ITRM20080433A1 - "MUTATED SEQUENCES OF EPATITIS B VIRUS RELATED TO RESISTANCE TO MEDICINES, A METHOD FOR THEIR ASSESSMENT AND FOR THEIR USE IN MEDICAL FIELD" - Google Patents

Description

Description of the Industrial Invention entitled: "Mutated sequences of the hepatitis B virus related to drug resistance, method for their evaluation and for their use in the medical field"

Field of the invention

The present invention relates to new mutated sequences of the hepatitis B virus related to drug resistance, a series of genomic, statistical and artificial intelligence methods for their evaluation and for use in the therapeutic field and a software implementation. of such mathematical methods. In particular, the invention comprises the development of an automated method for the evaluation of said mutations and for their correlation with resistance to antiviral drugs.

Definitions

Primary mutation = mutation capable of determining, by itself, a reduced sensitivity to a given antiviral drug.

Compensatory mutation = mutation which, although not alone responsible for conferring reduced sensitivity to an antiviral drug, confers an advantage in replicative terms to a virus that carries a primary mutation, thus allowing to increase, in fact, the degree of resistance to same drug.

Primer = Primer = nucleic acid strand that serves as a primer for DNA replication. Primers are needed because many DNA polymerases (enzymes that catalyze DNA replication) cannot start synthesizing a new strand "from scratch", but can only add nucleotides to a pre-existing strand.

Mutation profile = combination of two or more mutations present simultaneously in the sequence, even if they are not adjacent to each other.

"Immune escape" mutants = viruses that have mutations on the surface antigen that allow them to escape the immune response from the host and are responsible for the infection in subjects vaccinated against HBV.

Pyrosequencing (sequencing by synthesis) = advanced genome sequencing technique, based on the emission of a detectable signal following the incorporation of a nucleotide into the nascent DNA chain and the release of a pyrophosphate residue (Ronaghi et al. (1998). Science 281: 363 .; Ronaghi et al. (1996). Analytical Biochemistry 242: 84.). The GS FLX pyrosequencing system automatically manages a huge number of massively parallel pyrosequencing reactions in parallel.

Ultra-deep pyrosequencing = sequencing, carried out with a GS FLX pyrosequencer, of a large number of DNA fragments obtained by PCR amplification of a small target region, which allows the detection of mutations present with low frequency in the viral population analyzed.

Parsing or syntactic analysis = process designed to analyze a continuous input stream (read for example from a file or a keyboard) in order to determine its grammatical structure thanks to a given formal grammar. A parser is a program that performs this task. Parsers are usually not written by hand but generated through parser generators. Typically, the Italian term is used to refer to the recognition of a grammar and the consequent construction of a parse tree, which shows the rules used during the recognition from the input; the parse tree is then visited (even several times) during the execution of an interpreter or compiler. In most languages, however, parsing operates on a sequence of tokens in which the lexical parser chops up the input. Therefore, the English term is often used to indicate the whole of the lexical analysis and the actual syntactic analysis.

Clustering, or clustering, or cluster analysis, or grouping analysis = with these terms we refer to a set of multivariate data analysis techniques aimed at the selection and grouping of homogeneous elements in a set of data. All clustering techniques are based on the concept of distance between two elements. In fact, the goodness of the analyzes obtained by the clustering algorithms essentially depends on how significant the metric is and therefore on how the distance has been defined. Distance is a fundamental concept, since clustering algorithms group elements according to distance and therefore whether or not they belong to a set depends on how far the element under consideration is from the set. Clustering techniques can be mainly based on two philosophies:

a) From bottom to top. This philosophy provides that initially all the elements are considered clusters in themselves and then the algorithm joins the closest clusters. The algorithm continues to join elements to the cluster until a predetermined number of clusters is obtained or until the minimum distance between the clusters does not exceed a certain value;

b) From top to bottom. At first all the elements are a single cluster and then the algorithm starts dividing the cluster into many smaller clusters. The criterion that guides the division is always that of trying to obtain homogeneous elements. The algorithm proceeds until it has reached a predetermined number of clusters. This approach is also called hierarchical.

Clustering techniques are generally used when you have a lot of heterogeneous data and you are looking for anomalous elements.

Machine learning = represents one of the fundamental areas of artificial intelligence and deals with the realization of systems that rely on observations or examples as data for the synthesis of new knowledge, for example, classifications, generalizations, reformulations (Langley, P. (1996 ) "Elements of Machine Learning", Morgan Kaufmann publisher; Mitchell, T. (1997). "Machine Learning", McGraw Hill publisher; Witten, I. & Frank, E. (2005) "Data Mining: Practical Machine Learning Tools and Techniques ", Morgan Kaufmann publisher).

There are numerous situations that are difficult to solve using traditional algorithms. These typically are due to the presence of one or more of the following factors:

? Difficulty of formalization,

? High number of variables involved,

? Lack of theory,

? Need for customization.

Machine learning algorithms are traditionally divided into two main types:

? Supervised learning: an instructor provides examples (and counter-examples) of what needs to be learned;

? Unsupervised learning: starts with non-preclassified observations.

Known art

Despite the prevention implemented by vaccination, hepatitis B remains an important cause of mortality and morbidity. Currently, some 350 million people around the world are chronically infected, and approximately one quarter of these people develop progressive disease leading to cirrhosis and hepatocellular carcinoma.

The hepatitis B virus (HBV) is a DNA virus, belonging to the hepadnaviridae family, with a genome consisting of a circular DNA molecule of approximately 3.2 Kb with an incomplete double helix.

This virus has evolved a complex replicative mechanism that involves the formation of an intermediate called "covalently closed circular" DNA (cccDNA), which is transcribed by a host's DNA-dependent RNA polymerase into different RNA molecules. Among these, the pregenomic RNA is selectively packaged within the capsid and is then back-transcribed to DNA by the viral DNA polymerase (contained within the same capsid) which possesses reverse transcriptase (rt) activity.

HBV infection is characterized by high replication levels (about 10 <11> virions per day) and by a short average life of individual viral particles (1-3 days).

The enzyme responsible for viral replication, the reverse transcriptase, does not have 3'-5'exonuclease activity and is therefore unable to correct transcription errors committed during its normal enzymatic activity. Consequently, spontaneous mutations are introduced during each replicative event (up to about 10 <10> per day). As a result, HBV, similar to HIV and HCV, is present in the body in the form of quasispecies, that is, as a distribution of mutant, and sometimes recombinant, genomes, which forms a complex and dynamic population structure. The expression "quasispecies" therefore means a population of genetically distinct but very similar variants, generated by the random accumulation of mutations in the replicating genomes, by a fallacious replicative enzyme, on which selection acts as a mechanism of evolution of the quasispecies itself.

The virus has a genome with 4 partially overlapping open reading frames; this genetic organization means that a mutation in a gene often leads to a mutation in the superimposed gene, and this imbrication somehow reduces the chances of fixation of random mutations in the quasi-viral species. The endogenous (activity of the immune system) and exogenous (drug treatment) selective pressure strongly influence the composition of the viral quasispecies, giving the viral genome a plasticity that makes it capable of escaping the action of the immune system, and possibly antiviral drugs.

The goal of treatment in chronic HBV infection is the prevention of the development of cirrhosis and hepatocellular carcinoma, as well as the prevention of liver transplant failure.

The first approved therapeutic agent was, in 1990, interferon (IFN) -? , a cytokine having immunomodulatory, antiviral and antiproliferative activity.

Over the last few years, the therapeutic approach has changed. Currently, in addition to interferons, numerous other drugs are available that exert their antiviral activity directly, inhibiting the replicative activity of HBV (for example lamivudine, adefovir, entecavir and tenofovir).

The antiviral drugs currently available are all reverse transcriptase inhibitors (RTI), and are divided into nucleoside analogues (lamivudine, entecavir, telbivudine, emtricitabine, etc.) and nucleotide analogues (adefovir, and tenofovir). Among these, lamivudine, adefovir, entecavir and telbivudine have already entered current practice, while tenofovir, already in use for patients co-infected with HIV and HBV as part of antiretroviral therapy, will soon also be introduced in the treatment of patients with HBV only infection. .

Nucleoside and / or nucleotide analogs are generally well tolerated but require very long treatment times, virtually for life. Their choice is mandatory for those patients who do not tolerate IFN therapy, in cases of non-response to it, and in cases where the clinical situation is particularly advanced (patients with advanced cirrhosis), or complicated (patients undergoing chemotherapy and immunocompromised patients), for which a rapid reduction of viral replicative activity is necessary. In these latter patients the treatment of first choice is that with nucleoside / nucleotide analogues.

These drugs work by blocking the activity of HBV reverse transcriptase and thereby inhibiting replication of the virus within infected cells. Unfortunately, one of the most significant problems of treatment with these drugs and, more generally, of nucleoside and / or nucleotide analogues, is related to the onset of resistant mutants, a phenomenon that is facilitated by the lack of fidelity of the viral replicative enzyme.

Resistance can be assessed in terms of genotypic (appearance of mutations associated with drug resistance), virological (elevation of viral DNA levels in the serum of treated patients) and biochemical resistance (elevation of transaminases). Typically, an increase in viral load of at least one order of magnitude is one of the events used to define therapeutic failure in virological terms.

Therapeutic experience with antivirals in the case of HBV infection shows that resistance to an antiviral drug is gradually acquired through the selection of pre-existing viral variants in the viral quasispecies, which present mutations in some positions of the reverse transcriptase gene. The progressive increase in resistance to a certain drug is favored by the gradual accumulation of new mutations which confer a survival advantage to the virus, and therefore are fixed in the viral quasispecies.

Assays for the detection of HBV genomic mutations are based on direct sequencing of the reverse transcriptase (rt) gene, after amplification of specific viral sequences by polymerase chain reaction (PCR).

This latter approach, based on methods developed in-house by each laboratory or on commercial methods, such as the Trugene HBV Genotyping kit (Siemens Medical Solutions Diagnostics) system, allows to identify all possible mutations (primary or compensatory) already known, or newly identified, present in the amplified region, but has the limit of not allowing the detection of mutations present in a minority of the circulating viral quasispecies, as it generally detects the sequence (s) present with a frequency of at least 20% of the total virus population (Lok, Zoulim, et al (2007) Hepatology).

In addition to direct sequencing, there are other techniques that can also give a more sensitive response. Among these, a widely used technique for carrying out HBV genotypic resistance testing is reverse hybridization lineprobe assay (LiPA) (Stuyver, Van Geyt et al. (2000) J Clin Microbiol; Kim, Han et al. (2005) Antivir Ther; Hussain et al (2006); Osiowy (2006); Libbrecht et al (2007), used in the commercial INNOLiPA HBV DR v2 kit (Innogenetics NV, Ghent, Belgium). After amplification, DNA is hybridized with specific oligonucleotide probes fixed as parallel lines on the membrane of the strip supplied with the kit. This method allows to detect drug-resistant viral variants present in the total quasispecies with a low frequency, even in the order of 5%. In general, this technique is simpler, faster and more sensitive than the direct sequence, but it has the serious limitation of highlighting only mutations already known for which specific probes have been created. In particular, the commercial DR v2 test can detect simultaneam entails the wild type (wt) variant and the variants that carry mutations or polymorphisms of only codons 80, 173, 180, 181, 204, and 236 of the HBV rt gene.

The reverse transcriptase of HBV, like HIV and other viruses, contains seven well-preserved regions (A-E). Regions A, C and D form the binding domain between the catalytic center and nucleotide precursors (dNTP), domain B is involved in binding the RNA or DNA molecule to be copied (template), and domain E binds to the portion of nucleotide chain acting as a trigger for replication (primer strand, Bartholomeusz A. (2004), das K 2001). The most frequent lamivudine resistance-related mutations concern the YMDD motif (tyrosine, methionine, aspartic acid, aspartic acid) located in the C domain of reverse transcriptase, with the substitution of methionine with valine or isoleucine (M204V / I) (Allen MI, Deslauriers M. et al. Lamivudine Clinical Investigation Group. Hepatology (1998); 27: 1670-1677). More recently, a rarer mutation from methionine to serine (M204S) has been identified in this same location (Bozdayi AM, et al. (2003) J Viral Hepat.; 10: 256-65).

Lamivudine resistant mutants with mutated M204 position replicate less efficiently than wild type virus in vitro, especially when the mutation is from M toV (20). Therefore, in patients who develop resistance to lamivudine, the M204V mutation (and, to a lesser extent, M204 I) is almost always accompanied by compensatory mutations, which can restore an efficient replicative capacity of the virus. The L180M mutation (18, 22), and the V173L mutation, located in domain B, (18, 21, 22), are among the most frequent compensatory mutations (9-22% of cases). Other compensatory mutations, which progressively accumulate during lamivudine treatment, are: L80V / I, L82M, F166L, A200V and V207I (23-26).

Given the commonality of the therapeutic target of nucleoside and nucleotide antiviral drugs (reverse transcriptase), mutations capable of conferring resistance to a drug often confer resistance to another drug, especially if belonging to the same class. Given the continuous evolution of the antiviral therapeutic armamentarium for HBV, the literature is enriched with ever new information on this phenomenon, which is called cross-resistance.

The identification of mutations related to lamivudine resistance is very important, also in relation to the use of alternative drugs, especially in reference to the availability of new drugs effective against lamivudine-resistant strains.

Adefovir is a nucleotide analogue approved for the treatment of hepatitis B. This drug is active against resistant Lamivudine strains. Resistance to adefovir develops much more slowly than resistance to lamivudine. In any case, at the end of five years of treatment the percentage of patients with mutations reaches 28%. The main mutation associated with adefovir resistance is the N236T mutation in the D domain of the polymerase; more recently other mutations have been associated with adefovir resistance, such as A181T / V in domain B, V84M and S85A in domain A, and L217R and I233V in domain D. All these changes have been associated with reduced sensitivity. to the in vitro drug.

Entecavir is a powerful drug that has recently entered clinical practice for the treatment of chronic hepatitis. In a study conducted on 181 patients treated with entecavir for 90 weeks, of which 87% were lamivudine resistant, the following combinations of mutations were found: I169T + L180M + M204V + M250V and L180M + M204V + T184G + S202I. These results suggest that entecavir resistance requires the accumulation of four mutations to manifest, including two involved in resistance to lamivudine (Tenney DJ et al. (2004) 48: 3498-3507).

The experience gained in the past has taught that mutations developed in response to a drug can affect the therapeutic response to a subsequent drug, preventing its full effectiveness. The most recent experiences on therapeutic failures have also led to a change in the approach of rescue therapies. In fact, in the case of patients with previous therapeutic failure it has been observed that it is preferable to add a second drug rather than replace the antiviral drug used previously.

