaaggacaagggttgcttatgaa agaatgtgcaatatcctcaaaggaaaatttcaaacagctgcccagagggcaatgatggat caagtaagagaaagtcgaaacccaggaaacgctgagattgaagacctcattttcctggca cggtcagcactcattctgaggggatcagttgcacataaatcctgcctgcctgcttgtgtg tatgggcttgcagtagcaagtgggcatgactttgaaagggaagggtactcactggtcggg atagacccattcaaattactccaaaacagccaagtggtcagcctgatgagaccaaatgaa aacccagctcacaagagtcaattggtgtggatggcatgccactctgctgcatttgaagat ttaagagtatcaagtttcataagaggaaagaaagtgattccaagaggaaagctttccaca agaggggtccagattgcttcaaatgagaatgtggaaaccatggactccaataccctggaa ctgagaagcagatactgggccataaggaccaggagtggaggaaataccaatcaacaaaag gcatccgcaggccagatcagtgtgcagcctacattctcagtgcagcggaatctccctttt gaaagagcaaccgttatggcagcattcagcgggaacaatgaaggacggacatccgacatg cgaacagaagttataagaatgatggaaagtgcaaagccagaagatttgtccttccagggg cggggagtcttcgagctctcggacgaaaaggcaacgaacccgatcgtgccttcctttgac atgagtaatgaagggtcttatttcttcggagacaatgcagaggagtatgacagttga SEQ ID NO 10: >EPI176492 | NP | A/California/05/2009 | EPI_ISL_29575 | FJ966953 | H1N1 atggcgtctcaaggcaccaaacgatcatatgaacaaatggagactggtggggagcgccag gatgccacagaaatcagagcatctgtcggaagaatgattggtggaatcgggagattctac atccaaatgtgcactgaactcaaactcagtgattatgatggacgactaatccagaatagc ataacaatagagaggatggtgctttctgcttttgatgagagaagaaataaatacctagaa gagcatcccagtgctgggaaggaccctaagaaaacaggaggccccatatatagaagagta gacggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagagtttgg cgccaagcaaacaatggcgaagatgcaacagcaggtcttactcatatcatgatttggcat tccaacctgaatgatgccacatatcagagaacaagagcgcttgttcgcaccggaatggat cccagaatgtgctctctaatgcaaggttcaacacttcccagaaggtctggtgccgcaggt gctgcggtgaaaggagttggaacaatagcaatggagttaatcagaatgatcaaacgtgga atcaatgaccgaaatttctggaggggtgaaaatggacgaaggacaagggttgcttatgaa agaatgtgtaatatcctcaaaggaaaatttcaaacagctgcccagagggcaatgatggat caagtaagagaaagtcgaaacccaggaaacgctgagattgaagacctcattttcctggca cggtcagcactcattctgaggggatcagttgcacataaatcctgcctgcctgcttgtgtg tatgggcttgcagtagcaagtgggcatgactttgaaagggaagggtactcactggtcggg atagacccattcaaattactccaaaacagccaagtggtcagcctgatgagaccaaatgaa aacccagctcacaagagtcaattggtgtggatggcatgccactctgctgcatttgaagat ttaagagtatcaagtttcataagaggaaagaaagtgattccaagaggaaagctttccaca agaggggtccagattgcttcaaatgagaatgtggaaatcatggactccaataccctggaa ctgagaagcagatactgggccataaggaccaggagtggaggaaataccaatcaacaaaag gcatccgcaggccagatcagtgtgcagcctacattctcagtgcagcggaatctccctttt gaaagagcaaccgttatggcagcattcagcgggaacaatgaaggacggacatccgacatg cgaacagaagttataagaatgatggaaagtgcaaagccagaagatttgtccttccagggg cggggagtcttcgagctctcggacgaaaaggcaacgaacccgatcgtgccttcctttgac atgagtaatgaagggtcttatttcttcggagacaatgcagaggagtatgacagttga SEQ ID NO 11: >EPI176471 | MP | A/California/04/2009 | EPI_ISL_29573 | 2009712049_seg7 | H1N1 taaccgaggtcgaaacgtacgttctttctatcatcccgtcaggccccctcaaagccgaga tcgcgcagagactggaaagtgtctttgcaggaaagaacacagatcttgaggctctcatgg aatggctaaagacaagaccaatcttgtcacctctgactaagggaattttaggatttgtgt tcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgccc taaatgggaatggggacccgaacaacatggatagagcagttaaactatacaagaagctca aaagagaaataacgttccatggggccaaggaggtgtcactaagctattcaactggtgcac ttgccagttgcatgggcctcatatacaacaggatgggaacagtgaccacagaagctgctt