IT202000008014A1 - Guide RNA and their uses - Google Patents

Description

GUIDING RNA AND THEIR USES

Field of the invention

The present invention? related to guide RNA (gRNA) and short palindrome repeats grouped and separated at regular intervals (CRISPR) - protein associated with CRISPR 9 (Cas9) (CRISPR / Cas9) which includes said guide RNA and their use in the treatment of retinitis pigmentosa.

Background of the invention

Retinitis Pigmentosa (RP)? a group of genetically heterogeneous retinal diseases affecting three million people worldwide with an incidence of 1 in 3,500 live births 1, 2, 3, 4 (https://ghr.nlm.nih.gov/). Do patients with RP initially experience blindness? night with a gradual constriction of the visual field, but with saving of central vision. As rod loss progresses, secondary death of the cones occurs, resulting in deterioration of acuity? visual and possible blindness ?. Part of the difficulty? in the treatment of RP? its complex and diverse genetic etiology. To date, more? of 3,000 mutations in approximately 70 disease-causing genes have been causally associated with RP <5> (https://sph.uth.edu/retnet) and currently more? of 150 documented missense / nonsense mutations in the rhodopsin (RHO) gene are associated with an autosomal dominant RP (adRP) phenotype (RP4, OMIM 613731) <6, 7>. The RHO gene encodes rhodopsin (RHO), a visual pigment found in rod photoreceptors, responsible for converting photons into chemical signals that allow vision. Rhodopsin? a 348 amino acid G protein-coupled receptor characterized by an N-terminal extracellular domain needed to stabilize the protein, seven transmembrane? -helices hosting the binding site for the 11-cisretinal chromophore, and a C-terminal intracellular domain, involved in vector transport of rhodopsin to external segments of rods (OS) <8, 9, 10, 11>. Although about half? of RHO-associated adRP cases in the USA are caused by the P23H <12> mutation in the N-terminal extracellular domain, class I mutants clustered in the C-terminal domain <6> give rise to a defect in post-Golgi traffic to OS and determine a phenotype pi? severe and worse prognosis for patients <13, 14, 15>. The vast majority of RHO mutations are inherited in an autosomal dominant fashion. In most of these cases, simply adding a normal copy of the gene doesn't? help <16> since? the mutated gene must be inactivated. ? A reduction of mutant RHO was attempted in disease models using ribozymes <17>,? RNA interference? <16, 18>, transcriptional repressors fused with zinc finger proteins <19> and modification mediated by CRISPR / Cas9 <20, 21>.

Most of these approaches do not distinguish mutant alleles from wild-type (WT) alleles, thus obtaining a bi-allelic suppression that also requires the addition of an RHO WT ("suppression and replacement") cDNA. The capacity to correct the mutations that cause the disease, sparing the WT allele,? has been greatly enhanced by the discovery of CRISPR / Cas9-mediated genome modification. Cas9 endonucleases generate double-stranded breaks (DSBs) in a specific genomic region, which is located adjacent to a? Protospacer? -Adjacent motif (PAM) and? targeted by a complementary guide RNA (gRNA) <22>. In the absence of the exogenous template, Cas9-induced DSBs are repaired through the non-homologous joining mechanism (NHEJ), which leads to the frequent introduction of insertions or deletions at the destination site. Thus, as a valid alternative to the "suppression and replacement" approach that can? be potentially used to treat a wide range of dominant diseases but requiring dual intervention,? It is possible to pursue a specific inactivation of the altered allele for dominant negative mutations <23> that generate a unique PAM site or allow the design of a gRNA that contains the mutation in the seed sequence.

Given the high prevalence of the P23H allele in the United States <24>, it is not surprising that this was the primary focus of CRISPR / Cas9-mediated gene editing. In fact, this strategy does? already? proven effective in recent studies using the P23H <12, 21> knock-in mouse model. In these studies, the authors showed reduced expression of the murine mutant P23H transcript triggered by NHEJ repair occurring in the first exon of the gene. The specific inactivation of the murine P23H allele mutation caused a delay in the degenerative process of the retina and the saving of activity. function of the retina.

Till now ? a gene modification approach adapted to the C-terminal domain of human rhodopsin and in particular to proline 347, the pi? common mutated in European patients <25>.

International patent application WO2018009562 refers to methods for the treatment of retinal degeneration in a subject, such as Leber's congenital amaurosis (LCA), retinitis pigmentosa (RP) and glaucoma; methods to alter the expression of one or more? gene products in a cell, such as a retinal ganglion cell. Such methods may include the use of a modified nuclease system, such as the? Clustered Regularly Interspaced Short Palindromic Repeats? System. (CRISPR) comprising a bidirectional HI promoter and gRNAs targeting genes related to retinal degeneration, packaged into a single compact, adeno-associated virus (AAV) particle. The patent application refers to gRNAs directed at the R135G, R135W, R135L mutations in rhodopsin. The Cas9 used? the SaCas9.

Does the need remain? in the art of therapeutic methods and agents to effectively treat RP, in particular by inactivating the human pathogenic allele P347S.

Summary of the invention

The present inventors have surprisingly discovered that the use of CRISPR / Cas9 allows to selectively target the P347S mutation, preserving the wild-type RHO allele in vitro and in a mouse model of adRP. The detailed genomic and biochemical characterization of the editing of the C-terminal portion of rhodopsin demonstrates a safe and efficient reduction of P347S expression leading to the partial recovery of photoreceptor function in a transgenic mouse model treated with adeno-associated viral vectors. This application supports the efficacy and safety of CRISPR / Cas9-mediated allele-specific editing and paves the way for permanent and precise correction of dominant mutations in retinal diseases. The authors here use both Streptococcus pyogenes Cas9 (SpCas9) WT and variant VQRHF1 <26> combined with mutation-specific gRNAs to modify P347S RHO. The authors detail allele-specific editing for P347SRHO and prediction of off-target sites on the whole genome by next generation sequencing (NGS). Considering the role of the C-terminal portion of RHO in protein trafficking / folding and the unpredictable editing that occurs at the target site, the authors performed in-depth biochemical analyzes of RHO pi? frequent generated through l? CRISPR / Cas9- mediated editing. Furthermore, AAV2 / 8 vectors carrying SpCas9 WT or VQRHF1 and the target gRNA or scramble demonstrate the therapeutic potential of gene editing via AAV-Cas9 to effectively inactivate the human pathogenic allele P347S in the P347S transgenic mouse model, enhancing the progression of disease.

AND? an object of the present invention at least one isolated guide ribonucleic acid (gRNA), said gRNA comprising or consisting of a first sequence substantially complementary to a second sequence comprising SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3 ') or SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC-3 ') and in portions of them at least 15 nucleotides long, where such portions include SEQ ID NO: 3 (5'-CGAGCCAGGTGGCCT-3') or SEQ ID NO: 4 (5'-aggcaggtcTTAGGC-3 '). Another object of the invention? at least one gRNA in which the gRNA comprises or consists of the polynucleotide sequence of SEQ ID NO: 8 (5'-CCTCTGCTCGGTCCACCGGA-3 ') or 9 (5'-caggatccgtccagAATCCG-3') or 14 (5'GCCTAAgacctgcctaggac-3 '), or functional fragments thereof, in which such fragments are at least 15 nucleotides long, preferably 17-18 nucleotides, and comprise SEQ ID NO: 10 (5'-GCTCGGTCCACCGGA-3 ') or SEQ ID NO: 11 (5'-tccgtccagAATCCG-3 ') or 15 (5'-GCCTAAgacctgcct-3') or a variant thereof with at least 85% homology with any of the SEQ ID NOs: 8, 9, 14, 10, 11 or 15, where this variant includes SEQ ID NO: 12 (5'-GTCCACCGGA-3 ') or SEQ ID NO: 13 (5'-ccagAATCCG-3') or 16 (5'-GCCTAAgacc-3 ').

The present invention also encompasses the sequences mentioned herein in reverse orientation, 3 'to 5'.

? furthermore, object of the invention is at least one isolated guide ribonucleic acid (gRNA), said gRNA being substantially complementary or able to couple perfectly to the sequence SEQ ID NO: 1 (5'- GGAGACGAGCCAGGTGGCCT -3 ') or SEQ ID NO: 2 (5 '-gtcctaggcaggtcTTAGGC -3'), or in portions of them at least 15 nucleotides long,

in which such portions comprise or consist of SEQ ID NO: 3 (5'-CGAGCCAGGTGGCCT -3 ') or SEQ ID NO: 4 (5'- aggcaggtcTTAGGC -3').

In the context of the present invention, the gRNA pairing to the sequence SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3 ')? gRNA1, while the gRNA that matches the sequence SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC -3 ')? gRNA5.

Other objects of the invention are at least one isolated guide ribonucleic acid (gRNA), called gRNA which comprises or consists of a perfectly paired polynucleotide sequence or which? substantially complementary to SEQ ID NO: 2 (5'- gtcctaggcaggtcTTAGGC -3 ') or 1 (5'-GGAGACGAGCCAGGTGGCCT -3'),

or functional fragments thereof, in which such fragments are at least 15 nucleotides long, preferably 17-18 nucleotides and comprise SEQ ID NO: 4 (5'- aggcaggtcTTAGGC -3 ') or SEQ ID NO: 3 (5'- CGAGCCAGGTGGCCT -3 ') or a variant thereof having at least 85% homology to any of the SEQ ID NOs: 1-2 or 3-4, where said variant includes SEQ ID NO: 5 (5? -tcTTAGGC-3?) or SEQ ID NO: 6 (5? - GGTGGCCT-3?).

Preferably, at least one gRNA as defined above which comprises or consists of the polynucleotide sequence of SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC -3 ') or 1 (5'-GGAGACGAGCCAGGTGGCCT -3').

Another object of the invention? a nucleic acid encoding the gRNA or fragments as defined above, preferably wherein said nucleic acid? functionally linked to a promoter sequence which? recognized by a phage RNA polymerase for in vitro RNA synthesis, preferably wherein said nucleic acid? part of a vector

Another object of the invention? a system of short palindromic repeats grouped and separated at regular intervals (Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) - protein associated with CRISPR 9 (Cas9) which includes:

to. a Cas9 protein or a nucleic acid encoding a Cas9 protein, e

b. at least one gRNA or at least one nucleic acid as defined above,

preferably where the system is a. or b. are packaged in adeno-associated virus (AAV) vectors, preferably in which the Cas9 protein? a Streptococcus pyogenes Cas9 protein (SpCas9) or a variant thereof, such as Cas9-VQRHF1, VQR, EQR, eSpcas9, xCas9, evoCas9, SpCas9HF1, HyPaCas9 or KamiCas9 or a Cas9 of Staphylococcus aureus ( their recombination of the naturally occurring molecule, a version in which codons are optimized, or modified versions of them, and their combinations.