Identifying resistance-associated mutations early and defining the mutation picture, which can sometimes be very complex, is important for choosing the most suitable therapy for the individual case. In the case of previously untreated patients, there may also be minor pre-therapy variants in the viral population that could affect the therapeutic response.

To try to overcome these problems, a genotypic analysis of the HBV viral populations hosted by a patient is generally performed, using the known techniques described above, trying to correlate any mutations detected with the resistance data present in the literature on the subject. . But it is clear to those skilled in the art that this latter task is almost impossible using the tools currently provided by the state of the art, as the information is rather disorganized and fragmentary. In fact, there is no database of this type, that is, one that collects information on all possible mutations and their significance in relation to a potential therapeutic approach.

Therefore, the current state of the art does not allow the specialist doctor to select an antiviral drug or a combination of these drugs with a good margin of probability that the anti-HBV therapy will be effective.

Furthermore, there is no automated method which, together with the analysis of the genotypic profile, allows the subsequent correlation of this profile to the phenotypic characteristics in order to highlight the relationship between said mutations and resistance to one or more antiviral agents. Such an automated method should meet the criteria of speed of data entry and processing, which the tools in use in the field of diagnosis and therapy of HBV infection are currently unable to provide.

There are also no reliable, quick and easy-to-implement methods that allow the identification of mutations and / or mutation profiles with recurrences? 20%.

Furthermore, there are no rapid methods in the known art for using the HBV virus mutation profiles both for drug design and modification of existing drugs, and for clinical and diagnostic purposes.

Finally, there is no rapid method which, on the basis of sequence data of the HBV rt gene, provides the data relating to the sequence of the superimposed gene encoding the surface glycoprotein. Mutations of this antigen are important because they could alter the recognition of the antigen by the immune system, allowing the evasion of the immune defense mechanisms, and poor detectability by serological methods for the determination of HBs Ag, which is a marker of infection and viral replication.

The possibility of deciding in advance which drug can be administered to a patient with a good probability that the therapy will be effective is crucial, because it avoids subjecting patients to unnecessary side effects and unnecessary expenses.

As already described above, mutations or their combinations (mutation profiles) correlated or correlated with resistance to antiviral drugs are already known. But many others are continually being discovered whose role has yet to be definitively confirmed, and it is presumable that new mutations will be identified in the future, whose role, likewise, will have to be established. It is therefore considered useful and necessary to develop a method by which it is possible to keep all the data relating to the clinical significance of these mutations and to be able to easily and quickly correlate them to the therapy to be applied to a specific patient.

Summary of the invention

An automated method has now been found and constitutes the subject of the present invention which allows (i) the manipulation, i.e. the evaluation, analysis and management of a large number (in the order of some tens of thousands) of sequences originating from sequencing traditional and ultra-deep sequencing of the HBV virus gene. The manipulation required includes (ii) processing, parsing, alignment, error correction, clustering, phylogenetic analysis and data variation analysis, (ii) extracting from such sequences of reverse transcriptase gene mutations and / or surface antigen of the HBV virus, (iii) evaluation of nucleotide and amino acid variability and consequent (iv) extraction of significant mutations and / or mutation profiles. The method also advantageously includes the further stage (v) of correlation between the mutations found and the resistance to treatment with drugs, in particular antivirals, of at least one strain of the mutant viral isolate.

Still subject of the invention is the device for carrying out the various stages of the automated method for obtaining mutations and / or mutation profiles of the HBV virus.

Another object of the invention are the HBV genome mutations identified by the automated method of the invention and shown in Table 1 and the related mutation profiles.

Still another object is the use of the pyrosequencing technique for the genotypic characterization of the viral population present in a patient infected with HBV.

A further object is the use of said mutations and / or mutation profiles for the establishment of a database of genomic mutations of the HBV virus to be used in the medical field, in particular for the diagnosis and treatment of drug-resistant forms of the HBV virus. . This database can be implemented with the results of drug sensitivity tests performed in vitro (phenotypic assays) and in the clinical setting (in vivo) for use in combination with the automated method of the invention.

A further object is a method for evaluating the effectiveness of antiviral therapy in a patient infected with HBV, said method being conducted on a biological sample, preferably blood, of the patient and comprising the stages of:

- determine if the sample includes at least one nucleic acid that encodes the reverse transcriptase and / or the surface antigen of the HBV virus containing at least one resistance-related mutation; and - use the presence of said mutated nucleic acid for evaluating the effectiveness of antiviral therapy.

Still another object of the invention is a method for determining the sensitivity to one or more drugs of the viral population present in a patient infected with HBV, said method being conducted on a biological sample, preferably blood, of the patient and comprising the steps of:

- determine if the sample includes at least one nucleic acid that encodes the reverse transcriptase and / or the surface antigen of the HBV virus containing at least one resistance-related mutation; And

- use the presence of said mutated nucleic acid for the choice of antiretroviral therapy.

A method for identifying effective drugs on HBV strains resistant to therapy with nucleotide and / or nucleoside antivirals is also the subject of the invention, said method comprising the stages of:

- acquire at least one wild type or engineered HBV strain comprising in its genome at least one of the mutations identified with the method of the invention;

- determine the phenotypic response of the virus to the drug to be tested; And

- use the phenotypic response thus obtained to determine the efficacy of the tested drug.

Still further objects of the invention are: oligo- or polynucleotide sequences containing the mutations and / or mutation profiles generated according to the method of the invention to be used in the medical field, in particular for diagnosis and therapy purposes; plasmids comprising said oligo- and polynucleotides to be used as cloning and expression vectors; engineered HBV viruses containing one or more antiviral drug resistant mutations.

Further objects of the invention will become evident from what is described below.

Brief description of the figures

Figure 1: block diagram of the operation of the automated method of the invention.

Figure 2: frequency of the mutated positions in the rt of HBV of genotype A or D, obtained by applying ultra-deep pyrosequencing using GS FLX to biological samples from patients.

Detailed description of the invention The present invention relates to the field of diagnostics based on the analysis of nucleic acids and the identification of mutations in certain nucleic acid sequences.

In particular, the invention refers to a method for the genotypic characterization of the viral population present in a patient infected with HBV, carried out by means of a system capable of analyzing the complexity of the viral quasispecies, allowing to appreciate also mutations present in minority viral populations, typically? 20%, preferably? 15%, more preferably? 10%, even more preferably? 5%, and relate them to specific viral phenotypes resistant to one or more antiviral agents.

The invention relates in particular to an automated method that allows the analysis of massive sequence results, as well as the correlation of the mutations thus determined (possibly present in minority viral populations, therefore not easily detectable with the traditional methods of rectum sequencing ) their phenotypic characteristics, in order to highlight the relationship between said mutations and / or mutation profiles and resistance, without resorting to the expensive and difficult to apply phenotyping of the observed mutants on site.

The mutations and / or mutation profiles thus obtained constitute a database that can be used in diagnostics, clinical treatment and in defining therapies.

The method of the invention uses an approach that combines the observation of the presence of a certain mutation and / or combinations of mutations in the genome of a population of HBV in a patient, determined by any sequencing method, but preferably by the so-called method of ultra-deep pyrosequencing, and the in vitro verification, by means of a phenotypic test, of the real effect of the detected mutation, on the resistance to one or more antiviral drugs, or the in vivo verification in relation to clinical parameters, such as, for example, the viral load .

As already mentioned above, the HBV resistance genotype assay may comprise a sequencing step of the amplified viral genome fragments, which is typically performed following the Sanger method (Sanger F, Coulson AR. (1975) J Mol Biol. 94 : 441–448).

Preferably, the method of the invention exploits the depth of analysis of a new DNA sequencing system called "ultra-deep pyrosequencing", which is performed using the latest generation sequencing system called GS FLX. This sequencer has been applied to the deciphering of entire eukaryotic genomes (Margulies et al. (2005) Nature 437: 376-380) and is recently finding new applications in microbiology and virology.

Pyrosequencing is a relatively recent DNA sequencing technique based on synthesis rather than chain breaking according to the classic Sanger method. It was originally developed at the Royal Institute of Technology in Stockholm in 1990 (Nyrén, P. (2007). Methods Mol Biology 373: 1–14).

Pyrosequencing is based on 5 phases:

1) the sequence to be analyzed, after having been amplified with PCR, is denatured and incubated as a single helix with the enzymes DNA polymerase, ATP sulphorylase, luciferase and apyrase and the substrates adenosine sulphosphate (ASP) and luciferin;

2) one of the four dNTPs is added to the reaction. DNA polymerase catalyzes the addition of this base only if it is complementary with the template residue. In this case there is concomitant release of inorganic pyrophosphate PPi;

3) the PPi thus produced is transformed into ATP, by the sulphorylase and using the ASP as substrate. The ATP obtained allows the conversion of luciferin to oxyluciferin by luciferase with the production of a light signal which is detected by a fluorimeter;

4) the enzyme apyrase degrades the dNTP that has not been incorporated, and the ATP produced by the sulphorylase. Only when the degradation is finished is a second dNTP added to advance the polymerization reaction (returning to step 1);

5) all 4 ds (NTPs) are added cyclically until the complete deduction of the sequence. The light signal produced each time by luciferin is recorded in a special "pyrogram". The signal will be proportional to the ATP produced and therefore to the number of nucleotides of the same type incorporated in the nascent DNA chain.

The GS FLX system, in particular, exploits the pyrosequencing reaction described above and a miniaturized detection system. Thousands of DNA fragments adhere to a solid support made up of microballs (one fragment for each marble). The microbeads are suspended in an emulsion so as to be contained each in a single emulsion micelle, in which a PCR reaction is performed which amplifies the single adhered fragment (emulsion PCR). Subsequently the marbles, loaded with amplified fragments, are distributed in a chamber that contains thousands of cells, in each of which a separate pyrosequencing reaction takes place (one for each marble). The production of light signal in each single cell is recorded by a very high resolution CCD photographic apparatus, which produces a measurement for each single cell. The sequence report includes thousands of sequences, one for each single initial fragment (ultra-deep pyrosequencing) of viral DNA, thus allowing the detection of rare sequences (below 20%) within the viral quasispecies.

Resistance phenotypic assay is performed to determine the ratio between the dose of drug that inhibits replication of the mutated virus in vitro (IC50) by 50% and the IC50 of the reference virus wt in cell culture-based systems. The test is based on the introduction of the genome segment coming from the patient and containing the mutation (s) in a genomic background of HBV capable of replicating in vitro. The recombinant virus thus constructed is introduced into a cellular system capable of replicating it (typically HepG2 cells), and the culture is carried out for a few days in the absence or in the presence of scalar doses of the drug whose sensitivity is to be tested. Viral replication is measured by dot blot or southern blot using radioactive labeled probes, on the basis of which the number of genomes produced is quantified. On the basis of the comparison data between the culture without drug and that with the drug at the various concentrations, an inhibition curve is produced, on which the concentration value of the drug capable of causing a 50% inhibition of virus production is interpolated (IC50 ). A viral strain is defined as resistant to a drug when an increase of at least 10 times is observed in the IC50-In principle, it is not necessary to know a priori the mutation present in the virus to perform the phenotypic resistance test.

The basic methodology for obtaining artificially mutated HBV viruses is similar to that applied also to other types of viruses and has already been described (see Zoulim F. (2006) Semin Liver Dis. 26: 171-180) although for HBV does not yet exist commercially available tests.

A very interesting aspect related to the development of resistant mutants is linked to the fact that the gene for the polymerase is superimposed on that for the surface antigen. It is possible that in patients undergoing treatments with nucleotide / nucleoside analogues, multiple mutations in the polymerase may accumulate, which can simultaneously cause changes in the virus surface antigen (HBsAg), resulting in the selection of "immune escape" variants that escape. to the control of the host's immunological system. Even these mutations, difficult to detect with the traditional methods known in the art, can be detected with the method of the invention.

In one of its preferred forms, the present invention refers to the new mutations present in Table 1, compared with the HBV wild-type D and A genotypes.