ttggtctagtgtgtgccacttgtgaacagattgctgattcacagcatcggtctcacagac agatggctactaccaccaatccactaatcaggcatgaaaacagaatggtgctggctagca ctacggcaaaggctatggaacagatggctggatcgagtgaacaggcagcggaggccatgg aggttgctaatcagactaggcagatggtacatgcaatgagaactattgggactcatccta gctccagtgctggtctgaaagatgaccttcttgaaaatttgcaggcctaccagaagcgaa tgggagtgcagatgcagcgattcaagtgatcctctcgtcattgcagcaaatatcattggg atcttgcacctgatattgtggattactgatcgtctttttttcaaatgtatttatcgtcgc tttaaatacggtttgaaaagagggccttctacggaaggagtgcctgagtccatgagggaa gaatatcaacaggaacagcagagtgctgtggatgttgacgatggtcattttgtcaacata gagctagagtaa SEQ ID NO 9:> EPI176482 | NP | A / California / 04/2009 | EPI_ISL_29573 | FJ966083 | H1N1 atggcgtctcaaggcaccaaacgatcatatgaacaaatggagactggtggggagcgccag gatgccacagaaatcagagcatctgtcggaagaatgattggtggaatcgggagattctac atccaaatgtgcactgaactcaaactcagtgattatgatggacgactaatccagaatagc ataacaatagagaggatggtgctttctgcttttgatgagagaagaaataaatacctagaa gagcatcccagtgctgggaaggaccctaagaaaacaggaggacccatatatagaagagta gacggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagagtttgg cgccaagcaaacaatggcgaagatgcaacagcaggtcttactcatatcatgatttggcat tccaacctgaatgatgccacatatcagagaacaagagcgcttgttcgcaccggaatggat cccagaatgtgctctctaatgcaaggttcaacacttcccagaaggtctggtgccgcaggt gctgcggtgaaaggagttggaacaatagcaatggagttaatcagaatgatcaaacgtgga atcaatgaccgaaatttctggaggggtgaaaatggacgaaggacaagggttgcttatgaa agaatgtgcaatatcctcaaaggaaaatttcaaacagctgcccagagggcaatgatggat caagtaagagaaagtcgaaacccaggaaacgctgagattgaagacctcattttcctggca cggtcagcactcattctgaggggatcagttgcacataaatcctgcctgcctgcttgtgtg tatgggcttgcagtagcaagtgggcatgactttgaaagggaagggtactcactggtcggg atagacccattcaaattactccaaaacagccaagtggtcagcctgatgagaccaaatgaa aacccagctcacaagagtc aattggtgtggatggcatgccactctgctgcatttgaagat ttaagagtatcaagtttcataagaggaaagaaagtgattccaagaggaaagctttccaca agaggggtccagattgcttcaaatgagaatgtggaaaccatggactccaataccctggaa ctgagaagcagatactgggccataaggaccaggagtggaggaaataccaatcaacaaaag gcatccgcaggccagatcagtgtgcagcctacattctcagtgcagcggaatctccctttt gaaagagcaaccgttatggcagcattcagcgggaacaatgaaggacggacatccgacatg cgaacagaagttataagaatgatggaaagtgcaaagccagaagatttgtccttccagggg cggggagtcttcgagctctcggacgaaaaggcaacgaacccgatcgtgccttcctttgac atgagtaatgaagggtcttatttcttcggagacaatgcagaggagtatgacagttga SEQ ID NO 10: >EPI176492 | NP | A / California / 05/2009 | EPI_ISL_29575 | FJ966953 | H1N1 atggcgtctcaaggcaccaaacgatcatatgaacaaatggagactggtggggagcgccag gatgccacagaaatcagagcatctgtcggaagaatgattggtggaatcgggagattctac atccaaatgtgcactgaactcaaactcagtgattatgatggacgactaatccagaatagc ataacaatagagaggatggtgctttctgcttttgatgagagaagaaataaatacctagaa gagcatcccagtgctgggaaggaccctaagaaaacaggaggccccatatatagaagagta gacggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagagtttgg cgccaagcaaacaatggcgaagatgcaacagcaggtcttactcatatcatgatttggcat tccaacctgaatgatgccacatatcagagaacaagagcgcttgttcgcaccggaatggat cccagaatgtgctctctaatgcaaggttcaacacttcccagaaggtctggtgccgcaggt gctgcggtgaaaggagttggaacaatagcaatggagttaatcagaatgatcaaacgtgga atcaatgaccgaaatttctggaggggtgaaaatggacgaaggacaagggttgcttatgaa agaatgtgtaatatcctcaaaggaaaatttcaaacagctgcccagagggcaatgatggat