Preferably,

- when the gRNA comprises or consists of the perfectly matched polynucleotide sequence or what? substantially complementary to SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3 ') or includes or consists of SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3'), the Cas9 molecule recognizes a PAM of sequence 5'-CGG- 3 ', preferably Cas9? SpCas9, eSpCas9, xCas9, evoCas9, SpCas9HF1, HyPaCas9 or KamiCas9;

- when the gRNA comprises or consists of the polynucleotide sequence which is perfectly paired or substantially complementary to SEQ ID NO: 2 (5'- gtcctaggcaggtcTTAGGC -3 ') or comprises or consists of SEQ ID NO: 2 (5'- gtcctaggcaggtcTTAGGC -3' ), Cas9 recognizes a PAM of sequence 5'-CGAG -3 ', preferably Cas9? VQRHF1, VQR or EQR, or sequence SEQ ID NO: 7 (5'-NNGRR (N) -3 ') where R? A or G, preferably Cas9? SaCas9.

Another object of the invention? a vector comprising at least one gRNA or at least one nucleic acid or comprising a CRISPR-Cas system as defined above.

A further object of the invention? an adeno-associated recombinant viral vector comprising a viral genome comprising a retina-specific promoter sequence, preferably an interphotoreceptor retinoid-binding protein (IRBP) promoter, and a polynucleotide sequence encoding means for genome editing functionally linked to the promoter sequence, wherein said genome editing means comprises CRISPR / Cas9 which comprises a Cas9 protein and a guide RNA (gRNA) as defined above or at least one nucleic acid as defined above or the CRISPR-Cas system as defined above,

preferably wherein the vector comprises a capsid protein derived from an adenoassociated virus of AAV8, AAV3, AAV3B or AAV9,

preferably wherein the virus genome also comprises an inverted terminal repeat (ITR) nucleotide sequence selected from the group consisting of AAV2, AAV1, AAV3, AAV4, AAV6 and AAV9.

An additional object? a pharmaceutical composition comprising at least one guide RNA, at least one nucleic acid, a CRISPR / Cas9 system or at least one vector as defined above, and at least one pharmaceutically acceptable vector and / or excipient.

Another object of the invention? an in vitro or ex vivo method for altering the expression of the RHO gene in an isolated cell, said method comprising the introduction into an isolated cell a guide RNA according to the invention or a nucleic acid as defined above in a CRISPR system / Cas9, in which the guide RNA targets the gene and the Cas protein cuts the genomic loci of the DNA molecules encoding one or more? gene products, by altering the expression of one or more? gene products,

preferably said cell? a photoreceptor cell, a retinal progenitor cell, a retinal ganglion cell or an induced pluripotent stem cell (iPSC), preferably a cell from a patient with Retinitis Pigmentosa (RP), plus? preferably said method modifies a P347S mutation in the RHO gene.

Another object of the invention? a gRNA as defined above, or the nucleic acid as defined above, or the CRISPR / Cas system as defined above, or the vector as defined above, or a pharmaceutical composition as defined above for use as a medicament, preferably for use in gene therapy, preferably for use in the treatment of a retinal degenerative disorder, preferably said disorder being induced by the P347S mutation in the rhodopsin RHO gene.

Another object of the invention? a cell comprising the nucleic acid or a CRISPR / Cas9 system, or a vector as defined above.

Another object of the invention? a kit comprising at least one gRNA as defined above or a nucleic acid as defined above and further optionally comprising a CRISPR / Cas9 protein or a nucleic acid encoding the CRISPR / Cas9 protein, preferably the kit comprises the CRISPR / Cas9 system as above defined.

The present invention will be illustrated with non-limiting examples with reference to the following drawings and figures.

Brief description of the figures

Figure 1. CRISPR / Cas9 targeting the dominant P347S RHO mutation.

a) Schematic representation of human chromosome 3. The image illustrates two mutation-specific gRNAs (gRNA1 and gRNA5) (T, in bold) in exon 5 of the RHO gene and PAM sequences. Capital letters indicate exon 5 while 3'UTR? in lowercase. b) CRISPResso analysis of NGS data obtained on HeLa P347S and WT RHO HeLa clones transfected with effector plasmids (SpCas9_gRNA1 in blue and VQRHF1-SpCas9_gRNA5 in orange). The experiment? was performed in triplicate and? presented as an average? SEM. c) CRISPResso analysis of indel occurring in the P347S RHO transgene and in the endogenous WT RHO gene after transfection of effector plasmids in the P347S HeLa clone. The experiment? was performed in triplicate and? presented as an average? SEM. d) Analysis of the indels of offtarget sites predicted for gRNA1 (left panel) and for gRNA5 (right panel). The color bar (blue and orange) represents the values increasing from the bottom to the top classified according to the frequency of the indels. e-f) CRISPR Graphical representation of scoring indices in the target site of P347S RHO HeLa cells transfected with SpCas9_gRNA1 (e) and VQRHF1-SpCas9_gRNA5 (f). The upper sequence? the unmodified reference. The percentage of frequency of the indel and the number of readings marked are indicated. g) Type of indel, and their relative percentage, generated in the P347S HeLa clone transfected with SpCas9_gRNA1 and VQRHF1-SpCas9_gRNA5. h) CRISPResso analysis of indels leading to frameshift or frame mutations.

Figure 2. Biochemical characterization of the pi? frequently generated as a result of editing. a) Immunofluorescence analysis of CHO cells transfected with RHO mutant plasmids. Permeabilized cells (left panels) were stained with anti-BIP and anti-4D2 antibodies, while non-permeabilized cells (right panels) were stained with anti-4D2 and anti-HA antibodies. b) Western blot analysis of WT, P347S and RHO mutant plasmids transfected in CHO cells. The anti-HA antibody? been used to detect rhodopsin. Western blotting? was normalized using beta-actin antibody. c) Densitometric analysis of the Western blot performed on CHO cells transfected with mutant P347S and RHO plasmids (del9, del12.1 and del12.5) and treated with 10? g / mL of cyclooxymide (CHX). The experiment? was performed in triplicate and? presented as an average? SEM (* p-value <0.05). d) Western blot densitometric analysis performed on CHO cells transfected with P347S and RHO mutant plasmids (del9, del12.1 and del12.5) and treated with 50? M MG-132 proteasome inhibitor. The experiment? was performed in triplicate and? presented as an average? SEM (* p-value <0.05).

Figure 3. Efficient killing of P347S RHO expression in vitro. a) Western blot for rhodopsin protein expressed in RHO P347S and WT clones transfected with SpCas9_gRNA1 and VQRHF1-SpCas9_ gRNA5 plasmids and control plasmids. Western blotting? was normalized using beta-actin antibody. b) Densitometric quantification of the level of rhodopsin protein normalized to beta-actin after modification. The experiment? was performed in triplicate and? presented as an average? SEM. p <0.05 (*); p <0.01 (**). c) The RHO P347S and WT clones were transfected with SpCas9_gRNA1 and VQRHF1-SpCas9_gRNA5 plasmids and control plasmids. The quantity? Relative (RQ)? was calculated using the quantification 2 - <?? CT>, and? reported on the y axis. Any champion? was performed in triplicate. p <0.01 (**). d) Lactate dehydrogenase (LDH) assay of HeLa RHO P347S clone transfected with SpCas9_gRNA1 and VQRHF1-SpCas9_gRNA5 plasmids and control plasmids. Transfected P347S RHO control cells and WT RHO cells were used as positive and negative controls. The experiment? was performed in triplicate and? presented as an average? SEM. (* p-value <0.05).

Figure 4. Efficient allele-specific editing in mouse photoreceptors

a) Top panel,? depicted a diagram of the experimental timeline; central panel, the AAV2 / 8 vectors expressing the WT or VQRHF1 SpCas9 under the control of the IRBP promoter are reported; bottom panel, AAV2 / 8 vectors expressing gRNA (gRNA1, gRNA5 or scramble) and GFPs under the control of the rhodopsin promoter are shown. b) Frequency of indels determined by NGS in the retina injected with effector vectors. c) Representation of the indel marks in the retina treated with gRNA1 or gRNA5 vector AAV coupled to the appropriate AAV-SpCas9 vector. The inserted or deleted nucleotides are shown on the right. d) Downregulation of P347S RHO transcription in the retina injected with effector vectors compared to the retina treated with scramble vectors. Averages are represented with a bar (* p <0.05). e) The localization of rhodopsin? was studied at P50 in retina injected with effector vectors using 1D4 and 4D2 antibodies against rhodopsin. Representative images are shown. Scale bar, 10? M. The enlarged areas of the photoreceptors are shown on the side. OS = outer segment, IS = inner segment, ONL = outer nuclear layer

Figure 5. Significant Rescue of Retinal Electrical Function (ERG) and Pupillary Light Response (PLR)

P347S transgenic mice injected with AAV2 / 8 effector or control vectors were subjected to P40 at ERG (a), as shown in the dot blot distribution of the B wave amplitude at 20cd.s / m <2> and in the PLR analysis (b). Individual eyes are represented as squares. Group averages are represented with a bar. * p <0.05; ** p <0.01.

Figure 6. Engineering of HeLa cells to express the WT or P347S RHO.

a) qPCR on HeLa RHO P347S (left panel) and WT (right panel) clones to determine vector copy number (VCN) of PGK-driven expression cassettes carrying RHO WT or P347S cDNA and part of region 3 ' UTR. To select clones hosting 2 copies of the WT or P347S transgene,? An isolated WT * clone was included as reference and used in Latella et al. <48> b) Quantitative expression of RHO mRNA in P347S (left panel) or WT RHO (right panel) clones compared to isolated P23H * and WT * clones and used in Latella et al. <48> Clone # 3 belonging to P347S RHO and clone # 37 belonging to WT RHO were selected for in vitro editing experiments performed in this study.

Figure 7. Allele-specific editing of the P347S RHO transgene in vitro.

Clone HeLa P347S transfected with SpCas9_gRNA1 (a) or VQRHF1-SpCas9_gRNA5 (b)? been subjected to NGS analysis tailored to the target site. The readings of the NGS sequence were analyzed by the CRISPResso software which retrieved a frequency of reads with indel or without modification. Pie representations of the results of a representative experiment are shown. c, d) Pie charts of a representative experiment showing the frequency and quantity? of reads with indel or unmodified reads marked in the HeLa RHO WT clone transfected with SpCas9_gRNA1 (c) or -VQRHF1-SpCas9_gRNA5 (d).

Figure 8. Unmodified expression of off-target genes after CRISPR-mediated editing.

a) CRISPResso analysis of potential splice sites in THRA, ROR1, RBSN and EPSILS1 modified following modification induced by SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5. b) RT-PCR analysis for the expression of THRA, ROR1, RBSN and EPSILS1 in human RPE cells transfected or not with effector plasmids for the expression of SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5. RT-PCR analysis of GAPDH expression? was evaluated as a control. M, 100 bp molecular weight marker. c) Densitometric quantification of THRA, ROR1, RBSN and EPSILS1 mRNA, normalized with respect to GAPDH in RPE cells transfected or not as indicated in panel (b).

