ITMI20091007A1 - MONITORING AND TREATMENT METHOD - Google Patents

Description

DESCRIPTION

The present invention is concerned with methods of monitoring, diagnosing and deepening the pathological state and prognosis of patients with chronic myeloid leukemia based on quantitative DNA analysis of leukemic cells. It also develops on possible treatment methods resulting from the results of this technique.

Chronic myeloid leukemia (CML also known as chronic granulocytic leukemia (CGL)) is a clonal malignant myeloproliferation that originates from a single hematopoietic stem cell. The immature granulocytic cell lines that differentiate from this cell (eosinophils, basophils and neutrophils) proliferate for months or years. The increase of leukocytes in the marrow can result in the decrease of other cell types including the erythroid lineage.

Chronic myeloid leukemia is characterized by an increase and predominantly unregulated growth of myeloid cells in the medulla and periphery. CML is characterized by the presence of the Philadelphia chromosome.

This chromosome originates from the translocation with reciprocal exchange of material between chromosome 22 and chromosome 9. In the translocation part of the BCR gene ("breakpoint cluster region") on chromosome 22 binds with the ABL gene on chromosome 9 creating a fusion gene ( often referred to as BCR-ABL). The precise melting point between chromosome 22 and chromosome 9 is unique in each patient. The new fusion gene encodes a receptor tyrosine kinase (fusion protein).

The fusion protein is generally 210 kDA while in acute lymphatic leukemia the translocation leads to a protein of 185kDA. This mutant fusion gene is constantly active at the transcriptional level (it is always on) and does not require activation by other activation proteins. The fusion gene activates a protein cascade that controls the cell cycle by accelerating cell division.

Furthermore, the protein encoded by the fusion gene inhibits DNA repair causing genomic instability and making the cell more susceptible

to further chromosomal aberrations.

This results in chronic myeloid leukemia of which three phases have been identified:

- chronic phase (the first phase)

accelerated phase (second phase)

blast crisis phase (third and last phase).

In the chronic phase, patients may be asymptomatic or have subdued symptoms such as tiredness (fatigue), loss of appetite, weight loss, increased sweating, abnormal bruising and bleeding, a feeling of fullness or swelling of the left side of the abdomen due to increased blood pressure. volume of the spleen. An enlarged spleen can cause pressure on the stomach, which leads to digestive problems and decreased appetite.

In the accelerated phase, symptoms may disappear but leukemia cells may increase.

The WHO criteria are perhaps the most widely used in the world and describe the accelerated phase with one of the following:

10-19% myeloblasts in blood or marrow '-> 20% basal in peripheral blood or marrow; Platelet count <100,000 unrelated to therapy; Platelet count> 1,000,000, unresponsive to therapy;

Cytogenetic evolution with new additional aberrations to the Philadelphia chromosome;

Increased splenomegaly or white blood cell count unresponsive to therapy.

The accelerated phase is significant because it signals that the disease is evolving towards the blast crisis. While it may not cause any symptoms, some people may develop a high temperature (fever) and night sweats.

In the blast phase, the symptoms are easily more pronounced due to the increase in the number of abnormal cells in the marrow and the low number of normal cells in the peripheral blood.

Fse blastic is characterized by:

> 20% myeloblasts or lymphoblasts in the blood or marrow;

large clusters of blasts in the medulla;

development of chloromas (solid leukemic foci outside the marrow).

Symptoms include:

recurrent infections caused by a lack of healthy white blood cells;

pale vision due to blood deficiency (anemia);

- unusual bleeding caused by a low number of platelets in my blood. This includes bruising (with no apparent cause), heavy menstruation in women, frequent bleeding from the gums and nose. Formation on the skin and in the mouth of blood-colored spots called petechiae;

- swollen lymph nodes;

skin nodules due to leukemic infiltrations;

generalized itching.

Chronic myeloid leukemia has an annual incidence in Italy of 1-1.5 / 100,000 with about 800 new cases per year. In the UK, there are 700 new cases a year. The onset is between 45 and 55 years and is rare in children under 10 years of age.

Among the diagnostic criteria, cytogenetics is relevant with bone marrow chromosome analysis and fluorescent in situ hybridization (FISH) which uses fluorescent probes to bind specific targets in the BCR-ABL region of chromosome 9 and 22. The labeled chromosome is highlighted under the microscope and the translocation identified both in metaphase and on nuclei.

Constant monitoring of the patient with chronic myeloid leukemia is essential. Cytogenetics is a labor-intensive technique and the low number of observations possible may not be representative of the general cell population.

A number of PCR kits are available to evaluate the mRNAs produced by the fusion gene. There is an assumption that the number of mRNA molecules is correctable with the cells that contain the fusion gene. However, this assumption is not necessarily correct.

Even if RT-PCR is an applicable and very sensitive technique that can be applied on a large number of cells (for example on peripheral blood) in order to have statistically significant results, it cannot give a direct measurement of the number of cells. leukemia (containing the Philadelphia chromosome). Instead it highlights only the product of these cells.

The inventor believes it is important to measure the levels of abnormal cells directly, to assess minimal residual disease (MRD).

While a qualitative comparison between mRNA and DNA kits has been analyzed, an in-depth quantitative comparison has not yet been performed.

The inventor made a quantitative comparison using the two techniques on patients with chronic myeloid leukemia undergoing treatment with the approved drug (imatinib) and proposes the following observations:

the amount of gene expression product (mRNA) of leukemic cells can vary (so there is no linear relationship between the number of cells and the mRNA produced);

the absence of mRNA produced by the fusion gene does not correspond to the eradication of the disease (for example the lack of the presence of mutant RNA molecules cannot be considered definitive as quiescent leukemic cells or leukemic progenitors do not express but potentially could in a next time); And

the absence of leukemia cells could be a good indicator that the patient is in remission.

Although it has been hypothesized that imatinib could lead to long-term remission, treating doctors do not stop treatment because many patients could have relapses. Although it is possible that 20% of patients may stop treatment because they are in remission, at the moment the techniques in use do not allow to ensure the absence of leukemia cells in patients.

This is a real problem for health authorities and patients. Firstly, from the point of view of patients, imatinib is an effective drug and has drastically improved the treatment of chronic myeloid leukemia. However, the therapy has a number of side effects that include nausea, vomiting, swelling of the face, around the eyes, diarrhea, pain and cramps in the legs, itchy rush, decreased appetite, headache and fatigue. Clearly, if the drug was not necessary, the patient could avoid side effects.