caagtaagagaaagtcgaaacccaggaaacgctgagattgaagacctcattttcctggca cggtcagcactcattctgaggggatcagttgcacataaatcctgcctgcctgcttgtgtg tatgggcttgcagtagcaagtgggcatgactttgaaagggaagggtactcactggtcggg atagacccattcaaattactccaaaacagccaagtggtcagcctgatgagaccaaatgaa aacccagctcacaagagtc aattggtgtggatggcatgccactctgctgcatttgaagat ttaagagtatcaagtttcataagaggaaagaaagtgattccaagaggaaagctttccaca agaggggtccagattgcttcaaatgagaatgtggaaatcatggactccaataccctggaa ctgagaagcagatactgggccataaggaccaggagtggaggaaataccaatcaacaaaag gcatccgcaggccagatcagtgtgcagcctacattctcagtgcagcggaatctccctttt gaaagagcaaccgttatggcagcattcagcgggaacaatgaaggacggacatccgacatg cgaacagaagttataagaatgatggaaagtgcaaagccagaagatttgtccttccagggg cggggagtcttcgagctctcggacgaaaaggcaacgaacccgatcgtgccttcctttgac atgagtaatgaagggtcttatttcttcggagacaatgcagaggagtatgacagttga SEQ ID NO 11: >EPI176471 | MP | A / California / 04/2009 | EPI_ISL_29573 | 2009712049_seg7 | H1N1 taaccgaggtcgaaacgtacgttctttctatcatcccgtcaggccccctcaaagccgaga tcgcgcagagactggaaagtgtctttgcaggaaagaacacagatcttgaggctctcatgg aatggctaaagacaagaccaatcttgtcacctctgactaagggaattttaggatttgtgt tcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgccc taaatgggaatggggacccgaacaacatggatagagcagttaaactatacaagaagctca aaagagaaataacgttccatggggccaaggaggtgtcactaagctattcaactggtgcac ttgccagttgcatgggcctcatatacaacaggatgggaacagtgaccacagaagctgctt ttggtctagtgtgtgccacttgtgaacagattgctgattcacagcatcggtctcacagac agatggctactaccaccaatccactaatcaggcatgaaaacagaatggtgctggctagca ctacggcaaaggctatggaacagatggctggatcgagtgaacaggcagcggaggccatgg aggttgctaatcagactaggcagatggtacatgcaatgagaactattgggactcatccta gctccagtgctggtctgaaagatgaccttcttgaaaatttgcaggcctaccagaagcgaa tgggagtgcagatgcagcgattcaagtgatcctctcgtcattgcagcaaatatcattggg atcttgcacctgatattgtggattactgatcgtctttttttcaaatgtatttatcgtcgc tttaaatacggtttgaaaagagggccttctacggaaggagtgcctgagtccatgagggaa gaatatcaacaggaacagcagagtgctgtggatgttgacgatggtcattttgtcaacata gagctagagtaa
SEQ ID NO 12: >EPI176491 | MP | A/California/05/2009 | EPI_ISL_29575 | 2009712097_7 | H1N1 atgagtcctctaaccgaggtcgaaacgtacgttctttctatcatcccgtcaggccccctc aaagccgagatcgcgcagagactggaaagtgtctttgcaggaaagaacacagatcttgag gctctcatggaatggctaaagacaagaccaatcttgtcacctctgactaagggaatttta ggatttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtc caaaatgccctaaatgggaatggggacccgaacaacatggatagagcagttaaactatac aagaagctcaaaagagaaataacgttccatggggccaaggaggtgtcactaagctattca actggtgcacttgccagttgcatgggcctcatatacaacaggatgggaacagtgaccaca gaagctgcttttggtctagtgtgtgccacttgtgaacagattgctgattcacagcatcgg tctcacagacagatggctactaccaccaatccactaatcaggcatgaaaacagaatggtg ctggctagcactacggcaaaggctatggaacagatggctggatcgagtgaacaggcagcg gaggccatggaggttgctaatcagactaggcagatggtacatgcaatgagaactattggg actcatcctagctccagtgctggtctgaaagatgaccttcttgaaaatttgcaggcctac cagaagcgaatgggagtgcagatgcagcgattcaagtgatcctctcgtcattgcagcaaa tatcattgggatcttgcacctgatattgtggattactgatcgtctttttttcaaatgtat ttatcgtcgctttaaatacggtttgaaaagagggccttctacggaaggagtgcctgagtc catgagggaagaatatcaacaggaacagcagagtgctgtggatgttgacgatggtcattt tgtcaacatagagctagagtaa SEQ ID NO 12:> EPI176491 | MP | A / California / 05/2009 | EPI_ISL_29575 | 2009712097_7 | H1N1 atgagtcctctaaccgaggtcgaaacgtacgttctttctatcatcccgtcaggccccctc aaagccgagatcgcgcagagactggaaagtgtctttgcaggaaagaacacagatcttgag gctctcatggaatggctaaagacaagaccaatcttgtcacctctgactaagggaatttta ggatttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtc caaaatgccctaaatgggaatggggacccgaacaacatggatagagcagttaaactatac aagaagctcaaaagagaaataacgttccatggggccaaggaggtgtcactaagctattca actggtgcacttgccagttgcatgggcctcatatacaacaggatgggaacagtgaccaca gaagctgcttttggtctagtgtgtgccacttgtgaacagattgctgattcacagcatcgg tctcacagacagatggctactaccaccaatccactaatcaggcatgaaaacagaatggtg ctggctagcactacggcaaaggctatggaacagatggctggatcgagtgaacaggcagcg gaggccatggaggttgctaatcagactaggcagatggtacatgcaatgagaactattggg actcatcctagctccagtgctggtctgaaagatgaccttcttgaaaatttgcaggcctac cagaagcgaatgggagtgcagatgcagcgattcaagtgatcctctcgtcattgcagcaaa tatcattgggatcttgcacctgatattgtggattactgatcgtctttttttcaaatgtat ttatcgtcgctttaaatacggtttgaaaagagggccttctacggaaggagtgcctgagtc catgagggaagaatatcaacaggaacagcagagtgctgtggatgttgacgatggtcattt tgtcaacatagagctagag taa
SEQ ID NO 13: >EPI176483 | NS | A/California/04/2009 | EPI_ISL_29573 | 2009712049_8 | H1N1 atggactccaacaccatgtcaagctttcaggtagactgtttcctttggcatatccgcaag cgatttgcagacaatggattgggtgatgccccattccttgatcggctccgccgagatcaa aagtccttaaaaggaagaggcaacacccttggcctcgatatcgaaacagccactcttgtt gggaaacaaatcgtggaatggatcttgaaagaggaatccagcgagacacttagaatgaca attgcatctgtacctacttcgcgctacctttctgacatgaccctcgaggaaatgtcacga gactggttcatgctcatgcctaggcaaaagataataggccctctttgcgtgcgattggac caggcgatcatggaaaagaacatagtactgaaagcgaacttcagtgtaatctttaaccga ttagagaccttgatactactaagggctttcactgaggagggagcaatagttggagaaatt tcaccattaccttctcttccaggacatacttatgaggatgtcaaaaatgcagttggggtc ctcatcggaggacttgaatggaatggtaacacggttcgagtctctgaaaatatacagaga ttcgcttggagaaactgtgatgagaatgggagaccttcactacctccagagcagaaatga aaagtggcgagagcaattgggacagaaatttgaggaaataaggtggttaattgaagaaat gcggcacagattgaaagcgacagagaatagtttcgaacaaataacatttatgcaagcctt acaactactgcttgaagtagaacaagagataagagctttctcgtttcagcttatttaa Le sequenze selezionate come base per la sintesi dei primers dell'invenzione, in particolare le sequenze dei primers che giacciono all'interno della NP, sono collocate in zone altamente conservate e predittive dell'identità del virus studiato. Come di seguito mostrato negli Esempi, detti primers mostrano una altissima efficienza di ibridazione all'RNA virale, permettendo un'abbondante e assai specifica amplificazione dei frammenti di genoma virale prescelti (Figura 1). Inoltre, la lunghezza dei frammenti di genoma che vengono amplificati utilizzando i primers dell'invenzione, in particolare i primers delle SEQ ID NO 1 e 2 è ottimale (242 paia di basi; bp). Infatti essa è tale da permettere un'abbondante replicazione, ma soprattutto permette una precisione molto elevata di identificazione del virus (almeno 97%). SEQ ID NO 13:> EPI176483 | NS | A / California / 04/2009 | EPI_ISL_29573 | 2009712049_8 | H1N1 atggactccaacaccatgtcaagctttcaggtagactgtttcctttggcatatccgcaag