IT202000027489A1 - Selective activators of peroxisome proliferator-activated receptors (PPARs) for the treatment of vitiligo - Google Patents

Description

Selective activators

of peroxisome proliferator-activated receptors (PPARs) for the treatment of vitiligo

The present invention relates to selective activators of peroxisome proliferator-activated receptors (PPARs) for the treatment of vitiligo. In particular, the present invention relates to selective activators of receptors ? activated by peroxisome proliferators (PPAR?), for the treatment of vitiligo, such as non-segmental vitiligo.

Vitiligo? an acquired chronic depigmentation disorder of the skin resulting from the selective loss of melanocytes. In accordance with the widespread opinion at an international level, ? classified into three main forms, namely, non-segmental (or simply, vitiligo), segmental and mixed vitiligo (10;16). Non-segmental vitiligo, the most? common form of this unpredictable pathology, ? characterized by the presence of symmetrical and bilateral white patches. Lesions are typically subdivided into an acrofacial pattern (hands and feet, periorificial involvement of the face) or symmetrically disseminated throughout the body. The hairs present in the skin area involved initially remain pigmented but after a prolonged period it can become develop leukotrichia (hair bleaching).

Several clinical subtypes have been described, including the generalized, acrofacial, and universal forms, all with a bilateral distribution. In general, the basis for the diagnosis remains the progressive patchy loss of pigmentation of the skin, overlying hairs, and sometimes the mucosa. The involvement of non-cutaneous melanocytes, such as ocular and cochlear, is controversial (9;16).

Among the depigmenting pathologies, vitiligo? the "P? common. The estimated prevalence? 0.5% to 2% of the global population but peaks up to 8.8% have been recorded in India, probably related to the inclusion of chemically induced depigmentations. The differences in the classification of the pathology, the lack of simple laboratory tests, the variety of ethnicity of the population and the poor reporting by patients can determine the variability? of epidemiological data. Most cases of non-segmental vitiligo ? sporadic. Between 15% and 20% of patients have one or more first-degree relatives with vitiligo. Adults and children of both sexes are equally involved. The prevalence increases with age. The pathology generally manifests itself in young subjects, in an?age? between 10 and 30 years even if pu? develop at any age. Segmental Vitiligo tends to appear more? early, before the age of 30 in 87% of cases and before the age of 10 in 41.3% (10).

The characteristic of vitiligo ? the loss of functional melanocytes and, even if the mechanisms involved are not fully defined, from a pathogenetic point of view oxidative stress, the production of inflammatory mediators, cell detachment and an autoimmune response have been considered pathogenetically relevant (5;19) . In the last few years, ? been proposed a unitary pathogenetic theory that identifies as ?primum movens? an intrinsic defect of melanocytes. According to this model, oxidative stress in melanocytes induces a local inflammatory reaction with the activation of the immune system. which leads, in genetically predisposed subjects, to the induction of a cytotoxic immune response against melanocytes. The loss of melanocytes ? also the consequence of various processes, such as attack by the immune system or cell detachment with consequent degeneration (21). The role of the immune system? undoubtedly relevant, as demonstrated by the presence of antibodies directed against melanocytes, the association with some polymorphisms in loci associated with immunity, the presence of a conspicuous perilesional inflammatory infiltrate of T cells and the association with other autoimmune diseases. The first event? probably the? activation of? immunity? innate through the activation of pattern recognition receptors (PRR) which represent a family of receptors specialized in the recognition of patterns characteristic of numerous pathogenic species (the so-called PAMPs ? associated pathogenic molecular patterns). The relevance of? immunity? adaptive ? demonstrated both by genetic studies, which have highlighted the association of vitiligo with polymorphisms for genes that code for the major histocompatibility complexes? (MHC) of classes I and II and by the constant presence of CD4+ and CD8+ T cells at the margins of areas with active depigmentation.