Secondly, the cost of the drug is around 28,000 pounds (GBP) per patient per year. Continuing therapy for patients who no longer need it is not a justifiable cost for a health system with an already limited budget. For this reason, it is in the interest of the patient and the health authorities to identify with certainty the patients in definitive remission who no longer need therapy.

For this, a method is provided to identify whether a patient with chronic myeloid leukemia is in remission or not in remission which includes the analysis of the amount of leukemia cells in a sample, for example of marrow or peripheral blood, taken from the patient. by directly measuring the quantity of cells that contain the Philadelphia chromosome.

The technique also allows you to monitor a patient with chronic myeloid leukemia to assess the progression and prognosis of the disease.

The method uses accurate and / or precise techniques to quantify leukemia cells. It allows you to analyze a large number of cells for each test, for example 500, 1000, 500,000, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 15 million cells or more. This allows the result of these cell population analyzes to be highly representative of the actual number of leukemia cells in the patient. It is thought that if 10 million cells are analyzed, a leukemia cell can be identified / quantized.

On the other hand, using cytogenetic techniques a maximum of 500 cells can be analyzed per sample. Therefore cytogenetics is not an accurate method for quantifying leukemic cells in the context of the present specification.

In one aspect, the present technique is focused on the identification of the BCR-ABL gene in the Philadelphia chromosome.

The method could use any of the techniques to quantize the DNA. However, Reai Time PCR is a particularly suitable technique because it is sensitive, robust and used in many laboratories around the world.

An advantage is that DNA is less sensitive to degradation, for example in PCR, than TRNA.

Having said this and assumed that the translocation that occurs between chromosome 9 and 22 is unique in each individual patient specific initiators must be identified in each patient.

To identify each patient's specific breakpoint, leukocytes are isolated from peripheral blood and then lysed. Chromosomal separation is carried out for example on a FACS Vantage ™ (BD) celi sorter equipped with two lasers that emit UV for example at 457 nM respectively at 200 mW. The chromosomal suspension is stained with H33258 and Chromomycin A. The purity of the separation is determined by several quality controls. Samples resulting from chromosomal separation are fixed on slides and hybridized with specific probes for the chromosomes under study. Depending on the separation, 95% purity can be achieved (Weier HU Genomic, 1994 Jun; 21 (3): 64l-4.). The separated chromosomes are then digested and used separately to hybridize CGH slides. The hybridizations will indicate in each patient the sequences of chromosome 9 that are adjacent to chromosome 22. The Philadelphia chromosome and its derivative hybridized on CGH slides will identify the patient's genomic break-point. A more efficient method uses a microchip designed specifically to cover only the region of interest. The advantage of this personalized DNA microchip - in addition to the cost - is that the spots will represent sequences that are only 800 bp away from each other. Initiators and probes can be drawn directly into the sequence through the break-point from chromosome 9 to chromosome 22.

The initiators and probe will remain patient specific and can then be used to monitor the number of leukemia cells during patient treatment. The technique used to monitor leukemia cells is Quantitative Real Time PCR.

As discussed above, the initiators and probe are drawn on each patient's genomic breakpoint. The reason why they are specific to each patient and why chromosomal breakage can occur in any region of the BCR and ABL introns (non-coding regions) which vary in each individual. Therefore, in one aspect, the method according to the present description comprises the step of identifying the position of the translocation for each patient and optionally preparing probes and / or initiators for the aforementioned position.

The length of the initiators is designed according to the sequences in the studio. Generally, the longer the initiators, the more specific they will be. Each initiator can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, especially 15, 16, 17, 18, 19 or 20.

Examples of some patient-specific initiators are shown in Table 1.

The quantitative analysis of the genomic anomaly allows the direct quantification of leukemic cells and ensures maximum sensitivity of the analysis.

Of course, the search for patient-specific initiators / probes takes time but once identified they can be used on the patient to monitor the entire course of the disease. It is therefore recommended to document the translocation position and / or the appropriate initiators / probes on the patient's medical record to avoid the need to repeat this work.

Furthermore, given that there are few patients with chronic myeloid leukemia and given that:

• therapy is very expensive;

• unnecessary side effects should be avoided;

· The cost of the analyzes will probably be modest;

it makes sense to invest the time needed to provide patients with this personalized characterization.

Once patient-specific initiators are identified, PCR can then be performed in a standard manner to identify and determine the amount of cells with translocation.

So, in one aspect, the quantitative analysis is a PCR analysis carried out on genomic DNA. The technique may also employ a series of restriction enzymes to cut the patient's genomic DNA obtained from peripheral blood, for example, during the onset of CML or from a bone marrow biopsy. The onset is an acute phase in which a significant number of leukemia cells are present. The digested DNA is then linked to cassettes and, subsequently, amplified with specific initiators to the cassettes, combined with homologous initiators to BCR sequences.

• In one aspect, the method can also include a PCR analysis based on mRNa. Obviously, a comparison of the analysis of leukemic cells with a quantitative analysis of the gene expression product may be useful. Suitable kits include: BCR / ABL1 Quant (RUO) Asuragen Ine Kit, an instrument that uses Multiplex Quantitative Reai Time PCR to provide simultaneous detection and quantization of BCR / AB LI fusion transcripts (b2a2, b3a2 and ela2), ABL1 (an endogenous control), and BCR / ABLIQuant Norm (an exogenous control) in a single reaction.

• The kit is based on TaqMan ® technology compatible with Reai Time ABI 7500 systems or equivalent systems. Fusion transcripts corresponding to BCR / ABL b2a2 or b3a2 are present in more than 95% of patients with CML. About 5% of children with acute lymphoblastic leukemia (ALL) and 20-35% of adults with the same disease have t (9; 22), usually ela2. This diagnostic assay provides sensitive quantization of the BCR / ABL transcript on T ^ NA extracted from peripheral blood, bone marrow aspirate, or cultured cells. BCR / ABL1 Quant is an assay that provides an assay that covers a wide range of targets with dynamic coverage and with external and internal calibrators enhanced by Asurageris Armored RNA (R) Quant (TM) (ARQ) technology. The kit includes an internal exogenous control in ARQ, BCR / ABL1 Quant Norm, to verify the efficiency of the assay and 4 external calibrators consisting of a set of BCR / ABL1, ABL1 and BCR / ABL1 Quant Norm ARQs joined together at different concentrations in order to generate 3 different standard curves. The results obtained are compatible with those with capillary electrophoresis (CE) for the subsequent determination of the type of fusion transcript (ela2, b2a2, or b3a2) by size separation.

