ITMI20102403A1 - ANTIOXIDANT COMPOSITION FOR THE PREVENTION AND TREATMENT OF ASCRIVIBLE PATHOLOGIES AT THE MITOCHONDRIAL DECAY - Google Patents

Description

"ANTIOXIDANT COMPOSITION FOR PREVENTION AND THE

TREATMENT OF PATHOLOGIES ASCRIBABLE TO MITOCHONDRAL DECAYâ €

FIELD OF INVENTION

The present invention relates to antioxidant compositions to be used in the prevention and treatment of pathologies attributable to mitochondrial decay.

STATE OF THE TECHNIQUE

The harmful effects produced by reactive oxygen species (ROS) which are formed in cells, mainly at the mitochondrial level, in normal energy metabolism are known. Cells have developed defense mechanisms to eradicate the production of these radical forms, ie metabolites that show toxic effects by altering the permeability of cell membranes and the integrity of compartments, such as mitochondrial ones. In this way, ROS interfere with normal biochemical and biomolecular processes, often triggering cascades of signals that end in senescence or cellular apoptosis. A significant increase in ROS, associated with a decrease in the activity of antioxidant enzymes, occurs, for example, in the phases associated with the aging of an organism.

At least in part, in fact, aging and the consequent reduction of some functions that occur with senility are due to the damage caused by the oxidants produced as â € œby-productsâ € of normal metabolism, not sufficiently neutralized by the antioxidant systems present in the our body and continuous exposure to exogenous radicals (caused for example by environmental factors).

The production of reactive oxygen species also increases in various pathological situations, such as diabetes, cardiac and cerebral ischemia, obesity, inflammatory processes and neurodegenerative processes.

In particular, the mitochondrial decay of neuronal and heart cells, the most affected cells during the aging phase, is extremely relevant. It has been observed, in fact, that the oxidative damage found in the mitochondria is significantly higher than that of other organelles. This phenomenon is mainly due to the fact that mitochondria represent cellular compartments in which significant metabolic functions that regulate the energy needs of the cell develop. Aging leads to a reduced catalytic capacity of various mitochondrial enzymes. Among these, those of respiratory complexes III and IV are particularly damaged. Some of the enzymes of these two complexes reduce their affinity for ubiquinol and cytochrome C and trigger cascades of reactions that can lead to cellular apoptosis. The loss of function of these enzymes, triggered by oxidative stress, reduces the efficiency of the intracellular defense systems. The oxidative damage produced by ROS in mitochondria mainly affects mitochondrial DNA / RNA, causing the synthesis of mutated enzymes with reduced affinity for their substrates or with reduced catalytic activity. As easily imagined, such a situation triggers a vicious cycle that causes a continuous increase in mitochondrial damage by compromising cellular functions by reducing the cell's ability to produce ATP. The cells most damaged therefore by what is defined â € œmitochondrial decay ", understood as a decrease in the structural and functional integrity of the mitochondrion, are those in which a high consumption of ATP is required.

Primarily neuronal cells will be affected, which require a significant expenditure of ATP for neurotransmission. Muscle cells (both cardiac and skeletal) are also easily subject to alterations in mitochondrial metabolic processes, especially in conditions in which significant oxygen consumption occurs, due for example to prolonged physical exertion.

The aim of the present invention is therefore to provide a remedy that can limit this mitochondrial decay as much as possible.

SUMMARY OF THE INVENTION

The purpose indicated above has been achieved by means of a composition consisting of 10-40% by weight of R-a-lipoic acid, 5-20% by weight of acetyl-L-carnitine, 0.001-0.002% by weight of selenium, the remaining being pharmaceutically acceptable excipients, on the total weight of the composition.

From another aspect, the present invention relates to the use of such a composition in the prevention and treatment of pathologies ascribable to mitochondrial decay.

BRIEF DESCRIPTION OF THE FIGURES

The characteristics and advantages of the present invention will be evident from the detailed description given below, from the embodiment examples provided for illustrative and non-limiting purposes, and from the attached Figures, in which:

- Figure 1 represents the evaluation of the effects of selenium on cell viability, as per Example 1;

- Figure 2 represents the effects of selenium on the prevention of ROS induced by H2O2, as per Example 2;

- Figure 3 represents the study of the induction of some genes involved in the repair of oxidative stress, as in Example 4; And

- Figure 4 represents the effects of the composition of the invention on the quantity of reduced glutathione, as per Example 5.

DETAILED DESCRIPTION OF THE INVENTION

The invention therefore has as its object a composition consisting of 10-40% by weight of R-a-lipoic acid, 5-20% by weight of acetyl-L-carnitine, 0.001-0.002% by weight of selenium, the remainder being excipients pharmaceutically acceptable, based on the total weight of the composition.

As will also be seen from the Examples provided, this composition has unexpectedly been shown to be able to enhance and increase the function of enzymatic cofactor and antioxidant of R-a-lipoic acid, thanks to the appropriate combination with acetyl-L-carnitine and selenium, surprisingly obtaining the reactivation of the mitochondrial functions compromised in case of oxidative stress and the increase of the endogenous antioxidant activity.

In particular, selenium is present in the composition in the form of dimethyl selenide, selenomethionine, selenocysteine or methylselenocysteine. Preferably, the selenium is in the form of L-selenomethionine.

