IT201900012345A1 - DIAGNOSTIC DEVICE AND ITS USES - Google Patents

Description

DIAGNOSTIC DEVICE AND ITS USES

DESCRIPTION

The present invention relates to an integrated device for carrying out various laboratory procedures, in particular of molecular and / or cellular biology. In particular, an integrated device according to the invention is configured for clinical and research practice applications, such as those generally intended mainly for:

- health workers of first level structures (clinics and hospitals), located in developed or developing regions;

- health workers of second or third level structures who need to carry out a limited number of tests with quick responses;

- personnel involved in medium and long-term space missions as well as missions in remote or difficult to access areas of the Earth.

These applications can be substantially divided into two groups, those of molecular and cellular biology, for the analysis of nucleic acids, proteins or cell cultures and those in the field of reproductive medicine.

Background of the invention and state of the art

Genetics is the future of medicine: the so-called "tailored medicine" or "targeted medicine" is mainly based on the identification of clinically relevant, constitutional or acquired genetic variants. The presence or absence of a certain variant can confirm a diagnostic suspicion, establish the individual risk of developing a given condition over time, define a prognosis and / or identify the most appropriate and effective treatment for the patient. In addition, molecular genetic tests, based on the identification of the genome of specific pathogens, already allow for the rapid diagnosis of infection in conditions of suspected epidemics.

In the current scenario, access to genetic-molecular tests is limited by the relatively high costs / sample, long response times, the need for human resources and highly specialized laboratories, and the difficulty in interpreting the results. For these reasons, in several countries the diagnostic laboratory structures are pyramidal, with most of the molecular tests carried to the second and third level diagnostic centers, generally large hospitals or university centers. However, this system strongly penalizes patients who refer to first-level centers, especially if they are located in developing countries or, more generally, in remote areas.

A further need that will arise in the medium term, although initially concerning a narrow niche of users, is that relating to medium or long-term space travel, in anticipation of human missions to the Moon or Mars, now scheduled by all international space agencies. . Although similar to that of remote areas of the Earth, this scenario is further complicated by microgravity, the narrowness of spaces, the lack of health and laboratory personnel, and emerging health problems, unknown to date. Unlike what happens today on Earth, where one of the major sources of morbidity (i.e. the number of cases of disease recorded during a given period in relation to the total number of people examined) are environmental pathogens, it can be predicted that during space travel, prolonged exposure to cosmic radiation will be one of the major causes of illness for astronauts, with a consequent increased risk of neoplastic diseases.

Currently, the routine clinical application of genetic tests is limited and prevented by some drawbacks:

- the current trend of molecular genetics laboratories is towards push automation, however it still requires repeated manual interventions by qualified personnel, in addition to the presence of numerous tools, each dedicated to a part of the experimental process, with relatively high costs;

- the result of genetic tests is not always easily interpretable; in particular, although the diagnostic methods currently in use allow the identification of a very large number of gene variants, they often have no relapse into clinical practice, mainly due to the lack of data in the scientific literature. To date, for example, although there are many mutations identified in cancer, only a few are recognized by the EMA or the FDA as "druggable";

- the medium-long duration of the turnaround-time of genetic tests often limits their extensive application in patient clinical management protocols. For example, in some haematological diseases the therapeutic choices can be oriented by the finding of minimal signs of disease, diagnosable only by molecular methods. There are also clinical scenarios where the molecular diagnosis is even of an urgent / emergency nature: this is the case of the identification of some pathogens, in which the patient's isolation and / or the immediate establishment of therapy may be required.

With regard to applications in reproductive medicine, it should be noted that although for different reasons and causes, couple infertility is a common problem in both developed and developing countries, with a global prevalence of around 10%. In developed countries, the increase in the average reproductive age and lifestyles make male causes of infertility relatively more frequent. In developing countries, where the average reproductive age is lower, the prevailing causes of couple infertility are female and above all obstructive, such as in the case of tubal tuberculosis or sexually transmitted infections (Stevenson et al., 2016; Benagiano et al., 2006). In the first scenario, the method of choice for medically assisted fertilization is ICSI (Intra Cytoplasmic Sperm Injection), whose implementation requires well-equipped laboratories and highly specialized personnel. In the second scenario, in vitro fertilization (IVF) can be used for which it is sufficient to bring male and female gametes into contact in an adequate culture medium and in sterile conditions. For these reasons, to date, these assisted fertilization methods are carried out in highly specialized laboratories.

Furthermore, assisted fertilization methods are currently also used in the veterinary / zootechnical field in which, especially in the case of valuable animals, crosses are carried out in the laboratory.

In the context of research, the performance of various and numerous experimental procedures is often required. Although research laboratories are generally well structured and adequately trained, there are some applications that require repetitive operations, sometimes with experimental times that are not compatible with regular working hours.

In these cases, the automation of laboratory procedures allows to reduce the burden of staff, to standardize procedures and results, as well as to obtain reproducible scientific data in lower times and costs.

In this context, devices that belong to the "Point Of Care" (POC) category are already known. In particular, these are laboratory diagnostic application tools for first-level centers, which have a high degree of operational simplicity and do not require special skills from the operator. POCs are now quite common for routine biochemical tests (such as blood sugar, cholesterol, etc.). A separate discussion is valid for genetic tests that have significantly higher levels of complexity, both in terms of steps of the experimental procedures, with consequent automation difficulties, and for the manual skills required of operators.

For this type of applications the devices of the “Genetic-Point Of Care” (G-POC) category are used. To date, only very few G-POCs are on the market and are intended for a limited number of applications. All G-POCs share the use of DNA amplification by PCR and signal detection through fluorescent oligonucleotide probes / primers. Conveniently, this approach forms the basis of almost all molecular genetics, regardless of the portability and / or degree of automation of the tools.

Among the devices on the market there is, for example, Revogene (GenePoc, Quebec, Canada), an instrument created solely for the identification of two bacteria (C. difficile and S. agalactiae) by applying real time PCR.

However, even this device is not fully satisfactory as:

- allows genomic DNA to be extracted only from bacterial cells (and not from eukaryotic cell / tissue samples),

- does not allow to identify variants of single nucleotides,

- cannot be used for applications other than DNA amplification in PCR.

Cepheid xpert (Cepheid, California, USA) is an instrument that has been on the market for several years, with different configurations based on the number of samples that allows to extract DNA and RNA, and amplify DNA, the only possible applications.

Spartan rx (Spartan Bioscience Inc, Ottawa, Canada) is marketed for CYP2C19 gene analysis only; moreover it can be used only for cells obtained from buccal swab from which the DNA is not extracted and purified but subjected to direct amplification after cell lysis. Also this device is not fully satisfactory as: - it cannot be used for different tissues, due to the presence of DNA polymerase inhibitors, present in most cases, especially in whole blood.

- failure to purify the extracted DNA reduces its amplification efficiency, standardization of results and use for quantitative approaches,

- it cannot be used for applications other than DNA amplification.

Q-POC (Quantum dx, Newcastle, UK) is not yet on the market and has been in development for several years. It is based on a semiconductor microfluidics system. However, even this device is not fully satisfactory as the use of lyophilized reagents and the circulation system of the fluids in micro-cartridges limits the application of the instrument only to the analysis of nucleic acids and is not very versatile since it is limited to the genetic tests that the manufacturer develops.

Gene Radar (Nanobiosym, Massachusetts, USA) is a microfluidics-based device that allows you to perform capillary electrophoresis on consumable devices. However, even this device is not fully satisfactory as it does not allow the various cell biology and research applications obtainable with the present invention.

There are also several patent applications relating to devices for genetic analysis. For example, International applications WO2007149791 and WO2007100986 refer to automated systems for the purification of substances from biological samples, in particular RNA. Application WO2014144548 refers to a system and a method for the rapid analysis, quantification and identification of nucleic acids or proteins. Application WO200403950 refers to a microfluidic system for the purification and / or analysis of a nucleic acid in a sample. Application WO200403950 relates to a device for simultaneously extracting and fractionating DNA from a lysate or a whole sample. Application US2011229897 refers to a device for extracting and analyzing DNA.

None of the documents mentioned above describes a device that allows to obtain the various cell biology and research applications obtainable with the present invention.

Purposes of the present invention

The purpose of the invention is to propose a composite device, conceived as a portable and automated laboratory, which allows to overcome the drawbacks present in traditional solutions.

Another purpose of the invention is to propose a device inside which all the chemical / biochemical reactions necessary for the whole experimental process take place.

Another purpose of the invention is to propose a device that intends to carry out experiments / analyzes in molecular biology and genetics both on the analysis of DNA and proteins.

Another purpose of the invention is to propose a device that intends to perform specific experimental protocols on in vitro cell cultures.

Another purpose of the invention is to propose a device that intends to carry out cultures of embryos, human or animal, for medically assisted treatment of the IVF type.

Another purpose of the invention is to propose a device that will satisfy the growing demand for autonomy of health centers in coli or disadvantaged areas, for carrying out genetic tests of gnostic, prognostic or therapeutic significance, in the context of applications of tailoreddicine.