• The assays of this description can easily be performed on a sample derived from peripheral blood, which is advantageous because it is less invasive as a sampling. Alternatively, a sample can be obtained from a patient's marrow biopsy.

• You can take blood samples every day, every week, every month, for example every 2, 3, 4, 5, 6, 7, 8, 9, 10 I l or 12 months, as needed.

· Realistically, bone marrow samples can only be taken once a year due to the invasive nature of the examination.

• The analysis of bone marrow samples can provide additional information such as the presence of abnormal stem cells (Ph +), ie undifferentiated cells found mainly in the bone.

The absence of abnormal stem cells would indicate with a high level of confidence that the patient is in remission.

• One (one) sample derived from a patient can be analyzed 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. As a result, a larger number of cells can be analyzed. In general, Panali is carried out 2, 3 or 4 times on each sample.

• The method optionally includes the analysis of the results in order to assign the patient to the category of remission or not.

"The sensitivity of the genomic analysis revealed the persistence of leukemia cells at 0.001% (Table 2.) Patients with higher levels of leukemia cells will be considered not in remission and therefore in need of further therapy. Patients in remission will usually have undetectable levels of leukemia cells.

• Thus in one aspect a treatment method is provided for a patient with chronic myeloid leukemia in which the patient is identified in remission by a method described herein which includes the step of discontinuing imatinib therapy and optionally monitoring the patient for the presence and / or quantity of leukemic cells with the DNA-based molecular technique.

• Monitoring may be as frequent as required by the treating physician as the samples analyzed may be peripheral blood and not necessarily marrow. The test could for example be daily, weekly, monthly, for example once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or once a month initially and then every 3 months or 6 months. If the treating physician is sure that remission is persistent, monitoring can be annual.

Obviously, one or more of the steps of the analysis included here can be repeated whenever necessary.

• If the patient becomes immune-depressed for any reason, for example pregnancy, monitoring should be increased or maintained at short intervals because relapse can <*> occur more easily in these circumstances.

• One aspect of this proposal provides for a kit including the components for the analysis envisaged by the invention and / or instructions for carrying out the analysis.

• In a further aspect it provides a method for diagnosing chronic myeloid leukemia which includes the quantitative analysis of the number of leukemia cells of a patient in a sample derived for example from marrow or peripheral blood by directly measuring leukemia cells, analyzing the results and assigning the patient to the category of being affected by chronic myeloid leukemia or non-chronic myeloid leukemia.

• The results shown in Table 2 seem to indicate that in the vast majority of cases, the percentage of leukemia cells in a patient with chronic myeloid leukemia, for example at onset, is as high as 60, 65, 75, 80% or more. '. These data obtained at the onset could have clinical value in assessing the possible prognosis of each patient. This numerical value also appears to be a reliable way to diagnose the disease. The method described above to identify if a patient is in remission may also be suitable for providing a method of diagnosis.

A further application of this invention provides a method of predicting the prognosis of a patient already identified as having chronic myeloid leukemia which includes quantitative analysis of a sample derived from e.g. bone marrow or peripheral blood by directly measuring the cell count with the contained breakpoint. in the Philadelphia chromosome, analyzing the results obtained and establishing whether the patient will likely progress to remission following imatinimb therapy or whether the patient will require long-term maintenance therapy.

The results in Table 2 for patient no. 1 could indicate that a low level of leukemia cells, even in the presence of high mRNA levels, could mean that the patient is well suited to imatinib therapy and therefore more likely to go into remission.

The method of the present invention can be used as a robust tool for monitoring the effectiveness of new and / or experimental treatments for types of cancer such as chronic myeloid leukemia, for example in clinical trials.

It is also believed that there may be a correlation between the amount of cells with translocation and the therapeutic posology of the drug, for example of imatinib. Thus, the patient who is not in remission from chronic myeloid leukemia but who has low levels of leukemia cells may need a lower dose of the drug, for example 200-400mg / day, for effective therapy or maintenance therapy. . A higher number of leukemia cells may instead require a higher dose, such as 600-800 mg / day. This method provides the ability to give the patient the most appropriate dose for his specific symptoms.

Thus the method provides a way of treating a patient which includes the step of accurately assessing the number of cells with translocation and then administering a drug dose, e.g. imatinib, specifically identified for the patient based on the number of leukemia cells identified.

Thus a tool is provided for the management of the disease and / or for the control and monitoring of the latter.

The methods employed above for chronic myeloid leukemia could also be used to identify and monitor translocation into other cancers, cancers, and diseases that lead to hyperfunction or additional function of a new gene. Examples of other translocations are:

Translocations - chromosome 1

t (l; 2) (p22; pl2): BCL10 and Kappa light chains; MALT lymphoma (rare).

t (l; 2) (q22-25; p23): alpha-3 and ALK tropomyosia chain; common in inflammatory myofibroblastic tumor; rare in anaplastic large cell lymphoma.

t (1; 3) (p36; q21): MELI and RPN1; myelodysplastic syndrome (rare).

t (1; 3) (p36.3; q25): unknown protein; epithelioid hematoangiothelioma.

t (1; 7) (p34, q34): LCK and TCR beta; T-ALL

t (l; 7) (ql0; pl0) unknown protein; myelodysplastic syndrome (rare).

t (l; 13) (p36; ql4): PAX7 and FKHR; alveolar rhabdomyosarcoma; variant often present in the extremities of young patients, with a better prognosis than t (2; 13).

t (1; 14) (p22; q32): BCL10 and IgH; MALT lymphoma (rare).

t (l; 14) (p32; ql 1): TAL1 / SCL and T celi receptor alpha / delta; pre-T ALL (15-30%)

t (1; 14) (q21; q32): BCL9 and IgH; preB ALL, mantle cell lymphoma.

t (1; 14) (q25; q32): LHX4 and IgH; preB ALL (rare).

t (1; 16) (p 11; p 11): unknown protein; Castelman's hyaline vascular disease.

t (l; 17) (q32; q21): bizarre osteochondromatous paraosteal proliferation.

t (l; 19) (q23; pl3.3): PBX1 and E2A; pre-B ALL (30%)

References: Mol Celi Biol 1994; 14: 3938

t (l; 22) (pl3; ql3): OTT and MAL; AML-M7 in infants.