Preferably, the composition of the invention consists of 15-35% by weight of R-a-lipoic acid, 6-16% by weight of acetyl-L-carnitine, 0.0014-0.0019% by weight of selenium, the remainder being pharmaceutically acceptable excipients , on the total weight of the composition.

More preferably, the composition of the invention consists of 18-25% by weight of R-a-lipoic acid, 10-15% by weight of acetyl-L-carnitine, 0.0015-0.0019% by weight of selenium, the remainder being pharmaceutically excipients acceptable, on the total weight of the composition.

According to a preferred embodiment, the composition consists of 20% by weight of R-a-lipoic acid, 13.33% by weight of acetyl-L-carnitine, 0.0018% by weight of selenium, the remainder being pharmaceutically acceptable excipients, on the total weight of the composition.

In particular, it has been observed that for the purposes of the present invention, it is preferred in the composition that the quantity of R-a-lipoic acid is greater than the quantity of acetyl-L-carnitine.

As regards pharmaceutically acceptable excipients, sweeteners, diluents, disaggregants, glidants, dyes, binders, lubricants, stabilizers, adsorbents, preservatives, release retardants or mixtures thereof are suitable.

The composition of the invention may be in capsule, tablet, mini-tablet, micro-tablet, granule, micro-granule, pellet, multi-particulate, or micronized particulate form.

According to a preferred embodiment, the composition of the invention is in the form of a unit dose comprising 300-1200 mg of R-a-lipoic acid, 150-600 mg of acetyl-L-carnitine, and 30-60 µg of selenium.

More preferably, the composition is in unit dose form comprising 450-1050 mg of R-a-lipoic acid, 180-480 mg of acetyl-L-carnitine, and 42-57 µg of selenium. Even more preferably, the composition is in unit dose form comprising 600 mg of R-a-lipoic acid, 400 mg of acetyl-L-carnitine, and 55 µg of selenium.

From another aspect, the present invention relates to the therapeutic use of the composition described above. In particular, as mentioned, this composition is used in the prevention and treatment of pathologies attributable to mitochondrial decay typical of cellular aging and which occurs in situations associated with prolonged physical stress as well as neuropathies, neurodegenerative diseases, cardiomyopathies, syndromes canicular diseases, radiculopathies, vasculopathies and disorders of chronological aging. In particular, these pathologies include Alzheimer's disease, Parkinson's disease, cerebral stroke, diabetic neuropathies, carpal / tarsal tunnel syndromes, lumbosciatica, cervicobracalgia, herniated disc, diabetic neuropathies, peripheral neuropathies, post herpetic neuropathies and optic neuropathies. Î ± -lipoic acid (a-LA), a natural substance present in our body, is a known cofactor of enzymatic complexes (e.g. pyruvate dehydrogenase, alpha-ketoglutarate) involved in the oxidative decarboxylation reactions of Î ± acids -ketoacids. These processes take place at the mitochondrial level and constitute the fundamental stages of that set of reactions, known as the Krebs cycle. The availability of lipoic acid increases the efficiency of the entire metabolic process.

In the organism it is synthesized in the mitochondrion from octanoic acid. Lipoic acid is also taken from the outside through the diet and since the endogenous one is often not sufficient to perform an efficient antioxidant action, its intake is accompanied by a greater efficiency of the biological systems in which it is involved. However, lipoic acid, contained in various foods (especially in red meat, potatoes, broccoli, spinach) is poorly absorbed as it is bound to lipolysin. Furthermore, as evidenced by several pharmacokinetic studies, the rapid absorption is however associated with a low piasmatic concentration of lipoic acid, as on the one hand lipoic acid is rapidly transported and accumulated in various tissues (especially liver, heart and skeletal muscle) and on the other it is rapidly metabolized and excreted, mainly through the urinary tract. In the body, Î ± -LA is easily reduced to dihydrolipoic acid (DHLA). Given its particular chemical structure, DHLA acts as an electron carrier and as an antioxidant and, unlike other antioxidants, performs its action both in a hydrophilic environment (cytoplasm, extracellular matrix) and in a lipophilic environment (piasmatic membranes). Considering that it exhibits rapid absorbability and is easily transported across membranes, lipoic acid carries out its activity in various cellular compartments. The low redox potential of the LA / DHLA system justifies the ability of lipoic acid to be involved in the neutralization reactions of reactive oxygen species (ROS) and in the process of reducing the oxidized forms of other antioxidants. Both the oxidized form of Î ± -lipoic acid and the reduced one contribute to determining its overall antioxidant action, but the contribution of DHLA, due to its direct reducing action, is considerably greater. The antioxidant action of lipoic acid has been widely demonstrated â € œin vitroâ € and â € œin vivoâ €. The mechanisms through which the antioxidant action is expressed are many and some of them are not yet fully understood. The Î ± -LA / DHLA system strengthens and completes the defensive network set up by other antioxidant molecules. In the reduced form, DHLA, lipoic acid is able to donate its electrons to the oxidized forms of glutathione (GSSG) and vitamin C, regenerating them to reduced glutathione (GSH) and ascorbic acid. Oxidized lipoic acid is rapidly reduced by lipoamide dehydrogenase using NADH as a reducing agent. Due to this characteristic, and that is to recycle other antioxidant sources, lipoic acid is often referred to as an â € œantioxidant of antioxidants ".