Figure 9. Indel distribution in CRISPR modified HeLa P347S RHO clone.

Indel profile marked in HeLa P347S RHO clone transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5. Deletions are represented by numbers minus, while numbers plus? represent adverts. Sequences without indel (value = 0) are omitted from the graph.

Figure 10. Mutants RHO pi? occurrences generated after CRISPR-mediated modification of the RHO P347S mutation in vitro.

Nucleotide sequence of the six pi? frequently identified by CRISPResso following modification mediated by SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5. The conversion from C to T resulting in a mutation of P347S? highlighted in bold. Nucleotides belonging to the 3'-UTR are in italics. The dash indicates a deleted nucleotide, while inserting? shown in orange. The new stop codes after the canonical one (capital letters in italics) are underlined.

Figure 11. Localization of mutant WT and RHO proteins in CHO cells

a) Immunofluorescence analysis of the WT protein and P347S RHO performed in permeabilized cells stained with anti-BIP and 4D2 antibodies. b) CHO cells transfected with WT and P347S RHO were not permeabilized and stained with 4D2 and anti-HA antibodies. The panels generated by fusing the signals also includes a DAPI staining of the cores.

Figure 12. Localization and degradation of RHO mutants generated by modification of the RHO P347S mutation in vitro.

a) In-Cell Western analysis of permeabilized and non-permeabilized CHO cells transfected with RHO mutant plasmids and stained with anti-HA antibody. As control plasmids of expression P23H, WT and P347S RHO were transfected. Transfected control cells (CHOs) are included in the assay. b) Graphic representation of the ratio of rhodopsin localized to the plasma membrane with respect to total rhodopsin detected in the "In Cell Western" analysis. The experiment? been performed in duplicate and presented as media? SEM. c) Densitometric quantification of the RHO protein level detected by western blot (Fig. 2b) in CHO cells transfected with plasmids for the expression of RHO P347S, WT or mutants. The experiment? was performed in duplicate and presented as an average? SEM. * p-value p <0.05, ** p-value p <0.01.

Figure 13. Expression of AAV-CRISPR effector vectors in P347S transgenic mice.

RT-PCR analysis for SpCas9 and GFP expression in the retina of P347S transgenic mice treated with AAV2 / 8 effector or control vectors. The expression of the rod photoreceptor gene Pde6b and ribosomal RNA s26? was used for normalization. L and R indicate the left eye and the right eye respectively. NC, negative control, non-injected retina.

Figure 14. GFP expression in P347S transgenic mice treated with CRISPR-AAVs Immunohistochemistry of retinal sections derived from mice injected with vectors SpCas9 + gRNa1, VQRHF1-SpCas9 + gRNA5 or SpCas9 + scramble. The anti-GFP antibody stained the AAV carrying the gRNAs. The outer segment (OS), the inner segment (IS) and the outer nuclear layer (ONL) are indicated. A scale bar corresponding to 10? M is indicated.

Detailed description of the invention

Also included in the present invention are the corresponding proteins encoded by orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms of the proteins mentioned herein.

Preferably, the nucleic acid encoding the Cas9 protein? codon-optimized for expression in human cells. Single-chain guide RNA, including crRNA and tracrRNA, can be transcribed in vitro.

Preferably the target DNA sequence comprises nucleotides complementary to the guide RNA and a motif adjacent to the trinucleotide protospacer (PAM), and where the PAM? consisting of the 5'-CGG-3 'or 5'-CGAG-3' trinucleotide.

The truncated forms of the gRNA defined herein are also included in the present invention, see for example ZHOU, Zheng-wei et al., (2019). Truncated gRNA reduces the CRISPR / Cas9 mediated off target rate for MSTN gene knockout in cattle. Journal of Integrative Agriculture.

18. 2835-2843.

The mutations of Proline 347 are for example:

P347T, P347A, P347S, P347Q, P347L, P347R, P347C, see for example Athanasiou D et al., Prog Retin Eye Res. 2018 January; 62: 1-23.

A further object of the invention? a composition comprising a guide RNA according to the invention and at least one delivery medium selected from GalNAC, polymers, liposomes, peptides, aptamers, antibodies, viral vectors, folates or transferrin.

Another object of the invention? a method for treating retinal degeneration in a person who needs it, the method which includes:

a) provide an unnatural nuclease system comprising one or more? vectors comprising: i) a promoter functionally linked to at least one nucleotide sequence encoding a CRISPR system guide RNA (gRNA), in which the gRNA hybridizes with a target sequence of a DNA molecule in a subject cell, and in which the DNA molecule encodes one or more? gene products expressed in the cell; And

ii) a regulatory element operating in a cell functionally linked to a nucleotide sequence encoding a genomic target nuclease, in which components (i) and (ii) are located on the same or on different vectors of the system, in which the gRNA target and hybridizes with the target sequence and the nuclease cleaves the DNA molecule to alter the expression of one or more? gene products; And

b) administer to the retinal area of the subject a quantity? therapeutically effective system, in which the gRNA? as defined above.

Preferably, the system? packaged in two vectors of adeno-associated virus (AAV) and / or inactive one or more? gene products. ? it is preferable that the system eliminates at least one gene mutation.

Preferably the Cas9 protein? codon-optimized for expression in cells.

Preferably retinal degeneration? an autosomal dominant form of retinitis pigmentosa (adRP).

Preferably the target sequence of the gRNA? a P347 mutation of the rhodopsin gene, preferably selected from the group consisting of P347S

A further object of the invention? a method to alter the expression of one or more? gene products in a cell, in which the cell comprises a DNA molecule that encodes one or more? gene products, the method comprising the introduction into the cell of an unnatural nuclease system comprising one or more? carriers:

a) a promoter functionally linked to at least one nucleotide sequence encoding the guiding RNA of the nuclease system (gRNA), in which the gRNA hybridizes with a target sequence of the DNA molecule; And

b) a regulatory element that operates in a cell functionally linked to a nucleotide sequence encoding a genomic target nuclease,

in which components a) and b) are on the same vector or on different vectors of the system, in which the target gRNA hybridizes with the target sequence and the nuclease cleaves the DNA molecule to alter the expression of one or more? gene products

and where the gRNA? as defined above. Preferably the system? CRISPR.

Preferably the system? packaged in two adeno-associated virus (AAV) vectors.

Preferably the system inactivates one or more? gene products.

Preferably the genomically targeted nuclease? SpCas9. Other SpCas9 can be VQR and EQR (PAM NGNG) (see Nature. 2015 23 Jul 2015; 523 (7561): 481-485. Doi: 10.1038 / nature14592), eSpcas9 which recognizes PAM NGG (see Science. 2016 January 1; 351 (6268): 84? 88. Doi: 10.1126 / science.aad5227), xCas9, PAM (NG, GAA, and GAT) (see Nature. 2018 April 05; 556 (7699): 57? 63. Doi: 10.1038 / nature26155 ), evoCas9 (PAM NGG) (see Casini et al doi: 10.1038 / nbt.4066), SpCas9 HF1 (see Kleinstiver BP, Nature 2016), HyPaCas9 (see Chen JC, Doudna JA, Nature 2017), KamiCas9 or a Cas9 from Staphylococcus aureus (SaCas9). Preferably the cell? a eukaryotic or non-eukaryotic cell, preferably a human or mammalian cell.

Preferably, one or more? gene products are rhodopsin. The rhodopsin gene preferably has the sequence described in NCBI, with access number NM_000539; VERSION NM_000539.3. (genome version hg38).

Preferably the expression of one or more? gene products? decreased.

Preferably the retinal specific promoter sequence comprises a polynucleotide with 90% or more? homology with a polynucleotide sequence selected from the group consisting of the promoter of the IRBP (interphotoreceptor retinoid-binding protein) promoter, GRK (G protein-coupled receptor kinase promoter) promoter. The IRBP gene? preferably characterized by the sequence disclosed in NCBI Access No. 19661.

The Cas9 protein? preferably consisting of an amino acid sequence contained in the UniProtKB / Swiss-Prot Database, with the access number Q99ZW2, Streptococcus pyogenes serotype M1 (SpCas9).

For VQR, the 2015 Kleinstiver plasmid access number can? being NCBI Sequence Read Archive (SRA): SRP066862 for high fidelity SpCas9, VQR and VRQR.

In the recombinant adeno-associated viral vector according to the invention, the gRNA has a polynucleotide sequence established in any of the SEQ ID NO: 1-6 or comprises a polynucleotide sequence having 90% or more? of homology with a polynucleotide sequence established in any of the SEQ ID NO: 1-6, and can? be combined with a Cas9 protein as defined above.

The nucleic acid that encodes the Cas9 protein can? be introduced into the mammalian cell prior to introducing single-chain guide RNA into the mammalian cell.

The kit according to the invention can? also comprising at least one nuclear localization signal, at least one cell penetrating peptide, at least one marker domain, or a combination thereof.

Preferably, the pharmaceutical composition or the gRNAs of the invention can be administered to the subject via implantation, injection or via viral vector.

Preferably, administration takes place by subretinal injection.

An additional therapeutic agent can? be administered in combination to the subject, where such additional therapeutic agent is for the treatment and / or prevention of retinal diseases. The gRNA can also be modified as indicated in Hendel A et al., Nat biotech 2015.

The term "carrier" refers to a nucleic acid molecule capable of carrying another nucleic acid to which? been connected. Carriers include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules comprising one or more? extremity free, no ends? free (e.g. circular) nucleic acid molecules comprising DNA, RNA, or both; and other varieties? of polynucleotides known in the art. A type of carrier? a "plasmid", which refers to a circular double-stranded DNA ring into which further segments of DNA can be inserted, for example by standard molecular cloning techniques. Another type of carrier? a viral vector, in which sequences of virally-derived DNA or RNA are present in the vector for packaging into a virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.

Some vectors are able to replicate autonomously in a host cell into which they are introduced (for example, bacterial vectors that have a bacterial origin of replication and episomal vectors from mammals). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and then are replicated along with the host genome. Furthermore, some vectors are capable of targeting the expression of genes to which they are functionally linked. Such vectors are referred to herein as "expression vectors". Common expression vectors useful in recombinant DNA techniques are often in the form of plasmids.

The recombinant expression vectors may comprise a nucleic acid of the present invention in a form suitable for the expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more? regulatory elements, which can be selected on the basis of host cells to be used for expression, that is? functionally related to the nucleic acid sequence to be expressed.