Another purpose of the invention is to propose a device that will satisfy the growing demand for autonomy of coli health centers or in disadvantaged areas, for the identification of the genome of pathogens biological samples of patients.

Another purpose of the invention is to propose a device for zoology applications for genetic epidemiology studies of insect populations.

Another purpose of the invention is to propose a composite and compact device, portable, automatic and which produces reliable and reproducible results.

Another purpose of the invention is to propose a device that can be easily managed even by unskilled personnel.

Another purpose of the invention is to propose a device that provides easily interpretable results.

Another purpose of the invention is to propose a device that provides highly standardized molecular tests.

Another purpose of the invention is to propose a device that allows to carry out assisted fertilization methods without necessarily requiring traditional infrastructures, both in terms of human resources and equipment.

Another purpose of the invention is to propose a device that is suitable for use in laboratories that are not particularly structured or in areas that are geographically distant from more specialized centers.

Another purpose of the invention is to propose a device that allows the analysis of information deriving from laboratory procedures even by non-expert operators.

Another purpose of the invention is to propose a device that can be used for applications in molecular genetics and biology.

Another purpose of the invention is to propose a device that can be used for reproductive medicine applications.

Another purpose of the invention is to propose a device that can be used for research applications.

Another purpose of the invention is to propose a device that allows you to quickly perform molecular genetic tests.

Another purpose of the invention is to propose a device that can be used in conditions of microgravity.

Another purpose of the invention is to propose a device that is easily implementable and with low costs.

Another purpose of the invention is to propose a device that is an alternative and / or improved with respect to known devices.

All these purposes, both individually and in any combination thereof, and others which will result from the following description, are achieved, according to the invention, with a device with the characteristics indicated in claim 1.

Description of the figures

The present invention is further clarified hereinafter in some of its preferred embodiments described below for purely illustrative and non-limiting purposes with reference to the attached drawings, in which:

Figure 1 shows a schematic view of the device according to the invention, Figure 2 shows a perspective view of the device according to the invention without the connection tubes of the syringes to the reactor,

Figure 3 shows an exploded perspective view of the device of Fig. 2,

Figure 4 shows a top view of the device of fig. 2,

Figure 5 shows a solid schematic perspective view of the reactor of the device according to the invention in a first embodiment,

figure 6 shows a schematic side view of the reactor of fig. 5,

Figure 7 shows a schematic perspective view in horizontal section of the reactor of the device according to the invention in a second embodiment,

figure 8 shows in solid perspective side view the realization of the reactor of fig. 7,

figure 9 shows a schematic perspective view of the solid construction of the reactor of fig. 7,

Figure 10 shows a solid schematic perspective view of the reactor of the device according to the invention in a third embodiment,

Figure 11 shows a schematic perspective view of the construction of the reactor of fig. 10,

Figure 12 shows a solid schematic perspective view of the reactor of the device according to the invention in a fourth embodiment,

figure 13 shows a schematic side view of the reactor of fig. 12,

Figure 14 shows a schematic representation of the molecular strategy used for the determination of the APOE genotype. The reactor used is that of fig. 5. The DNA is extracted in the extraction chamber 301 of the reactor and subsequently amplified and analyzed in the reaction chambers 501 and 503. The expected result is schematized according to the observed genotype. The color of the fluorescence obtained varies according to the presence of the specific alleles.

Figure 15 shows a schematic representation of the molecular strategy used for the determination of the presence of BCR-ABL fusion transcripts. The reactor used is that of fig. 5. Total RNA is extracted from peripheral blood samples in the extraction chamber 301 of the reactor and subsequently amplified and analyzed in the three reaction chambers 501, 502 and 503. The expected result is schematized based on the chimeric gene identified. The color and intensity of the fluorescence obtained vary according to the rearrangement present in the sample and its relative quantity, respectively,

Figure 16 shows a schematic representation of the molecular strategy used for the determination of SMN protein levels in HeLa cells treated with salbutamol. The reactor used is that of fig. 12. A) After the extraction of total proteins, SMN and GAPDH are immobilized by binding with a specific antibody, linked to paramagnetic beads. B) The detection of proteins occurs by means of specific polyclonal antibodies, produced in different species, which are in turn recognized by fluorescent antibodies directed against the Fc fragment of the immunoglobulins. C) The amount of protein is determined based on the fluorescence emitted by the two secondary antibodies (represented in gray tones), measured by the instrument. The variation in SMN protein levels is established relative to those of the control protein (GAPDH).

Description of the invention

As can be seen from the figures, the device 1 comprises a manipulation apparatus 2 configured to transfer fluid substances between corresponding containers 4 - preferably defined by a plurality of syringes 4 - and a reactor 10.

In particular, the fluid substances transferred may include the sample to be analyzed and / or the air and / or appropriate reagents, either individually or in a suitable mixture thereof. Furthermore, suitably, the fluid substances transferred can be in the liquid or gaseous state, or in a mixture thereof.

The fluid handling apparatus 2 advantageously derives from the device described in US patent 8,669,096, the content of which is understood herein as fully incorporated by reference. With respect to the device described in US 8,669,096, in a preferred form of the present invention, the extraction and purification chambers containing nucleic acid binding membranes have been eliminated.

The preferred characteristics of the present device are also illustrated below, which differentiate it from the one described in US patent 8,669,096.

In particular, the apparatus 2 comprises a plurality of containers 4, and preferably syringes 4, also of different capacities and placed in suitable housings 5 mounted on a common base 11.

Conveniently, the apparatus 2 also comprises a plurality of connection tubes 6 configured to collect the fluids leaving the end of each syringe 4 and to transfer them into a reactor 10. Conveniently, each tube 6 is welded, in correspondence with a first end, at the outlet of a corresponding syringe 4 and, at the other end, it is welded to the reactor 10, so that the transfer of fluids occurs without losses.

Conveniently, each syringe 4 and the corresponding housing 5 can be numbered progressively. Furthermore, advantageously, each syringe 4 can also be equipped with a QR-code for recognizing the content and the specific kit, which is housed in the device 1, as well as to avoid incorrect positioning of the syringes 4 by the user.

Conveniently, the syringes 4 can be arranged parallel to each other, so as to reduce the size of the device 1.

Advantageously, one or more of the syringes 4 can be of the precision type, that is, configured to pipette volumes up to 0.01 ml, in order to allow the addition of precise quantities of reagents.

Advantageously, the plunger 8 of the syringes 4 is actuated by a telescopic piston 12 which is part of the manipulation apparatus 2 and, suitably, connected to a control and command unit 14, which allows its automated command and control.

Advantageously, both the syringes 4 and the tubes 6 can be made of materials resistant to heat and chemical compounds such as alcohols, ethers, acids and bases commonly used in the biological and / or chemical field; moreover, said materials are preferably non-toxic and this in order to avoid causing reactions in the biological samples inserted and, for example, it can be medical propylene in the Purell HP548N <®> formulation.

The device 1 also comprises a heating and / or cooling unit 16 configured to vary the temperature of the reactor 10.

Conveniently, the heating and / or cooling unit 16 can have a complementary shape to that of the reactor 10, in order to house it at least partially, and this in order to obtain an adequate heat exchange. In particular, the heating and / or cooling unit 16 can provide a recessed seat 17 with a shape substantially complementary to that of the reactor 10. The heating and / or cooling unit 16 allows to carry out incubations at a constant and controlled temperature but also to carry out repeated thermal cycles suitable for DNA amplification by polymerase chain reaction (PCR). Conveniently, the heating unit 16 can consist of an aluminum block whose temperature variation can be controlled by a Peltier system or other known temperature control systems that allow a ramping rate of at least 1 ° C / sec. Conveniently, the heating and / or refrigerating unit 16 can be controlled manually or, preferably, is controlled by a control and command unit (for example a microprocessor), which for example can be the same unit 14 that controls the apparatus handling 2.

To avoid deformation of the reactor due to temperature variations, the device 1 is equipped with a lid 21 configured to cover the reactor 10 above. In particular, the lid 21 can be applied / constrained by pressure and is in transparent material, for example in plexiglas. Conveniently, the material of the lid 21 has characteristics of optical indifference in order not to generate phenomena of refraction or diffraction of the light during the detection of the fluorescence.

Preferably, the device (1) comprises a cover (21) that can be applied / constrained to pressure of an optically indifferent material, configured to cover the reactor (10) at the top, which prevents the deformation of said reactor following temperature variations and allows the detection of the fluorescent signal, without refraction or diffraction phenomena of light,

The device 1 also preferably comprises means 18 for immobilizing the fluid substances, in particular the sample, when they enter and pass through the reactor 10. Conveniently, the immobilization means 18 are used to avoid the loss of the sample during the washing step.