References: Genes Chromosomes Cancer 2002: 33: 22. Blood 2002; 100: 618

t (l; 22) (p36.1; ql2): ZSG and EWS gene; Ewing's sarcoma / PNET (rare)

References: Oncogene 2000; 19: 3799

t (l; 22) (q22; ql 1): FC gamma Rllb and lambda light chain; follicular lymphoma.

References: OM1M 604590

Translocations - chromosome 2

t (2; 3) (p23; q21): ALK and TFG (fusion gene for the thrombomyosone receptor kinase (very rare).

t (2; 3) (ql3; p25): PAX8 and PPAR gamma 1; follicular thyroid carcinoma (50%), follicular adenoma (8%).

References: AJSP 2002: 26: 1016. Am J Path 2005: 167: 223

t (2; 3) (q31; q21): follicular protein; fibrous hamartoma (Archives 2005: 129: 520)

t (2; 5) (p23; q35): ALK and NPM; anaplastic large cell lymphoma (T / NK subtypes, 40-70%), inflammatory myofibroblastic tumor.

References: Blood 1989: 73: 806 (earlv reportb Blood 1996: 87: 284 (free), Mod Path 2002: 15: 931 (inflammatory myofibroblastic tumors, AJSP 2003: 27: 1473 [large B celi lymphoma with ti2; 51], more Information

t (2; 8) (pl2; q24): kappa and c-myc light chains; Burkitt's lymphoma (15%); rarely mantle cell lymphoma.

References: more Information, Mod Path 2002: 15: 1266 (mantle celi lymphoma)

t (2.8) (pl2-16; q24): REL and diffuse large cell lymphoma.

References: Blood 2004: 103: 1862

t (2; 10) (p23; q24): unknown protein; a case report with sclerosing perineuroma (AJSP 2005; 29: 1164).

t (2; l I) (q31-32; ql2): described in the fibroma of the tendon sheath. (Histopathology 1998; 32: 433) and desmoplastic fibroblasoma / collagen fibroma (Canee r Genet Cytogenet 2004; 149: 16 11

t (2; 13) (q35; ql4): PAX3 and FKHR; rhabdomy alveolar sarcoma References: Genes Chromosomes Cancer 1995; 12: 186.

Am J Path 1995: 146: 626. AJSP 2002: 26: 938,

t (2; 14) (pl3; q32): BCL1 1A and IgH; rare in CLL, ALL or AML References: Leukemia 2002: 16: 937, Blood 2001: 98: 3413 ffree). Leuk Lymphoma 2002: 43: 2063 (case report),

t {2; 17) (p23; q23): ALK and CLTC; inflammatory myofibroblastic tumor (very rare).

References: Am J Path 2001: 159: 411 (freeL.Mod Path 2003: 16: 828,

t (2; 18) (pl 1-I2; q21): kappa and BCL2 light chains; CLL / SLL (<5%), follicular lymphoma (<5%)

References: Leuk Lymphoma 1992: 8: 197. Oncogene 1992: 7: 573. Br J Haematol 1991: 78: 132

t (2; 19) (p23; pl3. 1): ALK and TPM4; inflammatory myofibroblastic tumor.

References: Am J Path 2000: 157: 377 ffreel.

t (2; 22) (q33; ql2): FEV and EWS; Ewing / PNET sarcoma (rare) References: Oncogene 1997: 14: 1159

Translocations - chromosome 3

t (3; 5) (q25; q34-35): MLF1 and NPM; myelodysplastic syndrome, acute myeloid leukemia with multi-clonal dysplasia.

References: Hum Path 2003; 34: 809 [AML and myelodysplasiat. Leukemia 2000; 14: 1757,

t (3; 8) (p21; ql2): CTNNB1 and PLAGI; pleomorphic adenoma of the salivary glands.

References: Mod Path 2005: 18: 1048. Nat Genet 1997: 15: 170

t (3; 12) (q27; ql4-15): HMGA2 and LPP; lipoma, pulmonary chondroid hamartoma (Genes Chromosomes Cancer 1998: 22: 100). soft tissue chondroma.

References: Mod Path 2003: 16: 1132 (chondroma), t (3; 14) (q27; q32): BCL6 and IgH; diffuse large cell lymphoma (30%), follicular lymphoma (10%); nodular predominantly Hodgkin's lymphoma (J Mol Diagn 2Q05; 7: 352)

t (3; 21) (q26; q22): EVI1 and AML1; CML and myelodysplastic syndrome

References: Oncogene 2004: 23: 4263.

Translocations - chromosome 4

t (4; 1 I) (q21; q23): AF4 and ALL1 / MLL; preB ALL (10%), post treatment. ALL (Ann Hematol 1992: 65: 143). rare AML M4 / M5

References: Blood 2005: 105: 3434,

t (4; 14) (pl6; q32): FGFR3 and IgH; multiple myeloma (20-30%).

References: Blood 2005; 105: 4060, Clin Cancer Res 2004: 10: 5692.

Translocations - chromosome 5

t (5; 9) (q31; p24): IL3 and JAK2 genes; clinical case of ALL with eosinophilia (Archives 2003: 127: 601)

References: IL3 Information

t (5; 12) (q33; pl3): PDGFRB and ETV6; chronic myelomonocytic leukemia with eosinophilia.

References: Acta Haematol 2002: 107: 113.

t (5; 14) (q31; q32): IL3 and IgH; preB ALL with peripheral eosinophilia.

Translocations - chromosome 6

t (6; 9) (p23; q34): DEK and CAN; AML (1%), myelodysplastic syndrome (rare).

References: Leukemia 2005: 19: 1338, AJCP 1997: 107: 430.

Blood 1992: 79: 2990 Ifree).

t (6; 9) (q21-25; p 13-24): cystic adenoid carcinoma.

References: Enr J Orai Sci 2004: 112: 545. Genes Chromosomes Cancer 2001: 30: 161

t (6; 1 I) (p21; ql2-13); TFEB and Alpha; renal neoplasm in children and young adults.

References: AJSP 2005: 29: 230. Proc Nati Acad Sci USA 2003: 100: 6051 [ire eh Hum Mol Genet 2003: 12: 1661 (freel. More Information, OMIM 600744

t (6; 12) (q23; ql5): HMGA2 / HMGIC; Castleman's hyaline vascular disease.