In the myocardium and liver, with aging, there is a drastic reduction in the quantity and consequently in the activity of glutathione. Since it is not easily absorbed in the intestine, oral supplementation of glutathione is not very efficient in these situations. From this point of view, formulations based on lipoic acid can be of great use to increase the levels of glutathione in our body.

Furthermore, Î ± -LA is able to increase the efficiency of insulin, but also to improve the transport of glucose within the cell, often using alternative routes to those attributable to insulin. This phenomenon contributes to the normalization of blood glucose and to prevent various complications, which occur instead in diabetic patients. In particular, lipoic acid decreases the probability of the formation of AGEs (Advanced Glycation Endproducts), dangerous compounds of a radical nature. These products are generated from cellular proteins following the accumulation of glucose in the blood and contribute to aging and cellular degeneration. For example, especially in the eye of diabetic patients, the considerable quantity of AGEs that develops determines a consequent loss of function of the various proteins modified by glycosylation.

The use of lipoic acid for diabetic individuals (especially type II diabetes) is therefore aimed both at reducing the amount of blood glucose and at preventing damage caused by dangerous radicals, attributable to various forms of neuropathies. Lipoic acid improves the signal conduction parameters of peripheral nerves, a signal that is decidedly compromised in various neuropathies (both diabetic and neurodegenerative diseases).

Another function of lipoic acid is that of hepato-protection, for this reason lipoic acid-based supplements represent a preventive weapon for the detoxification of toxic substances.

Carnitine, present in large quantities in the muscles, is an essential component of the shuttle system for transporting fatty acids across the mitochondrial membrane; its presence is therefore essential for the beta-oxidation of fatty acids in the mitochondria.

It exists both in free form and in other conjugated and modified forms. Acetyl-L-carnitine, in particular, represents the simplest of the esterified carnitines and acts as a transporter of acetyl groups for Coenzyme A. In this way, it actively participates in the metabolic processes that are upstream of the Krebs cycle and which are aimed at the production of ATP. It follows that the availability of acetyl-L-carnitine prevents an accumulation in the cytoplasm of significant quantities of fatty acids and in the mitochondria of acyl-Coenzyme A.

Acetyl-L-carnitine reverses the decline in tissue levels of carnitine caused by aging and stimulates mitochondrial beta-oxidation in various districts. In this way acetyl-L-carnitine contributes to directly reactivate the mitochondrial functions compromised by aging and consequently, indirectly, collaborates in the reduction of oxidative stress caused by the loss of antioxidant activity due to the functional alteration of the compartment mitochondrial. In addition to having a transporter function for acetyl groups, acetyl-L-carnitine actively participates in the protection of the functionality of various cells, especially neurons. First of all it contributes to the production of acetylcholine and stimulates the synthesis of membrane phospholipids. It also contributes to the preservation of acetylcholine receptors, the decrease of which is associated with the loss of cognitive abilities and other typical functions of aging. Finally, it has been shown that acetyl-L-carnitine increases NGF, a neurotrophic factor important for the maintenance of neuronal function.

Ultimately, acetyl-L-carnitine preserves neuronal function both by regulating energy metabolism, by maintaining the structural integrity of the membranes and by ensuring a correct release and response process of neurotransmitters.

It is very interesting that an administration of acetyl-L-carnitine to rats at high doses favors the correct maintenance of mitochondrial functions. In short, several data have confirmed that acetyl-L-carnitine, by favoring the transcription of specific factors (PGC-1 alpha, NRF-1, TFAM), actively participates in the biogenesis of mitochondria. One of the characteristics associated with aging, for example, is the reduction in both the number and function of mitochondria in the heart muscle. The loss of this function has also been attributed to a deficiency of cardiolipin, one of the main phospholipids of the inner membrane of the mitochondria. An oral treatment of acetyl-L-carnitine in "aged" rats largely reverses this dysfunction as it favors the induction of mitochondrial proteins as well as cardiolipin itself.

Selenium (Se) is a chemical element similar to sulfur. It exists in various allotropic forms; in appropriate dosages it is not toxic, but many of its compounds exhibit effects similar to those of arsenic. Due to its chemical properties, it acts as an excellent antagonist of heavy metals such as lead, mercury, aluminum and cadmium.

Numerous scientific articles have been published that demonstrate self involvement in multiple biological processes. Epidemiological studies have shown a correlation between various pathologies and selenium deficiency in soils where plants or animals are grown for food needs for the human species. For example, sheep and cattle raised in acid soils, characterized by an excessive presence of iron, a selenium antagonist, show a reduction in growth, in reproductive capacity, and present various myopathies. For this reason, in animal husbandry, to avoid various malformations of farm animals, soil fertilizers or feed rich in selenium are used.

In some areas of China, where there is a drastic shortage of selenium, there has been an increase in diseases such as Keshan (cardiomyopathy) and Keshan-Beck (deforming arthritis), while in numerous volcanic regions (especially in Finland ) a diet low in selenium is associated with premature vascular aging.