Advantageously, the immobilization means 18 comprise an electromagnet 20 and a plurality of paramagnetic beads, configured to bind with the sample and / or with the reagents. Unlike a permanent magnet, the electromagnet 20 generates a magnetic field only when activated. The orientation of the magnetic field can, for example, be oscillating in such a way as to allow the movement of the paramagnetic beads and thus mix the fluid substances present in the reactor 10. This oscillation is obtained by alternating the electric field that generates the magnetic field. Conveniently, the electromagnet 20 can be controlled manually or, preferably, it is controlled by a control and command unit, which for example can be the same unit 14 that controls the handling apparatus 2 and / or the heating unit and / or coolant 16.

Conveniently, the reactor 10, with the heating and / or cooling unit 16 and the immobilization means 18, are housed in a structure 13 mounted on the base 11.

The device 1 also includes an optical measurement apparatus 22, configured to carry out optical measurements on the fluid substances present inside the reactor 10. In particular, the optical measurement apparatus 22 is configured to carry out fluorescence measurements.

The optical measuring apparatus 22 includes:

- an excitation light source 24, preferably composed of one or more LED lamps and / or one or more laser sources,

- a detector 26, preferably a diode or alternatively a CCD camera, e

- filters configured to isolate the emission wavelengths of the individual fluorochromes, used in the experimental procedures.

Conveniently, the detector 26 can be located above the reactor 10 so that the excitation and measurement of the light emitted take place in a geometry that provides for the reflection of light radiation. The detector 26 measures and records the light produced by the fluid substances - in particular the sample - contained within the reactor 10, for example by fluorescence, during the various experimental procedures. Conveniently, the fluorescence emission at a suitable wavelength can be used to monitor the progress of the analyzed reactions.

The signal recorded by the detector 26 can be converted into analytical, qualitative or quantitative data. Conveniently, the conversion, as well as the control of the excitation light sources 24 can be carried out manually, or, preferably, it is controlled by a control and command unit, which for example can be the same unit 14 that controls the manipulation apparatus. 2 and / or the heating and / or cooling unit 16 and / or the electromagnet 20.

The device 1 also comprises the command and control unit 14 configured to control and coordinate the various components 2, 16, 20, 22 of the device itself. Conveniently, the unit 14 can include and / or be associated with a memory unit in order to be able to save the data detected and / or processed.

Conveniently, the unit 14 can comprise a processor programmed to control and coordinate the various components and, advantageously, to process the detected data. More in detail, suitably, in the command and control unit 14 a software module is loaded which allows the control of the different components 2, 16, 20, 22. For example, the software module is able to define the sequence and the times of activation / deactivation of the various components 2, 16, 20, 22 of the device 1 and, suitably, the accurate sequential injection of the appropriate volumes of the different reagents contained in the different syringes 4. The command and control unit 14 is also configured to collect and convert the raw data into analytical data, easy to interpret even for non-expert operators.

In addition, the command and control unit 14 can comprise means of communication to send the detected and / or processed data to a further device. The means of communication can comprise transmission means of the wireless type, even short range, or via cable.

Preferably, the command and control unit 14 includes and / or is associated with a user interface that is simple and intuitive to use even for non-specialist personnel. Preferably, said user interface is constituted by a touch-screen type display or by a display associated with a keyboard or other input means.

As mentioned, the device 1 comprises a microfluidic reactor 10 which, essentially, defines the container within which the different chemical / biochemical reactions take place.

Advantageously, the reactor 10 is of the disposable type. Preferably, the reactor is made of plastic material, for example medical polypropylene. Conveniently, the reactor 10 can be made of the same material of which the syringes 4 and / or the tubes 6 are made.

Advantageously, the reactor 10 is made of optical and biocompatible plastic material.

Conveniently, the reactor 10 is particularly small in size, for example about 56.5 x 35 x 2.5-4 mm.

The reactor 10 comprises inside one or more chambers 30 connected to each other by ducts 32, preferably cylindrical. In particular, said ducts 32 define inflow and outflow ducts for the fluids from / to the chambers 30. In particular, the ducts 32 are crossed by the samples to be analyzed / treated, possibly added with suitable reagents, and / or by waste products. reactions and / or gases (in particular air) and / or other substances.

Conveniently, the reactor 10 is formed by a parallelepiped body 29 (block), of laminar conformation (i.e. with a length and width greater than the thickness), in which cavities are obtained, defining the chambers 30, and hollow sections which connect said cavities and define said connection ducts 32.

The chambers 30 can have a circular or polygonal shape, preferably with rounded corners, to favor fluid dynamics and avoid stagnation of the reactants. For example, the chambers 30 can have a rhomboidal shape in plan with rounded corners.

Conveniently, in correspondence with the perimeter walls of the body 29, inlet / outlet ports 34 are provided for the inlet / outlet of the connection ducts 32. In addition, in correspondence with the connection ducts 32, anti-reflux valves are provided both to avoid the return of the reagents and to avoid the contamination of stock solutions.

Conveniently, the reactor 10 can have different embodiments and this according to the reaction to be studied.

The device as defined above can be used for:

- carry out analyzes of gene variants, for example aimed at the diagnosis / prognosis or epidemiology, or quantification / qualification of gene transcripts, where said analyzes include the steps of extraction from one or more isolated human or animal biological samples, purification and amplification of nucleic acids and where said steps are carried out inside the microfluidic reactor 10; o to identify the presence of the genome of pathogens in human or animal biological samples, where said analyzes include the steps of extraction from one or more isolated biological samples, purification and amplification of nucleic acids and where said steps are carried out inside the reactor microfluidic 10 o

- to carry out in vitro fertilization procedures or

- to cultivate adherent cells under controlled conditions and / or to measure over time specific biological / biochemical parameters of the cells grown in the microfluidic reactor 10 and / or to evaluate over time the effect of pharmacological treatments in adherent cells grown in vitro in the microfluidic reactor 10 or

- to purify and quantify proteins extracted from biological samples fed into the microfluidic reactor 10 or from cells grown in vitro in the microfluidic reactor 10.

First embodiment

A first embodiment (see Figs. 5,6) can be used for the identification of variants of diagnostic / prognostic / epidemiological significance and for the qualification / quantification of gene transcripts or to identify the presence of the genome of pathogens in human or animal biological samples. Conveniently, therefore, inside the reactor 10 the extraction of nucleic acids (DNA or RNA) is carried out starting from biological samples of various kinds (such as blood, plasma, tissues), possibly RT-PCR and amplification of specific DNA / cDNA regions in a fully automated way.

In this first embodiment the reactor 10 has the shape of a parallelepiped with rounded vertices and of external dimensions for example of about 56.5 mm (width), 35 mm (depth) and 3.5 mm (height)

In particular, in this case, the reactor 10 consists of an extraction chamber 301 and a variable number of reaction chambers 501, 502, 503 joined by connecting pipes 32 equipped with an anti-reflux valve. The number of reaction chambers 501, 502, 503 can suitably vary according to the number of analyzes which are carried out at the same time. In particular, figures 5 and 6 show the model with three reaction chambers 501, 502 and 503.

Regardless of the number of reaction chambers 501, 502, 503, the extraction chamber 301 advantageously has the shape of a prism with a rhomboidal base and rounded corners, to facilitate fluid dynamics and avoid stagnation of liquids near the corners.

Preferably, the extraction chamber 301 has a base with a size of about 28x18 mm and a height of about 2 mm, to thus contain about 1000 µl of fluidic volume. Preferably, moreover, each reaction chamber 501, 502, 503 is cylindrical in shape with a base of about 4 mm in diameter and a height of about 2 mm, to thus define a volume of about 25 µl.

The extraction chamber 301 includes:

- two first bidirectional channels 511, 516 for the inlet / outlet of the fluid / fluids to be treated from / to the reactor 10; in particular, the two channels 511 and 516 are located at two opposite ends of the rhomboid which defines the extraction chamber 301, and

- four second channels 512, 513, 514 and 515 for the introduction of reagents into said chamber 301; said channels are advantageously provided with anti-reflux valves and are located on the opposite side with respect to the duct 32 connecting the extraction chamber 301 to the first reaction chamber 501.

It is understood that the number of second reagent input channels 512, 513, 514 and 515 can be suitably defined based on the number of reagents to be introduced into the extraction chamber 301.

A series of corresponding ducts 32 connect the extraction chamber 301 to the first reaction chamber 501, the latter to the second reaction chamber 502, and the latter to the third reaction chamber 503. In this way, the fluids to be treated suitably and the reactants introduced into the extraction chamber 301 pass in sequence the first reaction chamber 501, the second reaction chamber 502 and the third reaction chamber 503.

Each reaction chamber 501, 502 and 503 is connected to a corresponding third channel - respectively 517, 518 and 519 - for the introduction of further biological sample and / or reagents into the corresponding chamber. Advantageously, each third channel is equipped with an anti-reflux valve.

In addition, from the third reaction chamber 503, an outflow channel 510 for the waste material departs, also preferably equipped with an anti-reflux valve.

Preferably, the aforesaid channels of the reactor 10 have a diameter of about 0.8 mm.

Second embodiment

A second embodiment (see Figs. 7, 8, 9) of the reactor 10 can be used for in vitro fertilization procedures that do not involve intracytoplasmic sperm injection (ICSI). In this embodiment, the reactor 10 allows the entry of gametes and the growth of the zygote up to the phase of 8-16 cells in a sterile environment, with controlled CO2 temperature and voltage.