The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogues. In aspects of the subject described herein the terms "chimeric RNA", "chimeric guide RNA", "guide RNA", "single guide RNA" and "synthetic guide RNA" are used interchangeably and refer to the polynucleotide sequence comprising the sequence guide. The term "guide sequence" refers to the sequence of about 20 bp within the guide RNA that specifies the target site and can? be used interchangeably with the terms "guide" or "spacer". How used here the term "variant" should be understood as a set of qualities? who have a model that differs from there? which happens in nature.

For "complementariet?" do you mean the capacity? of a nucleic acid to form a hydrogen bond with another nucleic acid sequence via either the traditional Watson-Crick type or other non-traditional types. A complementarity? percentage indicates the percentage of residues in a nucleic acid molecule that can? forming hydrogen bonds (e.g., Watson-Crick base coupling) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70% , 70%, 80%, 90% and 100% complementary). "Perfectly complementary" means that all contiguous residues of one nucleic acid sequence will bind to hydrogen with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary", as used herein, refers to a degree of complementarity? that ? at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 13, 14, 15, 16, 17, 18, 19, 20, 21, 21, 22, 23, 24, 25, 30, 35, 35, 40, 45, 50, or more? nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

As used herein, the "stringent conditions" for hybridization refer to the conditions under which a nucleic acid that has complementarity? with a target sequence it hybridizes predominantly with the target sequence and substantially does not hybridize with non-target sequences.

The stringent conditions are generally sequence dependent, and vary according to a number of factors, in general, more? long? the sequence, pi? high? the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology -Hybridization With Nucleic Acid Probes Part 1, Second chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.

By "hybridization" is meant a reaction in which one or more? polynucleotides react to form a complex that stabilizes through the hydrogen bond between the bases of the nucleotide residues. The hydrogen bond can? occur via Watson Crick base pairing, Hoogstein bond or any other specific sequence. The complex can? comprise two filaments that form a duplex structure, three or more? filaments that form a complex a pi? filaments, a single self-hybridizing filament, or any combination of these. A hybridization reaction can? constitute a phase of a process pi? extended, such as the initiation of PGR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is defined as the "complement" of the given sequence.

As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as in and mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated in peptides, polypeptides or proteins. The encoded transcripts and polypeptides can be collectively referred to as a "gene product". If the polynucleotide? derived from genomic DNA, the expression pu? include mRNA splicing in a eukaryotic cell.

Does the "CRISPR system" refer collectively to transcripts and other elements involved in the expression or direction of business. genes associated with CRISPR ("Cas"), including sequences encoding a Cas gene, a guide sequence (also called a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcribed from a CRISPR locus. In some embodiments, one or more? elements of a CRISPR system derive from a particular organism that includes an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system? characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also called a protospacer in the context of an endogenous CRISPR system).

In the context of forming a CRISPR complex, by "target sequence" is meant a sequence over which a lead sequence? designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity? Not ? necessarily required, provided that there is a complementarity? sufficient to cause hybridization and to promote the formation of a CRISPR complex. A target sequence can? include any polynucleotides, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is found in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence can? being inside an organelle of a eukaryotic cell, for example mitochondrion or chloroplast. A sequence or a model that can? be used for recombination at the targeted locus comprising the target sequences? referred to as "editing model" or "editing polynucleotide" or "editing sequence". In aspects of the currently disclosed topic, an exogenous model polynucleotide can? be referred to as the "editing model". In one aspect of the currently disclosed topic, recombination? a homologous recombination.

In some respects, a vector includes one or more? insertion sites, such as a restriction endonuclease recognition sequence (also called "cloning site"). In other respects, one or more? insertion sites (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and / or downstream of one or pi? sequence elements of one or more? carriers. When are pi? different driving sequences, a single expression construct can? be used to target the business? of CRISPR to pi? different and corresponding target sequences within a cell. For example, a single vector can? understand about or more? of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more? guide sequences. In some aspects of the invention, about or more? of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more? such vectors containing guide sequences can be provided, and optionally introduced into a cell.

In general, a guiding sequence? any polynucleotide sequence that has a complementarity? sufficient with a target polynucleotide sequence to hybridize with the target sequence and to directly bind a specific sequence of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity? between a lead sequence and its corresponding target sequence, when? optimally aligned using a suitable alignment algorithm,? about or more? approximately 50%, 60%, 75%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. The optimal alignment can? be determined with the use of any suitable algorithm for sequence alignment, including, for example, the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transformation (e. g. the Burrows Wheeler Aligner ), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Alumina, San Diego, California), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). some embodiments, a guide sequence is about or more than 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25 , 26, 27, 28, 29, 30, 35, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a lead sequence is less than about 75, 50, 45, 40 , 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.

In some embodiments, the target sequence can? be 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99, 6%, 99.7%, 99.8% homologous to the nucleotide sequences reported here.

The term "homologue" refers to "homology%" and? used here interchangeably with the term "identity%", and refers to the level of identity. of the nucleic acid sequence when aligned with a sequence alignment program. For example, as used here, 80% homology means the same thing as 80% identity. of sequence determined by a defined algorithm, and consequently a homolog of a given sequence has an identity? of sequence greater than 80% over a given sequence length.

The exemplified levels of identity? of sequence include, but are not limited to approximately, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99, 7%, 99.8% or more identity of sequence to the nucleotide sequences referred to in SEQ ID NO: 1-6.

The phrase "acceptable pharmaceutical carrier" used herein means an acceptable pharmaceutical material, composition or carrier, such as a liquid or solid filler, diluent, excipient or solvent encapsulating material, involved in the transport or transport of the subject compound from an organ, or part of the body, to another organ, or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient. Some examples of materials that can act as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) tragacanthus powder; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppositories; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline solution; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates and / or polyanhydrides; and (22) other compatible non-toxic substances used in pharmaceutical formulations.

Also included in the present invention are nucleic acid sequences derived from the nucleotide sequences mentioned herein, e.g. functional fragments, mutants, variants, derivatives, analogs and sequences with a% identity. at least 80% with the sequences mentioned here. The term "functional" can? be understood as being able to maintain the same activity. The "fragments" are preferably at least 10 nt long. The "derivatives" can be recombinant or synthetic. The term "derivatives" also refers to polynucleotides pi? long or longer? courts and / or having, for example, a percentage of identity? at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95%, 96%, 97%, 98%, more ? preferably at least 99% with the sequences indicated herein. In the present invention "at least 70% identity" does it mean that the identity? can be at least 70%, or 75%, or 80%, or 85%, or 85%, or 90%, or 95% or 100% identity? of the sequence to the indicated sequences. This applies to all% of identities. mentioned. Preferably, the% of identity? refers to the entire length of the indicated sequence. Furthermore, polynucleotides having the same nucleotide sequences as a polynucleotide exemplified here are included in the scope of the present invention with the exception of nucleotide substitutions, insertions or deletions within the sequence of the polynucleotide, provided that these variant polynucleotides maintain substantially the same activity. relevant functional of the polynucleotides specifically exemplified. Therefore, the polynucleotides reported herein are to be understood as comprising mutants, derivatives, variants and fragments, as discussed above, of the specifically exemplified sequences. The invention in question also contemplates those polynucleotide molecules which have sequences sufficiently homologous with the polynucleotide sequences of the invention so as to allow hybridization with this sequence under strict standard conditions and with standard methods (Maniatis, T. et al, 1982) . The polynucleotides described here can also be defined in terms of identity. pi? specific and / or ranges of similarity with those exemplified here. The identity of the sequence will be? generally higher than 60%, preferably higher than 75%, pi? preferably higher than 80%, even more? preferably higher than 90%, and can? be above 95%. The identity and / or the similarity of a sequence can? be 49, 50, 51, 51, 52, 53, 54, 54, 55, 56, 57, 58, 58, 59, 59, 60, 61, 61, 62, 63, 64, 64, 65, 66, 67 , 68, 68, 69, 70, 71, 72, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, or 99% or greater than a sequence exemplified here. Unless otherwise specified, as used here, the identity? percentage of the sequence and / or the similarity of two sequences can? be determined using the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Such an algorithm? incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990). BLAST searches can be performed with the NBLAST program, score = 100, word length = 12, to obtain sequences with the identity? desired sequence percentage. To get gapped alignments / sequence alignments with blanks for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997). When using the BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) can be used. See the NCBI / N1H website.

Also included in the present invention are the RNA sequences corresponding to the sequences disclosed herein, the complementary sequences to such RNA sequences or to the sequences exposed here, the inverse complementary sequences to these RNA sequences or to the sequences exposed here.

Examples

Example 1

MATERIALS AND METHODS

Plasmids

To generate the pCCL.PGK.wtRHO + 3'UTR, a 250 bp region of the 3'UTR of the RHO gene? was amplified from the genomic DNA of P23H <48> transgenic mice and cloned into the pCCL-PGK.wtRHO <49> downstream of the STOP codon of the WT RHO cDNA. To generate the pCCL.P347S.RHO + 3'UTR, the region comprising exon 5 of the RHO cDNA, carrying the P347S mutation, and a 250bp region of the 3'UTR of RHO amplified by the genomic DNA of the transgenic mouse P347S < 14> were cloned into the pCCL-PGK.wtRHO vector downstream of exon 4 of the RHO cDNA. The SpCas9_gRNA1 effector plasmid? was generated by cloning gRNA1 into plasmid pX330-U6-Chimeric_BBB-CBh-hSpCas9 (Addgene plasmid # 42230) by hybridizing oligonucletides at BbsI sites. The VQRHF1-SpCas9_gRNA5 effector plasmid? was obtained by cloning gRNA5 into plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 by oligo-annealing at BbsI sites, followed by subcloning of the U6-gRNA5 cassette into plasmid MSP2440 (Plasmid Addgene # 72250) carrying the expression cassette for VQRHF1 -SpCas9 <50>. To generate the effector plasmids carrying the hygromycin resistance gene, the expression cassette for the hygromycin resistance gene under the control of the Herpes Simplex Thymidine Kinase (TK) virus promoter? has been subcloned in the SpCas9_gRNA1 and VQRHF1-SpCas9_gRNA5 plasmids downstream of the polyA signal of the SpCas9 expression cassette, thus generating? the SpCas9_gRNA1-TKHygro and VQRHF1-SpCas9_gRNA5-TKHygro plasmids. To generate the plasmids CMV.HA.wtRHO + 3'UTR and CMV.HA.P347SRHO + 3'UTR, the human RHO cDNA carrying the WT or P347S mutation and the 250 bp region of RHO 3'UTR were cloned into the plasmid CMV.HA.RHO <51>. RHO mutant plasmids (CMV.HA.RHO delG / delGG / del12.1 / InsT / del9 / del12.5) were generated using the Site-direct Mutagenesis Kit (SDM) (NEB, New England Biolabs, Ipswich, Massachusetts, USA), according to the manufacturer's protocol. Primer pairs (Table 2) were designed to introduce insertions or deletions into CMV.HA.P347S.RHO + 3'UTR and pCCL.PGK.P347S.RHO + 3'UTR plasmids. The plasmid pAAV2.1-U6-gRNA1-RHO-GFP, pAAV2.U6-gRNA5.RHO-GFP and pAAV2.1-U6-scramble-RHO-GFP were generated by cloning the expression cassette for gRNA1, gRNA5 or gRNA scramble in a pAAV2.1-RHO-GFP <52> plasmid upstream of the RHO promoter using the AflII restriction site. The plasmid pAAV2.1-IRBP-SpCas9-spA? was generated by cloning the retinol binding intrafotoreceptor protein (IRBP) promoter into pAAV-pMecp2-SpCas9-spA (Plasmid Addgene # PX551) using HindIII and AgeI restriction enzymes. The vector pAAV2.IRBP.VQR-HF1.SpCas9? was generated by cloning the CMV.VQR-HF1.SpCas9-BGHpA cassette into the AAV2.1 vector <53> followed by the replacement of the CMV promoter with IRBP.