In reality, selenium deficiency does not in itself cause pathological conditions: however it can make the body more susceptible to diseases caused by other food, biochemical or infectious stresses. It follows that any pathological situation or metabolic hyperactivity involving oxidative stress or an inflammatory process can benefit from the administration of selenium. Almost all the selenium introduced into the body is incorporated into some amino acids (methionine, cysteine) and consequently used for the synthesis of some proteins. Selenocysteine (especially from animal sources), is selectively addressed for the synthesis of some enzymes, defined for this reason selenoproteins. On the contrary, methionine and selenomethionine (the latter from both animal and vegetable sources) are incorporated into proteins in a non-specific way; for both the same synthesis processes are used, but the choice of one or the other form depends on the amino acid reserve available.

At the moment about 35 selenoproteins have been identified, although their function is not yet known of all. Certainly, one of the most studied is Glutathione peroxidase (GPx), of which there are different isoforms distributed in different cellular districts (GPx1, GPx2, GPx3, GPx4). It is an enzymatic complex with an antioxidant function as it actively participates in the removal of toxic peroxides that are formed during cell metabolism.

Therefore, selenium, as an integral part of GPx, participates in the reduction of hydrogen peroxide, lipid and phospholipid hydroperoxides, slows the propagation of free radicals and reactive oxygen species; decreases the production of prostaglandins and leukotrienes (eicosanoids that trigger the inflammatory response) as it reduces the hydroperoxide intermediates that are formed during their synthesis

Another selenoprotein involved in the process of regulating the redox state is the thioredoxine reductase, of which some ¬soforms are known. This enzyme is also involved in the regeneration of antioxidant systems, in the maintenance of the intracellular redox state necessary for cellular vitality and for the regulation of the expression of some genes.

In view of these properties, it is understandable why selenium represents an important trace element especially for functions such as learning and memory. In the brain there is no catalase, the main enzyme involved in the detoxification of reactive oxygen species. Consequently, the removal of hydroperoxides is basically due to the activity of selenoproteins, especially glutathione peroxidase. A selenium deficiency, unable to correct the damage caused by hydroperoxides, is therefore associated with an alteration of the membranes, a reduction in the release of neurotransmitters, which lead to senility and reduced cognitive capacity.

However, it should be noted that although it is an essential element for the human organism, the Self is toxic if used at high concentrations. Doses higher than 400pg per day can cause selenosis, selenium poisoning, characterized by hair loss, weakening and / or falling out of teeth and nails, dermatitis, garlic smell in the breath and body, apathy, paralysis, delay in wound healing.

The selenium introduced by food is mainly absorbed in the intestine and excreted through the faeces, urine or lungs. The absorbed fraction, transported by piasmatic proteins, reaches different organs (especially spleen, liver, kidneys and heart) where it is used for the synthesis of selenoproteins or other proteins that have no specific function other than to represent a selenium reserve.

Some studies have shown that the administration of selenomethionine alone does not significantly improve the activity of glutathione peroxidase.

The composition of the present invention, with particular reference to the examples reported below, has shown that the combination of seleno-L-methionine, R-a-lipoic acid, which is less toxic and pharmacologically more active than the corresponding racemic, and acetyl-L- carnitine not only has an antioxidant activity, but also surprisingly a synergistic effect capable of effectively opposing mitochondrial decay.

As will also be seen from the following Examples, said prevention or said treatment preferably comprises oral administration of the composition once a day, in particular, of the composition in unit dose form, as described above.

An example of embodiment of the present invention is given below, provided for illustrative and non-limiting purposes.

EXAMPLES

Example 1.

Effects of selenium on cell viability

Experiments were set up to highlight the effects of L-selenomethionine on the viability of the SK-N-SH neuroblastoma cell line. Complementary analyzes were also performed in HepG2 cells, hepatocarcinoma lineage (data not shown).

Several experimental indications have shown a correlation between the viability results obtained from these cell lines and the toxicity tests carried out on animals. Furthermore, SK-N-SH cells constitute a good study model for the research of new antioxidants as they reproduce the biochemical and biomolecular characteristics of neuronal cells, therefore a system easily susceptible to oxidative stress.

Optical microscope analysis also allowed us to evaluate any morphological changes, the increase in intracellular vesicles, the index of proliferation, arrest and / or cell death; it was therefore possible to verify whether the administration of L-selenomethionine caused an evident alteration of the cell line. A quantitative value of the effects of L-selenomethionine on cell viability was obtained instead with a luminometric assay (ATPIite, PerkinElmer), which exploited the production of light produced by an enzymatic reaction in which the intracellular Î "Î'ΤΡ of the cells intervened vital. Consequently, the signal detected by the luminometer was proportional to the amount of intracellular ATP and therefore to the number of live cells.

Method:

â € ¢ SK-N-SH cells were seeded at a density of 4x10 <3> cells s / well.

They were cultured in EMEM enriched with glutamine, penicillin and streptomycin and supplemented with 10% fetal bovine serum (EMEM FBS 10%).

â € ¢ Incubate at 37 ° C at 5% C02.

â € ¢ L-selenomethionine (Sigma-Aldrich) was dissolved directly in EMEM FBS 10%. From some indications in the literature it was decided to analyze the effects of L-selenomethionine (SeMeth) at the following concentrations: 1, 2, 4 Î1⁄4Îœ. The control (etri) was represented by cells maintained in 10% EMEM FBS.