The reactor 10 in this embodiment has the shape of a parallelepiped with external dimensions for example of about 56.5 mm (width), 35 mm (depth) and 4 mm (height), and consists of at least one, preferably three, chambers of fertilization 601, possibly connected to each other by a series of ducts 32. Figures 7, 8, 9 show the model with three fertilization chambers 601 but it is understood that there could also be only one chamber.

In these fertilization chambers 601, the fertilization and cultivation of embryos takes place up to implantation in the uterus. The number of fertilization chambers 601 varies according to the number of embryos that are grown simultaneously (one embryo for each chamber). Regardless of their number, each fertilization chamber 601 can have the shape of a prism with a rhomboidal base and rounded sides, to facilitate fluid dynamics and avoid stagnation of liquids near the corners. For example, the fertilization chambers have base dimensions of approximately 28x18 mm and a height of approximately 1 mm, for a volume of approximately 500 µl.

Each chamber 601 has a central portion 602 which is suitably depressed with respect to the remaining part of the chamber 601. In particular, the portion 602 is cylindrical in shape (preferably with a height of 1.6 mm and a diameter of 9 mm, for an approximate volume of 125 µl). interior of which the gametes are deposited.

Each fertilization chamber 601 is equipped with a further conduit 630 for depositing the gametes. In particular, each further duct 630 is connected to a corresponding portion 602. Furthermore, suitably, said further duct 630 is closed and sealed before housing the reactor 10 in the device 1.

Conveniently in the case of an embodiment which comprises several fertilization chambers 601 connected in series, a fourth channel 603 is provided (which is connected to a first fertilization chamber 601) for the introduction of the culture medium and a fifth outflow 604 which is connected to another fertilization chamber 601.

Furthermore, the fertilization chambers 601 are conveniently connected to each other by means of ducts 32. Preferably, the connecting ducts 32 slope from top to bottom according to the direction of the flow, in order to reduce the risk of entrapment. of air bubbles.

Conveniently, in an embodiment not shown in which a single fertilization chamber 601 is provided, the fourth inlet channel 603 and the fifth outflow channel 604 are both connected to the same fertilization chamber 601.

Third embodiment

In a third embodiment (see Figs. 10, 11) the reactor 10 can be configured for carrying out experimental methods which provide for the cultivation of adherent cells under controlled conditions of temperature, CO2 tension and culture medium and / o to measure over time specific biological / biochemical parameters of cells cultured in reactor 10 and / or to evaluate over time the effect of pharmacological treatments in adherent cells cultured in vitro in reactor 10

The reactor 10 has the shape of a parallelepiped with external dimensions for example of about 56.5 mm (width), 35 mm (depth) and 3.5 mm (height).

The reactor 10 according to this embodiment consists of one or more culture chambers 701 not communicating with each other. The number of culture chambers varies according to the number of experimental conditions that are analyzed at the same time. Figures 10, 11 show the model with three culture chambers 701.

The culture chambers 701 preferably have the shape of a prism with a rhomboidal base and rounded sides, in order to facilitate fluid dynamics and avoid stagnation of liquids near the corners. Preferably, the culture chambers 701 have a base of about 25x15 mm and a height of about 2 mm, so as to define a volume of about 750 µl.

Each culture chamber 701 is provided with an access channel 703 for cell storage. Two channels are connected to each culture chamber 701, respectively a sixth channel 704 for the inflow of the culture medium and a seventh channel 714 for the outflow of the culture medium.

Conveniently, the channels 703, 704 and 714 can be equipped with anti-reflux valves. All channels 703, 714 preferably have a diameter of 0.8 mm.

Advantageously, for the reactor models 10 which comprise more than 3 culture chambers 701, the dimensions of the chambers themselves can be reduced, for example, to 25x8 mm at the base and 2 mm in height, with a volume of about 400 µl.

Fourth embodiment

In a fourth embodiment (see Figs. 12, 13) the reactor 10 can be configured for carrying out methods that provide for the purification and quantification of proteins of interest to the experimenter, extracted from biological samples introduced into the reactor or from cultured cells in vitro in the reactor itself, and subjected to various experimental conditions and / or to measure over time specific biological / biochemical parameters of the cells cultured in the reactor 10 and / or to evaluate over time the effect of pharmacological treatments in adherent cells cultured in vitro in the reactor 10

The reactor 10 in this fourth embodiment has the shape of a parallelepiped with external dimensions of 56.5 mm (width), 35 mm (depth), 2.5 mm (height), and comprises one or more analytical chambers (respectively 801, 802 and 803) not communicating with each other. The number of analytical chambers can suitably vary according to the number of experimental conditions that are analyzed at the same time. Figures 12, 13 show the model with three analytical chambers 801, 802, 803.

The analytical chambers 801, 802, 803 have a substantially prismatic shape with a rhomboidal base and rounded sides, to facilitate fluid dynamics and avoid stagnation of liquids near the corners and measure for example: base of about 25x15 mm and height of about 1 mm, about 375 µl of volume.

To each analytical chamber 801, 802 and 803 is connected:

- a corresponding channel - respectively 804, 805, 806 - for example for loading the biological sample,

- a corresponding channel - respectively 823, 824, 825 - for the outflow of the various reagents, and

- a plurality of channels 811-822 for the input of culture media / reagents;

for example, four channels are provided for each analytical chamber 801, 802, 803.

Conveniently, channels 811-822 are equipped with anti-reflux valves. All channels 804-825 preferably have a diameter of 0.8 mm.

Advantageously, for reactor 10 models that include more than three analytical chambers, the dimensions of the latter can be reduced, for example, to 25x8 mm at the base and 1 mm in height, with a volume of about 200 µl.

Application examples

By way of example, some detailed protocols of some possible applications of the device 1 according to the present invention follow. The reagents, kits, probes, sequences, culture media, antibodies exemplified below can be replaced with elements known to the skilled in the art and / or equivalent.

Example 1: Molecular test for the presence / absence of the allelic variant ε4 of the APOE gene, on DNA extracted from peripheral blood samples

This application involves the use of the reactor in the first embodiment and includes a cell lysis step, a DNA purification extraction step and a target sequence amplification step.

The APOE gene is present in humans in three main allelic variants, coding for proteins that differ from each other in only two amino acid residues. The presence of one or the other variants modifies the individual risk of developing Alzheimer's disease, among others, which is the most frequent form of dementia in the general population. The three most common alleles in the general population are referred to as ε2, ε3 and ε4. Of these, the ε4 allele significantly increases the risk of Alzheimer's disease, from 4 to 10 times compared to the general population. The three alleles are determined by two SNPs, a T-C transition (rs429358, chr19: 44908684, GRCh38.p12) which has an allelic frequency of about 0.15, and a C-T (rs7412, chr19: 44908822, GRCh38.p12) with an even allelic frequency about 0.05. The different combinations of the two SNPs determine the three alleles.

The implemented protocol allows, starting from peripheral blood or other tissue samples, to perform genomic DNA extraction and amplification, and to determine the genotype at the APOE locus, in a fully automated manner. The experimental strategy is schematized in Figure 14.

For DNA extraction and purification the MagMAX ™ DNA Multi-Sample kit (Applied Biosystems / Thermo Fisher) is used according to protocol 4425070, modified to suit the volumes and materials of the device 1.

In particular, the following operations are carried out:

1) Device 1 is initialized and equipped with twelve syringes 4:

- syringe n ° 1: Protein Kinase (PK) buffer / enzyme mix, connected via channel 512 to the extraction chamber 301 of reactor 10,

- syringe n ° 2: lysis buffer, connected by means of a channel 513 to the extraction chamber 301 of the reactor 10,

- syringe n ° 3: paramagnetic beads, connected through channel 513 to the extraction chamber 301 of reactor 10,

- syringe n ° 4: 100% isopropanol, connected through the channel 514 to the extraction chamber 301 of the reactor 10,

- syringe n ° 5: wash buffer 1 with isopropanol, through the channel 514 to the extraction chamber 301 of the reactor 10,

- syringe n ° 6: wash buffer 2 with ethanol, through the channel 514 to the extraction chamber 301 of the reactor 10,

- syringe n ° 7: elution buffer, connected through the channel 515 to the extraction chamber 301 of the reactor 10,

- syringes n ° 8 and n ° 9: empty, connected through the channels 511, 516 to the extraction chamber 301 of the reactor 10,

- syringe n ° 10: Taqman Mastermix II 1X (ThermoFisher PN 4440040); 900 nM of the APOE-c.364-F and APOE-c.417-R primers; 200 nM of the APOE-c.381-T and APOE-c.381-C probes; H2O via channel 517 to the first reaction chamber 501,

- syringe n ° 11: Taqman Mastermix II 1X (ThermoFisher PN 4440040); 900 nM of the APOE-c.500-F and APOE-c.550-R primers; 200 nM of the APOE-c.519-C and APOE-c.517-T probes; Volume H2O connected via channel 518 of the second reaction chamber 502,

- syringe n ° 12: empty, connected to channel 510 of the third chamber 503. Reagents other than those indicated could conveniently be used, provided they are equivalent. Conveniently, probes other than Taqman probes or even oligonucleotide probes with modified nucleotides (for example LNA or the like) could be used. Furthermore, appropriately, this application is to be considered purely by way of example, since the same experimental approach could be used for the identification of any constitutional or acquired genomic variant.