Cell culture

HeLa (ATCC CCL2?), CHO (CHO-K1 (ATCC? CCL-61?)), HEK293T (ATCC CRL-3216?) And human RPE cells (hTERT RPE-1 (ATCC? CRL-4000?)) Were grown in Dulbecco Eagle's modified medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U / mL penicillin and 100 mg / mL streptomycin (Lonza Ltd, Basel), Switzerland). For the protein degradation test, CHO cells transfected with CMV-HA-P347S, WT and mutant RHO plasmids, were treated with 10? G / mL of cycloheximide (CHX) at different time points (0-3-6 hours ) or with MG-132 (50? M) in different times (0-4-6 hours).

Viral production

Lentiviral (LV) vectors pseudotyped with vesicular stomatitis virus G protein were prepared by transient co-transfection of HEK293T cells with the transfer vectors, pMD.Lg / pRRE.Int, pMD2.VSV-Gplasmid coding for the envelope protein, and pRSV-Rev <49>. AAV vectors were produced by triple transfection of HEK293 cells followed by two rounds of CsCl2 <53> purification. For each viral preparation, viral titers (GC / ml) were determined by calculating the mean of the titre achieved with dot-blot analysis <54> and by PCR quantification using TaqMan probes (Applied Biosystems, Carlsbad, CA, USA) . The probes used for dot-blot and PCR analyzes were designed to bind to the IRBP promoter of the pAAV2.1-IRBPSpCas9-spA vector and to the bGHpA region of the vectors encoding the gRNA and RHO- expression cassettes. GFP. The length of the probes varied between 200 and 700 bp.

Cell transformations, isolation of single cell clones and VCN determination.

Transfection of 2.5? 10 <5> HeLa cells? was obtained using the Fugene HD transfection reagent (Promega, Madison, Wisconsin, USA) following the manufacturer's instructions. For each transfection reaction, 2µg of plasmid DNA was mixed with 6µL of Fugene (3: 1 ratio). The transfection of 2.5? 10 <5> HEK293T cells? was performed using the CaPO4 protocol with 1? g of SpCas9_gRNA1-TKHygro or VQRHF1-SpCas9_gRNA5-TKHygro. Starting the day after transfection, the cells were treated with 0.2 mg / ml of hygromycin for 15 days in order to select the resistant cells. antibiotic.

Transfection of 1? 10 <5> human RPE cells? was performed with 1? g of SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 or the respective plasmid controls using the TransIT-XI (Mirus Bio, Madison, USA) following the manufacturer's instructions. Transfection of 2.5? 10 <4> CHO cells obtained using the Transit-XI, following the protocol instructions. Each transfection reaction contained 150 ng of vector expressing RHO P347S, RHO wt, or mutants. To obtain HeLa clones expressing rhodopsin WT or P347S, HeLa cells were transduced with LV carrying RHO WT or P347S expression cassettes. The transduced bulks were diluted to obtain a concentration of 0.3 cells / well and seeded in a 96-well plate. Were genomic DNAs (gDNAs) extracted from clones obtained from a single cell and PCR screening? was performed on the RHO expression cassette as follows: PGK_F and hRHO_ex1_R primers (Table 2), PCR conditions: 30 sec at 94 ° C, 30 sec at 58 ° C and 30 sec at 72 ° C for 30 cycles. The PCR products were separated on agarose gel with 1% TBE (Tris / Borate / EDTA) and stained with ethidium bromide for analysis.

For the determination of the number of vector copies per cell (VCN),? quantitative PCR with 20 ng of gDNA was performed using the TaqMan Universal PCR Master Mix (Applied Biosystem) and the specific probes for human RHO and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (hRHO: Hs00892431m1; GAPDH: Hs03929097_g1, Applied Biosystem Milan Italy). The reactions were performed at 50 ° C for 2 minutes and 95 ° C for 10 min, followed by 40 cycles at 95 ° C for 15 sec and 60 ° C for 1 min. Normalization in the gDNA itself? been performed with the GAPDH and the relative number of copies? was calculated using 2 <- ?? CT> quantification.

Semiquantitative and quantitative analysis with RT-PCR.

Total RNA, purified from Hela RHO WT or P347S clones, from the retina of mice and from human RPE cells? isolated with the RNeasy Mini and Micro kit (Qiagen, Hilden, Germany) respectively according to the manufacturer's instructions. The cDNA? was synthesized in a 20? L reaction by the Superscript III Reverse Transcription (Invitrogen) kit. Semi-quantitative RT-PCR analysis? was performed with the following oligonucleotides: hRHO-Cterm_F and WPRE_R, GAPDH.F and GAPDH.R for the analysis of the mRNA of HeLa cells, hRHO-Cterm_F and hRHO_3'UTR_RC, Cas9.F and Cas9.R GFP.F and GFP.R, m.s26rRNA.F and m.s26rRNA.R and PDE6b.F and PDE6b.R for mRNA analysis of the retinas of treated mice. PCR cycles: 94? C 30 sec, 58? C 30 sec and 72? C 30 sec. The analysis of Real-Time PCR TaqMam? was performed using the ABI Prism 7900 Sequence Detection System instrument (Applied Biosystems Monza, Italy) with TaqMan Universal PCR Master Mix and specific probes for human RHO, human and murine GAPDH and murine Pde6g (hRHO: Hs00892431m1, hGAPDH: NM_02046.3, mGAPDH: , mPde6g: Mm00501964_m1; Applied Biosystems Monza, Italy). The reactions were performed at 50 ° C for 2 min and 95 ° C for 10 min, followed by 40 cycles at 95 ° C for 15 sec and 60 ° C for 1 min. Relative expression of target genes? was normalized to the GAPDH housekeeping gene level for HeLa clones or the Pde6g photoreceptor housekeeping gene in the same cDNA using 2 <- ?? CT> quantification. The values of the triplicates of Quantit? Relative (RQ) for each biological sample were averaged.

Specific deep sequencing (? Targeted deep sequencing?) And off-target analysis

Genomic DNA? was extracted from HeLa clones transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5, from HEK293T cells transfected with SpCas9_gRNA1-TKHygro or VQRHF1-SpCas9_gRNA5-TKHygro, and selected with Qtyro micrographs and DNAs from the microchip kits (DNAi) of the manufacturer. For NGS analysis, the genomic regions flanking the gRNA target sites were amplified by PCR using the AccuPrime Taq DNA polymerase system (Thermo Fisher) and the primers from Table 2. The PCR products were used for the preparation of the libraries. Briefly, the hRHO-Cterm_F and WPRE_R primers and the hRHO-Cterm_F and hRHO_3'UTR_RC primers (primers for 1? PCR amplification) were used, respectively, to specifically amplify the RHO P347S transgene in stable HeLa clones and the RHO P347S in transgenic mice. ? A second amplification with different primers was then necessary (primers for the amplification of the 2nd PCR). For off-target analysis performed in hygromycin-selected HEK293T cells, single pairs of specific primers (primers for 1? PCR amplification) were used. For the preparation of the NGS library, specific barcodes were added to each DNA fragment by means of a limited number of PCR cycles (n = 8) using primers defined as "primers for the amplification of the 3? PCR". Quantity Equimolar library were mixed, diluted and sequenced with an Illumina MiSeq system from CIBIO in Trento. The percentage of indels? been quantified by the CRISPResso webtool. Off-target analysis for each gRNA? was performed using the following COSMID <28> webtool. Off-target analysis? was carried out using NGS and the percentage of indels (insertions and deletions)? been quantified with the CRISPRessoV2 webtool.

Western blotting analysis

Cell lysates were extracted with RIPA buffer: 50 mM Tris-HCl pH 8.0, 150 mM w / v NaCl, 1 mM EDTA, 1% v / v NP-40, 0.1% c / v SDS, 0.05% w / v sodium deoxycholate with the addition of the mix of protease inhibitors (Roche, Basel, Switzerland) <55> at a concentration of 2% .60? g of protein extracts deriving from the HeLa clone and 20? g of cell protein extracts Transfected CHOs were loaded onto 12% polyacrylamide sodium dodecyl sulfate (SDS) electrophoresis gel (PAGE). After electrophoresis, the samples were transferred to PVDF membranes (GE Healthcare). Membranes were incubated with the primary monoclonal 4D2 antibody (1: 500, Millipore, Burlington, Massachusetts USA) or the primary monoclonal anti-HA antibody (Sigma, 1: 1,000), and an anti-B-actin antibody (Abcam , Cambridge, UK) for the normalization of the quantity? protein. The anti-mouse antibody conjugated with horseradish peroxidase (diluted 1: 10,000 for RHO mutant expression analysis, 1: 5,000 for rhodopsin expression in HeLa clones)? was used for the detection of chemiluminescence (Pierce). The quantification? was performed by densitometric analysis of the scanned images using the ImageJ software.

Immunofluorescence and? In-Cell Western?

For immunofluorescence analysis, cells were fixed using 4% v / v paraformaldehyde (PFA) and permeabilized with 0.01% (v / v) Triton X-100 / PBS, while non-permeabilized cells were remained in PBS. Non-specific binding sites were blocked using a blocking solution consisting of 3% bovine serum albumin (BSA) and 10% normal goat serum in PBS. The non-permeabilized cells were incubated with L? primary antibody 4D2 (Millipore, 1: 500) and l? primary anti-HA antibody (Sigma, 1: 1,000) in blocking solution; the permeabilized cells were incubated with l? primary anti-HA antibody (Sigma, 1: 500) and anti-binding protein antibody l? Immunoglobulin (BIP) (Sigma, 1: 200). Antibodies conjugated with Alexafluor488 antitope (from goat) (1: 1,000) and with Alexafluor594 anti-rabbit (from goat) (1: 1,000) were used as secondary antibodies. After washing,? Incubation was performed with 6-diamidino-2-phenylindole DAPI (1: 5,000), then the slides were mounted with the Dako Fluorescent Mounting Medium (Dako Omnis). Immunofluorescence? was visualized with the Zeiss LSM 520 confocal laser scanning microscope and analyzed with the ZEISS ZEN Microscope <56> software.