The fundamental role in the loss of melanocytes ? played by CD8+ T cells that are more? numerous in the skin of patients with active disease than in normal subjects and in patients with stable disease. Do these cells produce IFN? and TNF?. CD8+ cells specific for melanocyte antigens such as MelanA / MART-1, gp100 and tyrosinase, were detected in both peripheral blood and perilesional areas. CD8+ cells, or cytotoxic T lymphocytes (CTLs), can lead to cell death through two distinct mechanisms: the release of cytotoxic molecules, such as granzyma B and perforin, and the FasL / Fas pathway, which induces cell apoptosis target. CD8+ cells in the periwound skin areas of subjects with vitiligo can recognize melanocyte antigens, express granzyma B and the proinflammatory cytokines IFN?, TNF?, and IL-17. L?IFN? plays a fundamental role in the local recruitment of these cells through the expression of CXCR3 and its ligands CXCL9 and CXCL10, attracting circulating CTL. (1) Resident T cells, a subset of cells expressing cutaneous lymphocyte antigen (CLA) and CCR4, characterized by the memory phenotype (?resident memory cells? ? TRM), are located in the basal layer of the epidermis (21). Among the signals necessary for their survival, an important role is played by performed by IL-15, produced by keratinocytes. Upon stimulation by antigens and/or other inflammatory stimuli, TRM cells undergo reactivation and recruit circulating CD8 T cells to clear melanocytes. Subsequently ? activated a feedback mechanism that maintains the pathology. The IL-15? It has now been identified as a therapeutic target for molecules that inhibit the cytokine and subsequently lead to the regression of vitiligo by reducing the number of TRM cells and their activities. The melanocytes from apparently healthy skin of patients with vitiligo show various metabolic defects that lead to the alteration of the activity of neutralization of free radicals making it more? difficult for cells to adapt to external stresses. An increase in the level of reactive oxygen species (ROS)? been demonstrated in vivo, in lesional and non-lesional areas and in vitro in melanocytes obtained from pigmented skin, in association with alterations of antioxidant mechanisms (16;3). The imbalance of pro and antioxidant status ? responsible for the increased susceptibility? to external stresses and probably to the premature senescence of the skin characterized by the production of different proteins of the so-called senescence-associated secretory phenotype (SASP)(3). Furthermore, the increased intracellular oxidative stress? also responsible for the accumulation of immature proteins, caused by damage to the endoplasmic reticulum, and the consequent activation of the so-called "unfolded protein response" (UPR). Recent works have reported that some of the alterations are not exclusive to melanocytes and are also present in other skin cells obtained from non-lesional areas, suggesting that vitiligo leads to a generalized degeneration of the skin (2). Fibroblasts exhibit oxidative stress, p38 phosphorylation, p53 overexpression and a senescent phenotype. These modifications are at the basis of an altered secretion of soluble growth factors which contribute to the survival and homeostasis of melanocytes (5;6;11). Keratinocytes, which contribute to melanocyte survival and melanin production through the production of growth factors, including bFGF (basic fibroblast growth factor) and SCF (stem cell factor), present markers of apoptosis in lesional areas and reduced SCF production (14). The modifications of the dermis-epidermal network are probably the basis for the detachment of the melanocytes (2).

AND? important to emphasize that vitiligo is not? a ?cosmetic disease? and that therefore treatments must and can be offered to patients. The best initial approach depends on the subtype of the disease, the percentage of body surface area (BSA) involved, the effects on the quality of life, and the patient's perception of the risk/benefit ratio. European guidelines for the diagnosis and management of vitiligo recommend the use of narrowband ultraviolet B (NB-UVB), tacrolimus and topical steroids. (15)

Currently, no medical therapy ? It has been approved for the repigmentation of vitiligo by the US Food and Drug Administration (FDA) and the European Medical Agency (EMA) and, therefore, the treatments are used off-label. Topical therapies are used when small areas are involved. Phototherapy in combination with potent or ultrapotent topical corticosteroids? preferable when? affected >5-10% BSA or when specific areas are unresponsive to steroids alone. For lesions on the face, neck, and intertriginous areas, both mild-potency topical corticosteroids and calcineurin inhibitors are used in lesions in children. The European Forum of Dermatology in published guidelines, has proposed the twice-daily administration of topical calcineurin inhibitors as a first approach for head and neck lesions. There are two major indications for the use of whole body phototherapy: extensive disease (>5-10% BSA) and rapid evolution. In view of its relative scarcity? of side effects phototherapy with narrowband UVB rays (NB-UVB) (311nm) ? become the first line of treatment for progressive and extensive Vitiligo. Can? be used safely even on children, pregnant and breastfeeding women. Repigmentation rates vary from 40% to 70% depending on the location of the lesions. Localized phototherapy (excimer laser and excimer lamp) ? indicated in stable and limited lesions. Oral steroid therapy called ?mini pulse therapy? (OMP), that is? discontinuous administration of high doses of steroids generally stabilizes the rapidly progressive disease as demonstrated by retrospective studies.

Surgical treatments may be offered to some patients with stable and limited lesions.