2) Outside the device 1, the operator inserts, using a syringe with a needle, 100 µl of whole blood (with anticoagulant) into the extraction chamber 301 of the reactor 10, using the channel 511.

3) The reactor containing the whole blood is inserted into the corresponding recessed seat 17 provided in the device 1 and the extraction and analysis protocol is started.

4) At this point the DNA extraction phase begins. The initial step consists in injecting 100 µl of solution into the extraction chamber 301, through syringe No. 1 connected through channel 512. Syringe No. 8 connected through channel 511 draws an equal volume. During this phase the digestion of proteins takes place.

5) The solution is made homogeneous by mixing by pipetting between syringes n ° 8 and n ° 9 connected through channels 511 and 516.

6) The sample is then incubated for 20 minutes at 65 ° C, by heating carried out by the heating and / or refrigerating unit 16.

7) The next step consists in a phase of cell lysis, obtained by injection of 300 µl into the extraction chamber 301, through the syringe n ° 2 connected through the channel number 513. The syringe n ° 8 connected through the channel 511 sucks a equal volume.

8) The solution is made homogeneous by mixing by pipetting between syringes n ° 8 and n ° 9, connected respectively through channels 511 and 516.

9) 20 µl of solution containing paramagnetic beads are pipetted through syringe n ° 3 connected through channel number 513. The sample is made homogeneous by handling it through syringes n ° 8 and n ° 9 connected through channels 511 and 516. This step allows DNA binding to paramagnetic beads.

10) 400 µl of 100% isopropanol are injected (syringe n ° 4, channel 514) to favor the precipitation of nucleic acids and their binding to the paramagnetic beads. The syringe n ° 8 connected through the channel 511 draws an equal volume.

11) The solution is made homogeneous by mixing by pipetting between syringes n ° 8 and n ° 9 connected through channels 511 and 516.

12) The electromagnet 20 is activated and the sample is incubated for 5 minutes at room temperature.

13) With the electromagnet 20 still active, the supernatant is slowly aspirated through the syringe No. 8 connected via channel 511. The air inlet valve is open.

14) The washing phases begin: injection of 150 µl of Wash1 solution (containing isopropanol) (syringe No. 5, channel 514), with the electromagnet 20 on. Syringe n ° 9 connected via channel 516 draws an equal volume.

15) The sample is incubated for one minute at room temperature.

16) The supernatant is slowly aspirated through syringe n ° 9 connected via channel 516.

17) Steps 14, 15 and 16 are repeated.

18) 150 µl of Wash2 solution are then injected (syringe n ° 6, channel 514). Syringe n ° 9 connected via channel 516 draws an equal volume.

19) The sample is incubated for one minute at room temperature.

20) The supernatant is slowly aspirated through syringe n ° 9 connected via channel 516.

21) Steps 18, 19 and 20 are repeated.

22) The residual ethanol is evaporated by aspirating air through the syringe No. 8 connected via channel 511 and opening the air inlet valve.

23) 150 µl of elution buffer are injected and incubated for 5 minutes at room temperature (syringe n ° 7, channel 515). Syringe n ° 9 connected via channel 516 draws an equal volume. In this way the DNA is detached from the paramagnetic beads. The electromagnet 20 remains active.

24) The eluate is sucked into the three reaction chambers through channel 510 and this until the 3 reaction chambers 501, 502, 503 are filled. The air inlet valve is open.

25) Through channel 517 from syringe n ° 10 15 µl of reaction mix are injected into reaction chamber 501. Syringe n ° 12 connected through channel 510 draws an equal volume.

26) Through channel 519 15 µl of reaction mix are injected from syringe n ° 11 into reaction chamber 503. The syringe n ° 12 connected through the channel 510 draws an equal volume.

27) DNA amplification is started in real-time mode. After the initial denaturation of the genomic DNA (T = 95 ° time 10 '), 40 cycles are performed under the following conditions:

the. T = 95 ° time 15 ''

ii. T = 60 ° time 60 ''

28) the fluorescence, produced by the degradation of the Taqman-MGB probe, is measured and recorded by the optical measuring apparatus 22 during each amplification cycle. On the basis of the genotype of the analyzed subject, the presence of different fluorochromes is detected in the first chamber 501 and in the third reaction chamber 503. In particular, each allele gives the following results

The different combinations of the fluorophores will allow to establish the genotype of the subject at the APOE locus.

Example 2: Molecular genetic test for the presence / absence of the BCR / ABL fusion gene on cDNA of peripheral blood samples

This application is carried out using the reactor in the first embodiment, and is based on the extraction of total RNA from peripheral blood samples of patients with chronic myeloid leukemia (CML) or acute lymphoblastic.

This test is commonly used in clinical practice for monitoring the evolution of the patient's disease and response to treatment over time. Classic cytogenetic marker of chronic myeloid leukemia (but also of some forms of acute lymphoblastic leukemia, ALL) is the formation of the Philadelphia chromosome, originating from a balanced translocation between a chromosome 9 and a chromosome 22. This cytogenetic rearrangement determines the formation at the molecular level of a chimeric fusion protein between the BCR gene (located on chromosome 22) and the tyrosine kinase domain of the ABL oncogene (located on chromosome 9). The breaking points observed in most patients with CML determines the formation of a chimeric protein (p210), encoded by the e13a2 mRNA (Fig. 15) with breaking points in intron 13 BCR and intron 1 by ABL. An alternative product, encoded by the e14a2 mRNA, is obtained when the breakpoint on chromosome 22 occurs between exons 14 and 15 of the BCR. One of the two chimeric transcripts is observed in 95% of patients with CML; in 5% of cases both can be observed, due to an alternative splicing phenomenon. In addition, 50% of patients with ALL Ph + have a chimeric gene between exon 1 of BCR and exon 2 of ABL (e1a2); in 45% of cases the same rearrangement present in patients with CML can be observed.

A molecular test was therefore developed that allows the identification of the three most frequent chimeric genes, and we therefore developed a test with a sensitivity of 95% in both CML and ALL Ph +. The experimental strategy is schematized in Figure 15. The native BCR transcript is amplified as a positive control of amplification.

For the extraction of total RNA, the MagMAX ™ -96 Blood RNA Isolation Kit (ThermoFisher scientific, P / N AM1837) is used, modified with respect to the manufacturer's instructions and adapted to the molecular reactor. The same kit can be used for the extraction of RNA from tissue samples other than whole blood or cell cultures. Conveniently, another known kit could be used for RNA extraction. Furthermore, appropriately, this application is to be considered purely by way of example, since the same experimental approach could be used for the identification of any other fusion gene.

The steps of the RNA / cDNA extraction, retro-transcription and amplification protocol are as follows:

1) Device 1 is initialized and equipped with thirteen syringes:

- syringe n ° 1: solution of Lysis / Binding Solution, containing isopropanol, connected to channel 512 of reactor 10,

- syringe n ° 2: paramagnetic beads, connected to channel 513 of reactor 10,

- syringe n ° 3: wash buffer 1 with isopropanol, connected to channel 514 of reactor 10,

- syringe n ° 4: wash buffer 2 with ethanol, connected to channel 514 of reactor 10,

- syringe n ° 5: DNAse solution, connected to channel 514 of reactor 10,

- syringe n ° 6: elution buffer, connected to channel 515 of reactor 10,

- syringe n ° 7 and 8: empty, connected to channels 511 and 516 of reactor 10,

- syringe n ° 10: 1X reaction mix (TaqMan® Fast Virus 1-Step Master Mix, Thermofisher Scientific, P / N: 444432); 400 nM of the BCR-ex14F and BCR-ex15R primers; 100 nM of the BCR-P probe; H2O by volume. Connected to channel 517 of the first reaction chamber 501,

- syringe n ° 11: 1X reaction mix (TaqMan® Fast Virus 1-Step Master Mix, Thermofisher Scientific, P / N: 444432); 400 nM of the BCR-ABLe1a2-F and BCR-ABL-R primers; 100 nM of the BCR-ABLe1a2-P probe; H2O by volume. Connected to channel 518 of the second reaction chamber 502,

- syringe n ° 12: 1X reaction mix (TaqMan® Fast Virus 1-Step Master Mix, Thermofisher Scientific, P / N: 444432); 400 nM of BCRABLe13a2-F, BCR-ABLe14a2-F and BCR-ABL-R primers; 100 nM of the BCR-ABLe13a2-P and BCR-ABLe14a2-P probes; H2O by volume. Connected to channel 519 of the third reaction chamber 503,

- syringe n ° 13: empty, connected to channel 510.