To perform the 'In-Cell Western' analysis the cells were fixed, treated with blocking solution and stained with anti-HA antibody (Sigma, 1: 1,000). ? The secondary anti-mouse IRDye 680RD antibody (from goat) (LI-COR Biosciences, Lincoln, Nebraska, USA) was used. The acquisition? was performed using the Odyssey Imager (LI-COR Biosciences).

Cytotoxicity

The cytotoxicity assay performed using the Cytotoxicity Detection Kit (LDH, Roche)? been used for the quantification of cell death, which is based on measuring the concentration of lactate dehydrogenase (LDH) released in the supernatant by the cytosol of damaged cells. Transfected stable HeLa clones were incubated with the reaction mix provided by the kit and processed according to the manufacturer's instructions. Untransfected HeLa cells were used as "low control" (spontaneous LDH release), while the Triton 100X? was added to the "high control" sample (maximum LDH release). Absorbance? was measured at 492 nm by a spectrophotometer (Safire, Tecan, UK). The percentage of cytotoxicity? of the sample? was measured following this equation: Cytotoxicity? (%) = (exp.value - low control) / (high control - low control) x 100.

Animal care

The mice were housed in the TIGEM enclosure (Pozzuoli, Italy) and kept in a 12 hour light / dark cycle. The P347S transgenic mice were kindly provided by Prof. Enrico Surace. The P347S transgenic mice were maintained as F0 by crossing them with themselves, and were crossed with the C57BL / 6J mice purchased from Envigo Italy SRL (Udine, Italy) to generate experimental F1 mice.

Subretinal injection of AAV vectors into P347S transgenic mice

This study ? was made in accordance with l? Association for Research in Vision and Ophthalmology for the Use of Animals in Research in Vision and Ophthalmology and with the regulation of the Italian Ministry of Health for procedures on animals (authorization of the Ministry of Health No. 147/2015-PR). Surgery? was performed under general anesthesia and all tests were performed to minimize the suffering of the animals. One-week-old mice were anesthetized with an intraperitoneal injection of 2 mL / 100 g body weight with ketamine / medetomidine, then AAV2 / 8 vectors were administered subretinally via a transcoroidal transcleral approach, as described by Liang et al. <57>. The eyes were injected with 1 µL of vector solution. The AAV2 / 8 dose (GC / eye) was 1x10 <9> of each vector / eye, therefore, co-injection resulted in a maximum of 2x10 <9> GC / eye.

Electrophysiological recordings

P347S mice were dark adapted for 3 hours. Mice were anesthetized with ketamine and medetomidine and placed in a stereotaxic apparatus, under dim red light. The pupils were dilated with a 0.5% drop of tropicalamide (Visufarma, Rome, Italy), and the body temperature? been kept at 37.5 ° C. The flashes of light were generated by a Ganzfeld stimulator (CSO, Ophthalmic Instruments Construction, Florence, Italy). Electrophysiological signals were recorded through gold / gold-plated electrodes inserted under the lower lids in contact with the cornea. The electrodes of each eye referred to a needle electrode inserted subcutaneously at the level of the corresponding frontal region. The different electrodes were connected to a two-channel amplifier. After the completion of the answers obtained in conditions of darkness? (scotopic), the recording session continued with the aim of analyzing the visual pathway of the cones in response to light (photopic). To minimize noise, the different responses obtained following exposure to light were averaged for each stage of luminescence. The maximum scotopic response of rods and cones? was measured in dark conditions (scotopic) with two flashes of 0.7 Hz and an intensity? luminous of 20 cd s / m2, the photopic responses of the cones were isolated in light conditions with a continuous white background light of 50 cd s / m2, with 10 flashes of 0.7 Hz and an intensity? bright of 20 cd s / m2.

Analysis of the pupillary response to light

Pupillary light responses of P347S mice were recorded in dark conditions. using the TRC-50IX retinal camera connected to a charge-coupled device of the NikonD1H (Topcon Biomedical Systems) digital camera. Were the mice exposed to light stimuli at several lux for about 10 seconds and one image per eye? acquired using IMAGEnet (Topcon Biomedical Systems) software. For each eye, the pupil diameter? state normalized to the diameter of the eye (from the temporal to the nasal side).

Histological analysis

Mice were sacrificed and eyes fixed with Davidson's fixative (deionized water, 10% acetic acid, 20% formalin, 35% ethanol) overnight, followed by dehydration in serial ethanols and by? incorporation into paraffin blocks. Micro-sections ten micrometers thick were cut along the horizontal meridian and progressively distributed on slides.

The mouse retina embedded in paraffin? was treated with a citrate buffer for antigen retrieval, incubated with primary antibodies and developed with 3,3? -Diaminobenzidine (DAB) using a Leica Biosystems Bond-III automatic IHC dye according to the manufacturer's instructions. The primary antibodies used were: monoclonal 1D4 (1: 1000, a gift from Robert Molday), monoclonal 4D2 (1: 30,000) (Millipore, Burlington, Massachusetts USA) and monoclonal anti-GFP (1: 2,000, Proteintech, Manchester UK ). The images were acquired in bright field with a Zeiss LSM 510 AxioCam microscope.

Statistical analysis.

Was the data analyzed to verify significance? statistics using two-way ANOVA or Student's t-test. Were all values of each group expressed as mean? SEM. All group comparisons were considered significant at P <0.05, P <0.01, P <0.001.

RESULTS

The CRISPR / Cas9 system specifically modifies the RHO P347S mutation in vitro.

CRISPR / Cas9-mediated inactivation of dominant mutations in the RHO gene could reduce and delay photoreceptor degeneration and vision loss in RP patients. To specifically target the P347S mutation, caused by a C to T transition in exon 5 of the RHO gene, two gRNAs were designed. The guide RNA1 carries the point mutation (T) in the seed sequence, as the last nucleotide of the 20 nt of the protospacer, and guides the SpCas9 to the recognition of the PAM 5'-CGG-3 'sequence. On the reverse complementary strand, the gRNA5 drives the high fidelity variant? VQRHF1-SpCas9 to the PAM 5'-CGAG-3 'sequence which includes the point mutation (A, in the reverse complementary strand) (Fig. 1a). In the absence of human cell lines constitutively expressing rhodopsin, HeLa cells were engineered with a lentivirus (LV) expressing the phosphoglycerate kinase (PGK) promoter, RHO WT or P347S cDNA followed by a 250 bp 3 'long region. UTR for a pi? full of the translated mutants following the CRISPR-mediated cut. Two clones carrying two copies of RHO WT or P347S (Fig. 6a) expressing a comparable level of rhodopsin (Fig. 6b) were selected and used for further experiments.

To evaluate the specificity? and the efficiency of the gRNAs, the HeLa RHO WT and P347S clones were transfected with effector plasmids expressing gRNA1 or gRNA5 and the respective SpCas9 nucleases (SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5), or with plasmids without gRNAs analyzed by next generation gene sequencing (NGS).

CRISPResso analysis (http://crispresso.pinellolab.partners.org/)<27> of the sequence reads deriving from the HeLa RHO P347S clone transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 showed an editing of 65.7% and 28 , 6%, respectively, in a representative experiment (Fig.7a, b), while the sequences obtained from the transfected RHO WT clone were modified 6% and 1%, respectively by gRNA1 and gRNA5 (Fig.7c, d ). The NGS analysis on three independent experiments confirmed the high efficiency and specificity. gRNA1 (62.0 ± 1.8) and gRNA5 (25.4% ± 1.6) in targeting the RHO P347S mutation, with the barely detectable modification of RHO WT (gRNA1, 6.2 ± 0.1; gRNA5, 0.9? 0.1) (Fig. 1b). To further eliminate any distortions due to the different transfection efficiency between the HeLa WT and P347S clones, the allele-specific editing generated by SpCas9_gRNA1 and VQRHF1-SpCas9_gRNA5? was analyzed in the HeLa P347S clone by NGS on the RHO P347S transgenic copies or the endogenous RHO WT alleles. Allele-specific analysis showed that 97.7% and 98.5% of all indels generated in the HeLa clone P347S by SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5, respectively, occurred in the mutant transgene (Fig.1c), confirming the highly specific editing on the P347S mutation.

The main drawback of the CRISPR / Cas9 system? the possibility? to induce off-target effects at the genomic level. The <28> COSMID webtool predicted 28 and 6 possible off-target effects at the genomic level for gRNA1 and gRNA5, respectively. The authors investigated, by means of NGS, the first 10 predicted off-targets for gRNA1 mapped in the intragenic regions, and all potential off-targets predicted for gRNA5 (Fig.1d). In short, a resistance box to? hygromycin under the control of the thymidine kinase (TK) promoter? was cloned in both effector plasmids (SpCas9_gRNA1-TKHygro and VQRHF1SpCas9_gRNA5-TKHygro) with the aim of analyzing off-target sites in non-clonal hygroselected HEK293T cells expressing Cas9 nuclease and gRNA. Deep sequencing of the off-target regions showed detectable cleavage in the intronic sequences of four genes, 3 predicted for gRNA1 and 1 for gRNA5 (Fig. 1d). CRISPResso analysis of potential splice site changes did not predict any risk of interference with the canonical splice signals of affected introns (Fig. 8a). (Fig.8b and c).

In fact, the expression of these genes not cut? was modified following intronic cleavage in immortalized human retinal pigment epithelium (hRPE) cells <29> transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 (Fig. 8b and c).

The specific modification of the P347S region leads to the efficient degradation of the mutant RHO protein

To better characterize the RHO variants generated by gene editing, the authors analyzed the frequency and type of indels generated by CRISPResso in the HeLa RHO P347S clone transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 and investigated whether small insertions or deletions created by the repair NHEJ comprising the last codons of the P347S RHO gene would generate frameshift mutations which in turn will allow to destroy the mutated allele. This analysis, performed on a window ranging from -10 to 10 nucleotides around the target sites, revealed that the indels pi? Frequently generated by gRNA1 are 1-2nt deletions which occur around positions -2 to 1 with respect to the cleavage site (Fig. 1e). Conversely, the insertion of a T nucleotide into the cleavage site? the indel pi? frequent of samples treated with gRNA5 (Fig. 1f). In order to deepen this analysis, the authors calculated the frequency of deletions, substitutions and insertions generated in the samples treated with gRNA1 and gRNA5. The results identified the deletions as major changes. frequent for both gRNAs (88.9% and 47.8% of all indels, Fig. 1g) but,? Interestingly, a higher prevalence of replacements and listings? was obtained in samples treated with gRNA5 (32.8% and 19.4% of all indels) compared to samples treated with gRNA1 (9.9% and 1.9% of all indels) (Fig. 1g). The distribution analysis of indels revealed extensive deletions, up to 80 nt, and insertions, up to 13 nt, in the samples treated with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 (Fig. 9). In particular, despite the differences in indel type and distribution, 81.5% and 68.9% of all modified sequences generated frameshift mutations (Fig. 1h), which suggests a strong potential for destruction of the ? RHO P347S allele.