The best options innovative are represented by JAK inhibitors. The JAK-STAT route? critical for the activation pathway of inflammatory cytokines and growth hormones. JAK are tyrosine kinases associated with the cytoplasmic domain type I and II of chemokine receptors, with ligands such as IFN-?. Extracellular binding of cytokines activates their receptors, inducing JAK apposition and autophosphorylation activation. JAK inhibitors either selectively or collectively inhibit the tyrosine kinases JAK1, JAK2, JAK3, and tyrosine kinase 2 (TYK2). Tofacitinib, a potent JAK1 and JAK3 inhibitor, is been approved for the treatment of moderate to severe rheumatoid arthritis (RA) in Canada and the United States (US), and in European Union for Psoriatic Arthritis.

Ruxolitinib, a potent JAK1 and JAK2 inhibitor, is It was the first FDA-approved JAK inhibitor for myelofibrosis and polycythemia vera, and subsequently also approved in Canada and the European Union. The discovery that JAK contribute substantially to the induction of the immunological process in inflammatory diseases has led to the use for immunosuppressive therapy in dermatological conditions such as alopecia areata (AA), atopic dermatitis (AD) and vitiligo. The results of the phase II trial of the use of ruxolitinib in vitiligo demonstrate its efficacy in a significant percentage of patients, especially in facial lesions (17). Apremilast, a phosphodiesterase 4 inhibitor, induces potent activation of the cAMP signaling pathway resulting in an anti-inflammatory effect by reducing the response of IL-17-producing T helper 1 and T lymphocytes. The drug also reduces the production of CXCL9 and CXCL10 and modulates immunity. innate (18;19). L?Apremilast ? indicated in the treatment of rheumatoid arthritis and psoriasis. Some studies have reported its use in the treatment of vitiligo. However, in the randomized controlled trial performed by Khemis et al., apremilast in combination with NB-UVB did not demonstrate any significant improvement over the therapeutic results obtained with the use of NB-UVB alone (11).

The major limitation of currently usable therapies, both topical and systemic, ? the high recurrence rate (on average from 30% to 50%). The phenomenon ? due to the fact that these treatments reduce the production or release of inflammatory mediators and decrease the immune infiltrate but do not interfere with the initial mechanism responsible for the activation of the autoimmune response. As a result, any further stressful event can produce damage of melanocytes with the subsequent release of DAMPS and PAMPS and reactivation of the resident memory T cells responsible for the reappearance of the disease (4). Treatments that inhibit TRM function, but do not remove them from the skin, are not long-lasting. Some authors suggest that JAK inhibitors may prevent the accumulation of T cells in the skin during disease progression, but do not affect the number of T cells once formed.

Therefore, new therapies for vitiligo are needed, able to overcome the disadvantages of the current ones and capable of activating the precursors of melanocytes, mainly present in the hair follicles.

According to the present invention, the Applicant has now found that Peroxisome Proliferator-Activated Receptors (PPARs) prevent or block damage to melanocytes and presumably the induction of the immune response in vitiligo through a previously unidentified mechanism of action.

PPARs are nuclear receptors, which have an important role in mammalian physiology. The three isoforms PPAR, PPAR?, ? /? And ? have different sequence and structural homologies but have different tissue distribution, selectivity? and response to ligands, leading to the regulation of different sets of genes by different receptors. Activated PPARs heterodimerize with the retinoid X receptor (RXR) in the presence of activators and bind to a PPAR response element (PPRE) in the promoters of target genes. PPARs also act through modalities? of ligand-independent actions, such as transrepression and constitutive activation of receptors. PPAR?, the subtype pi? extensively studied, predominantly expressed in adipose tissue but also, to a lesser extent, in heart, colon, kidney, spleen, intestine, skeletal muscle, liver, macrophages and skin. AND? involved in the regulation of glucose and lipid metabolism. In the skin, it controls the expression of a network of genes involved in cell proliferation, differentiation and inflammatory response (20). PPARs are triggered by a wide variety of? of ligands deriving from the metabolism of fatty acids (FAs) with a certain degree of specificity? of the isoforms. Several exogenous ligands such as the thiazolidinediones (TZDs) rosiglitazone, troglitazone, pioglitazone and ciglitazone have been developed as drugs indicated for the treatment of metabolic diseases and are currently used in type 2 diabetes due to their properties to improve glycemic control (9;21).

The structure of PPAR ligands? it seems to determine the conformational change of the receptor and consequently regulates the activation of different clusters of genes. Specific ligands inhibit the production of various inflammatory mediators and cytokines from different cell types, including monocytes/macrophages, epithelial cells, dendritic cells and lymphocytes. The PPAR? acts directly by negatively regulating the expression of proinflammatory genes in a ligand-dependent manner by antagonizing the activities? of NF transcription factors?? B and AP?1.