2) The operator inserts 50 µl of fresh whole peripheral blood with anticoagulant into the extraction chamber of the molecular reactor (EDTA, heparin, citrate or other anticoagulants is indifferent to the yield of the extraction protocol). For this purpose, a syringe with a needle is used and the sample is inserted into the reactor through the loading channel 511. The reactor containing the sample is inserted into the special housing of the device 1 that was previously set up with the syringes 4 containing the reagents.

3) 130 µl of solution from syringe n ° 1 are injected through channel 512. An equal volume is aspirated through the syringe n ° 7, connected to the channel 511. The solution is mixed by moving through the syringes 7 and 8, connected to the channels 511 and 516.

4) At this point, 20 µl of solution from syringe n ° 2 are injected through channel 513. The sample is mixed for 5 minutes at room temperature, by pipetting through the syringes No. 7 and No. 8 connected to channels 511 and 516. This step allows the complete lysis of the sample and the binding of the RNA to the paramagnetic beads.

5) The electromagnet 20 is activated and the sample incubated for 5 minutes at room temperature. The supernatant is aspirated through syringe No. 7 connected to channel 511. The air intake channel is open.

6) 150 µl of syringe n ° 3 are injected into the extraction chamber, through channel 514. An equal volume is drawn through syringe n ° 7, connected to channel 511. The sample is incubated for one minute at room temperature. In these phases the electromagnet 20 remains active. This washing step is repeated once.

7) 150 µl of solution are injected through channel 514 (syringe n ° 4).

An equal volume is aspirated through syringe n ° 7, connected to channel 511. The sample is incubated for one minute at room temperature. In these phases the electromagnet 20 remains active.

8) The contents of the reactor are aspirated through syringe n ° 7, connected to channel 511.

9) Through channel 514, 50 µl of solution are injected (syringe n ° 5) and incubated for 5 minutes at room temperature. An equal volume is aspirated through syringe No. 7, connected to channel 511. The electromagnet 20 is not active.

10) Through channel 512 130 µl of solution are injected from syringe n ° 1. An equal volume is aspirated through syringe n ° 7, connected to channel 511. The solution is incubated for 3 minutes at room temperature. The electromagnet 20 is active.

11) The contents of the reactor are aspirated through syringe n ° 7, connected to channel 511.

12) 150 µl of solution are injected through channel 514 (syringe n ° 4).

An equal volume is aspirated through syringe n ° 7, connected to channel 511. The sample is incubated for one minute at room temperature. In these phases the electromagnet 20 remains active. The supernatant is aspirated from syringe No. 8 through channel 516. The washing step is repeated.

13) The residual ethanol is evaporated by aspirating air through syringe No. 8, connected to channel 516. The air inlet valve remains open.

14) 150 µl from syringe 6 are injected through channel 515 and incubated for 5 minutes at room temperature. In this way, the RNA is detached from the paramagnetic beads. The electromagnet 20 remains active.

15) The total RNA is then aspirated into the reaction chambers 501, 502, 503, by aspiration through the syringe No. 13 connected to channel 510 and the connecting channels between the chambers.

16) The control gene (BCR) is amplified in the reaction chamber 501.

Through channel 517 12.5 µl from syringe n ° 10 are injected. An equal volume is aspirated from syringe n ° 13, through channel 510.

17) The BCR-ABL e1a2 fusion gene is amplified in the reaction chamber 503. Through channel 518 12.5 µl are injected from syringe n ° 11. An equal volume is drawn from syringe n ° 13, through channel 510.

18) In reaction chamber III, the BCR-ABL fusion genes e13a2 and e14a2 are amplified. Through channel 519 12.5 µl from syringe n ° 12 are injected. An equal volume is aspirated from syringe n ° 13, through channel 510.

19) The following temperature conditions are used for RT-PCR and DNA amplification:

to. T = 50 ° C time 5 '

b. T = 95 ° C time 20 ''

40 cycles:

c. T = 95 ° C time 3 ''

d. T = 60 ° C time 30 ''

20) During the amplification cycles, the optical measurement apparatus 22 measures the fluorescence emitted during the amplification reaction during the extension phase at 60 ° C.

21) Based on the quantity of emitted fluorescence, the presence / absence of the fusion gene and its relative quantity are established by the management software of the device 1, with respect to the initial volume of blood introduced into the reactor Example 3: Human / animal assisted fertilization by IVF

This protocol makes use of one of the processors in the second embodiment (see Figs. 7,8,9), whose number of fertilization chambers 601 is variable depending on the clinical indication to IVF and therefore on the number of gametes female available. In the following example, the reactor 10 is used in the second embodiment with three fertilization chambers 601, used in cases involving ovarian stimulation cycles. In the case of a single oocyte, the operative protocol is completely superimposable; in this case, a version with a 601 fertilization chamber can also be used.

Inside the chambers described in Figure 7-9, the fertilization and cultivation of embryos takes place (one for each chamber) up to implantation in the uterus. The reactor 10 used in this procedure requires the use of an inverted light microscope as an ancillary monitoring device. To guarantee the sterility of the experimental procedures, the entire process is carried out in an operating room environment in both the human and zootechnical fields.

Female gametes are collected according to validated standard operating procedures currently in use in clinical practice, both in humans and in zootechnics. It is more appropriate to use fresh and non-cryopreserved gametes, in order to increase the yield of assisted fertilization (Ozcavukcu et al., 2008). Once the male gametes have been collected, the mobile and viable fraction is selected by migration-sedimentation process, as described by Kiratli et al. (2018). The maintenance of a finely regulated speed of fluid handling, during the fertilization of the oocyte as in the initial growth phase of the embryos, is considered a decisive factor in determining a better yield of the entire process on platforms that use microfluidics, compared to static systems (Swain JE et al., 2013).

The operational protocol includes the following steps:

1) Device 1 is initialized and set up with 2 syringes:

a) syringe No. 1: containing the culture medium Quinn's Advantage ™ Fertilization (HTF) Medium, balanced at 5% CO2, connected via channel 603 to the reactor; suitably, another culture medium could be used.

b) syringe n ° 2: empty, connected through channel 604 to the reactor.

2) First, the oocytes (one for each chamber) are manually inserted into the fertilization chambers 601 through the ducts 630, connected directly to the cylindrical depression 602.

3) 100 µl of the viable fraction of the spermatozoa, suitably selected, are withdrawn by means of a sterile disposable insulin syringe; 30 µl are inserted through the ducts 630 in each fertilization chamber, near the place where the oocytes are deposited. Steps 2) and 3) should be monitored by inverted light microscope observation.

4) The conduits 630 are sealed with methyl methacrylate.

5) Maintaining the conditions of sterility, the reactor 10 is inserted in the device 1.

6) The medium is injected from syringe No. 1, at a rate of 1 ml / min, to avoid the displacement of the gametes, until the entire fluidic is saturated. At the same time, syringe n ° 2 draws an equal volume.

7) The reactor thus assembled is incubated at 37 ° C for 48 hours. The hermetic closure of the system and the previous balancing of the soil guarantee the correct maintenance of the oxygen tension and the pH of the medium. 8) At the end of 48 hours of incubation, the fertilization chambers are analyzed under an inverted light microscope and those in which fertilization and growth of the embryos have occurred are identified.

9) The latter, at the stage of 4-8 cells, are taken with an intrauterine insemination cannula with flexible distal end (type Ainsenblue or similar), and implanted in the uterus, according to validated gynecological or veterinary protocols.

Example 4: Evaluation of the effect on the intracellular concentration of Na + of the treatment with ouabain, of cell cultures of human neuroblastoma SH-SY5Y

In this example, a specific fluorescent tracker for the Na + ion (Piacentini et al., 2015) is used to measure the effect of treatment with ouabain on human neuroblastoma SH-SY5Y cells. Ouabain is a compound that inhibits the activity of the Na / K ATPase pump (Marck et al., 2018).

Following treatment with ouabain, cell cultures are treated with gramicidin (Doebler et al., 1999) as a normalizer of the intracellular concentration of the Na + ion. It is a compound that allows the sodium / potassium pump to be short-circuited and to reach intracellular sodium concentrations of about 150 mM, equivalent to those of the extracellular environment.

The same protocol, suitably modified, can be used for any other compound that modifies the intracellular concentrations of ions and / or for any analyte for which a fluorescent tracer is available; Examples are ions H +, Ca ++, specific markers of the mitochondrial membrane potential, marker of activation of necrosis or apoptosis, etc. Furthermore, any other type of human or non-human cell culture, primary or stabilized, can be used, as long as it grows in adhesion.

For this protocol the reactor 10 is used in the third embodiment (see Figs. 10, 11); with this type of reactor it is possible to analyze up to 3 samples or treatments with alternative molecules. In this case, the number and content of the installed syringes 4 can be suitably modified and the other culture chambers 701 must be used. In this example, only one culture chamber is used, the central one. The availability of a cell culture facility is required, with a cell incubator and laminar flow hood for cell maintenance and preparation.