Table 1

s: E_2_A; s: E_2_D; rt: D_2_G; rt: W_3_R; s: N_3_S; rt: G_4_E; rt: G_4_R; s: I_4_T; s: T_5_A; s: T_5_I; s: T_5_S; rt: A_7_D; s: G_7_R; rt: A_7_T; rt: A_7_V; rt: A_7_Y; rt: E_8_D; s: F_8_H; rt: E_8_K; s: F_8_P; s: F_8_R; s: L_9_R; rt: H_9_Y; s: G_10_A; s: G_10_K; rt: G_10_R; s: G_10_R; rt: E_11_D; rt: E_11_K; s: P_11_L; rt: E_11_Q; s: L_12_V; rt: H_13_L; rt: H_13_N; s: L_13_P; rt: H_13_R; rt: H_13_Y; s: V_14_A; s: V_14_G; rt: R_15_K; s: G_18_del; rt: R_18_K; rt: R_18_S; s: F_19_C; s: F_20_L; rt: P_20_S; s: F_20_S; s: L_21_S; rt: R_22_C; rt: R_22_G; rt: V_23_A; rt: T_24_A; s: R_24_K; s: R_24_L; s: R_24_S; s: I_25_T; rt: G_26_R; s: T_27_del; rt: V_27_F; s: T_27_I; s: I_28_del; s: I_28_L; s: P_29_del; s: P_29_L; rt: V_30_G; s: Q_30_H; s: Q_30_K; s: Q_30_W; rt: D_31_N; s: S_31_N; s: S_31_R; s: L_32_Q; s: D_33_A; s: D_33_L; s: S_34_L; s: W_35_F; s: W_35_G; rt: H_35_Y; rt: N_36_H; s: W_36_L; s: W_36_U; s: T_37_P; rt: T_37_S; s: T_37_S; rt: A_38_E; rt: A_38_P; rt: A_38_S; rt: A_38_T; s: L_39_D; s: L_39_del; s: L_39_P; s: N_40_del; s: N_40_F; s: N_40_H; s: N_40_S; s: N_40_T; s: F_41_L; s: L_42_G; s: L_42_R; s: G_43_del; s: G_43_M; s: G_43_R; s: G_44_E; s: E_44_R; s: S_45_A; s: T_45_A; s: S_45_ins; s: T_45_N; s: T_45_S; s: S_45_V; s: P_46_G; s: T_46_P; s: P_46_V; s: V_47_A; s: V_47_del; s: V_47_E; s: V_47_G; s: V_47_I; s: V_47_ins; s: V_47_K; s: V_47_N; s: V_47_T; s: C_48_F; s: C_48_G; rt: Q_48_H; s: L_49_P; s: L_49_R; s: G_50_A; s: G_50_S; rt: S_50_W; rt: R_51_K; s: Q_51_L; s: Q_51_R; s: Q_51_V; s: N_52_D; rt: G_52_E; rt: G_52_R; rt: N_53_D; rt: N_53_I; rt: N_53_K; s: S_53_L; rt: H_53_S; rt: N_53_S; rt: N_53_V; rt: H_54_D; s: Q_54_H; s: Q_54_N; s: Q_54_R; rt: H_54_S; rt: H_54_T; rt: R_55_del; s: S_55_del; s: S_55_F; rt: R_55_H; rt: R_55_Q; rt: V_56_M; s: P_56_Q; s: P_56_S; s: P_56_T; s: T_57_A; s: T_57_I; s: T_57_S; s: S_58_C; s: S_58_F; rt: W_58_U; s: N_59_S; s: N_59_Y; s: H_60_Q; s: H_60_R; s: S_61_L; s: S_61_P; s: P_62_L; s: T_63_I; s: T_63_N; s: T_63_S; s: S_64_C; s: S_64_P; s: C_65_Y; s: P_67_Q; s: T_68_I; s: P_70_A; s: P_70_L; s: W_74_U; s: M_75_L; s: C_76_F; s: C_76_S; s: C_76_Y; rt: S_78_C; s: R_78_Q; s: R_79_C; s: R_79_G; s: R_79_H; s: R_79_L; s: R_79_S; s: F_80_C; rt: L_80_I; s: F_80_L; s: F_80_S; rt: L_80_V; s: I_81_H; s: I_82_L; rt: L_82_M; s: I_82_M; s: F_83_C; s: F_83_L; s: F_83_S; s: L_84_P; s: F_85_C; s: F_85_I; s: I_86_R; rt: A_87_E; rt: A_87_G; rt: A_87_T; rt: A_87_V; rt: F_88_S; rt: Y_89_S; rt: H_90_P; s: C_90_S; rt: I_91_F; rt: I_91_P; rt: I_91_V; s: I_92_L; s: I_92_M; rt: L_93_N; s: V_96_G; s: L_97_del; rt: A_97_S; rt: A_97_T; s: L_98_V; s: S_100_C; s: Y_100_C; s: Q_101_R; rt: V_103_I; s: M_103_I; s: M_103_L; rt: I_103_V; rt: G_104_S; s: P_105_A; s: P_105_S; s: A_105_V; rt: S_106_A; s: V_106_G; s: V_106_I; s: C_107_D; rt: G_107_R; s: C_107_R; s: C_107_Y; s: L_109_G; rt: S_109_P; rt: R_110_G; s: I_110_L; s: I_110_V; s: P_111_L; s: P_111_R; rt: V_112_A; s: G_112_A; s: G_112_E; rt: V_112_L; s: G_112_R; s: S_113_A; s: S_113_del; rt: A_113_G; s: S_113_T; rt: R_114_H; s: S_114_P; s: S_114_T; s: T_115_P; rt: L_115_V; s: T_116_S; s: S_117_R; s: S_117_T; s: T_118_A; rt: N_118_D; rt: N_118_S; rt: N_118_T; s: T_118_V; rt: N_118_Y; rt: R_120_K; rt: R_120_S; s: P_120_S; s: P_120_T; rt: I_121_N; rt: I_121_S; rt: I_121_V; rt: F_122_H; rt: F_122_I; s: R_122_K; rt: F_122_N; s: R_122_Q; rt: F_122_S; rt: F_122_V; rt: F_122_Y; rt: N_123_D; rt: N_123_T; s: T_123_V; rt: Q_125_H; s: T_125_M; s: T_126_I; s: T_126_S; rt: H_126_Y; s: P_127_L; rt: G_127_R; s: P_127_T; rt: T_128_A; s: A_128_E; rt: T_128_I; rt: T_128_N; s: A_128_T; s: A_128_V; s: Q_129_H; rt: M_129_L; s: Q_129_R; s: Q_129_U; s: G_130_del; s: G_130_E; s: G_130_R; s: N_131_A; s: T_131_A; rt: D_131_H; s: T_131_N; rt: D_131_S; s: K_133_I; s: M_133_I; s: K_133_L; s: M_133_R; s: K_133_T; s: M_133_T; s: F_134_C; s: Y_134_C; s: F_134_del; rt: D_134_E; s: Y_134_F; rt: D_134_G; rt: D_134_N; s: Y_134_N; rt: D_134_V; s: P_135_A; s: P_135_H; rt: H_135_T; s: S_136_L; rt: C_136_Y; s: C_137_G; rt: S_137_T; s: C_138_G; rt: R_138_K; rt: D_139_H; rt: D_139_K; rt: D_139_Q; rt: D_139_S; s: C_139_Y; s: T_140_del; s: I_140_S; s: T_140_S; s: K_141_del; rt: Y_141_F; rt: Y_141_Q; s: K_141_T; s: K_141_U; rt: V_142_E; rt: V_142_I; s: S_143_L; s: T_143_L; s: S_143_T; s: G_145_E; rt: L_145_M; s: G_145_R; s: N_146_H; s: N_146_T; s: C_147_Y; s: T_148_del; rt: Y_148_F; rt: K_149_H; s: C_149_R; s: C_149_Y; s: I_150_T; rt: F_151_L; s: P_151_L; rt: F_151_V; rt: F_151_Y; s: I_152_T; s: I_152_V; rt: R_153_Q; rt: W_153_R; rt: R_153_W; s: S_154_A; rt: K_154_E; rt: K_154_N; s: W_156_R; rt: L_157_P; s: F_158_L; s: G_159_A; s: G_159_E; rt: S_159_T; rt: H_160_R; s: K_160_R; s: Y_161_L; s: F_161_Y; s: L_162_I; s: W_163_C; s: W_163_U; rt: I_163_V; s: E_164_A; s: E_164_D; s: E_164_G; rt: L_164_M; s: E_164_V; s: L_165_U; s: A_166_V; s: V_168_D; rt: K_168_E; s: A_168_V; s: R_169_G; s: F_170_ins; s: F_170_S; s: F_170_T; s: W_172_C; rt: G_172_U; s: W_172_U; s: L_173_F; rt: V_173_L; s: L_173_P; s: S_174_N; s: S_174_T; s: L_175_F; s: L_175_S; s: L_176_R; s: V_177_A; s: V_177_E; s: V_177_M; s: P_178_Q; s: P_178_T; s: F_179_L; s: F_179_V; s: V_180_A; s: V_180_L; rt: L_180_M; s: Q_181_E; rt: A_181_S; rt: A_181_T; rt: A_181_V; s: W_182_U; s: F_183_C; s: F_183_L; s: V_184_A; rt: T_184_S; rt: A_186_T; s: S_187_del; rt: I_187_L; rt: I_187_T; rt: I_187_V; rt: C_188_R; s: T_189_I; s: V_190_A; s: V_190_G; s: W_191_U; s: L_192_F; s: L_192_I; rt: R_192_S; s: L_192_V; s: S_193_K; s: S_193_L; s: S_193_N; s: V_194_A; s: A_194_D; s: A_194_G; s: I_195_L; s: I_195_M; s: I_195_T; s: W_196_C; s: W_196_L; s: W_196_S; s: W_196_U; s: M_197_I; s: M_197_L; s: M_197_T; s: M_198_I; s: M_198_K; s: M_198_R; s: M_198_T; s: W_199_R; s: W_199_U; rt: L_199_V; s: Y_200_F; rt: A_200_G; s: Y_200_L; s: Y_200_N; s: Y_200_S; rt: A_200_T; rt: A_200_V; s: W_201_del; rt: F_201_U; s: W_201_U; s: G_202_A; rt: S_202_R; s: G_202_R; s: P_203_ins; s: P_203_L; s: P_203_Q; s: P_203_R; rt: Y_203_S; s: P_203_T; s: P_203_U; s: R_204_G; s: S_204_G; rt: M_204_I; s: R_204_K; rt: M_204_L; s: R_204_N; s: S_204_N; s: S_204_R; rt: M_204_V; s: L_205_G; rt: D_205_N; rt: D_205_Y; s: Y_206_C; rt: D_206_E; s: Y_206_F; s: Y_206_H; s: Y_206_P; s: Y_206_Q; s: Y_206_R; rt: D_206_U; s: R_207_C; rt: V_207_E; s: R_207_G; s: N_207_H; rt: V_207_L; rt: V_207_M; s: R_207_N; s: N_207_R; s: N_207_T; rt: V_208_A; rt: V_208_E; s: I_208_N; s: I_208_S; s: I_208_T; s: L_209_I; s: L_209_M; s: L_209_T; rt: L_209_V; s: L_209_V; rt: G_210_E; s: R_210_K; s: S_210_M; s: R_210_N; s: S_210_N; s: S_210_R; s: R_210_T; rt: A_211_D; rt: A_211_I; s: P_211_L; s: P_211_Q; s: F_212_del; s: F_212_L; rt: K_212_N; rt: K_212_R; s: I_213_F; s: L_213_I; s: I_213_M; s: L_213_M; rt: S_213_R; s: I_213_S; s: L_213_T; rt: V_214_A; s: P_214_H; s: P_214_L; rt: P_215_H; rt: P_215_T; s: L_216_C; s: L_216_F; rt: H_216_Q; s: L_216_U; rt: H_216_Y; s: L_217_E; rt: L_217_H; s: L_217_ins; rt: L_217_R; rt: E_218_D; rt: E_218_H; s: I_218_ins; s: I_218_S; s: I_218_T; s: F_219_I; s: F_219_S; s: F_220_C; s: F_220_del; rt: L_220_F; s: F_220_L; s: F_220_S; rt: L_220_T; s: C_221_G; s: C_221_R; rt: F_221_Y; s: C_221_Y; rt: T_222_A; s: L_222_del; s: L_222_P; rt: T_222_S; s: L_222_V; rt: A_223_P; s: W_223_R; rt: A_223_S; s: W_223_U; s: V_224_A; s: V_224_E; s: V_224_G; rt: V_224_I; rt: V_224_L; s: Y_225_C; s: Y_225_F; s: Y_225_H; rt: T_225_P; rt: T_225_S; s: Y_225_S; s: Y_225_U; rt: N_226_H; rt: F_227_H; rt: L_228_P; rt: L_229_M; rt: L_229_S; rt: L_229_V; rt: L_229_W; rt: S_230_C; rt: S_230_P; rt: S_230_Y; rt: L_231_H; rt: L_231_S; rt: G_232_V; rt: I_233_L; rt: I_233_M; rt: I_233_P; rt: I_233_T; rt: I_233_V; rt: H_234_L; rt: L_235_F; rt: L_235_U; rt: L_235_V; rt: N_236_K; rt: N_236_T; rt: N_236_V; rt: P_237_L; rt: P_237_Q; rt: P_237_T; rt: A_238_H; rt: A_238_K; rt: A_238_S; rt: K_241_R; rt: R_242_G; rt: G_244_R; rt: Y_245_H; rt: S_246_N; rt: S_246_P; rt: S_246_T; rt: N_248_H; rt: H_248_Y; rt: F_249_L; rt: M_250_I; rt: M_250_T; rt: Y_252_H; rt: V_253_I; rt: I_253_T; rt: G_255_R; rt: S_256_C; rt: C_256_G; rt: Y_257_G; rt: Y_257_H; rt: W_257_L; rt: Y_257_W; rt: S_259_L; rt: T_259_P; rt: T_259_S; rt: S_259_T; rt: Q_262_U; rt: H_264_Y; rt: I_266_T; rt: I_266_V; rt: Q_267_H; rt: Q_267_L; rt: Q_267_R; rt: Q_267_Y; rt: I_269_L; rt: I_269_T; rt: E_271_A; rt: E_271_D; rt: H_271_D; rt: H_271_E; rt: E_271_H; rt: E_271_L; rt: E_271_Q; rt: R_274_G; rt: R_274_Q; rt: R_274_S; rt: I_278_A; rt: V_278_I; rt: R_280_M; rt: D_283_E; rt: W_284_R; rt: K_285_Q; rt: V_286_L; rt: C_287_F; rt: Q_288_U; rt: R_289_S; rt: I_290_L; rt: I_290_N; rt: V_291_G; rt: V_291_M; rt: V_291_W; rt: G_292_A; rt: G_292_W; rt: L_293_V; rt: L_294_F; rt: L_294_U; rt: G_295_D; rt: F_296_L; rt: F_296_M; rt: F_296_S; rt: A_297_I; rt: A_297_T; rt: A_298_D; rt: A_298_V; rt: F_300_Y; rt: T_301_K; rt: Q_302_E; rt: C_303_F; rt: Y_305_A; rt: P_306_S; rt: P_306_T; rt: A_307_V; rt: L_308_E; rt: K_309_L; rt: P_310_L; rt: L_311_S; rt: A_313_T; rt: Q_316_H; rt: A_320_P; rt: F_321_T; rt: T_322_P; rt: T_322_S; rt: T_322_V; rt: F_323_L; rt: S_324_R; rt: P_325_H; rt: A_329_D; rt: A_329_T; rt: F_330_C; rt: L_331_V; rt: C_332_F; rt: C_332_N; rt: C_332_R; rt: C_332_S; rt: C_332_Y; rt: K_333_N; rt: K_333_T; rt: Y_335_F; rt: L_336_M; rt: N_337_D; rt: N_337_H; rt: N_337_T;

where rt: reverse transcriptase gene (polymerase);

s: surface coding gene;

x = wild type amino acid (genotype D or A);

n = positive integer indicating the position of the amino acid codon (standard numbering);

y = amino acid in substitution of the wild type (mutation); moreover, when y = U the mutation introduces a stop codon.

The mutations listed in Table 1 can be present as single mutations or in association with each other and can confer resistance to treatment to at least one antiviral drug as regards reverse transcriptase (rt), and an "immune escape" phenotype to the HBV virus. regarding HBsAg.

The sequences and mutations of the invention were obtained as follows:

- pyrosequencing from 13 blood samples drawn from 8 patients treated with lamivudine / emtricitabine, or with lamivudine followed by adefovir, and from 5 therapy-naive patients;

- download of the HBV database on GenBank

- extraction of mutations from wild type D or A genotypes on the above sequences, with optimized local alignment and error correction;

- evaluation of nucleotide and amino acid variability (with calculation of confidence intervals on the frequencies of mutations);

- extraction of mutations with a frequency of more than 1%.