â € ¢ Replace the culture medium 24 hours after sowing; 10ÎÎ1⁄4Î ™ of the medium containing or not the specific concentration of L-selenomethionine were added to each well.

â € ¢ Renew the culture medium containing the specific concentration of L-selenomethionine every 24 hours and set up the experiment for the phase contrast microscope analysis as well as for the viability assay using the ATPIite protocol ( PerkinElmer).

Results:

Figure 1 shows the cell viability results of SK-N-SH after treatment for 24 or 48 hours with L-selenomethionine at different study concentrations. The values were compared with those obtained in the control, therefore in cells kept in culture for the same interval of time, but in the absence of L-selenomethionine.

As evidenced by the cell viability values obtained for both analysis times, the effects of L-selenomethionine are comparable to those of the respective control.

Optical microscope analysis (data not shown) confirmed what has just been described; in fact, a treatment with L-selenomethionine does not alter the cell morphology.

Example 2.

Role of selenium in preventing the formation of ROS induced by hydrogen peroxide

During some biochemical processes metabolites can be produced, such as superoxide anion, hydroperoxide radical, hydrogen peroxide, hydroxyl radical, known as reactive oxygen species (ROS from Reacting Oxygen Species). These substances induce cell damage at various levels; mainly by altering the permeability and the structure of membranes, both piasmatic and of the various organelles, they compromise some biological functions which in more drastic cases can lead to the loss of cellular integrity.

As a defense mechanism, cells have at their disposal scavenger systems (eg activity of enzymes such as superoxide dismutase, catalase, glutathione peroxidase) which consist of a series of enzymes aimed at stopping the cascades of reactions initiated by free radicals.

The central nervous system is particularly susceptible to alterations of the redox state. Due to the high oxygen consumption, a significant concentration of polyunsaturated fatty acids, the biochemical processes that occur inside the neuronal cells are accompanied by a significant production of reactive oxygen species. For this reason the scavenger systems in this type of cells must always be functional, if not upgradeable.

Furthermore, cellular aging is accompanied by a loss of efficiency of the defense systems; the decline of scavenger systems associated with the loss of function of other cellular mechanisms capable of degrading and repairing damaged molecules results in an increase in reactive oxygen metabolites. These free radicals react easily with the polyunsaturated fatty acids that make up the neuronal membrane and nerve fibers. It follows that a cellular senescence, in addition to being affected by the production of toxic metabolites that are triggered by the peroxidation of lipids, altering the integrity of the membranes, leads to an ionic imbalance that influences the homeostasis of calcium, at the basis of various cellular functions (e.g. control of membrane potential, release of neurotransmitters).

From these considerations arises the need to help the body with an integration of antioxidants capable of counteracting the formation or progression of free radicals.

In this context, the studies described later are placed, aimed at verifying whether the administration of L-selenomethionine in SK-N-SH cells is capable of counteracting the formation of ROS produced by the administration of H202.

Previous data have shown that a treatment for 2 hours with H2O2 1.5mM is characterized by a significant production of ROS, even if morphologically no drastic effects suggesting cell death are evident. Ultimately, we want to verify whether a treatment with SeMeth, before the administration of H2021.5mM, leads to a decrease in ROS production. In this case, SeMeth would enhance the intracellular scavenger systems, making them more efficient in canceling the cytotoxic effects of hydrogen peroxide.

Method:

â € ¢ The quantity of ROS was technically evaluated by means of a fluorescence analysis; in fact, the cells in culture (SK-N-SH cells) were administered 2â € ™, 7â € ™ -dichlorodihydrofluorescein-dìacetate (DCFH-DA), a substrate that emitted fluorescence (excitation light: 480 nm; emission light : 530 nm) only after a radical reaction due to the presence of intracellular ROS. With the same substrate administered in the various cells, the signal obtained was therefore proportional to the quantity of ROS present.

â € ¢ The values obtained were normalized with the luminescence signal determined by the cell viability test (ATPIite, PerkinElmer) and were reported as an arbitrary unit of DCF (fluorescence unit) / CPS (luminometry unit).

Results:

As described in Figure 2, H2O2 induced a significant increase in ROS production, a quantity which, however, was not yet sufficient to determine evident morphological alterations.

On the other hand, however, a dose and time-dependent treatment of L-selenomethionine was completely irrelevant on the quantity of ROS induced by hydrogen peroxide under these experimental conditions.

The administration of L-selenomethionine alone, therefore intended as a source of selenium for the activity of various selenoproteins with antioxidant activity, was not sufficient, in the analysis times considered, to counteract the production of ROS produced by H2O2. From these data first of all it emerged that, if made available now from the exogenous source, the Se is not a limiting factor for the known activity of glutathione peroxidase, capable of reducing hydrogen peroxide to water using glutathione as a reducing agent.

2 GSH H202â † ’GSSG 2 H20

glutathione peroxidase

Since there was no decrease in ROS formation, it could be thought that the ineffectiveness of the scavenger system in the experimental model described could be explained by insufficient activity of the glutathione peroxidase enzyme due to the limiting expression or the enzyme or glutathione, a hydrogen donor for its reducing action.

Example 3.