References: AJSP 2002: 26: 662

t (6; 14) (p21.1; q32.3); cyclin D3 and IgH; gastrointestinal tumors stromal, multiple myelosa (4%), diffuse large B cell lymphoma

References: Mod Path 2003: 16: 886 IGISTL

t (6; 14) (p25; q32): MUM / IRF4 and IgH; multiple myeloma (20%) References: Leiikemia 1999; 13: 1812

Translocations - chromosome 7

t (7; 9) (q34; q34.3): TCR beta and TAN1 / NOTCH1; T-ALL (rare, but aberrations in the NOTCH1 signal are common).

References: Cell 1991; 66: 649. Cancer Lett 2005: 219: 113,

t (7; 16) (q34; pl 1): unknown protein; low-grade fibromyxoid sarcoma, hyalinizing elongated cell tumor with giant rosettes.

References: AJSP 2003: 27: 1229, Archives 2000: 124: 1179

t (7; 17) (pl5; q21): JAZF1 and JJAZ1; stremal endometrial sarcoma (50-80%).

References: AJSP 2004: 28: 224. Proc Nati Acad Sci USA 2001: 98: 6348 ffree), Cancer Genet Cytogenet 2003; 144: 119 »J Mol Diagn 2005: 7: 388, QMIM 606246

t (7; 19) (q34-35; pl3): TCR beta and LYL1; T-ALL

References: Mol Celi Biol 1996: 16: 23941,

t (7; 22) (p22; ql2): ETV1 and EWS; Ewing's sarcoma / PNET (rare) Reference: QMIM 600541 -ETVT. Cancer Res 2000: 60: 1536

Translocations - chromosome 8

t (8; 9) (q24; pl3): c-myc and B-ALL (Archives 2003: 1 27: 6 10-case reportl

t (8; 13) (pl l-12; q11-12): FGFR1 and ZNF198; T-cell lymphoblastic lymphoma, myeloproliferative disease.

References: Nat Genet 1998; 18: 84, Acta Haematol 2002: 107: 101.

t (8; 14) (q24; q32.3): c-myc and IgH; Burkitt's lymphoma (75%), ALL-L3 (6%); rarely mantle cell lymphoma.

References: AJSP 2003; 27: 818 (Burkitt's in transplant recipient). Mod Path 2002; 15: 1266 Imantle celi lymphomal, Leukemia 2003; 17: 585.

t (8; 21) (q22; q22): ETO and AML1; AML-M2 (10%) with Auer's rods, granulocytic sarcoma.

References: Nat Med 2002: 8: 743 ffree). Proc Nati Acad Sci USA 2005; 102: 4016

t (8; 22) (q24; ql 1): c-myc and lambda light chains; Burkitt's lymphoma (10%)

Translocations - chromosome 9

t (9; 11) (p22; q23): AF9 and MLL / ALL1; AML-M5a and M4; AML associated therapy; rarely ALL fGenes Chromosomes Cancer 1991: 3: 74)

References: Hum Mol Genet 2000: 9: 1671 ffree),

t (9; 14) (pl3; q32): PAX5 and IgH; lymphoplasmacytic lymphoma (0-50%), diffuse large cell lymphoma and other B lymphoproliferative diseases.

References: Blood. 1996: 88: 4110 ffree). Genes Chromosomes Cancer 2005: 44: 218, Hum Path 2004: 35: 447 fnot characteristic for lymphoplasmacytic lymphoma), Leuk Lymphoma 2000: 36: 435,

t (9; 15) (q22; ql 1-q21): TEC / CHN and TCF12; extra skeletal myxoid chondrosarcoma.

References: Am J Path 2003: 162: 781 | freeì. Cancer Res 2000: 60: 6832

t (9; 17) (q22; q 11-12): TEC / CHN and TAF2N / RBP56; myxoid chondrosarcoma [variant of t (9; 22)]

References: Cancer Res 1999: 59: 5064 (freel. Am J Path 2003: 162: 781 ffree). Hum Path 2001: 32: 1116, Oncogene 1999: 18: 7594, AJSP 2000: 24: 1020. TAF2N

t (9; 22) (q22-31; ql 1- 12): TEC / CHN and EWS; extra skeletal myxoid chondrosarcoma. References: Mod Path 1995: 8: 765.

Cytopathology 1991; 2: 261, Genes Chromosomes Cancer 2002: 35: 340

t (9; 22) (q34; ql 1): c-abl and ber (Philadelphia chromosome); CML (100%), preB ALL (5% in, 25% in adults), AML

References: Mayo Clin Proc 2005: 80: 390, Clin Lab Sci 2005: 18: 38. more information (CML).

Translocations - chromosome 10

t (10; 14) (q24; ql 1): HOX11 and T delta receptor; preT-ALL (5-10%)

References: Proc Rati Acad Sci USA 1990: 87: 3161 (freel.

Leuk Lymphoma 1995: 16: 209,

t (10; 14) (q24; q32): NFKB-2 / LYT10 and IgH; low-grade non-Hodgkin's lymphoma. References: Cell 1991,67: 1075. OMIM 164012 (NFKB-2)

Translocations - chromosome 1 1

t (l 1; 1 1) (q23; q23): MLL / ALL1 (auto-fusion); AML (frequent), ALL (10% involved in rearrangements l lq23, less involved in autofusion. References: Proc Nati Acad Sci USA 1998: 95: 2390 [freel, Leuk Res 2005; 29: 517, Blood 1996; 87: 2496 Ifree ), Cancer Res 1997: 57: 117. MLL info

t (l l; 14) (pl3; ql 1): rhombotin 2 (TTg-2, RBTN2) and antigen receptor T alpha / delta; T-ALL (5% of cases in children)

References: Leukemia 1995: 9: 1812.

t (l 1; 14) (pl5; ql 1): rhombotin 1 (TTg-1 / LMOl) and TCR alpha / delta; T-ALL (<1%)

References: Mol Celi Biol 1989: 9: 2124 [freeh

t (11; 14) (ql 3; q32): BCL1 / cyclin DI and IgH; Mantle cell lymphoma (90%), B prolymphocytic leukemia (20%, may represent mantle cell variants, Br J Haematoi 2004: 125: 330), spleen lymphoma (10%), CLL (2- 5%), myeloma (2-5%, Blood 1996: 88: 674 (freel)

References: Archives 1999: 123: 1 182, Hum Path 2002: 33: 7. more Information

t (l I; 17) (q23; q21): PLZF and alpha receptor for retinoic acid; AML M3 variant (rare)

References: Semin Hematol 2001: 38: 37. Proc Nati Acad Sci USA 1997: 94: 10255 (freel. More information-translocation, PLZF

t {l I; 18) (q21; q21): API2 and MALTI; MALT lymphoma (50%); Diffuse large B cell lymphoma

References: Mod Path 2003: 16: 1232 (colorectal lymphomash Int J Hematol 2005; 82: 59 fcytologic specimensl t (l 1; 19) (q23; pl3): ALL1 and ELL; AML, often M4 / M5; also M1 / M2 , related to therapy.