The automation of the method is performed as described below. A series of programs written in the open source language java (http://java.sun.com), executable on any type of platform (i.e. Windows, Mac, Linux, Unix, Solaris) acts as a wrapper by incorporating an implementation of the Smith-Waterman-Gotoh (SWG) local alignment algorithm (Smith and Waterman, 1981; Gotoh, 1982), provided in the Jaligner package (jaligner.sourceforge.net/). To implement the automated method of the invention, commercially available programs can be used that perform the following operations:

A. Alignment and translation into amino acids of all nucleotide sequences given in input (even multiple bands) against a user-defined consensus to report the variation frequencies (with confidence intervals and descriptive statistics) by amino acid codon, together with the translated sequence;

B. Alignment of all nucleotide sequences given in input (even multiple bands) against a user-defined consensus to report the variation frequencies (with confidence intervals and descriptive statistics) for each nucleotide position; C. Alignment and translation into amino acids of all nucleotide sequences given in input (even multiple bands) against a consensus defined by the user to report the list of mutations detected, with analysis on frameshift, insertions and deletions not in frames, ambiguous positions;

D. Alignment and translation in amino acids of all nucleotide sequences given in input (even multiple bands) against a user-defined consensus to report a binary or real matrix in which each row is a viral isolate and each column is a position changed;

E. Alignment and translation of all nucleotide sequences given in input (even multiple bands) against a user-defined consensus to report the translated sequences, possibly already aligned with the consensus;

F. Calculation of nucleotide variation divided by base type on a set of input sequences using a reference consensus;

G. Extraction of mutations on the polymerase region, with alignment and translation into amino acids of all nucleotide sequences given in input (even multiple fasta) against a consensus to report the list of mutations detected, with analysis on frameshift, insertions and deletions not in frame, ambiguous positions. The list shown is in accordance with the numbering of the subregions of reverse transcription;

H. Alignment and translation in amino acids of all nucleotide sequences given in input (even multiple fasta) against reference sequences to report the list of detected mutations, with analysis on frameshift, insertions and deletions not in frames, ambiguous positions;

I. Reconstruction of haplotypes from a set of sequences produced by sequencing through reconstruction of the complete graph of the overlaps on the output referred to in points D or E (therefore on sequences processed and corrected or translated into binary space) using a weighted average on the approach frequentistic for determining the prevalence of different species.

The wrapper includes various input processing functions, including processing multiple sequences and reformatting to the standard fasta from various formats, including ace. It is also possible to directly process the output files of the pyrosequencing machines by connecting directly to a central server. Based on the alignments produced with the execution of the SWG algorithm, various analysis procedures, amino acid translation, output formatting are then applied. The SWG algorithm is specifically optimized for data generated by pyrosequencing (Wang et al, 2007): refinements are in fact applied to the original algorithm for the detection / correction of frameshift, the realignment of insertions and deletions that are not in the correct frame of coding, the translation of nucleotide ambiguities, with the application of specific inclusion thresholds of the variations according to the indications of (Eriksson et al, 2008), who analyzed in detail the error rate in the data coming from pyrosequencing. Specifically, the fasta sequences of the pyrosequencer (read and processed as described above directly by the central servers) are selected according to the quality scores generated by the machine and are then aligned locally using a consensus sequence chosen by the user or automatically determined by default. (for example for HBV there is a library of different genotypes collected in GenBank).

The alignment parameters concerning the penalties for opening and extending the gaps are optimized through a grid search in real space [5, 30] and [0.25, 3] with steps of 5 and 0.5 respectively. It is also possible to optimize the alignment parameters by maximizing the similarity coefficient, the alignment score, or by minimizing the number of 1-base or 2-base frameshift. In fact, given that the correct protein coding frame of the consensus is known, it is possible to divide the aligned nucleotides into coding triplets and perform a series of alignment refinements and quality controls. When insertions or deletions of three (or multiples of three) consecutive bases do not correspond exactly to a triplet in the encoding frame, an automatic procedure corrects the alignment according to a criterion of maximum likelihood and repositions the insertions or deletions in frames. In the case of 1- or 2-base frameshift with respect to the consensus, however, these are considered possible errors of the pyrosequencer and are ignored, while for 1- or 2-base frameshift present in a query sequence, the same are reported and analyzed frequently.

Other wrappers for the execution of the BLAST program (Altschul et al, 1990) are implemented: specifically, java scripts execute the BLAST and automatically parse the output using local replicas on genomic database servers downloaded and periodically updated from world databases. (GenBank, www.ncbi.org): to date the wrapper is configured on HIV, HBV, HCV and Herpes.

In series with the implementation of nucleotide alignment with optimization, error correction / detection and amino acid translation, a program works that extracts nucleotide and amino acid mutations from any consensus sequence, both on the input of pyrosequencers and Sanger sequences.

The prevalence of mutations is calculated as relative frequency in the sequenced (sub) regions, with a robust estimate of confidence intervals and other basic descriptive statistics. Additional procedures format the output of the alignments in fasta or phylip formats, report the translated protein sequences, binary matrices for the analysis of point variation or real matrices for quantitative population analysis.

These outputs are directly usable by other bioinformatics packages, such as EMBOSS (http://emboss.sourceforge.net/), R (http://www.r-project.org/) and phylip (http: // evolution. genetics.washington.edu/phylip.html), the use of which is widespread among researchers.

Several thousand sequences can then be processed and made available for high-level analysis within a couple of hours.

In addition, additional scripts allow the execution of the aforementioned bioinformatics programs on supercomputers and servers with high localized storage capacity, a higher processing capacity being required for the large amount of data coming from pyrosequencing. For example, the server in use at the Interuniversity Consortium for Supercomputing Applications for University and Research (CASPUR, www.caspur.it) can be used.

Regarding the reconstruction of complete genomes using pyrosequencing, a wrapper has been implemented that uses the CAP3 algorithm (Huang and Madan, 1999): CAP3 is performed directly on the data of the pyrosequencer and then eventually sends the generated contiguous ones to the aforementioned wrapper of BLAST. Finally, as regards the reconstruction of haplotypes, this is performed by implementing a work by (Eriksson et al, 2008), which reconstructs the most probable subpopulations from a series of data coming from pyrosequenation, also associating the prevalences of individual species.

The automated method of the invention allows the manipulation of a large number of sequences, typically in the order of tens of thousands, coming from both Sanger sequencing and ultra-deep pyrosequencing. Said method of the invention allows the reduction of processing times and manual intervention, execution on dedicated servers and supercomputers. The automated method of the invention performs nu cleotide alignment, translation into amino acids, mutation extraction, frequency calculation with confidence intervals, haplotype reconstruction, subtyping, hierarchical clustering, bootstrap sample generation for population studies . Furthermore, said method proceeds with the identification of mutations in the sequences obtained (up to 20,000 readings for each patient), by comparison with the databases available for consultation (for example GenBank, Japanese database and the like). The method allows the identification of mutations even in subpopulations that would not be detected by phenotypic tests, because they are present in variants that are very little represented in the sample.

Figure 1 is a block diagram of an example of implementation of the operation of the computerized method of the invention. Said method is advantageously implemented by means of software which encodes the various stages of the method in machine language when this program is run on a computer. Therefore, both said software and the reading means of the computer on which the software is registered are included within the scope of protection of the invention.

The computerized method of the invention also allows the execution of genomic analysis for the prediction of the resistance of mutant viral isolates to single drugs and their combinations, by means of machine learning techniques, with statistical validation.

In practice, the method of the invention allows the entry on the computer, in a single session, of numerous sequences obtained by classical sequencing (typically according to Sanger) or by ultra-deep pyrosequencing, their alignment, the extraction of the mutations present. , their comparison with the known mutations present on GenBank or other databases, the calculation of their frequency with the relative confidence intervals, and the prediction of the resistance of the virus population isolated from the single patient to one or more antiviral drugs.

In this way, it is possible to enter the sequencing data of individual patients obtained with ultra-deep pyrosequencing, or of a very large number of data obtained from classical sequencing (for example, Sanger), and analyze them in a short time. (approximately 2 hours), where, using the methods currently in use in the field, it would be necessary to perform all the individual steps manually, taking weeks or months to interpret the sequencing data.

The automated method of the invention brings an advance in the state of the art compared to pre-existing automated methods, such as the built-in software provided on the interfacing server of the pyrosequencing machinery, specifically GSBrowser, GSAmplicon, GSAssembler, GSMapper from Roche for the machine 454 (http://www.454.com/).

In fact, an optimized local alignment algorithm is implemented with error detection / correction procedures and automatic translation into correct frame proteins. A series of descriptive statistics and analysis of variation not only at the nucleotide level, but also at the amino acid level is also produced, with robust estimation of the confidence intervals, a feature not present in the software mentioned above.

This flexibility in the transition from nucleotide to amino acid analysis allows the detection of sets of amino acid substitutions of interest for resistance analysis. In addition, the method involves the serialization of the various procedures for alignment, translation, mutation extraction, generation of variability matrices, descriptive statistics, all managed by dedicated scripts that generate output files for immediate use, while software supplied with the devices indicated above can only be used by highly specialized personnel and require the exclusive installation on dedicated servers with particular operating systems (linux only), with a series of limited formats for other types of analysis (to date only ace and fasta formats).

The method uses advanced scripts to generate a sufficient amount of data to investigate mathematical methods (statistical and machine learning) for the correlation between detected mutations (or mutation patterns) and resistance to pharmacological treatments (or combinations of treatments), using simultaneously demographic and / or viro-immunological data from clinical centers and providing for the verification of significant univariate associations (or of the linear or non-linear multivariate models tested) both with validation on the aforementioned data in vivo, and with validation on phenotypic tests in vitro.

The following examples are to be considered illustrative and not limitative of the scope of the invention.

Examples

Patients

13 blood samples from patients with HBV were analyzed, of which 9 with genotype D and 4 with genotype A; 5 were naïve and 8 were on antiviral treatment (4 with lamivudine, 1 with emtricitabine + tenofovir, and 3 with adefovir after previous lamivudine treatment).

These patients were all viraemic; HBV DNA values were obtained with the COBAS Taq-Man HBV test (Roche Molecular Systems, Inc., Branchburg, NJ, detection limit: 12 IU / ml). In particular, the viral load values for the treated patients were the following: pcs n. 1: 971.104 IU / ml; pcs n. 2: 1,609,456 IU / ml; pcs n. 3: 40.004 IU / ml; pcs n.4: 89.700.000 Log UI / ml; pcs n.5: 530 UI / ml; pcs 6 and 8:> 110,000,000 IU / ml; pcs 7: 73,659,072 IU / ml; for naïve patients: pcs n. 9 and 11:> 110,000,000 IU / ml; pcs n.10: 698.962 IU / ml; pcs 12: 13,129 IU / ml; pcs no.13: 48.830.532 IU / ml.

The serum of the 13 patients was analyzed by ultra-deep pyrosequencing to identify mutations in rt and HBs; the classic genotypic resistance test based on direct sequencing of the same region was also performed in parallel on all patients, and the DR v2 test was also performed on the 8 patients treated.

For all genotypic resistance analyzes, HBV DNA was extracted from the serum with the QIAamp DNA Blood Mini kit (Valencia, CA).

Ultra-deep pyrosequencing analysis to identify mutations in rt and HBs

The primers (Table 2) have been designed to be able to link conserved sequences between the different genotypes and to amplify 8 partially overlapping segments as this technique does not allow to sequence DNA fragments longer than 250 bp (base pairs). In addition to the sequence described in the Table, the primers for ultra-deep pyrosequencing contain at the 5 'end the adapter sequences indicated by the GS FLX system, necessary for binding to the beads (left GCCTCCCTCGCGCCATCAG, right GCCTTGCCAGCCCGCTCAG), not shown in the table.

These amplicons cover the rt gene from amino acid 1 to amino acid 288 (trait that includes all functional domains) and the complete region of the gene that codes for HBsAg.

The conditions used for PCR are as follows: a cycle of 95 ° C for 2 min followed by 40 cycles of denaturation of 30 sec at 95 ° C, pairing of the primers for 30 sec at 60 ° C and extension for 45 sec at 72 ° C, and finally an additional step of 5 min for the extension.

Since the quality and quantity of the DNA samples are important for the success of the procedure, the 8 amplicons obtained for each sample were purified using a purification kit, QIA quick PCR (Qiagen, Chatsworth, CA, USA), and then quantified using an Agilent 2100 bioanalyzer (Agilent Life Sciences and Chemical Analysis, CA, USA). The purified amplicons were then mixed in equal quantities and subjected to ultra-deep pyrosequencing using the GS-FLX platform (Roche). The frequency of 1% was chosen as the threshold value for the mutations.

The principle of this technique is summarized as follows: DNA fragments are amplified using primer pairs that include specific sequences called "A and B adapters". Subsequently, the DNA fragments are denatured and then mixed with beads which have oligonucleotides on their surface complementary to the adapters. This step is done with very low concentrations of DNA to obtain on average a single DNA chain linked to a marble. The DNA bound to the beads is amplified in an emulsion of water and oil in which each single drop contains a single ball with a single fragment of DNA bound. At the end of the process, beads with many copies of homogeneous PCR products are obtained. The beads with the bound DNA are then distributed on a microplate at a density of about 400,000 beads per plate which is placed inside the instrument in which the sequencing will take place, ie the GS FLX. A polymerase is used to elongate the DNA chain from the primer bound on each strand. The 4 triphosphate nucleotides are sequentially added onto the microplate. Each time a nucleotide is incorporated, pyrophosphate is released in the solution (hence pyrosequencing) which, thanks to an enzyme, is incorporated into ATP. In turn, the ATP activates a light-pherase that produces a light signal for each well, which is quantized and the corresponding signals detected and stored in the computer. The sequential application of the 4 nucleotides allows the formation of DNA fragments about 260 nucleotides long, obtaining a total of about 100 million bases in a few days. Subsequently all the images are processed by the dedicated software.

The data thus obtained were processed according to the computerized method of the invention described above.

Direct sequence and DR v2

For the direct sequence, the PCR conditions were as follows: 2 groups of primers (HBV1 fw - HBV4 rw and HBV5 fw -HBV8 rw) to amplify a stretch of the same length (1-288 amino acids) as the one sequenced by GS FLX ( Table 2). The PCR conditions above. The amplified PCR product was purified with the QIAquick PCR purification Kit (Qiagen, Chatsworth, CA, USA) and quantified on a gel with a standard of known molecular weights. Sequencing was performed with the ABI Prism 3100 sequencer, using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Warrington, UK).

In the samples of patients under anti-HBV treatment, the resistance test was also performed with INNO-LiPA HBV DR v2 (Innogenetics NV, Ghent, Belgium) following the relevant instructions.