cgatttgcagacaatggattgggtgatgccccattccttgatcggctccgccgagatcaa aagtccttaaaaggaagaggcaacacccttggcctcgatatcgaaacagccactcttgtt gggaaacaaatcgtggaatggatcttgaaagaggaatccagcgagacacttagaatgaca attgcatctgtacctacttcgcgctacctttctgacatgaccctcgaggaaatgtcacga gactggttcatgctcatgcctaggcaaaagataataggccctctttgcgtgcgattggac caggcgatcatggaaaagaacatagtactgaaagcgaacttcagtgtaatctttaaccga ttagagaccttgatactactaagggctttcactgaggagggagcaatagttggagaaatt tcaccattaccttctcttccaggacatacttatgaggatgtcaaaaatgcagttggggtc ctcatcggaggacttgaatggaatggtaacacggttcgagtctctgaaaatatacagaga ttcgcttggagaaactgtgatgagaatgggagaccttcactacctccagagcagaaatga aaagtggcgagagcaattgggacagaaatttgaggaaataaggtggttaattgaagaaat gcggcacagattgaaagcgacagagaatagtttcgaacaaataacatttatgcaagcctt acaactactgcttgaagtagaacaagagataagagctttctcgtttcagcttatttaa Le sequenze selezionate come base per la sintesi dei primers dell'invenzione, in particolare le sequenze dei primers che giacciono all'interno of NP, are located in highly conserved areas and predictive of the identity of the studied virus. As shown below in the Examples, said primers show a very high hybridization efficiency to viral RNA, allowing an abundant and very specific amplification of the selected viral genome fragments (Figure 1). Furthermore, the length of the genome fragments which are amplified using the primers of the invention, in particular the primers of SEQ ID NO 1 and 2, is optimal (242 base pairs; bp). In fact it is such as to allow abundant replication, but above all it allows a very high accuracy of virus identification (at least 97%).
La sensibilità di determinazione che si ottiene con i primers dell'invenzione rispetto ai primers utilizzati finora nella diagnostica del virus influenzale è altissima, come mostrato in Tabella 1. La sensibilità è espressa come ultima diluizione positiva dei campioni di acido nucleico amplificato da due pazienti positivi per il virus influenzale A di origine suina. I campioni dai pazienti erano diluiti serialmente 1:10 fino alla concentrazione minima di 10<-12>. La quantità di acido nucleico virale che può venire determinata con i primers dell'invenzione è da 1000 a 10.000 volte inferiore a quanto determinabile con i primers attualmente disponibili per i virus dell'influenza umana di tipo A (ad esempio quelli indicati con SEQ ID NO: 7 e 8). The sensitivity of determination obtained with the primers of the invention compared to the primers used up to now in the diagnostics of the influenza virus is very high, as shown in Table 1. The sensitivity is expressed as the last positive dilution of the amplified nucleic acid samples from two positive patients for swine influenza A virus. Samples from patients were serially diluted 1:10 to the trough concentration of 10 <-12>. The quantity of viral nucleic acid that can be determined with the primers of the invention is from 1000 to 10,000 times lower than what can be determined with the primers currently available for human influenza type A viruses (for example those indicated with SEQ ID NO : 7 and 8).