References: Proc Nati Acad Sci USA 1994: 91: 12110 Ifree), Cancer Genet Cytogenet 2001; 129: 17 (case report |

t (l I; 22) (pl3; ql2): WT1 and EWS; small round cell desmoplastic tumor.

References: AJSP 2002: 26: 823, Archives 2002: 126: 1226 (moons tumors [correction at Archives 2003; 127: 782], Mod Path 2002: 15: 673 (hard tumors, AJSP 1992: 16: 411 , Semin Cancer Biol 2005: 15: 197

t (l I; 22) (q24; ql2): FUI and EWS; Ewing's sarcoma / PNET (90% of cases)

References: Adv Anat Pathol 2005: 12: 212, Cancer Res 2005: 65: 4633

Translocations - chromosome 12

12q-: myelodysplastic syndrome, germ cell tumor.

References: Archives 2005: 129: 1299. Cancer Genet Cytogenet 1995: 80: 158

12: trisomy: CLL / SLL (10-30%). tumor of the ovarian granulosa.

References: Blood 1993; 82: 571 (freel. J Clin Oncol 1984: 2: 1121. More Information

i (12p): associated with intratubular germ cell neoplasm, germ cell tumors.

References: Mod Path 2005; 18 Suppl 2: S51. APMIS 2003: 111: 161

t (12; 14) (ql4-15; q23-24): HMGA2 / HMGIC; malignant and benign smooth muscle tumors, lipomas, pleomorphic adenoma of the salivary glands, hamartoma, pulmonary chondroid.

References: Cancer Genet Cytogenet 1988: 32: 13 (uterine leiomy omasi. Cancer Genet Cytogenet 2002: 138: 50 Ivarious smooth muscle tumorsj. Mod Path 2002: 15: 351 fintravenous le iomyomatosisl, more information-HMGA2

t (12; 15) (pl3; q25): ETV6 and NTRK3; infantile (congenital) fibrosarcoma, mesoblastic cellular nephroma, secretory carcinoma of the breast (Genes Chromosomes Cancer 2004: 40: 152). AML (Blood 1999: 93: 1355 f freel. Case report)

References: Mod Path 2000: 13: 29. Mod Path 2001: 14: 1246. AJSP 2000: 24: 937. Nat Genet 1998: 18: 184. Pathol Res Pract 2003: 199: 35. Hum Path 2003: 34: 1299 Isecretory carcinoma), more Information (se ere tory carcinoma!

t (12; 16) (ql3; pl 1): CHOP and TLS; myxoid and round cell liposarcoma rarely epithelioid variant of pleomorphic liposarcoma fHistopathology 2005: 46: 3341

References: J Mol Diagn 20Q0; 2: 132 ifreeì. Semin Diagn Path 2001; 18: 267 Ireview), more information-TLS, more information-CHOP / DDIT3

t (12; 2 1) (pl2-13; q22): TEL / ETV6 and AML1 / CBFA2; preB ALL (20%)

References: Curr Opin Hematol 20Q2; 9: 345, Diagn Mol Path 2000: 9: 184, more Information

t (12; 22) (p 13; ql 1-12): TEL / ETV6 and MN1; AML References: Mol Celi Biol 2000: 20: 9281 ffreel. more Information, MNl-more Information, ETV6-more Information

t (12; 22) (ql3; ql2): CHOP and EWS; myxoid liposarcoma (rare). References: J Mol Diagn 2002: 4: 164 [freel, Clin Cancer Res 2000: 6: 2788 (freel, more information-CHOP / DDIT3

t (12; 22) (ql3; ql2): ATF1 and EWS; clear cell soft tissue sarcoma. (> 95%)

References: J Mol Diagn 2002; 4:44 I freel. more information-clear celi sarcoma of soft parte, moreInformation ATF1

Translocations - chromosome 13

der (13; 2 l) (qlO; qlO): unknown protein; mesenchymal chondrosarcoma. References: Mod Path 2002; 15: 572

Translocations - chromosome 14

t (14; 15) (q32; ql 1-13): IgH and BCL8; diffuse large cell lymphoma. (4%)

References: Proc Nati Acad Sci USA 1997: 94: 5728

t (14; 16) (q32; q23): IgH and c-maf myeloma; multiple myelose

(10%)

References: Blood 1998; 9 1: 4457

t (14; 18) (q32; q21): IgH and BCL2; follicular lymphoma (90%); secondary and non-primary cutaneous follicular lymphoma, diffuse large cell lymphoma. (30%, probably of central follicle origin), rarely CLL (Archives 2005: 129: 410)

References: Am J Path 2002; 160: 759 (free. Follicular lymphoma), AJSP 2003; 27: 356 Icutaneous diffuse large B celi lymphomaì, Archives 2003: 127: 610 (B-ALL1. Archives 2002; 126: 1543 [CLLL Archives 2002; 126: 902 fqualitv controll ,

t (14; 18) (q32; q21): IgH and MALTI; MALT lymphomas (20%)

References: Blood 2003: 101: 2335 (freel

t (14; 19) (q32; ql3): IgH and BCL3; CLL / SLL (5%) References: Leuk Lymphoma 2002: 43: 813. Genes Chromosomes Cancer _ 1997: 20: 64, http: / / www.infobiogen. fr / Services / chromcancer / Anomalies / 114191D20 50.html

Translocations - chromosome 15

t (15; 17) (q22; ql2-21): PML and alpha receptors for retinoic acid; AML-M3 (acute promyelocytic leukemia)

References: Acta Haematol 2004 ;! 12:55. Curr Oncol Rep 2003: 5: 391,

Translocations - chromosome 16

t (16; 17) (q22; pl3): CDH11 and USP6; aneurysmal cyst of the bone.