Considering that Cas9 generates a cut at the level of the C-terminal RHO region? an in vitro study was performed on the localization and degradation of the RHO mutants generated following the? genomic editing. The six mutants pi? frequencies identified by CRISPResso following gRNA1 or gRNA5-mediated shearing led to a shift of the reading frame (delG, delGG and insT, Fig. 10) or to the deletion in frame of a region that includes the stop codon TAA and to the generation cos? of new stop codons downstream of the canonical one (del9, del12.1, del12.5, Fig. 10).

The cellular localization of these six RHO mutant proteins? was studied by immunofluorescence in CHO cells transfected with plasmids expressing RHO variants fused in the N-terminal region with the human influenza hemagglutinin (HA) tag. All mutant variants showed localization of rhodopsin at the plasma membrane (Fig.2a) as observed for rhodopsin WT and P347S (Fig. 11), contrary to what was observed for rhodopsin P23H which was retained in the endoplasmic reticulum (ER ) <30>. In addition, the essay by? In-Cell Western? performed on non-permeabilized and permeabilized CHO cells and transfected with the six selected RHO mutants, it allowed to quantify the localization of the mutated proteins at the plasma membrane level.

The test confirmed the localization of all the mutants analyzed mainly on the plasma membrane, so? as the retention in? ER of rhodopsin P23H (Fig.12a, b). The persistent expression of rhodopsin mutants generated following editing could compromise the therapeutic benefits of this strategy. Therefore, the expression of rhodopsin WT, P347S and RHO mutants? was evaluated by western blot in CHO cells two days after transfection (Fig.2b and Fig.12c). The degradation rate of RHO mutants? was measured in CHO cells transfected following treatment with the protein translation inhibitor cycloheximide (CHX). Unlike rhodopsin P347S, rhodopsin proteins generated by 9 and 12-nt deletions were degraded very rapidly, with a 60-95% reduction in expression after 6 hours of translation inhibition (Fig. 2c).

Treatment with the proteasome inhibitor MG-132 at different time intervals (0, 4, 6 hours) revealed that the degradation of the rhodopsin mutants del9, del12.1 and del12.5 was mediated by the proteasome (Fig. 2d) . The degradation of mutants pi? frequency generated by Cas9-generated cleavage demonstrates a significant reduction in rhodopsin, observed in HeLa P347S cells transfected with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5 effector plasmids. Similarly, the P347S rhodopsin protein showed a 40% reduction in expression following transfection with effector plasmids in P347S-expressing HeLa cells (Fig.3a, b). Furthermore, the transcript of rhodopsin P347S? was significantly reduced post editing as demonstrated by RTqPCR (Fig. 3c). The control plasmids did not affect the expression of the RHO P347S protein and, in particular, the expression of the rhodopsin WT did not? been modified following treatment with SpCas9_gRNA1 or VQRHF1-SpCas9_gRNA5, how could it be predicted considering the specificity? editing for the P347S allele (Fig. 3a, b and c). Interestingly, the HeLa clone expressing the P347S mutation showed greater viability. cellular following silencing of RHO P347S gene expression by genomic editing. In fact, the cytotoxicity test? showed that the P347S clone presented a viability? lower (90%) than the HeLa WT clone (99%), while following treatment with Cas9 and the specific gRNA? a 50-60% increase in vitality has been demonstrated? cellular compared to negative controls, suggesting that approximately 60% reduction of the P347S RHO protein was sufficient to significantly reduce the dominant negative effect of the RHO mutation in vitro (Fig. 3d).

The specific cleavage of the P347S mutation involves up to 30% of the photoreceptors of the mouse With the aim of translating in vivo the results obtained in vitro into a preclinical model of RP, the authors treated transgenic mice carrying the human RHO allele with the P347S <mutation. 14>. To enhance the translational potential of this approach, the components of the CRISPR / Cas9 system have been inserted into AAV2 / 8 vectors. The transport of the CRISPR / Cas9 system or of therapeutic genes in AAV vectors yes? proven very effective for the treatment of retinal diseases in various preclinical studies <31, 32, 33>. In order to limit the expression of SpCas9 to photoreceptors, the authors used the promoter of the retinol-binding intrafotoreceptor protein (IRBP), while the expression of GFP, driven by the rhodopsin promoter, allowed to identify the expression of gRNAs in the injected eyes. Briefly, effector AAV vectors are AAV vectors expressing SpCas9 WT or VQRHF1 in combination with AAV expressing gRNA1 or gRNA5, while control AAV vectors are those associated with AAV expressing gRNA scramble (Fig.4a). P347S transgenic mice at day P7 received a single subretinal injection per eye of two AAV2 / 8 vectors carrying SpCas9 WT or VQRHF1 in combination with effector gRNAs or exchange gRNA. Four weeks after injection (P40), molecular analyzes of the treated retinas showed coexpression of the SpCas9, GFP and Pde6b genes (Fig. 13), which indicated the presence of AAV vectors in photoreceptors following subretinal injection. Subsequently, the frequency and type of indel in the target locus and the inactivation of the P347S mutant transcript were evaluated. NGS analysis detected indels in the RHO gene up to 14% in 11 retinas following treatment with SpCas9 + gRNA1, and indels up to 30% in 15 retinas treated with VQRHF1-SpCas9 + gRNA5. In the retinas treated with the control gRNA (n = 6, data not shown) no indels were detected in the RHO gene. (Fig.4b). The alterations pi? common at the target sites were comparable to the types of indels observed in vitro (Fig. 4c), suggesting a destabilization of mutant rhodopsin transcripts and mutant proteins, with a potential therapeutic benefit in counteracting photoreceptor degeneration. This strategy, capable of specifically targeting the human RHO P347S gene, led to a significant reduction, from 20% to 60%, of the P347S mRNA in 11 out of 20 retinas expressing effector vectors compared to contralateral retinas injected with control vectors (Fig. 4d).

The localization of rhodopsin? was studied at P50 in the retina injected with effector vectors and control vectors (Fig. 4e). Total rhodopsin (RHO WT murine RHO P37S human) in the retina injected with control vectors? It was detected using the 4D2 antibody capable of binding to the aN-terminal region of the protein, which recognizes the WT and mutant rodospin. The localization? it has been observed predominantly in the outer nuclear layer (ONL) and, to a lesser extent, in the inner segment (IS) and in the outer segment (OS). In contrast, in the retina injected with effector vectors capable of reducing the expression of the dominant RHO hP347S gene, rhodopsin was more? evident in? IS and in? OS, suggesting the restoration of a correct localization in the? OS. In order to confirm these data, endogenous murine rhodopsin WT? was specifically stained using the 1D4 antibody capable of recognizing an epitope in the C-terminal region of rhodopsin, which includes the P347 residue, without binding to the mutant protein. In the retina transduced with the control vectors? The localization of murine RHO has been identified mainly in the cell body of the rod in? ONL, along the IS and also in the? OS. Transduction with effector vectors preserved the localization of endogenous rhodopsin WT mainly at the level of the OS. Staining for GFP in both control and treated eyes identified the transduced portion of the retina (Fig. 14).

Therapeutic efficacy of CRISPR / Cas-mediated knockdown of the P347S mutation in mice.

The authors then investigated whether allele-specific silencing of the P347S mutant has therapeutic efficacy in a mouse model of RP <4> expressing RHO P347S <14>. Retinal function of P347S transgenic mice treated with effector and control AAV vectors? was examined 1 month after injection (P40) both by electroretinography (ERG) and by analyzing the pupillary response to light. ERG analysis showed a significant improvement in b-wave amplitudes at 20cd.s / m <2> in retinas treated with SpCas9 + gRNA1 or VQRHF1-SpCas9 + gRNA5 compared to their respective controls (Fig. 5a). The improvement of the activity? of the retina? was evidenced by post-focus responses to light stimuli, which result in a transient constriction of the pupil. Such a variation? less evident and not statistically significant in the eyes injected with AAV VQRHF1-SpCas9 + gRNA5 compared to their control. In contrast, eyes injected with AAV SpCas9 + gRNA1 showed significantly more gradual pupillary constriction. high compared to eyes injected with gRNA scramble (Fig. 5b).

These results together indicate that specific editing with the aim of selectively silencing a dominant mutation in the RHO gene? promising for slowing photoreceptor degeneration observed in dominant RPs.

DISCUSSION

Retinitis pigmentosa (RP) causes progressive photoreceptor death and, in the worst case, blindness. Treatment of RP? a very ambitious challenge as rod death precedes the onset of symptoms. Therefore, early therapeutic intervention aimed at blocking or reducing rod degeneration could be an effective approach to preserving vision in patients with RP. This was the goal of previous nutrient studies in RP, and the results have been evaluated over several years <34, 35, 36.>

Pi? recently, gene therapy approaches aimed at correcting the mutations identified in the genes that cause RP <4, 37, 38> have been investigated. In this study, the authors directed their efforts to propose a CRISPR / Cas9 system-mediated gene modification approach directed towards a heterozygous common mutation in the RHO gene that causes an autosomal dominant form of RP (adRP) (RP4, OMIM 613731). The ClinVar Miner <39> database lists 156 variants in the RHO gene, of which 50 of them are pathogenic or probable pathogenic variants associated with RP4 (https://clinvarminer.genetics.utah.edu/variants-by-gene/RHO). In this scenario, the killing of both alleles followed by gene integration represents the most effective approach. convenient to pursue. In fact, the? Ablate-and-replace? (removal and replacement) could be used for the treatment of all pathogenic mutations of the RHO gene, thus bypassing it? the heterogeneity? allelic of the disease. However, this strategy requires biallelic modification, which is difficult to achieve in vivo. Furthermore, the threshold level of the rhodopsin protein in the cell represents a crucial issue. For rhodopsin, c '? a subtle balance between insufficiency and toxicity <40, 41> which requires fine regulation of the substitution or increase of rhodopsin WT. Indeed, the "suppression and substitution" approach carries the risk of converting a dominant condition into a more subdued one. mild in severe recessive PR, when replacement is not as effective as suppression. Conversely, a specific and permanent silencing of the mutant allele by the CRISPR / Cas9 system, as proposed in this study, would prevent the pathogenic effects of the dominant mutation, while preserving the WT allele, which would not even require the ethical problem. the destruction of a human functional gene.

Several studies have demonstrated the beneficial effects of the CRISPR / Cas9 system in the treatment of adRP in preclinical models1 <2, 20, 21>. Most of the reported studies were designed to correct the P23H mutation, the pi? frequent in North America, accounting for 8% of adRP cases. To date, a gene modification strategy focused on the C-terminal mutation in the human RHO gene is not? has been described yet and, in particular, the correction of the P347S is not? never been addressed.