Evaluation of the efficacy of the R-a-lipoic acid / acetì-L-carnitine / selenium combination in the prevention of ROS, induced by hydrogen peroxide With the present Example, the capacity of the composition according to the invention has been verified to counteract the formation of ROS induced by hydrogen peroxide in SK-N-SH cells. This evaluation was carried out in parallel on the single components of the composition and on partial compositions, in the same quantities chosen for the composition, in order to highlight the synergy of the combination of the invention.

The cellular model chosen mimics, in part, the oxidative stress that occurs in various neurodegenerative diseases and in the case of diabetic neuropathies.

For the purposes of this Example, the following composition of the invention has been prepared:

Quantity

R-a-Lipoic acid 600mg

Acetyl-Lcarnitine 400 mg

L-selenomethionine 11 mg (corresponding to a contribution of 1, 25% of selenium calcium phosphate equal to 55 Î1⁄4g)

Excipients * 1989 mg; TOTAL 3 g ;; * isomalt, sucralose, acesulfame K, silicon dioxide, beta-carotene 1%, xanthan gum, flavorings The excipients used are sweeteners, anti-caking agents and dyes.

Method:

The ROS analysis was carried out as already described in the previous Example. The following samples were prepared, each starting from 100 mg and then diluted in water up to the concentrations reported below:

Composition Composition of the invention Ref. 1 Ref. 2 Ref. 3 Ref. 4 of the invention without excipients R-a-Lipoic acid 100 Î1⁄4Îœ 100 pM 100 pM 100 pM Acetyl-Lcarnitine 60 Î1⁄4Îœ 60 pM 60 pM 60 pM L-selenomethionine 24 nM 24 nM 24 nM

Where with "Ref.â € we mean the comparison samples.

The sample relating to the composition of the invention without excipients was prepared in order to demonstrate the synergy between the three selected active ingredients.

The control (etri) was represented by cells maintained in culture with 10% EMEM + FBS, enriched with 0.06% DMSO, solvent used to dilute R-a-Lipoic acid and Acetyl-L-carnitine.

The results reported in Table 1 below describe the quantity of ROS induced by H202 recorded in SK-N-SH cells treated with the samples indicated above. The ROS values, calculated as DCF / CPS, were reported as fold induction (f.i.) with respect to the reference unit corresponding to the quantity of physiological ROS recorded after 24 hours and after 48 hours in the control cells.

Table 1.

H202 (mM) after 24h after 48h Ctrl 0 1.0 4.1 Ctrl 1.5 19.2 40.8 Ref. 1 1.5 9.3 22.8 Ref. 2 1.5 14.6 48.1 Ref. 3 1.5 17.9 41.1 Ref. 4 1.5 17.1 26.4 Composition of the invention

1.5 8.1 20.9 without excipients

Composition of the invention 1.5 8.1 17.3

A treatment for 2 hours with H202 (1.5 mM) resulted in a significant production of ROS (f.i .: 19.2). This production was reduced following an administration of R-a-lipoic acid (f.i .: 9.3), but only slightly with acetyl-L-carnitine (f.i .: 14.6) or with L-selenomethionine (f.i .: 17.9) when used alone (Ref. 1, Ref. 2 and Ref. 3 respectively), measured 24 hours after this administration. The combination of Ref. 4, that is R-a-lipoic acid - acetyl-L-carnitine, on the other hand, showed a decidedly weak anti-ROS activity and therefore completely satisfactory (f.i. 17.1).

The decrease in reactive oxygen species was instead observed to a surprisingly high extent by administering the composition of the invention with R-a-lipoic acid, acetyl-L-camitine and selenium (f.i: 8.1) both with and without excipients, thus indicating that the three components unexpectedly act in synergy with each other.

This surprising anti-ROS activity was observed even after a more prolonged treatment, ie after 48 hours. First of all, keeping the cells in culture for a longer time interval recorded a physiological increase in ROS in the control samples (f.i .: 4.1) and a significantly greater susceptibility to ROS production after treatment with H2O2 (f.i. 40.8). It was observed that, while with the single components acetyl-L-carnitine (Ref. 2) and L-selenomethionine (Ref.

3) ROS were even increased compared to the control alone, again the combination of Ref. 4 showed a fold induction value worse than R-Î ± -Lipoic acid alone.

Only the composition of the invention both with and without excipients, even after 48h of treatment, showed surprisingly satisfactory effects of prevention of ROS production, and consequently of protection of cellular functions (f.i .: 17.3 and 20.9 respectively).

Example 4.

Study of the induction of some genes involved in the repair of oxidative stress

To give an answer to the synergistic effects observed for the composition of the invention, it was considered appropriate to investigate the possibility that this composition determines a variation in the expression of some factors involved in the repair of oxidative stress. As mentioned, one of the enzymes most involved in this process is glutathione peroxidase (GPx) which reduces hydrogen peroxide at the expense of glutathione. This enzyme is a selenoprotein which requires Se in its active site, incorporated in the form of selenocysteine. An exogenous supply of L-selenomethionine results in a greater availability of selenium for the synthesis of modified cysteine to be used for the synthesis of GPx.

Another important factor in cellular redox processes is glutathione. In this regard, it is known that one of the biomolecular functions attributed to lipoic acid is its ability to induce the gene transcription of γ-glutamyl cysteine ligase (GCLC), the enzyme most involved in the synthesis of glutathione. This process then results in a greater synthesis and therefore bioavailability of glutathione (Suh et al .; 2004; Jia Z et al., 2008).