References: Cancer Res 2004: 64: 1920 (free), Genes Chromosomes Cancer 1999: 26: 265

t (16; 22); (q23; ql 1): c-maf and Ig lambda; multiple myeloma.

References: Blood 1998: 91: 4457

Translocations - chromosome 17

t (17; 17) (pl3; ql2): USP6 and COLI Al; aneurysmal cyst of bone and soft tissue.

References: AJSP 2002: 26: 64, Oncogene 2005: 24: 3419

t (17; 22) (ql2; ql2): E1AF and EWS; Ewing's sarcoma / PNET (rare)

References: Cancer Lett 2004: 216: 1, Jpn J Cancer Res 1998: 89: 703

t (17; 22) (q21-22; ql3) related ring chromosomes: COL1A1 and PDGF beta; protuberant dermatofibrosarcoma, giant cell fibrosarcoma.

References: Oncogene 2001: 20: 2965, AJSP 2003: 27: 27, more information-PDGF beta

Translocations - chromosome 18

t (18; 22) (q21; q21): lambda light chains (22ql l) and BCL2 (18q21); <5% of CLL / SLL

References: Genes Chromosomes Cancer 1993: 6: 39.

Genes Chromosomes Cancer 1991; 3: 205, Leukemia 1996: 10: 970.

Translocations - chromosome 20

20q-: myelodysplastic syndrome, myeloproliferative disorder, AML, myelomas (occasional), Genes Chromosomes Cancer 2004: 41: 223)

References: Cancer Genet Cvtogenet 2005: 160: 188.

20: trisomy associated with desmoid fibromatosis (Am J Path 1999: 154: 729 Ifreel. Int J Cancer 1995: 63: 527), patients at risk of lung cancer. (Cancer Epidemiol Biomar kers Prev 1998: 7: 10511

Translocations - chromosome 21

t (21; 22) (q22; ql2): ERG and EWS; Ewing's sarcoma / PNET (5-10%), round cell desmoplastic tumor (rare), AJSP 1998; 22: 10261 References: Nat Genet 1994; 6: 146, J Clin Oncol 1999: 17: 1809

Translocations - chromosome 22

t (22; 22) (ql3; ql 1): ber; variant of the Philadelphia CML chromosome

References: Leuk Res 1986: 10: 1131, Blut 1989: 58: 279

Translocations - X chromosome

t (X; l) (pl 1.2; q2 1.2): TFE3 and PRCC; renal cell subtype.

References: AJSP 2002: 26: 1553,

t (X; 2) (ql 1; p23): MSN and ALK; anaplastic large cell lymphoma (very rare).

t (X; 6): subequal exostosis; case report of AML-M7, premature ovarian failure, females with Duchenne muscular dystrophy.

References: AJSP 2004: 28: 1033

t (X; 17) (pl l.2; q25): TFE3 and ASPL; infantile renal cell carcinoma, alveolar soft tissue sarcoma.

References: AJSP 20Q3; 27: 75Q

t (X; 18) (pl 1.2; ql 1.2): SYT and SSX1 or SSX2, rarely SSX4; synovial sarcoma (> 90%), other tumors.

Thus in one aspect the present invention provides a method for diagnosing or monitoring a tumor, type of cancer or disease resulting from a hyperfunction produced by a cell with a translocation, which includes the step of identifying and / or quantizing directly the cell with the translocation, not employing cytogenetics to identify the translocation that generates the Philadelphia chromosome.

The methods and procedures described above in relation to chronic myeloid leukemia apply equally to other types of cancers, cancers and translocated diseases.

Examples

Patients and BCR-ABL breakpoint sequencing We monitored 8 patients with chronic myoloid leukemia in the early phase for a mean period of 26 months (range 12 to 42). All participants gave written informed consent. Genomic junctions of BCR-ABL had been characterized in Mattarucchì et al. (Mattarucchi). Briefly, DNA from patients designated 1, 2, 3, 4, 6, 8, 9, and 10 was extracted from blood or marrow, then fragmented, ligated to adapters, and amplified by nested PCR using an initiator. BCR specific forward. Thus, the genomic break-points were sequenced. The majority of patients underwent IM monotherapy at an initial dose of 400 mg / day, except patient 9 who participated in a trial of 800 mg / day. The dose for patients 6 and 10 was increased to 600 mg / day as a result of suboptimal cytogenetic results at 12 and 6 months, respectively.

Cytogenetics and molecular monitoring

A bone marrow cytogenetic analysis was performed (approximately 20 metaphases for each patient) before using conventional staining. Cytogenetic tests were repeated every 6 months until a complete reaction was achieved. Then marrow metaphases were analyzed less frequently. BCR-ABL mRNA levels were measured at the time of diagnosis and approximately every 3 months. The molecular investigation was completed by the reference laboratory of the Italian group for CML part of the Italian group of malignant hematological diseases in adults (GIMEMA) at the hospital in Bergamo, Italy. All analytical procedures are subject to quality control in accordance with the accreditation of the ISO 9001: 2000 laboratory. The quantitative PCR proposed by the EAC was adopted and the results were reported as the ratio between the number of BCR-ABL transcripts and those of ABL with the ratio expressed as a percentage (BCR-ABL / ABL) (Gabert Beillard). The number of transcript copies was calculated using plasmid calibrators purchased from Ipsogen (Marseille, France). All kits (Qiagen, Hilden, Germany) were used for the extraction of mRNA from blood and bone marrow aspirate previously treated with HetaSept gradient (Stem Celi Technologies, Vancouver, Canada) to eliminate 1 red blood cells and precursors.