In patients with psoriasis, pioglidazone (PGZ) reduces the infiltration of inflammatory cells into the skin and the expression of inflammatory factors, such as interleukin 2 and C-reactive protein, and exerts an inhibitory effect on the local inflammatory immune response. A few randomized controlled trials (RCTs) have investigated the efficacy and safety of pioglitazone in the treatment of psoriasis. A meta-analysis has shown that 15 or 30 mg/day significantly reduce the clinical manifestations in psoriatic patients with limited adverse effects. Recently, the inventors of the present invention have demonstrated that selective activators PPAR? they are capable of reducing the inflammatory process in human keratinocytes and sebocytes and of improving psoriasis as manifestations induced in an experimental mouse model (13).

According to the present invention, Pioglidazone (PGZ) is been tested at different concentrations on melanocytes, keratinocytes and fibroblasts of apparently healthy skin of subjects with vitiligo, with the aim of evaluating whether the selective activators of PPAR? were able to inhibit the inflammatory process in vitiligo.

According to the present invention the biological characteristics of the cells of the apparently healthy skin of patients with vitiligo have been studied. In particular, the structural and functional alterations of melanocytes from apparently healthy skin of patients with vitiligo (VHM) were analysed. The results also demonstrate that melanocytes from subjects with vitiligo are characterized by an alteration of energy metabolism, for which a decreased production of ATP tries to be compensated by an increased activity of ATP. of enzymes involved in glucose (7;8).

According to the present invention the morphological and functional characteristics of the keratinocytes (unpublished data) and of the fibroblasts of subjects with vitiligo were also studied.

Based on the results obtained from these studies, ? been found that vitiligo pu? be defined as a mitochondrial disease associated with an alteration of the barrier function of the skin, which could be an initial event of the induction of the inflammatory process.

In addition, according to the present invention the effects of PGZ on melanocytes, fibroblasts and keratinocytes of vitiligo have been studied.

The unexpected results obtained from PGZ treatment make it plausible that PGZ could be successfully used in the treatment of vitiligo as a new therapeutic approach that acts through the improvement of energy metabolism of cells. AND? note that most of the effects obtained from PGZ treatment have not been previously described, including:

? the reduction of glucose intake associated with mitochondrial genesis and increase in ATP production;

? regression of the senescent phenotype in all skin cells;

? improvement of the skin barrier functions;

? the decrease in the production of inflammatory mediators.

Is therefore a specific object of the present invention a selective PPAR activator? or a PPAR agonist? for use in the treatment of vitiligo, such as non-segmental vitiligo. For selective PPAR activator or agonist? do you mean a drug capable of activating the PPAR nuclear receptor? and through this mechanism activate some of the target genes involved in the processes of inflammation, differentiation and mitochondriogenesis.

According to the present invention, a selective activator of PPAR? or a PPAR agonist? can? be selected from the group consisting of thiazolidinediones (TZDs) such as pioglitazone, rosiglitazone, ciglitazone, preferably pioglitazone, or mixtures thereof.

According to one embodiment of the present invention, the selective activator or agonist of PPAR? can? be administered before, simultaneously with or after a phototherapy treatment.

The present invention also relates to a pharmaceutical composition comprising or consisting of a selective activator or agonist of PPAR? in combination with one or more excipients and/or adjuvants, for use in the treatment of vitiligo, such as non-segmental vitiligo.

As previously mentioned, the selective activator or agonist of PPAR? to be used in the pharmaceutical composition of the invention can? be selected from the group consisting of thiazolidinediones (TZDs) such as pioglitazone, rosiglitazone, ciglitazone, preferably pioglitazone, or a mixture thereof.

According to one embodiment of the present invention, the selective activator or agonist of PPAR? can? be administered before, simultaneously with or after a phototherapy treatment.

The pharmaceutical composition can further comprising a drug selected from the group consisting of an anti-inflammatory drug, such as a steroid, and an immunosuppressive drug.

Additionally, the present invention also relates to a combination of a selective PPAR activator or agonist? with a drug selected from the group consisting of an anti-inflammatory drug, such as a steroid, or an immunosuppressive drug for separate or sequential use in the treatment of vitiligo.

According to the present invention for ?separate use? it is meant the administration, at the same time, of the compounds of the combination according to the invention in distinct pharmaceutical forms. For ?sequential use? it means the successive administration of the compounds of the combination according to the invention, each in a distinct pharmaceutical form.