A first investigation was aimed at identifying a possible synergistic activity of the combination "R-a-lipoic acid + Acetyl-L-carnitine + L-selenomethionineâ €, ie the composition of the invention without excipients, on the gene induction of GCLC and GPx Transcriptional analysis was performed by real time PCR in SK-H-SN cell and in HepG2, to exclude any epigenetic constraints that could be selectively present in the two cell contexts.

Method:

â € ¢ Cultivate HepG2 and SK-N-SH cells for 24 hours in the presence of R-a-lipoic acid (100 Î1⁄4M); acetyl-L-carnitine (60 µM); L-selenomethionine (24 nM), or the combination of the three macromolecules. {Mix: Î ± -LA (100 pM) ACar (60 pM) SeMeth (24 nM)}. The control (etri) will be represented by cells maintained in culture with EMEM + FBS 10%, enriched with DMSO 0.06%, solvent used to dilute R-a-lipoic acid and acetyl-L-carnitine.

â € ¢ Extract, purify and reverse-transcribe 1 µg of total RNA in a final 20 µl volume of reaction mix (iScript cDNA Synthesis kit, Biorad).

â € ¢ Use 10 ng of cDNA obtained as a template for the Reai Time PCR reaction. The reaction mix for a total volume of 25 µl contains 0.4 µM of each oligo (F: forward and R: reverse primers) and the iQ SYBR Green Supermix (Biorad).

Monitor β-actin for back-transcribed RNA control; moreover, this housekeeping gene, not regulated by the molecules under examination, can be used to normalize the values obtained from the analysis of the mRNA under study. For the real time PCR, the following oligo pairs were used:

GCLC; (F: 5â € ™ gtggggcgatgaggtggaatac 3â € ™; R: 5â € ™ agggtaggatggtttgggtttgtc 3â € ™) GPx: (F: 5â € ™ ggttttcatctatgagggtgttt 3â € ™; R: 5â € ™ ggatcaacaggaccagca (F: 5â € ™ ggatcaacaggaccagca) : 5â € ™ cgccgccagctcaccatg 3â € ™; R: 5â € ™ cacgatggaggggaagacgg 3â € ™). PCR conditions: 95 ° C for 3â € ™, 35 cycles at 95 ° C for 10 ", 60 ° C for 30â €. Â € ¢ Confirm the formation of a specific amp, evaluating the melting curve obtained by introducing, to PCR analysis, an additional cycle of thermal denaturation (61 cycles of 10â €, between 65 ° C and 95 ° C).

â € ¢ Perform a quantitative analysis of the results obtained using the iQ5 Optical System Software (Biorad) with the comparative method of the AACt. The value obtained for the single gene will thus be normalized with that relating to a housekeeping gene (β-actin).

â € ¢ Express the value relative to the samples treated with DMSO 0.06% as an arbitrary unit. All other values are compared to it and therefore are reported as â € œfold inductionâ €.

Result

As described in Figure 3, R-a-lipoic acid induced an induction of GCLC in both cell types, indicating that at the study concentration (concentration also tested in the study of ROS production, Example 3) it was sufficient to activate the complex mechanism for the transcription of this gene. This function was unexpectedly enhanced in case of synergistic administration of the composition of the invention. On the contrary, acetyl-L-camitine and L-selenomethionine (as a source of selenium), administered individually, did not influence, or even inhibit, the expression of GCLC. Unless there was interference in the protein translation phase, this phenomenon described a potential increase in the enzyme responsible for the synthesis of glutathione. Consequently, it is conceivable that an administration of R-a-lipoic acid, acetyl-L-carnitine and selenium, in the form of the composition of the invention, would determine a greater availability of glutathione.

Unlike GCLC, glutathione peroxidase is not a known target of lipoic acid. From the data represented in Figure 3, it was however observed that the combination of the invention was capable of weakly increasing the expression of GPx. Conversely, both acetyl-L-carnitine and selenium administered individually resulted in a decrease in GPx mRNA levels. These data relating to the effects of SeMeth are in agreement with what has been reported by other research groups (Schnabel et al .: 2008; Wu et al. 2010).

In conclusion, it was found that the combination of R-a-lipoic acid, acetyl-L-carnitine, and selenium of the invention presented an important and unexpectedly effective antioxidant activity, determined a substantial gene induction of GCLC and a moderate expression of GPx, confirming that R-a-lipoic acid, acetyl-L-carnitine and selenium operated synergistically, sheltering an obsessed stress.

Example 5.

Effects of the composition of the invention on the amount of reduced intracellular glutathione

Glutathione is a crucial factor for the detoxification of free oxygen species; it is also capable of regenerating various antioxidant systems. In its reduced form (GSH) it represents a substrate of glutathione peroxidase (GPx), directly involved in the detoxification process of hydrogen peroxide. As previously discussed, the composition of the invention involves an increase, albeit moderate, in the expression of GPx mRNA. This indication shows a greater availability of glutathione peroxidase, strengthened by the administration of L-selenomethionine, a source of selenium necessary for the synthesis of its catalytic site.