Tabella 1 Table 1
Paziente 1 Paziente 2 Patient 1 Patient 2
Primers influenza umana* 10<-2>10<-4>Human Influenza Primers * 10 <-2> 10 <-4>
Primers influenza nuovo 10<-5>10<-8>Primers influence new 10 <-5> 10 <-8>
ceppo* stump *
* I dati sono stati ottenuti analizzando su gel di agarosio i prodotti ottenuti dall'amplificazione con i primers indicati nel testo * The data were obtained by analyzing on agarose gel the products obtained from the amplification with the primers indicated in the text
I primers dell'invenzione possono essere utilizzati in tutte le tecniche di amplificazione genica in vitro quali la RT-PCR e la real time PCR, senza dovere apportare particolari adattamenti dei correnti protocolli in uso per queste tecniche che non siano quelli normalmente applicati dall'esperto nel ramo nell'utilizzo di primer diversi. The primers of the invention can be used in all in vitro gene amplification techniques such as RT-PCR and real time PCR, without having to make particular adaptations of the current protocols in use for these techniques other than those normally applied by the expert. in the art in the use of different primers.
Inoltre, la grande efficienza di trascrizione permette l'utilizzo di questi primer anche in reazioni one-step (vedi Esempio 1), in tutti i casi in cui sia necessario procedere ad una diagnosi rapida, necessaria nei casi di epidemie e pandemie. Furthermore, the great transcription efficiency allows the use of these primers even in one-step reactions (see Example 1), in all cases where it is necessary to carry out a rapid diagnosis, necessary in cases of epidemics and pandemics.
I kit dell'invenzione possono contenere, oltre ai primers dell'invenzione, tamponi, enzimi, oligonucleotidi e markers fluorescenti o di origine enzimatica, quale la perossidasi di rafano, per l'esecuzione, per esempio, della retrotrascrizione di segmenti del genoma virale e dell'amplificazione di detti segmenti, per la determinazione molecolare del virus dell'influenza, in particolare del virus dell'influenza suina. The kits of the invention may contain, in addition to the primers of the invention, buffers, enzymes, oligonucleotides and markers that are fluorescent or of enzymatic origin, such as horseradish peroxidase, for carrying out, for example, the reverse transcription of segments of the viral genome and of the amplification of said segments, for the molecular determination of the influenza virus, in particular the swine flu virus.
I primers dell'invenzione (SEQ ID NO 1-6) e più in particolare i primers delle SEQ ID NO 1-2, e i kit che li contengono presentano una serie di vantaggi che li rendono superiori ai materiali e kit attualmente in commercio per la determinazione dei virus influenzali. Essi permettono infatti la determinazione estremamente precisa ed attendibile della presenza del virus influenzale, in particolare del virus dell'influenza suina, anche in tempi molto rapidi applicando il protocollo di PCR one-step. Inoltre, grazie alla grande sensibilità dimostrata, rendono possibile una precoce rilevazione dell'infezione permettendo l'adozione di provvedimenti terapeutici ed epidemiologici con grande tempestività. The primers of the invention (SEQ ID NO 1-6) and more particularly the primers of the SEQ ID NO 1-2, and the kits containing them have a series of advantages that make them superior to the materials and kits currently on the market for determination of influenza viruses. In fact, they allow the extremely precise and reliable determination of the presence of the influenza virus, in particular of the swine flu virus, even in very short times by applying the one-step PCR protocol. Moreover, thanks to the great sensitivity demonstrated, they make it possible to detect the infection early allowing the adoption of therapeutic and epidemiological measures with great timeliness.
Gli esempi seguenti sono da considerare illustrativi e non limitativi della portata dell'invenzione. The following examples are to be considered illustrative and not limitative of the scope of the invention.
Esempi Examples
Esempio 1. Determinazione del virus dell'influenza A suina in pazienti umani Example 1. Determination of the swine influenza A virus in human patients
Il materiale ottenuto da tamponi naso-faringei eseguiti su 3 pazienti con sospetta infezione da virus dell'influenza suina fu estratto in triplicato utilizzando il kit MagMAX-96 Viral RNA Isolation Kit (Applied Biosystems) e l'apparecchio MagMAx Ambion (Applied Biosystems) come indicato dal produttore. The material obtained from nasopharyngeal swabs performed on 3 patients with suspected swine flu virus infection was extracted in triplicate using the MagMAX-96 Viral RNA Isolation Kit (Applied Biosystems) and the MagMAx Ambion (Applied Biosystems) apparatus as indicated by the manufacturer.