As mentioned above, the above selective PPAR activator or agonist? can? be selected from the group consisting of thiazolidinediones (TZDs) such as pioglitazone, rosiglitazone, ciglitazone, preferably pioglitazone, or a mixture of two or more of the above selective activators of PPAR?.

The present invention will be now described in an illustrative, but non-limiting form, in accordance with its preferred embodiments, with particular reference to the examples and accompanying graphs, where:

Figure 1. Morphological appearance of vitiligo keratinocytes induced to differentiate by calcium modification. The figure shows the morphological appearance of the vitiligo keratinocytes induced to differentiate by calcium modification at 24 and 48 hours.

Figure 2. Vitiligo keratinocytes induced to differentiate by calcium ions show reduced expression of keratinocyte differentiation markers compared with control cells. The figure shows Involucrin and Filaggrin mRNA transcripts evaluated by qRT-PCR in control and vitiligo keratinocytes.

Figure 3. Non-lesional keratinocytes of vitiligo show spontaneous up-modulation of pro-inflammatory cytokines and chemokines. The figure shows the results of IL-6 quantification assayed by ELISA and the gene expression of the pro-inflammatory cytokines and chemokines interleukin 1 alpha (IL1?), interleukin 1 beta (IL1?) chemokines CXCL9 and CXCL10, determined by qRT-PCR .

Figure 4. Melanocyte proliferation rate.

Treatment with PGZ 2?M significantly increases the speed? of Vitiligo Melanocyte (VHM) proliferation assessed at 48 hours and 10 days using the automatic cell counter.

Figure 5. Pioglitazone improves bioenergetics in melanocytes of nonlesional vitiligo. because ? been previously shown that the ATP content ? reduced in vitiligo melanocytes (VHM), ? The ATP level in Pioglitazone 2?M treated and untreated cells was measured using a mitochondrial luciferase assay kit. AND? been found an increase in ATP content in vitiligo melanocytes treated for 96 hours which ? further increased after 10 days.

Mitochondrial dysfunction results in a decrease in mitochondrial membrane potential. After 10 days of treatment, PGZ restores the mitochondrial membrane potential. The adopted technique uses 5,5,6,6?-tetrachloro-1,1?,3,3? tetraethylbenzimi-dazoylcarbocyanine iodide (JC-1), a cationic lipophilic dye capable of entering the mitochondria where it accumulates and (in a concentration dependent manner) begins to form reversible complexes called J aggregates.

Figure 6. Pioglitazone increases glucose metabolism. The figure reveals that Pioglitazone increases glucose metabolism in non-lesional vitiligo (HMV) melanocytes. PGZ 2 ?M produces a decrease in glucose consumption, evaluated on the basis of the concentration in the culture medium, with an overexpression of anaerobic glycolysis enzymes Hexo 2 (Hexokinase 2), PKM1,2 (Pyruvate kinase isozymes M1/M2) , PDK4 (Pyruvate Dehydrogenase Kinase) at 6 hours without modifying the expression of -ketoglutarate dehydrogenase

Kreb's cycle enzyme.

Figure 7. Mitochondrial DNA (mtDNA) copy number in normal and vitiligo melanocytes. Does the PGZ increase the? Integrit? and mitochondrial DNA (mtDNA) copy number in Normal (NHM) and Vitiligo (VHM) melanocytes. The number of copies of mitochondrial DNA (mtDNA), which regulates the ability of mitochondrial energy production, ? was measured using a specific nuclear genomic DNA sequence as a reference for data normalization. As a comparison, cells isolated from unexposed areas of healthy age-matched donors were used. Were observed significant levels more? low mtDNA levels in vitiligo melanocytes compared to normal melanocytes. Treatment with PGZ at 2µM for 10 days significantly increased the mtDNA copy number. The evaluation of the number of copies of mtDNA ? was performed using nuclear DNA as an internal reference.

Figure 8. PGZ increases the expression of some mitochondrial genes. The figure shows that mRNAs for the mitochondrial genes ND1, ND2, ATP51A, ATP51B and ? increased in vitiligo melanocytes after 6 hours of Pioglitazone treatment.