However, considering the enzymatic reaction

2 GSH H202â † ’GSSG 2 H20

glutathione peroxidase

necessary for the detoxification of H202, it follows that even an increase in GSH accelerates this process.

In this context, having ascertained that the combination of the three active ingredients of the invention induces an increase in the mRNA of GCLC, an enzyme responsible for the synthesis of glutathione (fig 4), we wanted to verify whether the decrease in reactive oxygen species triggered by H202 (fig 3) was also linked to an increase in reduced intracellular glutathione.

For this reason, under the same experimental conditions, in which it was verified that the combination of the invention (ie the composition without excipients) caused a decrease in ROS, an analysis was performed for the determination of GSH.

Method:

A colorimetric kit (ApoGSH Glutathion, Valter Occhiena) was used to detect glutathione, which exploited the glutathione regeneration system (GSH / GSSG) in the presence of the chemical substrate DTNB and the enzyme glutathione reductase. The absorbance measured at 405 nm was proportional to the content of reduced glutathione present in the cells. The obtained values (ng of GSH) were normalized with the quantities of proteins extracted in the single samples and determined by the Bradford assay.

Result

In Table 2 below and in Figure 4, the GSH values obtained in SK-N-SH cells after treatment for 24 hours with the single molecules or with the combination of the same in the form of composition of the invention are reported.

Table 2.

GSH (ngÎ1⁄4g protein) DMSO 28.6

Ref. 1 36.8

Ref. 2 28.6

Cells

SK-N-SH Ref. 3 27.7

Ref. 4 31.4 Composition of the invention 43.9

(without excipients)

Again, the combination of Ref. 4, ie R-a-lipoic acid - acetyl-L-carnitine, showed a worse result than R-a-lipoic acid alone.

Surprisingly, after treatment with the combination of the three active ingredients of the invention there was a significant increase in reduced glutathione.

From the detailed description and the Examples reported above, the advantages achieved by the antioxidant composition of the present invention are evident. In particular, this composition was surprisingly and advantageously shown to be able to enhance and increase the function of regulating gene transcription and the antioxidant capacity attributable to R-alipoic acid, thanks to the appropriate combination with acetyl-L-carnitine and selenium, surprisingly obtaining the reactivation of the mitochondrial functions compromised in case of oxidative stress and the increase of the endogenous antioxidant activity. In this context, acetyl-L-carnitine and selenium, for different reasons, in fact show a synergistic action with R-a-lipoic acid, enhancing its ability to eradicate reactive oxygen species and therefore advantageously preserving cellular functionality.

Claims (15)

CLAIMS 1. Composition consisting of 10-40% by weight of R-a-lipoic acid, 5-20% by weight of acetyl-L-carnitine, 0.001-0.002% by weight of selenium, the remainder being pharmaceutically acceptable excipients, on the total weight of the composition. 2. The composition of claim 1, consisting of 15-35% by weight of R-a-lipoic acid, 6-16% by weight of acetyl-L-carnitine, 0.0014-0.0019% by weight of selenium, the remainder being pharmaceutically acceptable excipients , on the total weight of the composition. 3. The composition of claim 2, consisting of 18-25% by weight of R-a-lipoic acid, 10-15% by weight of acetyl-L-carnitine, 0.0015-0.0019% by weight of selenium, the remainder being pharmaceutically acceptable excipients , on the total weight of the composition. 4. The composition of claim 3, consisting of 20% by weight of R-alipoic acid, 13.33% by weight of acetyl-L-carnitine, 0.0018% by weight of selenium, the remainder being pharmaceutically acceptable excipients, on the total weight of the composition . The composition of any one of claims 1-4, wherein the amount of R-a-lipoic acid is greater than the amount of acetyl-L-carnitine. The composition of any one of claims 1-5, wherein the selenium is in the form of L-selenomethionine. The composition of any one of claims 1-6, in capsule, tablet, mini-tablet, micro-tablet, granule, micro-granule, pellet, multi-particulate, or micronized particulate form. The composition of any one of claims 1-7, wherein said pharmacologically acceptable excipients are sweeteners, diluents, disaggregants, glidants, dyes, binders, lubricants, stabilizers, adsorbents, preservatives, release retardants or mixtures thereof. The antioxidant composition of any one of claims 1-8, in unit dose form comprising 300-1200 mg of R-a-lipoic acid, 150-600 mg of acetyl-L-carnitine, and 30-60 Î1⁄4g of selenium . 10. The antioxidant composition of claim 9, in unit dose form comprising 450-1050 mg of R-a-lipoic acid, 180-480 mg of acetyl-L-carnitine, and 42-57 Î1⁄4g of selenium. 11. The antioxidant composition of claim 10, in unit dose form comprising 600 mg of R-a-lipoic acid, 400 mg of acetyl-L-carnitine, and 55 µg of selenium. The composition of any one of claims 1-11 for use as a medicament. 13. The composition of any one of claims 1-11 for use in the prevention and treatment of pathologies attributable to mitochondrial decay. 14. The composition of claim 13, wherein said pathologies are neuropathies, neurodegenerative pathologies, cardiomyopathies, canicular syndromes, radiculopathies, vasculopathies and disorders of chronological aging. The composition of claim 13 or 14, wherein said prevention or treatment comprises oral administration of the composition once per day.