Representative sequences of HBV genotypes A and D from the GeneBank database (genotype A: AAY25236, AAY25270, E00010, V00866; genotype D: Y07587, AF043594, Y796031, AY721610, AY796030) were used, on which consensus sequences were obtained.

Results and conclusions

A total of 290,315 readings were obtained, with an average length of 189 bp; the range of the number of reads per pc was 2,852-180,167.

Table 3 shows the mutations found with GS FLX in the 8 patients under treatment, compared to those identified by the direct sequence and DR v2. All mutations present at a frequency <24% by GS FLX and DR v2 were not identified by the direct sequence. In 3 patients some mutations (4 for patient 1, 3 for patient 5 and 1 for patient 6) were detected by the GS FLX at a frequency between 2% and 8% and lost by the DR v2. Only in patient 4 a mutation (M204V) was seen by the DR v2, but not by the GS FLX and the direct sequence (the result of the DR v2 could be an artifact).

These results indicate that all major resistance-associated mutations included in DR v2 were identified by GS FLX. Additionally, GS FLX detected other mutations (not included in DR v2) with variable frequency (> 1%) in both treated and naive patients. The list of all mutations found is shown in Table 4.

It should be noted that in 2 naïve patients GS FLX identified resistance-associated mutations, in particular V214A, Q215S, M204I at a frequency of 6%, 26%, 1% respectively for patient 11, and V214A, Q215H at a frequency respectively by 2%, 1% for patient 12. However, the primary mutation M204I, identified at low frequency in patient 11, corresponds to a stop codon on HBsAg.

The total distribution of all mutated codons identified by GS FLX in each patient's rt gene is shown in Figure 2, where the ordinate scale is cut to 20% (limit of direct sequence) to better visualize infrequent mutations.

In this figure it is also seen that, as already known in the literature, genotype D is more heterogeneous than genotype A in both treated and naive patients. Furthermore, in both treated and naive patients, there are mutated positions, both in functional domains and in interdomains. The total number of mutations was always greater in treated than naive patients in both functional domains (48 vs 19) and interdomains (96 vs 63). However, the ratio of the number of mutations between treated and naive patients was higher in functional domains than in interdomains (2.5 vs 1.5, respectively).

In treated patients, the applied method allowed the identification of new mutations, never described in the literature according to our knowledge, in 45 different codons, 15 of which were also present in naive patients. Nine of these mutations were present in the viral quasispecies at a frequency> 24% (therefore seen also from the direct sequence), 2 mutations were present in 2 patients at a very different frequency (1 vs 99%) and the remaining mutations had a frequency <24% in all patients.

Sequencing with GS FLX also made it possible to identify and quantify the mutations present in the HBV surface antigen for each patient (Table 4). The correspondence between the rt mutations and those of HBs is reported in Table 5.

Overall, the described method, based on ultra-deep pyrosequencing by applying the GS FLX sequencing platform and on the application of the automated method of the invention, allowed to analyze the quasispecies of HBV in the coding region for reverse transcriptase and for the 'HBsAg, highlighting the presence of: (i) mutations already known to be associated with resistance to various drugs, but with the innovative aspect of being able to calculate their frequency in each individual patient; (ii) mutations present with a frequency of less than 20%, which could not have been visualized with the classic sequence, (iii) known mutations, present with a frequency of less than 5%, which could not have been visualized with the DR v2 ; (iv) mutations never described previously, whose frequency in individual patients ranged from 1 to 99%.

The quantitative aspect highlighted in the examples described is important because, followed over time in individual patients, it allows to evaluate an evolving situation and therefore to adopt therapeutic changes before the mutated variant is definitively established in the viral quasispecies.

Furthermore, the aspect concerning the new mutations identified is important, because it allows the re-evaluation of the interpretative algorithms of the genotypic resistance tests.

A further important aspect is the identification of HBsAg mutations, not all of which are described in the literature, and can be applied to the study of immunological escape variants. Furthermore, some rt mutations that determine stop codons in HBsAg have been described in the literature, and for them a role in the maintenance of resistance has been proposed (thanks to the change made to the replicative enzyme), but only in co-presence of the corresponding wt, which provides the missing HBsAg function because it is truncated in the mutated strain. These situations are very rare, but it is not known whether this is due to the fact that direct sequencing does not allow the visualization of mutation frequencies lower than 20%. With the application of the automated system claimed here, it was possible to highlight a similar situation, never described before, in the rt204 codon of patient 11, which corresponds to a stop codon in the HBsAg, which is represented with a frequency of 1% , and which could not have been appreciated with the methods currently in use.

Table 2.

Sequence and position of the primers used for the ultra-deep pyrosequencing of HBV. In addition to the sequence described in the Table, the primers contain at the 5 'end the adapter sequences indicated by the GS FLX system, necessary for binding to the beads (SEQ ID No 17 left GCCTCCCTCGCGCCATCAG, SEQ ID No 18 right GCCTTGCCAGCCCGCTCAG), not shown in the table .

SEQ ID No Name Sequence (5'-3 ') Position in Rt 1 HBV 1 FW CCTGCTGGTGGCTCCAGTT –34 -53 2 HBV 1 RW AGAGAAGTCCACCACGAG 124 - 140 3 HBV 2 FW CCTGCTCGTGTTACAGGCG 58 - 72 4 HBVAC 24RW CCGC 2 GTATTCCCATCCCATCRTC 471 - 489 12 HBV 6 RW CGGTAWAAAGGGACTCAMG 649 - 667 13 HBV 7 FW TTGTTCAGTGGTTCGTMGGG 561 - 580 14 HBV 7 RW GGGTTAAATGTATACCCAVAG 689 - 710 64KGGACTCAMG 649 - 667 13 HBV 7 FW TTGTTCAGTGGTTCGTMGGG 561 - 580 14 HBV 7 RW GGGTTAAATGTATACCCAVAG 689 - 710 64KCCV 8 FWACCT.

HBV variants obtained by sequencing with GS FLX versus those obtained with INNO-LiPA DR v2 and direct sequence in patients on anti-HBV treatment

Table 4.

Mutations in rt and HBsAg, and their frequency (with 95% confidence interval) detected by ultra-deep pyrosequencing in 9 patients with HBV of genotype D and in 4 patients with HBV of genotype A. The concentration is indicated for each patient. by HBV

DNA, the drug administered and the number of reads obtained

with the GS FLX platform.

CI = Confidence Interval

Genotype D

Patient 1 (4317 reads)

HBV DNA 5.99 Log10 IU / ml

Treatment = ADV

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtG4E 0.019 0.004 0.058 rtA7D 0.172 0.120 0.240 rtR18K 0.013 0.001 0.049 rtP20S 0.019 0.004 0.058 rtT24A 0.013 0.001 0.049 rtH35Y 0.022 0.011 0.041 rtA38T 0.020 0.010 0.038 rtL80I 0.08 0.008 0.079 0.082 0.721 r13 0.008 0.008 0.07 0.08 0.021 rtI 0.721 r13 0.001 0.06 0.059 0.111 rtD139S 0.011 0.004 0.026 rtY141Q 0.699 0.662 0.734 rtV142E 0.187 0.158 0.219 rtK154E 0.647 0.609 0.684 rtS159T 0.995 0.966 1.000 rtH160R 0.022 0.007 0.058 rtL180M 0.02. rtC256G 0.286 0.078 0.649

Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sE2A 0.013 0.001 0.049 sN3S 0.013 0.001 0.049 sG10R 0.013 0.001 0.049 sP11L 0.013 0.001 0.049 sL13P 0.013 0.001 0.049 sV14A 0.045 0.020 0.092 sV14G 0.038 0.016 0.083 sQ54R 0.076 0.063 0.091 sW74U 0.011 0.006 0.020 sF83L sF83L 0.01 0.011 0.059 0.111 sT131A 0.011 0.004 0.026 sM133R 0.697 0.661 0.732 sM133T 0.011 0.005 0.023 sY134N 0.187 0.158 0.219 sP135H 0.185 0.157 0.217 sI152T 0.011 0.001 0.042 sI152V 0.022 0.007 0.058 sW163U 0.017 0.009 0.031 sW17 0.04 0.05 0.05 s 0.017 0.04 0.04 sW17 0.05 sR204G 0.156 0.141 0.172 sR207N 0.222 0.203 0.243 sI208T 0.998 0.994 0.999 sR210K 0.241 0.221 0.261 sL213I 0.996 0.991 0.998

Patient 2 (8876 reads)

HBV DNA 6.21 Log10 IU / ml

Treatment = ADV

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtH13L 0.994 0.989 0.997 rtR18S 0.028 0.022 0.036 rtV27F 0.013 0.009 0.019 rtA38P 0.015 0.011 0.020 rtA38S 0.015 0.012 0.020 rtA38T 0.734 0.719 0.748 rtG52E 0.011 0.006 0.018 rtH54D 0.012 0.046 0.14 0.15 rtW58U rVt 0.1024 0.01 rVt 0.01 0.087 0.126 rtA181T 0.033 0.026 0.043 rtL199V 0.011 0.008 0.015 rtF221Y 0.018 0.012 0.026 rtL229W 0.022 0.000 0.129 rtS230C 0.022 0.000 0.129 rtI233T 0.022 0.000 0.129 rtI233V 0.022 0.000 0.129 rtL221Y rtF221Y 0.018 0.012 0.026 rtL229W 0.022 0.000 0.129 rtS230C 0.022 0.000 0.129 rtI233T 0.022 0.000 0.129 rtI233V 0.022 0.000 0.129 rtL235U rtL235U rt 0.129 0.129 0.126 0.126 0.129 rt rtG255R 0.022 0.000 0.129 rtE271A 0.022 0.000 0.129 rtE271D 0.044 0.005 0.159 rtR274S 0.022 0.000 0.129 Mutations in HBsAg

Mutation Head Lower 95 CI Upper 95CI sT5S 0.996 0.992 0.998 sG10A 0.028 0.022 0.036 sL21S 0.148 0.137 0.161 sR24K 0.033 0.028 0.040 sW36U 0.017 0.011 0.026 sL39P 0.029 0.021 0.040 sT57I 0.022 0.017 0.028 sP70L 0.028 0.023 0.036 0.15 sS113 sS113 0.722 sY134N 0.104 0.086 0.125 sC149Y 0.012 0.004 0.030 sP151L 0.071 0.050 0.101 sA166V 0.013 0.008 0.019 sW172U 0.036 0.028 0.046 sV180A 0.010 0.006 0.017 sW182U 0.011 0.007 0.019 sR20 0.04K 0.02 0.012 0.008 0.016 sR207N 0.122 s022 0.122 sR207N 022.000 0.023 0.000 0.131

Patient 3 (15483 reads)

HBV DNA 4.60 Log10 IU / ml

Treatment = LAM

Mutations in rt

Mutation Head Lower 95 CI Upper 95CI rtV27F 0.018 0.013 0.025 rtL80I 0.243 0.226 0.260 rtL80V 0.030 0.024 0.037 rtL82M 0.034 0.027 0.042 rtM204I 0.119 0.111 0.128

Mutations in HBsAg

Mutation Head Lower 95 CI Upper 95CI sE164V 0.556 0.533 0.577 sW196L 0.116 0.108 0.125

Patient 4 (15623 reads)

HBV DNA 6.91Log10 IU / ml

Treatment = LAM

Mutations in rt

Mutation Head Lower 95 CI Upper 95CI rtV27F 0.024 0.019 0.030 rtA38E 0.377 0.364 0.390 rtG52E 0.016 0.012 0.022 rtN53D 0.095 0.084 0.107 rtL80V 0.030 0.024 0.037 rtI91F 0.016 0.012 0.022 rtI 0.0091V 0.016 0.012 0.022 rtA97T rtA97T rt 0.011 0.0010 0.04 0.011 0.04 0.011 0.04 0.011 0.04 0.011 0.05 0.0010 0.017 rtR120K 0.011 0.007 0.018 rtT128I 0.845 0.826 0.862 rtD134E 0.101 0.087 0.117 rtH135T 0.825 0.805 0.843 rtC136Y 0.010 0.006 0.016 rtR138K 0.012 0.008 0.019 rtD139K 0.029 0.022 0.038 rtF221Y 0.055 0.047 0.065 rtI266V 0.991 0.973 0.998 rtQ267H 0.011 0.003 0.031 rtE271H 0.991 0.973 0.998 rtR274G 0.011 0.003 0.031 Mutazioni in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sR24K 0.016 0.013 0.020 sQ30K 0.384 0.371 0.397 sW36U 0.015 0.011 0.021 sE44R 0.014 0.010 0.020 sW74U 0.012 0.009 0.017 sI82M 0.016 0.012 0.022 sV106I 0.010 0.006 0.017 sP120S 0.843 0.824 0.860 sR122Q 0.017 0.012 0.025 sT088 sT 0.045 0.059 sR207N 0.053 0.045 0.062 sL213I 0.055 0.047 0.065 sL216U 0.010 0.007 0.015 sV224A 0.040 0.024 0.067

Patient 5 (12287 reads)

HBV DNA 2.72 Log10 IU / ml

Treatment = ADV

Mutations in rt

Mutation Lower 95CI Upper 95CI rtN53D 0.024 0.018 0.031 rtN53K 0.024 0.019 0.032 rtV56M 0.140 0.127 0.156 rtL80I 0.020 0.015 0.025 rtQ125H 0.011 0.006 0.019 rtK149H 0.044 0.035 0.055 rtR153W 0.128 0.113 0.145 rtK15 rtR153W 0.128 0.113 0.145 rtK15 rtK15 0.039 0.043 rtA181V 0.074 0.063 0.087 rtT184S 0.030 0.023 0.039 rtA200V 0.128 0.118 0.140 rtM204V 0.023 0.018 0.028 rtV214A 0.017 0.013 0.021 rtT225S 0.428 0.409 0.448 rtL228P 0.011 0.007 0.016 rtL229S 0.012 0.000 0.075 rtS230P 0.025 0.002 0.092 rtL231S 0.025 0.002 0.092 rtI233M 0.025 0.002 0.092 rtN236T 0.123 0.067 0.216 rtP237T 0.531 0.423 0.636 rtA238H 0.025 0.002 0.092 rtA238S 0.012 0.000 0.075 rtR242G 0.012 0.000 0.075 rtG244R 0.012 0.000 0.075 rtH248Y 0.012 0.000 0.075 rtM250T 0.012 0.000 0.075 rtY252H 0.012 0.000 0.075 rtC256 0.012 0.012 0.000 0.075 0.425Wt0256 0.012 0.000 0.075 0.025Wt0256.031.025.000 0.075 rtI266V 0.469 0. 364 0.577 rtQ267H 0.506 0.399 0.613 rtQ267R 0.012 0.000 0.075 rtQ267Y 0.012 0.000 0.075 rtI269T 0.012 0.000 0.075 rtE271D 0.519 0.411 0.624 rtE271H 0.111 0.058 0.201

Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

SV14A 0.034 0.026 0.045 0.023 0.039sV177A 0.036 0.028 0.045sT189I 0.466 0.449 0.482 sF220L 0.011 0.008 0.017 sC221R 0.012 0.000 0.075 sL222P 0.025 0.002 0.092 sW223R 0.025 0.002 0.092 sV224A 0.062 0.024 0.141 sY225C 0.025 0.002 0.092 sY225S 0.062 0.024 0.141

Patient 6 (4459 reads)

HBV DNA> 8.04 Log10 IU / ml

Treatment = EMC + TDV

Mutations in rt

Mutation Head Lower 95 CI Upper 95CI rtD2G 0.012 0.000 0.074 rtW3R 0.011 0.000 0.069 rtG4R 0.011 0.000 0.069 rtA7T 0.420 0.322 0.525 rtE11K 0.011 0.000 0.069 rtH13R 0.057 0.022 0.131 rtR22C 0.011 0.000 0.069 rtV23A rt 0.023R 0.024 0.023A 0.023R 0.024 0.023 0.107 rtA38T 0.065 0.050 0.084 rtN53S 0.055 0.040 0.074 rtH54S 0.023 0.014 0.038 rtH54T 0.025 0.015 0.039 rtR55H 0.025 0.015 0.039 rtG107R 0.019 0.013 0.026 rtS109P 0.012 0.006 0.024 rtV112A 0.014 0.007 0.026 rtN118T 0.014 0.007 0.026 rtI121N 0.011 0.005 0.022 rtF122I 0.024 0.014 0.038 rtN123D 0.924 0.902 0.941 rtH126Y 0.029 0.019 0.044 rtD139Q 0.011 0.005 0.022 rtL145M 0.050 0.037 0.066 rtY148F 0.011 0.006 0.021 rtF151Y 0.039 0.028 0.055 rtR153W 0.012 0.007 0.022 rtL164M 0.098 0.061 0.155 rtK168E 0.012 0.003 0.037 rtG172U 0.028 0.013 0.059 rtV173L 0.598 0.536 0.658 rtL180M 0.606 0.544 0.665 rtA181V 0.016 0.005 0.043 rtA186T 0.012 0.000 0.071 rtI187T 0.012 0.000 0.071 rtI187 V 0.395 0.298 0.502 rtC188R 0.012 0.000 0.071 rtR192S 0.012 0.000 0.071 rtM204I 0.210 0.190 0.230 rtM204V 0.398 0.374 0.422 rtF221Y 0.073 0.061 0.087 rtT222A 0.056 0.046 0.069 Mutations in HBsAg

Head Mutation Lower 95 CI Upper 95CI sN3S 0.011 0.000 0.069 sT5A 0.057 0.022 0.131 sV14A 0.011 0.000 0.069 sR24K 0.047 0.034 0.064 sT45A 0.051 0.037 0.070 sT46P 0.055 0.040 0.074 sV47T 0.025 0.015 0.039 sL49P 0.036 0.024 0.052 sT57I 0.011 0.011 0.011 0.011 0.011 sT57I 0.011 0.067 sC76S 0.299 0.273 0.326 sC76Y 0.036 0.027 0.049 sF83S 0.909 0.891 0.924 sL84P 0.018 0.012 0.028 sF85C 0.012 0.007 0.021 sI110L 0.014 0.007 0.026 sS113T 0.011 0.005 0.022 sR122K 0.022 0.03 0.0012 0.04 0.043 sQ129H 0.013 0.019 s22 0.01 0.04 0.04 0.01 0.04 0.01 0.04 0.01 0.04 0.04 0.04 0.05 0.039 0.028 0.055SG159A 0.293 0.240 0.353 0.071 sF183L 0.012 0.000 0.071 sI195M 0.395 0.372 0.420 sW196S 0.208 0.1 89 0.229 sW201U 0.026 0.019 0.035 sR207N 0.076 0.064 0.091 sL213I 0.018 0.012 0.026 sL213M 0.055 0.045 0.068 Patient 11 (9329 reads)

HBV DNA> 8.04 Log10 IU / ml

naive

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtA7T 0.012 0.008 0.019 rtE8K 0.014 0.009 0.021 rtG10R 0.011 0.007 0.017 rtR15K 0.017 0.012 0.025 rtR18K 0.075 0.063 0.090 rtV27F 0.034 0.026 0.043 rtA38P 0.019 0.014 0.025 rtA38S 0.019 0.07 0.08 0.08 rtA38T 0.06 0.06 rG0.38 0.08 0.013 rG08 0.013 0.06 rG 0.08 0.007 0.023 rtA87V 0.015 0.009 0.026 rtF88S 0.025 0.016 0.037 rtI91F 0.011 0.006 0.021 rtS106A 0.165 0.149 0.181 rtG107R 0.012 0.008 0.018 rtR110G 0.251 0.227 0.277 rtV112A 0.029 0.020 0.040 rtA113G 0.015R11 rtG107R 0.02 rtI121S 0.011 0.007 0.020 rtI121V 0.022 0.015 0.033 rtF122S 0.014 0.009 0.023 rtN123T 0.017 0.011 0.026 rtH126Y 0.979 0.969 0.986 rtM129L 0.010 0.005 0.018 rtD131S 0.041 0.031 0.055 rtD134E 0.035 0.026 0.048 rtD134V 0.614 0.584 0.643 rtC136Y 0.010 0.006 0.019 rtR138K 0.018 0.011 0.028 rtV142I 0.031 0.025 0.039 rtF151V 0.019 0.014 0.025 rtR153Q 0.316 0.297 0.336 rtI1 63V 0.098 0.081 0.118 rtA181S 0.011 0.007 0.016 rtA200T 0.011 0.007 0.016 rtM204I 0.015 0.010 0.021 rtD205N 0.013 0.009 0.019 rtV214A 0.070 0.059 0.082 rtE218D 0.219 0.195 0.245 rtF221Y 0.740 0.713 0.767 rtL235 rtF221Y 0.740 0.713 0.767 rtL235 rt 0.007 0.031 Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sT5I 0.064 0.053 0.077 sG7R 0.012 0.008 0.019 sF8H 0.046 0.036 0.057 sF8P 0.066 0.055 0.080 sF8R 0.017 0.011 0.024 sG10K 0.060 0.049 0.073 sG10R 0.016 0.011 0.023 sV14A 0.011 0.007 0.018 sV14 0.00A 0.051. 0.283 0.324 sC76F 0.030 0.020 0.044 sC76S 0.029 0.019 0.043 sC76Y 0.203 0.177 0.231 sR78Q 0.255 0.227 0.285 sR79C 0.016 0.009 0.028 sR79G 0.014 0.008 0.025 sR79S 0.015 0.009 0.026 sF80L 0.025 0.016 0.037 sF80S 0.213 0.188 0.241 sI 0.06 0.06 0.06 0.06 0.06 0.06 0.01 0.06 0.06 0.06 0.06 0.06 0.08 0.08 0.010 sP105A 0.017 0.011 0.027sP105S 0.011 0.006 0.020 0.032 0.056 sT126S 0.645 0.615 0.673 sA128T 0.010 0.006 0.019 sG130E 0.012 0.007 0.021 sG1 30R 0.013 0.008 0.022 sM133I 0.031 0.025 0.040 sY134C 0.027 0.021 0.035 sC139Y 0.010 0.007 0.016 sK141U 0.017 0.013 0.024 sS143L 0.011 0.008 0.017 sG145E 0.016 0.012 0.023 sG145R 0.312 0.293 0.332 sC147Y 0.014 0.010 sG145E 0.016 0.017 0.017 0.017 0.017 0.014 0.025 0.006 0.016SW182U 0.012 0.006 0.022 sL213T 0.063 0.049 0.079 sP214L 0.043 0.032 0.058 sL216U 0.058 0.047 0.071 sI218T 0.015 0.010 0.023 sF219S 0.016 0.011 0.024 sF220C 0.044 0.034 0.056 sV224A 0.025 0.015 0.044 sY225S 0.028 0.016 0.047

Patient 12 (5667 reads)

HBV DNA 4.12 Log10 IU / ml

naive

Mutations in rt

Mutation Head Lower 95 CI Upper 95CI rtV27F 0.052 0.038 0.071 rtF122N 0.032 0.018 0.055 rtH126Y 0.032 0.018 0.056 rtD134G 0.013 0.005 0.032 rtD139Q 0.032 0.018 0.055 rtL145M 0.018 0.011 0.028 rtF151Y 0.017 0.010 0.03 r29 rv 0.026 rtP215H 0.016 0.011 0.023 rtR242G 0.012 0.005 0.026

Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sP11L 0.020 0.011 0.034 sT118A 0.013 0.005 0.032 sT126A 0.013 0.005 0.032 sS193L 0.064 0.054 0.075 sY206H 0.019 0.014 0.026 sN207I 0.047 0.033 0.067 Patient 13 (180167 reads)

HBV DNA 7.69 Log10 IU / ml

naive

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtV27F 0.045 0.036 0.055 rtN53D 0.472 0.456 0.488 rtH54D 0.442 0.426 0.458 rtM129L 0.012 0.008 0.017 rtD134E 0.056 0.047 0.066 rtD134V 0.548 0.527 0.568 rtD139K 0.076 0.065 0.087 rtR153W 0.989 0.985 0.992 rtP237T 0.995 0.969 1.000 rtY245H 0.066 0.038 0.111 rtY257G 0.020 0.006 0.053 rtY257W 0.949 0.908 0.973 rtQ267H 0.980 0.947 0.994 rtE271D 0.934 0.889 0.962 rtR274Q 0.010 0.000 0.039 Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sT126S 0.602 0.582 0.622 sT131N 0.076 0.066 0.088 sS193L 0.349 0.335 0.363 sR204N 0.013 0.010 0.017 sR207N 0.016 0.011 0.022 sI208T 0.605 0.585 0.625

Genotype A

Patient 7 (8917 reads)

HBV DNA 7.87 Log10 IU / ml

Treatment = LAM

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtH13N 0.183 0.161 0.209 rtH53S 0.190 0.167 0.216 rtL80V 0.182 0.162 0.204 rtI103V 0.039 0.030 0.051 rtV173L 0.047 0.038 0.057 rtL180M 0.772 0.752 0.790 rtM204I 0.238 0.226 0.250 rtM204V 0.754 0.741 0.767 rtI.000

Mutation Prevalence Lower 95 CI Higher 95CI

sT45A 0.191 0.168 0.217 sT45S 0.810 0.784 0.833 sP67Q 0.121 0.108 0.135 sP111L 0.013 0.005 0.031 sE164D 0.046 0.037 0.057 sI195M 0.754 0.741 0.767 sW196L 0.238 0.226 0.251 sL209V 0.996 0.994 0.998 Patient 8 (10590 reads)

HBV DNA> 8.04 Log10 IU / ml

Treatment = LAM

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtV27F 0.017 0.012 0.024 rtH53S 0.235 0.215 0.257 rtI103V 0.041 0.032 0.052 rtL180M 0.409 0.387 0.430 rtM204V 0.421 0.405 0.437 rtP237L 0.011 0.001 0.042 rtS246P 0.011 0.001 0.04

Mutation Prevalence Lower 95 CI Higher 95CI

sT45A 0.235 0.215 0.257 sT45S 0.764 0.743 0.784 sW172U 0.010 0.007 0.016 sI195M 0.420 0.404 0.436 sL209V 0.993 0.989 0.996

Patient 9 (11768 reads)

HBV DNA> 8.04 Log10 IU / ml

naive

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtV27F 0.045 0.037 0.055

Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sT45S 0.996 0.991 0.998 sL209V 0.999 0.994 1.000

Patient 10 (2852 reads)

HBV DNA 5.84 Log10 IU / ml

naive

Mutations in rt

Mutation Prevalence Lower 95 CI Higher 95CI

rtW153R 0.996 0.987 0.999 rtL229V 0.015 0.005 0.035 rtP237T 0.468 0.415 0.521 rtN248H 0.462 0.410 0.515 rtS256C 0.591 0.537 0.642 rtW257L 0.120 0.089 0.159 rtT259P 0.129 0.097 0.169 rtT259S 0.462 0.410 0.515 rtQ267H 0.468 0.415 0.521 rtH271D 0.462 0.410 0.515 rtH271E 0.129 0.097 0.169 rtV278I 0.416 0.364 0.471 rtR280M 0.979 0.879 1.000 rtD283E 0.935 0.816 0.984 rtW284R 0.024 0.000 0.140 Mutations in HBsAg

Mutation Prevalence Lower 95 CI Higher 95CI

sT45S 0.997 0.980 1.000 sY100C 0.994 0.984 0.998 sR207N 0.992 0.974 0.998 sF220L 0.013 0.006 0.026

Table 5.