The operational protocol includes the following steps:

1) Device 1 is initialized and equipped with four syringes 4:

- syringe n ° 1: containing DMEM High glucose, Ham's F12 medium, free of phenol red, with 5% fetal bovine serum, balanced with 5% CO2. The syringe n ° 1 is connected through the channel 714 to the reactor 10 in the third embodiment; suitably, different culture media could be used.

- syringe n ° 2: containing the same culture medium as indicated above, with the addition of 100 µM of ouabain, 5µM of CoroNa green (Invitrogen) and 300ng / ml of Pluronic f-127 (Sigma-Aldrich). Syringe n ° 2 is connected through channel 714 to reactor 10 in the third embodiment, - syringe n ° 3: containing the same culture medium indicated above, added with 10µg / ml of gramicidin, 5µM of CoroNa green (Invitrogen) and of 300ng / ml of Pluronic f-127 (Sigma-Aldrich). Any other sodium fluorescent marker can also be used. Syringe No. 3 goes via channel 714 to reactor 10 in the third embodiment, - syringe No. 4: empty is connected via channel 704 to reactor 10 in the third embodiment,

2) The day before the experiment, the SH-SY5Y cells are detached from the culture flask by trypsinization, according to standard protocols. After counting, the cells are resuspended in DMEM High glucose w / o phenol red, Ham's F12 medium, 5% fetal bovine serum at a concentration of 600 cells / µl; 100 µl of cell suspension are loaded into the culture chamber 701 of the reactor 10 through the channel 703, which is subsequently sealed with methyl-methacrylate.

3) Reactor 10 is loaded into device 1.

4) Through the syringe n ° 1, 650 µl of basal medium are injected at the rate of 1 ml / minute; at the same time, an equal volume is aspirated through syringe n ° 4.

5) The cells are incubated at 37 ° C for 16 hours.

6) In the last two hours of incubation, the fluorescence emitted by the plastic and cell culture (autofluorescence) is measured every 30 minutes in 6 different points of the reactor, by reading at 450 nm. This measurement constitutes the baseline.

7) Through syringe n ° 2, 750 µl of medium are injected into the culture chamber 701, at a rate of 1 ml / minute. At the same time, an equal volume is aspirated through syringe n ° 4.

8) Cell culture is maintained at 37 ° C.

9) Starting from time 0, the fluorescence emitted by the CoroNa green probe is measured every 15 minutes for 6 hours, in the same points of the culture used for the baseline.

10) At the end of the incubation, 750 µl of medium are injected into the culture chamber through syringe No. 3; at the same time, an equal volume is aspirated through syringe n ° 4.

11) The fluorescence levels emitted by the CoroNa green probe are measured after 15 minutes of incubation in the same points of the culture used previously.

12) The Na + concentration measured at each time is extrapolated with respect to the fluorescence measured after gramicidin.

13) The Na + concentration curve is constructed which constitutes the final output of the analysis.

Example 5: Determination of SMN protein levels with respect to Glyceraldehyde-3-Phosphate-Dehydrogenase levels in HeLa cell cultures treated with salbutamol for 12 and 24 hours.

This example describes a hybrid method between ELISA and Western blot, for the quantification of the levels of the SMN protein compared to those of Glyceraldehyde-3-Phosphate-Dehydrogenase (GAPDH) in HeLa cells treated with salbutamol (Angelozzi et al., 2008) .

The same protocol, suitably modified, can be used to determine the levels of any protein of interest for which specific antibodies are available. Also, although human HeLa cells were used in this example, any other type of human or non-primary or stabilized cell culture can be used as long as it grows in adhesion. The use of the different reagents and culture media indicated in the example is not binding and, therefore, can be suitably modified.

For this operational protocol, reactor 10 is used in the fourth embodiment which has three analytical chambers 801, 802, 803. The availability of a cell culture facility is required, with a cell incubator and a laminar flow hood for culture and cell preparation.

The operational protocol includes the following steps:

1) Device 1 is initialized and set up with 9 syringes:

� syringe n ° 1: containing the appropriate culture medium, depending on the cell line under examination, balanced at 5% CO2. In the case of HeLa cells, DMEM High glucose with the addition of Pen strep / l-glutamine can be used. The syringe n ° 1 is connected through the channels 811, 815 and 819 analytical chambers 801, 802, 803, of the reactor 10 in the fourth embodiment,

- syringe n ° 2: containing the same culture medium as indicated above, with the addition of 0.05 µM of salbutamol (Angelozzi et al., 2008). Syringe No. 2 is connected via channels 815 and 819 to analytical chambers 802 and 803 of reactor 10 in the fourth embodiment,

- syringe n ° 3: containing RIPA buffer (25mM Tris, pH 7.8; 150 mM NaCl; 0.5% sodium deoxycholate; 1% NP-40; protease inhibitors cocktail; DNAse I 10 mg / ml), connected via channels 812, 816 and 820 to the analytical chambers 801, 802, 803 of the reactor 10 in the fourth embodiment,

- syringe n ° 4: containing anti-SMN (e.g. monoclonal antibody 2B1, Sigma-Aldrich, produced in mice) and GAPDH (e.g. Abcam ab8245, monoclonal antibody produced in mouse), diluted 1/1000 in RIPA buffer / 1% Bovine Serum Albumin (BSA), containing 1% v / v of Absolute Mag ™ Anti-Mouse IgG (Fc) Magnetic Particles (Creative Diagnostics, WHM-S070), connected via channels 812, 816 and 820 to analytical chambers 801, 802, 803 of reactor 10 in the fourth embodiment. Conveniently, any other antibody directed against the proteins under examination can be used. Conveniently, any other protein can be assayed in suitable samples, using specific antibodies,

- syringe n ° 5: anti-SMN (for example Abcam ab232784, polyclonal antibody produced in rabbit) and anti-GAPDH (for example Sigma-Aldrich SAB2500450, polyclonal antibody produced in goat), diluted 1/1000 in Dulbecco's modified Phosphate Buffer ( PBS) / BSA 1%, anti-rabbit conjugated with FITC and anti-goat conjugated with Alexa-fluor, diluted 1/1000; the syringe n ° 5 is connected through the channels 813, 817 and 821 to the analytical chambers 801, 802, 803 of the reactor 10 in the fourth embodiment,

- syringe n ° 6: containing PBS 1x / Tween 20 0.1%, connected via channels 814, 818 and 822 analytical chambers 801, 802, 803 of reactor 10 in the fourth embodiment,

- syringes 7-9: empty, each connected through channels 823, 824 and 825, to the analytical chambers 801, 802, 803 respectively of the reactor 10 in the fourth embodiment,

2) The day before the experiment, the HeLa cells are detached from the culture flask by trypsinization, according to standard protocols. After counting, the cells are resuspended in DMEM High glucose, 15% fetal bovine serum at a concentration of 100,000 cells / ml and loaded into the reactor through channels 804, 805, 806 in number of 50,000 for each analytical chamber 801, 802, 803. (see figure 5).

3) The reactor is loaded into device 1.

4) Through syringe n ° 1, 500 µl of medium are injected at the rate of 1 ml / minute into each analytical chamber 801, 802, 803. Syringes 7-9 draw an equivalent volume.

5) The cells are incubated at 37 ° C for 16 hours.

6) After the indicated time has elapsed, 500 µl of medium from syringe n ° 1 are injected into the incubation chambers 801, 802, 803 through channels 821 and 825. The empty syringes 7 and 8 draw an equivalent volume through channels 825 and 824.

7) Subsequently, 500 µl of medium containing salbutamol are injected into the incubation chamber 803 through channel 819 (syringe n ° 2). Syringe n ° 9 draws an equal volume through channel 823.

8) Cell culture is maintained at 37 ° C.

9) After 12 hours of incubation, 500 µl of medium with salbutamol are injected into the incubation chamber 802 through channel 815 (syringe n ° 2). Syringe # 8 draws an equivalent volume of medium through channel 824.

10) After a further 12 hours, the medium contained in the three incubation chambers is aspirated through syringes 7-9.

11) In the three incubation chambers 250 µl of RIPA buffer are injected through channels 812, 816 and 820 (syringe n ° 3) and incubated for 30 min at 4 ° C.

12) 250 µl of antibodies conjugated with paramagnetic beads are injected into the incubation chambers through channel 812, 816 and 820 (syringe No. 4), and incubated at 37 ° C for 30 '. In this phase the electromagnet 20 is active. 13) After the incubation time, the RIPA buffer is aspirated through channels 823, 824, 825.

14) 375 µl of 0.1% PBS / Tween are injected into each analytical chamber 801, 802, 803, from syringe n ° 6 through channels 814, 818 and 822; the reactor is incubated at 20 ° C for 10 minutes.

15) The washing step is repeated 14)

16) The PBS-T is aspirated and 500 µl of secondary antibodies are injected into the three analytical chambers from syringe No. 5, through channels 813, 817 and 821, and incubated for 30 minutes at 37 ° C.