Figure 9. PGZ modifies the expression of markers associated with senescence. The figure indicates that Pioglitazone modulates the expression of senescence-associated markers such as insulin-like growth factor binding protein 3 (IGFBP3) and cyclooxygenase 2 (COX2) in VHM (Human Vitiligo Melanocytes). The relative mRNA expression in IGFBP3 and Cox2 ? was evaluated after 6 hours of treatment with PGZ (2 ?M) and measured with qRT-PCR normalizing with a reference gene (ACTIN). MITF (a transcription factor associated with Microphthalmia) ? a specific melanocyte marker and a key regulator of melanocyte development. To measure Mitf mRNA expression in normal melanocytes (NHM) and vitiligo melanocytes (VHM) ? semi-quantitative real-time PCR was used (A). Vitiligo melanocytes show a lower level high expression of Mitf which indicates a greater level of differentiation, which ? been revered by treatment with Pioglitazone (B).

Figure 10. PGZ reduces the expression of markers of cell damage. The figure shows that the PGZ (2 ?M) significantly reduces the expression/release of the High Mobility Box 1 Group? (HMGB1) in/from VHM, a cell damage marker that ? able to activate the? immunity? innate.

Figure 11. PGZ downregulates growth factor expression and decreases glucose consumption in vitiligo fibroblasts. The figure shows the metabolic modifications produced by PGZ in Vitiligo Fibroblasts. PGZ 2 ?M at 72 hours produces a decrease in glucose consumption evaluated as concentration in the culture medium, and downregulates and reduces the expression of Basic Fibroblast Growth Factor (bFGF), Insulin Growth Factor (IGF ) and Vascular Endothelial Growth Factor (VEGF).

Figure 12. The expression of genes related to inflammatory and differentiation processes increases in non-lesional vitiligo keratinocytes after treatment with Pioglitazone. The figure shows the results of the expression analysis (qRT-PCR) of inflammatory (CXCL10) and differentiation (Filaggrin, Involucrin, Corneodesmosin) genes in undifferentiated (low Ca ions) or differentiated (high Ca ions) vitiligo keratinocytes before and after treatment with PGZ; after treatment with Pioglitazone in the keratinocytes of non-lesional vitiligo, the expression of genes connected to inflammation decreases and the expression of those connected to the process of differentiation increases.

Figure 13a, b. Treatment with Pioglitazone up regulates the mRNA of genes associated with the biosynthesis and metabolism of skin barrier lipids. The figure shows that Pioglitazone up regulates genes associated with the biosynthesis and metabolism of skin barrier lipids.

The expression levels of mRNA in keratinocytes in vitiligo were evaluated before and after treatment with PGZs related to TGM1 (Transglutaminase 1), PNPLA1(Patatin Like Phospholipase Domain Containing 1), ALOX12B (Arachidonate 12-Lipoxygenase), CERS3 Ceramide 3) and ELOVL4(ELOVL Fatty Acid Elongase 4).

EXAMPLE 1: Study on the capacity? of PPAR activation? by the PZD on the improvement of the biological characteristics of vitiligo melanocytes.

Materials and methods

Skin biopsies were performed after obtaining written informed consent from all patients on the execution and use of these biopsies, on the basis of current legislation.

To evaluate if? Activation of PPARs? by the PDZ the characteristics of the vitiligo melanocytes improved, normal and vitiligo melanocytes were treated with Pioglitazone in a concentration range between 2 and 10 ?M for periods from 6 hours to 10 days based on the type of parameter evaluated.

10 normal subjects and 10 with non-segmental vitiligo matched for sex and age were involved in the study. Subjects with vitiligo were classified according to VETF criteria. Control samples (normal human primary epidermal melanocytes, NHM), were obtained from subjects who had undergone plastic surgery for diseases not related to pigmentation disorders. Primary epidermal melanocytes from vitiligo (VHM) subjects were isolated from 1 to 2 cm biopsies of nonlesional skin after informed consent. Isolated NHM and VHM were grown in Medium defined 254 (Cascade Biologics, TermoFisher) supplemented with a cocktail of specific Growth Factors (Cascade Biologics) and penicillin/streptomycin (Gibco). All analyzes were performed between 3 and 7 passages in culture.

Primary cultures of control normal human keratinocytes (NHKs) and isolates from non-lesional vitiligo skin were grown in a defined Medium 154 (Life Technologies Italia, Monza, Italy) supplemented with Human Keratinocyte Growth Supplement (Life Technologies Italia), pi ? antibiotics and Ca<2+ >(0.07 mM).

Determination of ATP extension

The intracellular level of ATP ? was measured with a commercial fluorometric kit (ThermoFisher) according to the manufacturer's instructions. The results were reported as ?M mean ?SD.