Successivamente fu eseguita una RT-PCR one step con i primers delle SEQ ID NO 1 e 2 sui campioni di acidi nucleici ottenuti per estrazione come sopra descritto. Le reazioni furono eseguite utilizzando il kit OneStep RT-PCR della Qiagen (cat. Subsequently a one step RT-PCR was performed with the primers of SEQ ID NO 1 and 2 on the nucleic acid samples obtained by extraction as described above. The reactions were performed using the Qiagen OneStep RT-PCR kit (cat.
210212) utilizzando i seguenti parametri: 210212) using the following parameters:
- Pre-amplificazione: 50°C per 30 minuti/94°C per 15 minuti; - Pre-amplification: 50 ° C for 30 minutes / 94 ° C for 15 minutes;
- Amplificazione: 95°C per 50 minuti/55°C per 50 minuti/72°C per 60 minuti, 50 cicli; - Amplification: 95 ° C for 50 minutes / 55 ° C for 50 minutes / 72 ° C for 60 minutes, 50 cycles;
- Estensione finale: 72°C per 10 minuti. - Final extension: 72 ° C for 10 minutes.
In Figura 1 è mostrata la corsa su gel di agarosio del prodotto amplificato ottenuto da un paziente utilizzando primers di routine (SEQ ID NO 7 e 8) (corsia 2) e quello ottenuto utilizzando i primers delle SEQ ID NO 1 e 2 (corsia 3). In corsia 1 è mostrato lo standard di pesi molecolari. Come è possibile vedere, è stato possibile ottenere un prodotto di amplificazione solo con i primers dell'invenzione. Figure 1 shows the agarose gel run of the amplified product obtained from a patient using routine primers (SEQ ID NO 7 and 8) (lane 2) and that obtained using the primers of SEQ ID NO 1 and 2 (lane 3 ). Lane 1 shows the molecular weight standard. As can be seen, it was possible to obtain an amplification product only with the primers of the invention.
I prodotti dell'amplificazione furono purificati tramite il PCR Purification Kit della Qiagen e usati per il sequenziamento. Quest'ultimo fu eseguito utilizzando il BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). I prodotti così ottenuti furono purificati tramite colonne Centri-Sep (Princeton Separations) ed analizzati con un sequenziatore automatico ABI PRISM 3100 (Applied Biosystems). Le sequenze ottenute furono sottoposte ad analisi BLAST e identificate come appartenenti al nuovo ceppo influenzale suino (SEQ ID NO 9-10). The amplification products were purified using the Qiagen PCR Purification Kit and used for sequencing. The latter was performed using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). The products thus obtained were purified by Centers-Sep (Princeton Separations) columns and analyzed with an ABI PRISM 3100 (Applied Biosystems) automatic sequencer. The sequences obtained were subjected to BLAST analysis and identified as belonging to the new swine flu strain (SEQ ID NO 9-10).