17) After the incubation time, two washes are carried out, as indicated in step 14)

18) Fluorescence emitted by the two secondary antibodies is measured and recorded by the device for 5 minutes

19) The variation of SMN protein levels in response to treatment is determined with respect to GAPDH levels and normalized with respect to the untreated cell culture present in the analytical chamber 801.

DESCRIPTION OF THE SEQUENCES ANALYZED IN THE EXAMPLES

- APOE-c.364-F: 5'-GGGCGCGGACATGGA-3 '(SEQ ID NO: 1)

- APOE-c.417-R: 5'-CCTCGCCGCGGTACTG-3 '(SEQ ID NO: 2)

- APOE-c.381-T: 5'-VIC-GACGTGTGCGGCCG-MGB-3 '(SEQ ID NO: 3) - APOE-c.381-C: 5'-FAM-GACGTGCGCGGCC-MGB-3' (SEQ ID NO: 4) - APOE-c.500-F: 5'-CCGCGATGCCGATGAC-3 '(SEQ ID NO: 5)

- APOE-c.550-R: 5'-GCCCCGGCCTGGTACA-3 '(SEQ ID NO: 6)

- APOE-c.519-C: 5'-VIC-CAGAAGCGCCTGGCA-MGB-3 '(SEQ ID NO: 7) - APOE-c.517-T: 5'-FAM-TGCAGAAGTGCCTGGC-MGB-3' (SEQ ID NO: 8) - BCR-ex14F: 5'- TTCTGAATGTCATCGTCCACTCA -3 '(SEQ ID NO: 9) - BCR-ex15R: 5'-CCAGGGTGCAGTACAGATTTGA-3' (SEQ ID NO: 10) - BCR-P: 5'- FAM-CCACTGGATTTAAGCAGAG-MGB-3 '(SEQ ID NO: 11) - BCR-ABLe13a2-F: 5'-AGCATTCCGCTGACCATCA-3' (SEQ ID NO: 12) - BCR-ABLe13a2-P: 5'-VIC-ATAAGGAAGAAGCCCTTCAG- MGB-3 '(SEQ ID NO: 13)

- BCR-ABLe1a2-F: 5'-CGAGGGCGCCTTCCAT-3 '(SEQ ID NO: 14) - BCR-ABLe1a2-P: 5'-VIC-AGACGCAGAAGCC-MGB-3' (SEQ ID NO: 15) - BCR-ABLe14a2 -F: 5'-CAGCCACTGGATTTAAGCAGAGT-3 '(SEQ ID NO: 16)

- BCR-ABLe14a2-P: 5'-FAM-CAAAAGCCCTTCAGCG-MGB-3 '(SEQ ID NO: 17)

- BCR-ABL-R: 5'-GAGGCTCAAAGTCAGATGCTACTG-3 '(SEQ ID NO: 18)

Claims (14)

CLAIMS 1. Integrated and automated device (1) for carrying out molecular and / or cell biology laboratory procedures, characterized by the fact that it includes: - an apparatus for handling fluids (2) configured to allow the transfer of fluidic substances, comprising the sample to be analyzed / treated and / or at least one reagent, between corresponding containers (4) and at least one microfluidic reactor (10), called microfluidic reactor (10) comprising at least one chamber (30) in which the molecular and / or cellular biology reactions between said sample to be analyzed and at least one reagent take place, - a heating and / or cooling unit (16) which is configured to control the thermal conditions in at least one chamber (30) of said reactor (10), - a pressure applicable / constraintable lid (21) of an optically indifferent material , configured to cover the reactor (10) at the top, which prevents the deformation of said reactor following changes in temperature and allows the detection of the fluorescent signal, without refraction or diffraction phenomena of light, - an optical measuring apparatus (22) which is configured to carry out optical measurements on the fluidic substances entering and / or passing through said reactor (10), - a command and control unit (14) configured to control and / or coordinate the fluid handling apparatus (2), the heating and / or refrigerating unit (16), and / or said optical measuring apparatus ( 22). Device (1) according to claim 1, characterized in that it comprises means (18) for immobilizing the fluid substances, when they enter and pass through the reactor (10), said means comprising: - an electromagnet (20) configured to generate a variable magnetic field, - a plurality of paramagnetic beads configured to bind specifically with some substances present inside the reactor (10). 3. Device (1) according to one or more of the preceding claims characterized in that said containers (4) comprise at least two syringes (4) and in that: - said syringes (4) are arranged parallel to each other, and - at least one syringe (4) is of the precision type and is configured to pipette volumes up to 0.01 ml, - said syringes (4) comprise a plunger (8) which is actuated in an automated and controlled manner and - the plunger (8) of the syringes (4) is actuated by a telescopic piston (12) which is part of the handling apparatus (2). 4. Device (1) according to one or more of the preceding claims characterized in that said optical measuring apparatus (22) comprises: - an excitation light source (24), preferably at least one LED lamp and / or at least one laser source, - a detector (26) placed above said reactor (10), - filters configured to isolate the emission wavelengths of the individual fluorochromes present within said reactor (10). 5. Device (1) according to one or more of the preceding claims characterized in that said reactor (10): - has a substantially laminar conformation, - it is disposable, - it is made of optical and bio-compatible plastic material - it comprises inside a plurality of chambers (30) of circular or polygonal shape with rounded corners, said chambers (30) being fluidly connected, by means of cylindrical connection ducts (32), possibly equipped with anti-reflux valves, both between them and doors (34) for inlet / outlet to / from said reactor (10) and by the fact that said inlet / outlet ports (34) are defined in correspondence with the edges of said reactor (10) and each of said ports (34) is connected by means of a connecting tube (6) of the handling apparatus (2 ) to a corresponding container (4) containing the sample to be analyzed / treated and / or a reagent. 6. Device (1) according to one or more of the preceding claims characterized in that said reactor (10) comprises: - an extraction chamber (301) for mixing said fluidic substances, said extraction chamber (301) being fluidically connected with: ● at least one first bidirectional channel (511, 516) for the inlet / outlet in / from said extraction chamber (301) of the sample to be treated / analyzed, ● at least a second channel (512,513,514,515) for placing the reagents in said extraction chamber (301), - at least one reaction chamber (501, 502, 503) which is in fluidic connection with said extraction chamber (301) and / or with any other reaction chambers (501, 502, 503), with each reaction chamber being fluidically connected at least a third channel (517, 518, 519) for the introduction of further biological sample and / or reagents into the corresponding reaction chamber (501, 502, 503). 7. Device (1) according to one or more of claims 1-5 characterized in that said reactor (10) comprises at least one fertilization chamber (601) configured to contain the embryos to be cultivated in a portion (602) depressed with respect to the rest of the chamber (601), to said fertilization chamber (601) being fluidly connected: - at least one further conduit (630) for the deposition of gametes, - at least one channel (603) for the introduction of the culture medium, - at least one outflow channel (604) of the culture medium. 8. Device (1) according to claim 7 characterized in that said reactor (10) comprises a plurality of fertilization chambers (601) fluidically connected in series by at least one connection duct (32) and in that: - said at least one channel (603) for the introduction of the culture medium is connected to the fertilization chamber (601) further upstream, - said outflow channel (604) is connected to the fertilization chamber (601) further downstream. Device (1) according to one or more of claims 1-5 characterized in that said reactor (10) comprises at least one culture chamber (701) to which are connected: - at least one access channel (703) for cell storage, - at least one inflow channel (704) of the culture medium, e - at least one outflow channel (714) of the culture medium. 10. Device (1) according to one or more of claims 1-5 characterized in that said reactor (10) comprises at least two analytical chambers (801, 802, 803) fluidically independent of each other, to each analytical chamber (801, 802, 803) being connected: - at least one corresponding channel (804, 805, 806) for loading the biological sample into said chamber, - a plurality of channels (811-822) for the introduction of culture media and / or reagents. - at least one corresponding channel (823, 824, 825) for the outflow of reagents. 11. Use of the device according to one of claims 1-6 for: a) carry out analyzes of gene variants, for example aimed at the diagnosis / prognosis or epidemiology, or quantification / qualification of gene transcripts, where said analyzes include the steps of extraction from one or more isolated human or animal biological samples, purification and amplification of acids nucleic and where said phases are carried out inside the microfluidic reactor (10); or b) to identify the presence of the genome of pathogens in human or animal biological samples, where said analyzes include the steps of extraction from one or more isolated biological samples, purification and amplification of nucleic acids and where said steps are carried out inside the microfluidic reactor (10). Use of the device according to one of claims 1-5 and 7-8 for carrying out in vitro fertilization procedures. 13. Use of the device according to one of claims 1-5 and 9 to cultivate adherent cells under controlled conditions and / or to measure over time specific biological / biochemical parameters of the cells grown in the microfluidic reactor (10) and / or to evaluate over time the effect of pharmacological treatments in adherent cells cultured in vitro in the microfluidic reactor (10). Use of the device according to one of claims 1-5, 10 and 13 to purify and quantify proteins extracted from biological samples fed into the microfluidic reactor (10) or from cells grown in vitro in the microfluidic reactor (10).