Real-Time Semi-Quantitative Polymerase Chain Reaction (RT-PCR)

The total RNA ? was extracted using the Aurum Total kit (BioRad, Milan Italy). The cDNA? was synthesized from 1 µg total RNA using the FirstAid Kit (Fermentas, ThermoFisher Scientific, Waltham, MA, USA) and amplified in a reaction mix containing SsoAdvanced Universal Syber Green Supermix (BioRad) and 25 pmol forward and reverse primers using a CXF96 Touch Cycler (BioRad). All samples were analyzed in triplicate. Amplifications of the ?-actin (?act) transcript and GAPDH of each sample were included as internal controls. For each gene, the quality assessment? ? was performed by analyzing the melting curves after quantitative (q)RT-PCR to ensure the specificity? of the product. Table 1 shows the oligonucleotide sequences used to detect the expression of the reported target genes.

Table 1

Treatment with Pioglitazone (PGZ)

PGZ (Sigma) ? was dissolved in dimethyl sulfoxide (DMSO) in a 20 mM stock solution and added to the cell growth medium at the final concentration of 2?M. In untreated control cells ? an equal volume of DMSO was added.

Keratinocytes were induced to differentiate in vitro by changing the calcium concentration in the culture medium from low (0.07mM) to high (1.8mM) and were treated with Pioglitazone (20 ?M) (Sigma Aldrich, Milan, Italy) for 48 hours.

mtDNA quantification

All DNA? was prepared from melanocytes using DNeasy Blood and Tissue (Qiagen) following the manufacturer's instructions and stored at ?20?C.

The mtDNA content ? was measured by real-time PCR using an iQ5 real-time PCR (BioRad). The amplification conditions were as follows: 5 min at 95°C, then 45 cycles of 15s at 95°C and 1min at 58°C. For each sample ? a dissociation curve was also calculated to ensure the presence of a single PCR product. The experiment? was repeated three times. As previously reported (Moiseeva et al., 2009), the relative quantification of mitochondrial DNA (mtDNA) versus nuclear DNA (nuDNA) levels ? was determined using the difference in the cycle threshold values of the nuclear TATA box binding protein region on chromosome 6 and the noncoding mitochondrial control region (D-loop ?Ct, namely, CtmtDNA?CtnuDNA). The relative abundance of the mitochondrial genome ? been reported as 2??Ct. The following primers were used:

sense mtDNA, GATTTGGGTACCACCCAAGTATTG (SEQ ID NO:51);

antisense, GTACAATATTCATGGTGGCTGGCA (SEQ ID NO:52);

And

nuDNA sense, TTCCACCCAAGTATTG (SEQ ID NO:53); antisense, TGTTCCATGCAGGGGAAAACAAGC (SEQ ID NO:54) The absolute number of mtDNA copies ? was tested using the Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qPCR Assay Kit following the manufacturer's instructions (ScienCell Research Laboratories, Sun Diego, CA).

Protein determination by assay in a sorbent bound to sandwich enzyme

The determination of IL-6 in the supernatants of control and vitiligo keratinocytes ? was performed by ELISA assay (IL-6 from 4ABiotech) following the manufacturer's protocol. The results were normalized by the number of cells contained in each sample and were expressed as picograms 1x10<6>cells. The measurement ? was performed in duplicate for each sample and the experiments were repeated three times.

Results

Biological characteristics of skin cells of apparently normal skin from patients with vitiligo. Melanocytes

AND? it has been demonstrated that melanocytes from apparently normal skin of patients with vitiligo (VHM) show, compared to normal melanocytes, some structural and functional alterations with:

? a speed? of replication significantly pi? slow;

? greater susceptibility? at mild stresses;

? increased generation of reactive oxygen species (ROS):

? a decrease in the mitochondrial transmembrane potential (??m) and in the expression of some proteins of the electron transport chain (ETC).

In addition, they have a pi? high expression of:

? p53;

? differentiation markers such as microphthalmia-associated transcription factor (MITF); ? secreted senescence-associated phenotype, including interleukin 6 (IL-6) and insulin growth factor binding protein 3;

? increased cellular uptake of glucose from the culture medium;

? ATP level pi? low;

? mitochondrial mass, detected by cytofluorimetry (DLS), as a compensatory mechanism to obtain a sufficient energy level in steady state conditions; ? increased expression of some mitochondrial genes (ND2, ND5, ND6 of CxI, and CxI, CxII, CxIII of CxIV), without an increase in mitochondrial DNA content.

Therefore, the melanocytes of vitiligo appear to be characterized by a compromised energy metabolism, for which an attempt is made to compensate for the defect in ATP production with an increase in activity. of the enzymes involved in the use of glucose (7;8).