Patient-specific genomic analyzes

For each patient an assay was designed on the basis of their BCR-ABL sequences. Each assay includes two reactions one directed to the breakpoint sequences (one copy per leukemic cell) and a second directed against the BCR used as control (one copy for leukemia cells and two for normal cells). Thus the percentage of leukemic cells (CL) was calculated using the following formula: CL = 100 x (2 / (2ACt 1)) where the delta et is the difference between the BCR-ABL and BCR amplification cycles. The "forward" initiator and the probe common to the two reactions (Table 1) have been used so that the two reactions have similar efficiency (for example> 90%). In addition, the assays were tested to ensure high sensitivity (at least 10-5 starting from 300 ng) and the absence of false positives after 45 cycles. The DNA was extracted with the All-Prep DNA / RNA kit from the same samples used for mRNA monitoring described above. The reaction mixture contained: 12.5 ul of TaqMan® Universal PCR MasterMix (Appliedbiosystems, Foster City, CA, USA); 900 nM of each initiator; 200 uM of probe; DNA from 100 ng to 300 ng depending on availability; H20 until reaching a total volume of 25 ul. The POR program is as follows: 2 minutes at 50 C followed by 10 minutes at 95 C and 45 amplification cycles (95 ° C for 15 seconds and 60 ° C for 60 seconds). The reactions were prepared and run in triplicate on ABI Prism 7000 SDS (Appliedbiosystems) and each experiment was repeated and confirmed twice.

Table 1. Sequences of initiators and probes. Identity

Patient

1 F 5'- CTGCTGCrGGGTGGTTGA-3 '

Ph-R 5 <'> - G G ΑΤΠΤΑ U TCCTTA CTTGTTTTCTA TTTC AC -3 <'> wt-R 5 '-GCCAGAl CCAAGGCACAGA-3 <'>

Probe 6-FAM-AGATGCACGGCTTC-MGB

2 F 5 '- CCCCCTTCCTGTTAGCACTTT -3'

Ph-R 5 '- GCTGC A A CAGT AC AA A C AG T AACCC -3' wt-R 5 '- CCC'J AACAAGC ATAGCTCTTCCTT -3 <'>

Probe 6-FAM- Al GGG ACTAGTGG ACTTT -MGB

3 F 5'- GCCCTCCTCTCCTCC AGCT A -3 '

Ph-R 5'- A A GCCTCTGGCGTG TTTCC -3 '

wt-R 5 <'> - TGAGCATA TGTGCAACAGTUAATG -3

Probe 6-FAM- CACTTT'IGGTCAAGCTG -MGB

4 F 5'-TGGGACTAGTGGACTTTGGTTCA -3 <'>

Ph-R 5 '-GTGCATGATCATCACTAGTTAAAA ΓΟΤΛΑΑ -3' wt-R S'-CTAACCCACClTGrCCACTCCT -3 <'>

Probe 6-FAM-ACAAG AGGCCCT A ACAA -MGB

6 5 <'> - CACAGC AT ACGCT ATGCACATGT -3'

Ph-R 5 '-GGG AAA A AA TGTTTTCTCCTTATATCG -3' wt-R5 <'> - ATAAGGT3'CCAAGGACAGCAGAG -3 <'>

Probe 6-FAM-ACACACACCCCACCC -MGB

8 F 5'-TGCTCTGTGCCTTGGATCTG -3 '

Ph-R 5 1TCGGTGTAAAATCCTTCCATACTTT -3 <'> wt-R 5'-TGCAAAACAGCrFGACCAAAA -3'

Probe 6-FAM-CCCCACTCCCG I CCT -MGB

9 F 5 <'> - TT GTCACCT GCC TCCCTJ Ί <'> C -3 '

Ph-R 5 - TG AAC TCCTG ACCTC ΑΛ GTG ATCT -3

vvt-R 5'- GAGCCCCGGAGACTCATCA -3 '

Probe 6-FAM- CGGGACAACAGAAGC -MGB

10 F 5 CACTGGTT I GCCTGTATTGTGA A -3 '

PK-R 5 - GGACACACAGGGAACTACACTGC -3 '

wt-R 5'- TGGGCCAAAAACATACTCATCA -3 <*>

Probe 6-FAM- TCCTGAGATCCCC -MGB

PR1 F 5'-CCGCTGACCATCAATAAGGAA-3 '

Ph-R 5 <'> - TGCCACGCCTTC TC TTCTG -3'

wt-R 5 CAAAGTCCACTAGTCCCATC ΑΛΑΑ -3 <’>

Probe 6-FAM-rrTCCGTGTACAGGGCA-MGB

PR2 F 5'- TTTTGGTCAAGCTGTFTTGC A-3 '

Ph-R 5'- GGCACCAGAAGCTGAGTGAAG-3 <'>

wt-R 5'- ACACATG TGCATAGCGTATGCTG -3 <1>

Probe 6-FAM- TG fTGCACATATGCTC-MGB

For each specific patient assay, the initiators are designed as follows: F, common forward initiator; Ph-R, “reverse” initiator for specific amplification of BCR-ABL sequences; wt-R, “reverse” initiator for BCR amplification selection.

Table 2. Residual disease levels (%) measured simultaneously with DNA and mRNA analysis.

In each patient row, the results are reported as follows: top, percentage of BCR-ABL / ABL mRNA; below, percentage of leukemia cells. The early results are approximated to unity. -, Data not available; UND, undetectable levels; *, bone marrow samples; †, peripheral blood samples.

Claims (9)

CLAIMS 1. A method of identifying whether a patient with chronic myeloid leukemia is in remission or not in remission which includes the analysis of the amount of leukemia cells present in the patient in a sample such as bone marrow or blood, by directly measuring the amount of cells with the genomic break-point that generates the Philadelphia chromasome. 2. A method to check the trend of chronic myeloid leukemia is to evaluate the number of leukemia cells, from a sample from the patient, containing the genomic break-point. 3. A method for managing the disease which includes the steps of: • Quantitative analysis of the number of leukemia cells in a patient from a bone marrow or blood sample, directly measuring the amount of cells containing the genomic break-point that generates the Philadelphia chromasome, and • Discontinue therapy in a patient in whom zero leukemia cells are identified, and / or • Optionally modulate the dose of medication administered to a patient not in remission, so that it is related to the level of leukemia cells identified. 4. A method to measure the number of leukemia cells, for example at onset, in order to have an indication of the prognosis of the disease which includes the step of measuring the quantity of cells containing the genomic break-point that generates a fusion gene in a sample taken from the patient. 5. A method to precisely evaluate the reaction of leukemia cells to a drug against, for example, chronic myeloid leukemia which includes the step of directly measuring the quantity of cells containing the genomic break-point that generates a fusion gene in a sample taken from the patient. 6. A method according to any one of claims 1 to 5 in which the genomic DNA is quantitatively measured. A method according to any one of claims 1 to 6 wherein RT-PCR is employed in the quantification. A method according to claim 7 wherein RT-PCR employs patient specific initiators. A method according to claim 8 wherein the initiators are designed based on the patient's introns.