Mutations in rt and corresponding mutations in HBsAg, deter-

mined considering that any HBsAg mutation can be generated

nerated by substitutions in each of the 2 adjacent codons of rt

rt mutation # 1 rt mutation # 2 Mutations in HBsAg

rtE11K - sN3S

rtH13L - sT5S

rtH13R - sT5A

rtR15K - sG7R

rtR18K - sG10K

rtR18K - sG10R

rtR18S - sG10A

- rtP20S SP11L

rtR22C rtV23A sV14A

rtR22C - sV14A

- rtV23A sV14A

rtG52E rtN53D sG44R

rtG52E - sG44R

rtN53K - sT45N

rtN53S - sT45A

rtN53S rtH54S sT45A

rtN53S rtH54T sT45A

rtH54S rtR55H sT46P

rtH54S - sT46P

rtH54T rtR55H sT46P

rtH54T - sT46P

rtR55H - sV47T

rtS78C - SP70A

- rtA87E sR78Q

- rtA87G sR78Q

- rtA87V sR78Q

rtA87E - sR79S

rtA87E rtF88S sR79S

rtA87G - sR79G

rtA87G rtF88S sR79G

rtA87V - sR79C

rtA87V - sR79S

rtA87V rtF88S sR79C

rtA87V rtF88S sR79S

rtF88S - sF80L

- rtL91V sI82M

rtL91P - sF83L

- rtR110G sQ101R

- rtV112L sM103I

rtA113G rtR114H sP105A

rtA113G - SP105A

rtR114H - sV106I

- rtL115V sV106G

rtL115V - sC107Y

rtD118S - sI110V rtD118T - sI110L rtR120K - sG112R rtR120K rtI121S sG112R rtR120K rtI121V sG112R - rtI121S sG112E - rtI121V sG112E rtR120S - sG112A rtI121N - sS113T rtI121N rtF122I sS113T rtI121S - sS113A rtI121S rtF122S sS113A rtF122S - sS114P rtF122S rtN123T sS114P rtN123T - sT115P rtQ125H - sS117T rtT128I - sP120S rtN131S - sT123V rtD134E - sT126S rtD134G - sT126A rtD134V - sT126S rtC136Y - sA128T rtR138K - sG130R rtN139K - sT131N rtN139Q - sT131N rtN139S - sT131A rtY141Q rtV142E sM133R rtY141Q - sM133R - rtV142E sM133T - rtV142I sM133I rtV142E - sY134N rtY148F - sT140S rtQ149H - sK141T rtF151V - sS143L rtF151Y - sS143T rtR153Q - sG145R rtK154N - sN146T rtL157P - sC149R rtH160R - sI152V - rtK168E sG159A - rtG172U sW163C - rtV173L sE164D rtG172U rtV173L sE164D - rtA181S sW172C - rtA181T sW172U rtL180M rtA181T sW172U rtA181T - sL173P rtA181V - sL173F - rtT184S sL175F - rtC188R sF179L rtI187T - sF179L rtI187T rtC188R sF179L rtI187V rtC188R sF179L rtC188R - sV180A - rtR192S sF183L - rtA 200T sW191U rtA200V - sL192F - rtM204V sI195M - rtM204V sI195T rtM204I - sW196L rtM204I - sW196S rtM204I - sW196U rtM204I rtD205N sW196U - rtD205N sW196U rtK212R - sK204G rtV214A - sF206H rtE218D - sS210T rtF221Y rtT222A sL213M rtF221Y - sL213I rtF221Y - sL213T - rtT225S sL216F - rtL229S sF220L - rtL229V sF220L rtL228P - sF220L rtL228P rtL229S sF220L rtL229S rtS230P sC221R rtL229S - sC221R rtL229W rtS230C sC221G rtL229W - sC221G rtS230C - sL222V rtS230P - sL222P rtS230P rtL231S sL222P - rtL231S sL222P rtL231S - sW223R - rtI233M sV224A rtI233M - sY225C rtI233T - sY225H Riferimenti bibliografici

Fattovich G. Natural history of hepatitis B. J Hepatol. 2003; 39 Suppl 1: S50-8.

Peters M, Walling DM, Kelly K, Davis GL, Wagoner JG, Hoofnagle JH. Immunologic effects of interferon-alpha in man: treatment with human recombinant interferon-alpha suppresses in vitro immunoglobulin production in patients with chronic type B hepatitis. J Immunol. 1986 Nov 15; 137 (10): 3147-52.

Marcellin P, Lau GK, Bonino F, Farci P, Hadziyannis S, Jin R, Lu ZM, et al. Peginterferon Alfa-2a HBeAg-Negative Chronic Hepatitis B Study Group. Peginterferon alfa-2a alone, lamivudine alone, and the two in combination in patients with HBeAgnegative chronic hepatitis B. N Engl J Med. 2004 Sep 16; 351 (12): 1206-17.

Locarnini S. Molecular virology and the development of resistant mutants: implications for therapy. Semin Liver Dis. 2005; 25 Suppl 1: 9-19.

Zoulim F. Mechanism of viral persistence and resistance to nucleoside and nucleotide

analogs in chronic hepatitis B virus infection. Antiviral Res. 2004 Oct; 64 (1): 1-15.

Hussain M, Lok AS. Mutations in the hepatitis B virus polymerase gene associated with antiviral

treatment for hepatitis B. J Viral Hepat. 1999 May; 6 (3): 183-94. Review

Wright TL. Clinical trial results and treatment resistance with lamivudine in hepatitis B. Semin Liver Dis. 2004; 24 Suppl 1: 31-6. Review.

Dienstag JL, Goldin RD, Heathcote EJ, Hann HW, Woessner M, Stephenson SL, Gardner S, Gray DF, Schiff ER. Histological outcome during long-term lamivudine therapy.

Gastroenterology. 2003 Jan; 124 (1): 105-17.

Tang XR, Zhang JS, Zhao H, Gong YH, Wang YZ, Zhao JL. Detection of hepatitis B virus genotypes using oligonucleotide chip among hepatitis B virus carriers in Eastern China. World J Gastroenterol. 2007 Apr 7; 13 (13): 1975-9.

Vernet G, Tran N. The DNA-Chip technology as a new molecular tool for the detection of HBV mutants. J Clin Virol. 2005 Dec; 34 Suppl 1: S49-53.

Sertoz RY, Erensoy S, Pas S, Akarca US, Ozgenc F, Yamazhan T, Ozacar T, Niesters HG. Comparison of sequence analysis and INNO-LiPA HBV DR line probe assay in patients with chronic hepatitis B. J Chemother. 2005 Oct; 17 (5): 514-20.

Wang C, Mitsuya Y, Gharizadeh B, Ronaghi M, Shafer RW. Characterization of mutation spectra with ultra-deep pyrosequencing: application to HIV-1 drug resistance. Genome Res. 2007 Aug; 17 (8): 1195-201. Epub 2007 Jun 28

TF Smith and MS Waterman. Identification of common molecular subsequences. J. Mol. Biol. 147: 195-197, 1981.

O Gotoh. An improved algorithm for matching biological sequences. J. Mol. Biol. 162: 705-708, 1982.

SF Altschul, W Gish, W Miller, EW Myers, DJ Lipman. Basic local alignment search tool. J Mol Biol. 215: 403-10, 1990.

N Eriksson, L Pachter, Y Mitsuya, SY Rhee, C Wang, B Gharizadeh, M Ronaghi, RW Shafer and N Beerenwinkel. Viral population estimation using pyrosequencing. PLoS Comput Biol.

4 (5): e1000074. 2008.

A Agresti and BA Coull. Approximate is better than "exact" for interval estimation of binomial proportions. The American Statistician 52 (2): 119-126. 1998.

Keeffe EB, Dieterich DT, Pawlotsky JM, Benhamou Y.Chronic hepatitis B: preventing, detecting, and managing viral resistance. Clin Gastroenterol Hepatol. 2008 Mar; 6 (3): 268-74. Review.

Lok AS, Zoulim F, Locarnini S, Mangia A, Niro G, Decraemer H, Maertens G, Hulstaert F, De Vreese K, Sablon E. Monitoring drug resistance in chronic hepatitis B virus (HBV) -infected patients during lamivudine therapy: evaluation of performance of INNO-LiPA HBV DR assay. J Clin Microbiol. 2002 Oct; 40 (10): 3729-34.

Zoulim F. New nucleic acid diagnostic tests in viral hepatitis. Semin Liver Dis. 2006 Nov; 26 (4): 309-17.

Hoffmann C, Minkah N, Leipzig J, Wang G, Arens MQ, Tebas P, Bushman FD. DNA bar coding and pyrosequencing to identify rare HIV drug resistance mutations.

Nucleic Acids Res. 2007; 35 (13): e91. Epub 2007 Jun 18.

M. Margulies et al., Nature 437, 376 (2005).

Claims (20)