Keratinocytes

Morphological and functional characteristics in vitiligo keratinocytes were also evaluated (unpublished data).

Vitiligo keratinocytes showed, compared with normal ones:

? one more high expression of inflammation-related genes IL1?, IL1b, CXCL9 and 10;

? an increase in the release of IL-6 at the protein level (Fig. 3)

? morphologically a lower differentiation rate under conditions of high calcium at 24 and 48 hours (Fig. 1);

? a lower expression of the differentiation markers, Involucrin and Filaggrin, in condition of differentiation (Fig. 2).

fibroblasts

Vitiligo fibroblasts appear, compared to normal control cells (12):

? flattened and enlarged, features resembling a senescent phenotype (12);

? demonstrate a significant increase in size compared to the control;

? a significant increase in reactive oxygen species (ROS);

? a marked increase in p53 levels;

? an important induction of gene expression of IL-1?, IL-6, and HGF.

Treatment with Pioglitazone (PGZ)

The PGZ in the tested concentration (up to 10 ?M) does not modify the vitality? cell in both normal and vitiligo melanocytes. Conversely, treatment with PGZ from 2 ?M to 5 ?M increases the duplication rate in both normal and vitiligo melanocytes by 15 to 35% (p<0.005) depending on the culture period (2-10 days ). Whereas 2 ?M ? was the concentration pi? low capable of inducing a significant increase in the rate of cell proliferation, this concentration? was used in further experiments (Fig 4).

PGZ treatment

In the melanocytes of vitiligo:

? improves mitochondrial bioenergetic status, significantly increases ATP concentration after 4 days and even more? after 10 days;

? increases the mitochondrial membrane potential, assessed by flow cytometry (Fig 5);

? increases the expression of the glucose transporter genes GLUT 1 and 4 cos? such as the genes for aerobic and anaerobic glucose metabolism. Unexpectedly, however, glucose consumption reduced (Fig 6);

? increases mitochondrial biogenesis as demonstrated by the significant increase in mtDNA copies (Fig 7) and in the expression of complex I-V genes of the respiratory chain (Fig.8); ? determines a decrease in the expression of the differentiation marker MITF and of the senescence marker IGFBP3 (Fig 9) and in the release of HMGB1 capable of activating the immune response (Fig 10) In vitiligo fibroblasts:

? significantly decreases glucose consumption, similar to that reported in melanocytes (Fig 11);

? decreases the expression level of growth factors, vascular endothelial growth factor (VEGF), insulin growth factor (IGF) and basic fibroblast growth factor (bFGF) (Fig 11).

In vitiligo keratinocytes:

? decreases the expression of pro-inflammatory mediators (Fig 12):

? up-regulates differentiation genes (Fig 12); ? it increases the expression of genes associated with the biosynthesis and metabolism of lipids of the skin barrier (Fig 13).

Claims (10)

1) PPAR activator? for use in the treatment of vitiligo. 2) PPAR activator? for use according to claim 1, wherein the vitiligo is non-segmental vitiligo. 3) PPAR activator? for use according to any one of claims 1-2, wherein said PPAR activator? ? selected from the group consisting of thiazolidinediones (TZD) such as pioglitazone, rosiglitazone, ciglitazone, preferably pioglitazone, or mixtures thereof. 4) PPAR activator? for use according to any one of claims 1-3, wherein said PPAR activator? ? administered before, simultaneously with or after a phototherapy treatment. 5) Pharmaceutical composition comprising or consisting of a PPAR activator? in combination with one or more excipients and/or adjuvants, for use in the treatment of vitiligo. 6) Pharmaceutical composition according to claim 5, for the use according to claim 5, in which the vitiligo is? non-segmental vitiligo. 7) Pharmaceutical composition according to any one of claims 5-6, wherein said PPAR activator? ? selected from the group consisting of thiazolidinediones (TZD) such as pioglitazone, rosiglitazone, ciglitazone, preferably pioglitazone, or mixtures thereof. 8) Pharmaceutical composition according to any one of claims 5-7, for use according to any one of claims 5-7, wherein said pharmaceutical composition ? administered before, simultaneously or after a phototherapy treatment. 9) Pharmaceutical composition according to any one of claims 5-8, for use according to any one of claims 5-8, said pharmaceutical composition further comprising a drug selected from the group consisting of an anti-inflammatory drug, such as a steroid, and an immunosuppressive drug . 10) Combination of a PPAR activator? with a drug selected from the group consisting of an anti-inflammatory drug, such as a steroid, or an immunosuppressive drug for separate or sequential use in the treatment of vitiligo.