Here, the authors describe the use of the CRISPR / Cas9 system to silence the RHO P347S mutation, a dominant mutation prevalent in the European population capable of causing severe adRP. SpCas9 and its high fidelity variant? (VQRHF1), associated with mutation-specific gRNAs, were employed to silence the P347S mutation in engineered HeLa cell lines and in P347S transgenic mice. In vitro experiments demonstrated that both SpCas9 variants, WT SpCas9 and VQRHF1-SpCas9, resulted in efficient and mutation-specific cleavage, albeit the high-fidelity variant? has highlighted a profile pi? safe with an off-target effect in only 1 site at the genomic level without modifying the expression of the off-target gene. In particular, the genomic analysis of indels? was fundamental to predict the fate of the mutants pi? frequent at the time of the cut mediated by the CRISPR / Cas9 system. Double-stranded cleavage of a dominant mutation followed by DNA repair via the NHEJ mechanism could, in principle, generate new rhodopsin mutants leading to a dominant negative effect on the WT protein. A thorough in vitro characterization of the pi? frequent generated post-editing demonstrated proteasome-mediated degradation of pi? common frame-shifted mutants and,, in-frame mutants exhibiting a larger cytoplasmic tail. long. Indeed, the RHO mutants located on the plasma membrane could be degraded by the quality control mechanism of endocytosis? protein occurring in the presence of non-native plasma membrane proteins <42>. These results also highlight the safety of cleavage in the C-terminal domain of rhodopsin, expanding the application of CRISPR-mediated editing in the 3 'terminal region of mutated genes.

In addition to safety, mutation-specific editing performed in vitro demonstrated robust knockdown of P347S expression that significantly improved viability. of cells stably expressing P347S rhodopsin, supporting the thesis that degradation of the P347S RHO protein in vivo could improve the RP phenotype. To demonstrate this hypothesis, the authors transferred the CRISPR / Cas9-mediated editing system to the retina of P347S transgenic mice using AAV2 / 8 vectors. AAV2 / 8 vectors efficiently transport genes to photoreceptors in the retina <43, 44> and the successful use of CRISPR-AAV vectors in retinal diseases is already in progress. been proven <45, 46, 47>. P347S transgenic mice received a single injection of AAV2 / 8 effector or control vectors. One month later, during rod degeneration, molecular analyzes revealed a variable but effective permanent suppression of human RHO P347S gene expression following mutation-specific gene modification mediated by both SpCas9 variants. Although the frequency of indels differs significantly from that observed in vitro, the types of indels resemble the pattern observed in vitro suggesting a comparable effect on the P347S rhodopsin protein in vivo. Significant evidence of therapeutic benefit was obtained through pupillary light response analysis (PLR) and electroretinography (ERG). Comparison of ERG analysis between treated eyes and control eyes at P40 demonstrated significantly improved responses in treated eyes compared to controls.

The beneficial effects observed by ERG analyzes were also observed at P50 through histological analyzes on the treated and control retina. The dislocation and retention of rhodopsin in the? ONL? was partially saved in the retina injected with AAV2 / 8 vectors, showing a greater localization of murine rhodopsin WT in the? OS as a consequence of the reduction of the dominant effect exerted by human RHO P347S. ? It is important to note that although the structure of the outer nuclear layer has not been significantly improved by the treatment,? a significant functional recovery was recorded by ERG and PLR demonstrating that the reduction of the expression of the allele P347S? was sufficient to improve the function of the surviving rods, but did not significantly prevent their death.

Overall, this study provides the proof of concept for using the CRISPR / Cas9 system to specifically silence the allele carrying one of the strongest mutations. of the RHO gene associated with adRP. The use of? SpCas9 WT or variant VQRHF1, which exhibit similar efficiency in this study, could be useful for 62% of the pathogenic and probable pathogenic variants of the RHO gene, listed in the Clinvar Miner Database, showing genomic sequences suitable for allelic inactivation specific of the mutation (Table 1), without the need? of an integration therapy with the RHO gene. Would the translation of this genomic editing approach benefit from the development of more viral or non-viral delivery systems? clinically efficient and non-toxic, allowing targeting and editing of a greater number of photoreceptors. Allele-specific genome editing therefore has the potential to become the therapeutic intervention of choice for the precise silencing of mutations that cause dominant retinal degeneration.

Tables

Table 1. List of 50 pathogenic and probable pathogenic RHO variants associated with dominant Retinitis Pigmentosa 4 according to the Clinvar Miner database (version 2020-03-02).

The variants are shown in the first column according to the nomenclature authorized by Human

Genome Variation Society (HGVS). The second column indicates whether the variant? pathogenic or

probably pathogenic. The third column reports the SpCas9 (WT or VQR) that could be

used to achieve a specific modification of the mutation according to the requirement used in

this study (PAM including mutation and mismatch in the gRNA seed sequence). There

"Not specific" indicates that to date not? any design available. The nxt column

represents part of the human RHO cDNA that hosts the mutation (in bold) responsible for

RP4. Capital letters indicate exons, introns are lowercase. The dotted lines

indicate deletions. The putative PAM sequence recognized by the WT or VQR variant?

underlined. The last column shows the reference number of the variants according to the database

of single nucleotide polymorphism (dbSNP).

Table 2 Primer used in this study

Claims (10)

Claims 1. At least one isolated guide ribonucleic acid (gRNA), called gRNA comprising or consisting of a perfectly paired polynucleotide sequence or which? substantially complementary to SEQ ID NO: 2 (5'- gtcctaggcaggtcTTAGGC -3 ') or 1 (5'-GGAGACGAGCCAGGTGGCCT -3'), or functional fragments thereof, in which such fragments are at least 15 nucleotides long, preferably 17-18 nucleotides and comprise SEQ ID NO: 4 (5'- aggcaggtcTTAGGC -3 ') or SEQ ID NO: 3 (5'- CGAGCCAGGTGGCCT -3' ) or a variant thereof with at least 85% homology to any of the SEQ ID NO: 1-2 or 3-4, where this variant includes SEQ ID NO: 5 (5'- tcTTAGGC -3 ') or SEQ ID NO: 6 (5'-GGTGGCCT -3 '). 2. At least one gRNA according to claim 1 comprising or? consisting of the polynucleotide sequence of SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC -3 ') or 1 (5'-GGAGACGAGCCAGGTGGCCT -3'). 3. A nucleic acid encoding the gRNA or fragments of claims 1 or 2, preferably wherein said nucleic acid? functionally connected to a promoter sequence which? recognized by a phage RNA polymerase for in vitro RNA synthesis, preferably wherein said nucleic acid? part of a vector. 4. A system of short palindrome repeats grouped and separated at regular intervals (CRISPR) - protein associated with CRISPR 9 (Cas9) comprising: to. a Cas9 protein or a nucleic acid encoding a Cas9 protein, e b. at least one gRNA according to claim 1 or 2 or at least one nucleic acid according to claim 3, preferably in which the system is or a. or b. are packaged in adeno-associated viral vectors (AAVs), preferably where the Cas9 protein? a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof, such as Cas9-VQRHF1, VQR, EQR, eSpcas9, xCas9, evoCas9, SpCas9HF1, HyPaCas9 or KamiCas9 or a Cas9 of Staphylococcus aureus their recombination of the naturally occurring molecule, codon-optimized, or their modified versions, and their combinations. 5. The CRISPR / Cas9 system of claim 4 where - when the gRNA comprises or consists of the perfectly matched polynucleotide sequence or what? substantially complementary to SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3 ') or includes or? consisting of SEQ ID NO: 1 (5'-GGAGACGAGCCAGGTGGCCT -3 '), the Cas9 molecule recognizes a PAM sequence of sequence 5'-CGG-3', preferably Cas9? SpCas9, eSpCas9, xCas9, evoCas9, SpCas9HF1, HyPaCas9 or KamiCas9; - when does the gRNA include or? consisting of the polynucleotide sequence that matches perfectly or what? substantially complementary to SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC -3 ') or includes or? constituted by SEQ ID NO: 2 (5'-gtcctaggcaggtcTTAGGC -3 '), Cas9 recognizes a PAM sequence of sequence 5'-CGAG -3', preferably Cas9? VQRHF1, VQR or EQR, or sequence SEQ ID NO: 7 (5'-NNGRR (N) -3 ') where R? A or G, preferably Cas9? SaCas9. A vector comprising at least one gRNA of claim 1 or 2 or at least one nucleic acid of claim 3 or comprising a CRISPR-Cas system according to any one of claims 4-5. 7. An adeno-associated recombinant viral vector comprising a viral genome comprising a retinal specific promoter sequence, preferably an interphotoreceptor retinoid-binding protein (IRBP) promoter and a polynucleotide sequence encoding the means for genome editing functionally linked to the promoter sequence, wherein said genome editing means comprises CRISPR / Cas9 comprising a Cas9 protein and a guide RNA (gRNA) as defined in claim 1 or 2 or at least one nucleic acid of claim 3 or the CRISPR system Cas according to any one of claims 4-5, preferably wherein the vector comprises a capsid protein derived from an adenoassociated virus of AAV8, AAV3, AAV3B or AAV9, preferably wherein the virus genome also comprises an inverted terminal repeat (ITR) nucleotide sequence selected from the group consisting of AAV2, AAV1, AAV3, AAV4, AAV6 and AAV9. A pharmaceutical composition comprising at least one guide RNA according to claim 1 or 2, at least one nucleic acid according to claim 3, a CRISPR / Cas9 system according to any one of claims 4-5, at least one vector according to claim 6 or 7 and at least one pharmaceutically acceptable carrier and / or excipient. 9. An in vitro or ex vivo method for altering the expression of the RHO gene in an isolated cell, said method comprising the introduction into an isolated cell of a guide RNA according to any one of claims 1-2 or a nucleic acid of the claim 3 in a CRISPR / Cas9 system, where the guide RNA targets the gene and the Cas protein cuts the genomic loci of the DNA molecules encoding one or more? gene products, by altering the expression of one or more? gene products, preferably said cell? a photoreceptor cell, a retinal progenitor cell, a retinal ganglion cell or an induced pluripotent stem cell (iPSC), preferably a cell from a patient with Retinitis Pigmentosa (RP), plus? preferably said method modifies a P347S mutation in the RHO gene. 10. A gRNA according to claim 1 or 2, or the nucleic acid according to claim 3, or the CRISPR / Cas system according to any one of claims 4-5, or the vector according to claim 6 or 7, or a pharmaceutical composition which comprises according to claim 8 for use as a medicament, preferably for use in gene therapy, preferably for use in the treatment of retinal degenerative disorder, preferably said disorder being induced by the P347S mutation in the rhodopsin RHO gene.