CLAIMS 1. Automated method for the in vitro determination of HBV virus mutations resistant to antiviral drugs to be performed on biological samples comprising the following steps: (i) sequencing of the HBV virus genome present in the samples; download of mutation data present in public databases; (ii) processing, parsing, alignment, error correction, clustering, phylogenetic analysis and variation analysis of the data on the sequences generated in stage (i); extraction from the sequences thus processed of mutations of the reverse transcriptase gene and / or of the surface antigen of the HBV virus; optimized local alignment and error correction; (iii) evaluation of nucleotide and amino acid variability, with calculation of confidence intervals on the frequencies of the mutations; inclusion of mutations with a frequency greater than 1%; (iv) extraction of the generated mutations and / or mutation profiles. Method according to claim 1 wherein the sequencing is accomplished by ultra-deep pyrosequencing. Method according to claims 1-2 further comprising a correlation step (v) between the mutations and / or mutation profiles found and the acquired data of resistance to treatment with antiviral drugs. 4. Method according to claim 3 in which the resistance data are acquired by the phenotyping method on at least one strain of the HBV mutant viral isolate. 5. Mutations and / or mutation profiles of the HBV genome in which the mutations are indicated with the coding: x✕y and choices between: s: E_2_A; s: E_2_D; rt: D_2_G; rt: W_3_R; s: N_3_S; rt: G_4_E; rt: G_4_R; s: I_4_T; s: T_5_A; s: T_5_I; s: T_5_S; rt: A_7_D; s: G_7_R; rt: A_7_T; rt: A_7_V; rt: A_7_Y; rt: E_8_D; s: F_8_H; rt: E_8_K; s: F_8_P; s: F_8_R; s: L_9_R; rt: H_9_Y; s: G_10_A; s: G_10_K; rt: G_10_R; s: G_10_R; rt: E_11_D; rt: E_11_K; s: P_11_L; rt: E_11_Q; s: L_12_V; rt: H_13_L; rt: H_13_N; s: L_13_P; rt: H_13_R; rt: H_13_Y; s: V_14_A; s: V_14_G; rt: R_15_K; s: G_18_del; rt: R_18_K; rt: R_18_S; s: F_19_C; s: F_20_L; rt: P_20_S; s: F_20_S; s: L_21_S; rt: R_22_C; rt: R_22_G; rt: V_23_A; rt: T_24_A; s: R_24_K; s: R_24_L; s: R_24_S; s: I_25_T; rt: G_26_R; s: T_27_del; rt: V_27_F; s: T_27_I; s: I_28_del; s: I_28_L; s: P_29_del; s: P_29_L; rt: V_30_G; s: Q_30_H; s: Q_30_K; s: Q_30_W; rt: D_31_N; s: S_31_N; s: S_31_R; s: L_32_Q; s: D_33_A; s: D_33_L; s: S_34_L; s: W_35_F; s: W_35_G; rt: H_35_Y; rt: N_36_H; s: W_36_L; s: W_36_U; s: T_37_P; rt: T_37_S; s: T_37_S; rt: A_38_E; rt: A_38_P; rt: A_38_S; rt: A_38_T; s: L_39_D; s: L_39_del; s: L_39_P; s: N_40_del; s: N_40_F; s: N_40_H; s: N_40_S; s: N_40_T; s: F_41_L; s: L_42_G; s: L_42_R; s: G_43_del; s: G_43_M; s: G_43_R; s: G_44_E; s: E_44_R; s: S_45_A; s: T_45_A; s: S_45_ins; s: T_45_N; s: T_45_S; s: S_45_V; s: P_46_G; s: T_46_P; s: P_46_V; s: V_47_A; s: V_47_del; s: V_47_E; s: V_47_G; s: V_47_I; s: V_47_ins; s: V_47_K; s: V_47_N; s: V_47_T; s: C_48_F; s: C_48_G; rt: Q_48_H; s: L_49_P; s: L_49_R; s: G_50_A; s: G_50_S; rt: S_50_W; rt: R_51_K; s: Q_51_L; s: Q_51_R; s: Q_51_V; s: N_52_D; rt: G_52_E; rt: G_52_R; rt: N_53_D; rt: N_53_I; rt: N_53_K; s: S_53_L; rt: H_53_S; rt: N_53_S; rt: N_53_V; rt: H_54_D; s: Q_54_H; s: Q_54_N; s: Q_54_R; rt: H_54_S; rt: H_54_T; rt: R_55_del; s: S_55_del; s: S_55_F; rt: R_55_H; rt: R_55_Q; rt: V_56_M; s: P_56_Q; s: P_56_S; s: P_56_T; s: T_57_A; s: T_57_I; s: T_57_S; s: S_58_C; s: S_58_F; rt: W_58_U; s: N_59_S; s: N_59_Y; s: H_60_Q; s: H_60_R; s: S_61_L; s: S_61_P; s: P_62_L; s: T_63_I; s: T_63_N; s: T_63_S; s: S_64_C; s: S_64_P; s: C_65_Y; s: P_67_Q; s: T_68_I; s: P_70_A; s: P_70_L; s: W_74_U; s: M_75_L; s: C_76_F; s: C_76_S; s: C_76_Y; rt: S_78_C; s: R_78_Q; s: R_79_C; s: R_79_G; s: R_79_H; s: R_79_L; s: R_79_S; s: F_80_C; rt: L_80_I; s: F_80_L; s: F_80_S; rt: L_80_V; s: I_81_H; s: I_82_L; rt: L_82_M; s: I_82_M; s: F_83_C; s: F_83_L; s: F_83_S; s: L_84_P; s: F_85_C; s: F_85_I; s: I_86_R; rt: A_87_E; rt: A_87_G; rt: A_87_T; rt: A_87_V; rt: F_88_S; rt: Y_89_S; rt: H_90_P; s: C_90_S; rt: I_91_F; rt: I_91_P; rt: I_91_V; s: I_92_L; s: I_92_M; rt: L_93_N; s: V_96_G; s: L_97_del; rt: A_97_S; rt: A_97_T; s: L_98_V; s: S_100_C; s: Y_100_C; s: Q_101_R; rt: V_103_I; s: M_103_I; s: M_103_L; rt: I_103_V; rt: G_104_S; s: P_105_A; s: P_105_S; s: A_105_V; rt: S_106_A; s: V_106_G; s: V_106_I; s: C_107_D; rt: G_107_R; s: C_107_R; s: C_107_Y; s: L_109_G; rt: S_109_P; rt: R_110_G; s: I_110_L; s: I_110_V; s: P_111_L; s: P_111_R; rt: V_112_A; s: G_112_A; s: G_112_E; rt: V_112_L; s: G_112_R; s: S_113_A; s: S_113_del; rt: A_113_G; s: S_113_T; rt: R_114_H; s: S_114_P; s: S_114_T; s: T_115_P; rt: L_115_V; s: T_116_S; s: S_117_R; s: S_117_T; s: T_118_A; rt: N_118_D; rt: N_118_S; rt: N_118_T; s: T_118_V; rt: N_118_Y; rt: R_120_K; rt: R_120_S; s: P_120_S; s: P_120_T; rt: I_121_N; rt: I_121_S; rt: I_121_V; rt: F_122_H; rt: F_122_I; s: R_122_K; rt: F_122_N; s: R_122_Q; rt: F_122_S; rt: F_122_V; rt: F_122_Y; rt: N_123_D; rt: N_123_T; s: T_123_V; rt: Q_125_H; s: T_125_M; s: T_126_I; s: T_126_S; rt: H_126_Y; s: P_127_L; rt: G_127_R; s: P_127_T; rt: T_128_A; s: A_128_E; rt: T_128_I; rt: T_128_N; s: A_128_T; s: A_128_V; s: Q_129_H; rt: M_129_L; s: Q_129_R; s: Q_129_U; s: G_130_del; s: G_130_E; s: G_130_R; s: N_131_A; s: T_131_A; rt: D_131_H; s: T_131_N; rt: D_131_S; s: K_133_I; s: M_133_I; s: K_133_L; s: M_133_R; s: K_133_T; s: M_133_T; s: F_134_C; s: Y_134_C; s: F_134_del; rt: D_134_E; s: Y_134_F; rt: D_134_G; rt: D_134_N; s: Y_134_N; rt: D_134_V; s: P_135_A; s: P_135_H; rt: H_135_T; s: S_136_L; rt: C_136_Y; s: C_137_G; rt: S_137_T; s: C_138_G; rt: R_138_K; rt: D_139_H; rt: D_139_K; rt: D_139_Q; rt: D_139_S; s: C_139_Y; s: T_140_del; s: I_140_S; s: T_140_S; s: K_141_del; rt: Y_141_F; rt: Y_141_Q; s: K_141_T; s: K_141_U; rt: V_142_E; rt: V_142_I; s: S_143_L; s: T_143_L; s: S_143_T; s: G_145_E; rt: L_145_M; s: G_145_R; s: N_146_H; s: N_146_T; s: C_147_Y; s: T_148_del; rt: Y_148_F; rt: K_149_H; s: C_149_R; s: C_149_Y; s: I_150_T; rt: F_151_L; s: P_151_L; rt: F_151_V; rt: F_151_Y; s: I_152_T; s: I_152_V; rt: R_153_Q; rt: W_153_R; rt: R_153_W; s: S_154_A; rt: K_154_E; rt: K_154_N; s: W_156_R; rt: L_157_P; s: F_158_L; s: G_159_A; s: G_159_E; rt: S_159_T; rt: H_160_R; s: K_160_R; s: Y_161_L; s: F_161_Y; s: L_162_I; s: W_163_C; s: W_163_U; rt: I_163_V; s: E_164_A; s: E_164_D; s: E_164_G; rt: L_164_M; s: E_164_V; s: L_165_U; s: A_166_V; s: V_168_D; rt: K_168_E; s: A_168_V; s: R_169_G; s: F_170_ins; s: F_170_S; s: F_170_T; s: W_172_C; rt: G_172_U; s: W_172_U; s: L_173_F; rt: V_173_L; s: L_173_P; s: S_174_N; s: S_174_T; s: L_175_F; s: L_175_S; s: L_176_R; s: V_177_A; s: V_177_E; s: V_177_M; s: P_178_Q; s: P_178_T; s: F_179_L; s: F_179_V; s: V_180_A; s: V_180_L; rt: L_180_M; s: Q_181_E; rt: A_181_S; rt: A_181_T; rt: A_181_V; s: W_182_U; s: F_183_C; s: F_183_L; s: V_184_A; rt: T_184_S; rt: A_186_T; s: S_187_del; rt: I_187_L; rt: I_187_T; rt: I_187_V; rt: C_188_R; s: T_189_I; s: V_190_A; s: V_190_G; s: W_191_U; s: L_192_F; s: L_192_I; rt: R_192_S; s: L_192_V; s: S_193_K; s: S_193_L; s: S_193_N; s: V_194_A; s: A_194_D; s: A_194_G; s: I_195_L; s: I_195_M; s: I_195_T; s: W_196_C; s: W_196_L; s: W_196_S; s: W_196_U; s: M_197_I; s: M_197_L; s: M_197_T; s: M_198_I; s: M_198_K; s: M_198_R; s: M_198_T; s: W_199_R; s: W_199_U; rt: L_199_V; s: Y_200_F; rt: A_200_G; s: Y_200_L; s: Y_200_N; s: Y_200_S; rt: A_200_T; rt: A_200_V; s: W_201_del; rt: F_201_U; s: W_201_U; s: G_202_A; rt: S_202_R; s: G_202_R; s: P_203_ins; s: P_203_L; s: P_203_Q; s: P_203_R; rt: Y_203_S; s: P_203_T; s: P_203_U; s: R_204_G; s: S_204_G; rt: M_204_I; s: R_204_K; rt: M_204_L; s: R_204_N; s: S_204_N; s: S_204_R; rt: M_204_V; s: L_205_G; rt: D_205_N; rt: D_205_Y; s: Y_206_C; rt: D_206_E; s: Y_206_F; s: Y_206_H; s: Y_206_P; s: Y_206_Q; s: Y_206_R; rt: D_206_U; s: R_207_C; rt: V_207_E; s: R_207_G; s: N_207_H; rt: V_207_L; rt: V_207_M; s: R_207_N; s: N_207_R; s: N_207_T; rt: V_208_A; rt: V_208_E; s: I_208_N; s: I_208_S; s: I_208_T; s: L_209_I; s: L_209_M; s: L_209_T; rt: L_209_V; s: L_209_V; rt: G_210_E; s: R_210_K; s: S_210_M; s: R_210_N; s: S_210_N; s: S_210_R; s: R_210_T; rt: A_211_D; rt: A_211_I; s: P_211_L; s: P_211_Q; s: F_212_del; s: F_212_L; rt: K_212_N; rt: K_212_R; s: I_213_F; s: L_213_I; s: I_213_M; s: L_213_M; rt: S_213_R; s: I_213_S; s: L_213_T; rt: V_214_A; s: P_214_H; s: P_214_L; rt: P_215_H; rt: P_215_T; s: L_216_C; s: L_216_F; rt: H_216_Q; s: L_216_U; rt: H_216_Y; s: L_217_E; rt: L_217_H; s: L_217_ins; rt: L_217_R; rt: E_218_D; rt: E_218_H; s: I_218_ins; s: I_218_S; s: I_218_T; s: F_219_I; s: F_219_S; s: F_220_C; s: F_220_del; rt: L_220_F; s: F_220_L; s: F_220_S; rt: L_220_T; s: C_221_G; s: C_221_R; rt: F_221_Y; s: C_221_Y; rt: T_222_A; s: L_222_del; s: L_222_P; rt: T_222_S; s: L_222_V; rt: A_223_P; s: W_223_R; rt: A_223_S; s: W_223_U; s: V_224_A; s: V_224_E; s: V_224_G; rt: V_224_I; rt: V_224_L; s: Y_225_C; s: Y_225_F; s: Y_225_H; rt: T_225_P; rt: T_225_S; s: Y_225_S; s: Y_225_U; rt: N_226_H; rt: F_227_H; rt: L_228_P; rt: L_229_M; rt: L_229_S; rt: L_229_V; rt: L_229_W; rt: S_230_C; rt: S_230_P; rt: S_230_Y; rt: L_231_H; rt: L_231_S; rt: G_232_V; rt: I_233_L; rt: I_233_M; rt: I_233_P; rt: I_233_T; rt: I_233_V; rt: H_234_L; rt: L_235_F; rt: L_235_U; rt: L_235_V; rt: N_236_K; rt: N_236_T; rt: N_236_V; rt: P_237_L; rt: P_237_Q; rt: P_237_T; rt: A_238_H; rt: A_238_K; rt: A_238_S; rt: K_241_R; rt: R_242_G; rt: G_244_R; rt: Y_245_H; rt: S_246_N; rt: S_246_P; rt: S_246_T; rt: N_248_H; rt: H_248_Y; rt: F_249_L; rt: M_250_I; rt: M_250_T; rt: Y_252_H; rt: V_253_I; rt: I_253_T; rt: G_255_R; rt: S_256_C; rt: C_256_G; rt: Y_257_G; rt: Y_257_H; rt: W_257_L; rt: Y_257_W; rt: S_259_L; rt: T_259_P; rt: T_259_S; rt: S_259_T; rt: Q_262_U; rt: H_264_Y; rt: I_266_T; rt: I_266_V; rt: Q_267_H; rt: Q_267_L; rt: Q_267_R; rt: Q_267_Y; rt: I_269_L; rt: I_269_T; rt: E_271_A; rt: E_271_D; rt: H_271_D; rt: H_271_E; rt: E_271_H; rt: E_271_L; rt: E_271_Q; rt: R_274_G; rt: R_274_Q; rt: R_274_S; rt: I_278_A; rt: V_278_I; rt: R_280_M; rt: D_283_E; rt: W_284_R; rt: K_285_Q; rt: V_286_L; rt: C_287_F; rt: Q_288_U; rt: R_289_S; rt: I_290_L; rt: I_290_N; rt: V_291_G; rt: V_291_M; rt: V_291_W; rt: G_292_A; rt: G_292_W; rt: L_293_V; rt: L_294_F; rt: L_294_U; rt: G_295_D; rt: F_296_L; rt: F_296_M; rt: F_296_S; rt: A_297_I; rt: A_297_T; rt: A_298_D; rt: A_298_V; rt: F_300_Y; rt: T_301_K; rt: Q_302_E; rt: C_303_F; rt: Y_305_A; rt: P_306_S; rt: P_306_T; rt: A_307_V; rt: L_308_E; rt: K_309_L; rt: P_310_L; rt: L_311_S; rt: A_313_T; rt: Q_316_H; rt: A_320_P; rt: F_321_T; rt: T_322_P; rt: T_322_S; rt: T_322_V; rt: F_323_L; rt: S_324_R; rt: P_325_H; rt: A_329_D; rt: A_329_T; rt: F_330_C; rt: L_331_V; rt: C_332_F; rt: C_332_N; rt: C_332_R; rt: C_332_S; rt: C_332_Y; rt: K_333_N; rt: K_333_T; rt: Y_335_F; rt: L_336_M; rt: N_337_D; rt: N_337_H; rt: N_337_T; in which: rt: reverse transcriptase gene (polymerase); s: surface antigen coding gene; x = wild type amino acid (genotype D or A); n = positive integer indicating the position of the amino acid codon (standard numbering); y = amino acid in substitution of the wild type (mutation); moreover, when y = U the mutation introduces a stop codon. 6. Mutations and / or mutation profiles of the HBV genome determined by the automated method according to claims 1-4. 7. Use of the mutations and mutation profiles according to claims 5-6 for the establishment of a database of genomic mutations of the HBV virus for use in the medical field, in particular for the diagnosis and treatment of drug-resistant forms against the HBV virus. 8. Automated device for obtaining mutations and / or mutation profiles of the HBV virus genome resistant to antiviral drugs including: - unit for the sequencing of the HBV virus genome and for the download of accessible data in databases; - units for processing, parsing, alignment, error correction, clustering, phylogenetic analysis and data variation analysis; unit for the extraction from the sequences thus processed of mutations of the reverse transcriptase gene and / or of the surface antigen of the HBV virus; unit for optimized local alignment and error correction; - unit for the evaluation of nucleotide and amino acid variability, with calculation of confidence intervals on the prevalence of mutations; unit for the inclusion of mutations with a frequency greater than 1%; - unit for the extraction of mutations and / or mutation profiles generated. 9. Device according to claim 8 in which the sequencing unit is an ultra-deep pyrosequencing unit. 10. Device according to claims 8-9 further comprising a unit for the correlation between the mutations found and the resistance to treatment with drugs. 11. Use of the pyrosequencing technique for the genotypic characterization of the viral population present in a patient infected with HBV. 12. Method for evaluating the effectiveness of antiviral therapy in a patient infected with HBV, said method being conducted on a biological sample, preferably blood, of the patient and comprising the steps of: - determine with the method according to claims 1-4 if the sample includes at least one nucleic acid that encodes the reverse transcriptase and / or the surface antigen of the HBV virus containing at least one resistance-related mutation; And - use the presence of said mutated nucleic acid for evaluating the effectiveness of antiviral therapy. 13. Method for determining the sensitivity to one or more drugs of the viral population present in a patient infected with HBV, said method being conducted on a biological sample, preferably blood, of the patient and comprising the steps of: - determine with the method according to claims 1-4 if the sample includes at least one nucleic acid that encodes the reverse transcriptase and / or the surface antigen of the HBV virus containing at least one resistance-related mutation; And - use the presence of said mutated nucleic acid for the choice of antiretroviral therapy. 14. Method for identifying drugs effective on HBV strains resistant to antiviral therapy, said method comprising the steps of: - acquire at least one wild type or engineered HBV strain comprising in its genome at least one of the mutations identified with the method according to claims 1-4; - determine the phenotypic response of the virus to the drug to be tested; And - use the phenotypic response thus obtained to determine the efficacy of the tested drug. 15. Oligo- or polynucleotide sequence of HBV virus comprising mutations and / or mutation profiles according to claims 5-6 for use in the medical field, in particular for the diagnosis of resistance to antiviral drugs. 16. Plasmid comprising the oligo- or polynucleotide sequence according to claim 15. 17. Plasmid according to claim 16 for use as a cloning and expression vector. 18. Engineered cell comprising the vector according to claim 17, in particular HepG2 cells. 19. Engineered HBV virus containing one or more antiviral drug resistant mutations identified by the method according to claims 1-6. 20. Primer selected from those having the following sequences: SEQ ID No 1 HBV 1 FW CCTGCTGGTGGCTCCAGTT SEQ ID No 2 HBV 1 RW AGAGAAGTCCACCACGAG SEQ ID No 3 HBV 2 FW CCTGCTCGTGTTACAGGCG SEQ ID No 4 HBV 2 RW CCGCAGACACATCCAGCG SEQ ID No 5 HBV 3 FW CCGTGTGTCTTGGCCAAA SEQ ID No 6 HBV 3 RW GACAAACGGGCAACATAC SEQ ID No 7 HBV 4 FW GCTGCTATGCCTCATCTTCT SEQ ID No 8 HBV 4 RW GAYGATGGGATGGGAATAC SEQ ID No 9 HBV 5 FW GCACGACTCCTGCTCAAGG SEQ ID No 10 HBV 5 RW CCCKACGAACCACTGAACAA SEQ ID No 11 HBV 6 FW GTATTCCCATCCCATCRTC SEQ ID N 12o HBV 6 RW CGGTAWAAAGGGACTCAMG SEQ ID No 13 HBV 7 FW TTGTTCAGTGGTTCGTMGGG SEQ ID No 14 HBV 7 RW GGGTTAAATGTATACCCAVAG SEQ ID No 15 HBV 8 FW CKTGAGTCCCTTTWTACCG SEQ ID No 16 HBV 8 RW CKTGAGTCCCTTTWTACCG