Claims (10)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IT000214A ITRM20090214A1 (en) | 2009-05-05 | 2009-05-05 | KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IT000214A ITRM20090214A1 (en) | 2009-05-05 | 2009-05-05 | KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| ITRM20090214A1 true ITRM20090214A1 (en) | 2010-11-06 |
Family
ID=41381831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| IT000214A ITRM20090214A1 (en) | 2009-05-05 | 2009-05-05 | KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES |
Country Status (1)
| Country | Link |
|---|---|
| IT (1) | ITRM20090214A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008026741A1 (en) * | 2006-08-31 | 2008-03-06 | Osaka Prefectural Government | Rapid diagnosis method specific to avian influenza virus |
| WO2008128176A1 (en) * | 2007-04-12 | 2008-10-23 | Nucleonics, Inc. | Influenza polynucleotides, expression constructs, compositions, and methods of use |
-
2009
- 2009-05-05 IT IT000214A patent/ITRM20090214A1/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008026741A1 (en) * | 2006-08-31 | 2008-03-06 | Osaka Prefectural Government | Rapid diagnosis method specific to avian influenza virus |
| EP2063270A1 (en) * | 2006-08-31 | 2009-05-27 | Osaka Prefectural Government | Rapid diagnosis method specific to avian influenza virus |
| WO2008128176A1 (en) * | 2007-04-12 | 2008-10-23 | Nucleonics, Inc. | Influenza polynucleotides, expression constructs, compositions, and methods of use |
Non-Patent Citations (4)
| Title |
|---|
| "CDC protocol of realtime RTPCR for influenza A (H1N1)", WORLD HEALTH ORGANIZATION, 28 April 2009 (2009-04-28), XP002562161, Retrieved from the Internet <URL:http://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR_SwineH1Assay-2009_20090430.pdf> * |
| "Viral gene sequences to assist update diagnostics for influenza A (H1N1) - GenBank accession numbers", WORLD HEALTH ORGANIZATION, 25 April 2009 (2009-04-25), XP002562159, Retrieved from the Internet <URL:http://www.who.int/csr/resources/publications/swineflu/SwinefluViralgenome.pdf> * |
| "Viral gene sequences to assist update diagnostics for swine influenza A(H1N1)", WORLD HEALTH ORGANIZATION, 25 April 2009 (2009-04-25), XP002562158, Retrieved from the Internet <URL:http://www.who.int/csr/disease/swineflu/swineflu_sequences_labs_20090425.pdf> * |
| LALLE E. ET AL.: "Design and clinical application of a molecular method for detection and typing of the influenza A/H1N1pdm virus", JOURNAL OF VIROLOGICAL METHODS, vol. 163, 25 October 2009 (2009-10-25), pages 486 - 488, XP002562160 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Decaro et al. | Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay | |
| Poddar | Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription-polymerase chain reaction (RT-PCR) and agarose gel electrophoresis | |
| Piewbang et al. | Development and application of multiplex PCR assays for detection of virus-induced respiratory disease complex in dogs | |
| US7247457B2 (en) | Detection and identification of enteroviruses by semi-nested amplification of the enterovirus VP1 protein | |
| Decaro et al. | A nested PCR approach for unambiguous typing of pestiviruses infecting cattle | |
| US20090061417A1 (en) | Influenza a virus detection method and kit therefore | |
| US10815538B2 (en) | Compositions and assays to detect seasonal H3 influenza A virus nucleic acids | |
| Qiu et al. | A reverse transcription-PCR for subtyping of the neuraminidase of avian influenza viruses | |
| JP2023516472A (en) | Compositions and methods for detecting severe acute respiratory syndrome coronavirus 2 (SARS-COV-2), influenza A and influenza B | |
| US9803251B2 (en) | Methods of detecting influenza virus | |
| Mohamed et al. | Development and evaluation of a broad reacting SYBR-green based quantitative real-time PCR for the detection of different hantaviruses | |
| US20180265936A1 (en) | Compositions and methods for detection and discrimination of influenza viruses | |
| TW202018093A (en) | Method for influenza a virus and influenza b virus detection | |
| CN102286639A (en) | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit | |
| US10329630B2 (en) | Compositions and methods for detection and discrimination of emerging influenza virus subtypes | |
| Losurdo et al. | Development of a TaqMan assay for sensitive detection of all pestiviruses infecting cattle, including the emerging HoBi-like strains | |
| RU2361924C1 (en) | Way of detection of virus of flu a of h5n1 subtype | |
| ITRM20090214A1 (en) | KIT FOR THE IDENTIFICATION OF INFLUENCED VIRUSES | |
| CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
| Poddar | Detection of type and subtypes of influenza virus by hybrid formation of FRET probe with amplified target DNA and melting temperature analysis | |
| CN102649984B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) visual detection kit for H1N1 subtype avian influenza viruses | |
| US20220243290A1 (en) | Molecular detection of novel coronaviruses | |
| AL-Ezzy | Molecular Diagnostic Approaches For SARS-COV2 | |
| Wang et al. | An integrated microfluidic system for diagnosis and multiple subtyping of influenza virus | |
| Hadzhiolova et al. | Application of molecular biology methods for detection of influenza viruses in Bulgaria |