IT201800004853A1 - Methods of treating cancer - Google Patents

Description

METHODS FOR THE TREATMENT OF A CANCER

FIELD OF THE INVENTION

The present invention refers to methods of treatment or prevention of tumors such as solid tumors, as well as of other diseases related to excessive or insufficient immune responses, deriving from the discovery of natural NKp44 ligands that mediate immunosuppression.

BACKGROUND OF THE INVENTION

NK cells are innate lymphoid cells (CLI) involved in various immune processes ranging from the direct elimination of pathogens or cancer cells to the release of cytokines and chemokines and to regulatory interactions with different immune cells. To fulfill this variety of functions, NK cells use a series of receptors that detect microenvironmental stimuli and mediate appropriate responses. Different NK receptors are able to regulate the functions of different NK cells. For example, the natural cytotoxicity (NCR) receptors NKp44, NKp30 and NKp46 play an important role in human NK cell-mediated recognition and killing of virus-infected and tumor-infected cells, and also in inducing the release of a certain number of cytokines and chemotactic factors. Furthermore, NKp30 and NKp46 mediate the regulatory interactions that occur between NK and different leukocytes, including dendritic cells (DCs), neutrophils, eosinophils, macrophages and T cells. NCRs were identified and characterized molecularly in the 1990s. . Since then, numerous studies have attempted to identify their ligands as this information is essential for better exploiting the potential of NK cells in the treatment of cancer, infection or disease mediated by immunity. Despite much effort, until now, the NCR ligand panel has only been partially defined. One reason for these difficulties is related to the fact that the study models of receptor-ligand interaction for NCR are rather limited, and among human NCRs only NKp46 is expressed on NK cells of rats and mice. Furthermore, although NCRs belong to the Ig superfamily, they differ greatly in their molecular structure, which implies that their ligands can be quite heterogeneous. Furthermore, each NCR can interact with different ligands, not necessarily showing similar molecular characteristics. So, for example, NKp44 and NKp46 have been shown to bind viral hemagglutinins. On the other hand, molecularly unrelated cellular ligands have been shown to bind NKp30 (B7H6 and BAT3 / BAG6) and NKp44 (21spe-MLL5 and PDGF-DD). To further complicate this problem, NCRs can interact with ligands in different ways and even opposite functional results. For example, NKp44 appears to modulate NK cell function differently through cis or trans interactions with heparan-sulfate proteoglycans (present on the surface of NK or target cells). Furthermore, it has been reported that it transduces inhibitory signals following interaction with the nuclear antigen of proliferating cells (PCNA). NKp30 triggers cytotoxicity and the release of cytokines following binding to B7H6 or BAT3 at the cell surface. In addition to NCRs, other activating receptors, including NKG2D and DNAM-1, help trigger cell-mediated cytotoxicity. The specific ligands for these receptors have been extensively characterized: the MICA / B and ULBP molecules are recognized by NKG2D, while PVR and Nectin-2 (belonging to the Nectin family), are ligands for DNAM-1. Soluble ligands, endowed with suppressive capacity, have been described for NKG2D and the activating receptors DNAM-1 (sMICA, sULBP and sPVR) and for NKp30 (sB7H6 and sBAT3 / BAG6). As for other NCRs, it has recently been shown that NKp46 binds an extracellular molecule: the complement factor P (Narni-Mancinelli et al. (2017) Science Immunol.

2 (10)). In the case of the NKp46-CFP interaction, however, CFP can actually represent an important tool for innate responses to pathogens rather than inducing an inhibitory cycle.

The identification and characterization of cell surface ligands for NCR is important for understanding the mechanisms of regulation of the immune functions of NCR and for the development of new therapies for the treatment of diseases and disorders related to these mechanisms.

SUMMARY OF THE INVENTION

Here it is shown that human NKp44 recognizes an extracellular ligand known as the Nidogen-1 (NID1) protein (also known as entactin). In the present it is also shown that the NKp44 / NID1 interaction results in a reduced induction mediated by NKp44 of the release of cytokines by human NK cells. Further analysis of the proteomic changes induced in NK cells by exposure to human NID1 revealed a substantial modulation of different molecules and pathways involved in important biological processes. Herein it is also shown that NID1, in addition to being released into the extracellular space, can also be detected by NKp44-Fc proteins and anti-NID1 antibodies on the cell surface (e.g. NID1 releasing cells).

The present disclosure provides natural NKp44 ligands, in particular NID1 polypeptides, e.g., full-length soluble NID1 polypeptide, soluble NID polypeptide fragments, membrane-bound NID polypeptides, and NKp44-binding fragments of any of the above elements (e.g. a fragment of NID1 comprising an NKp44 binding domain).

In some embodiments, the technology described herein relates to antibodies and antibody fragments (for example comprising an antigen-binding portion of an antibody that binds a polypeptide of NID1). In some embodiments, the technology described herein relates to NKp44 polypeptides and related fragments (e.g. isolated, purified and / or soluble polypeptides) which bind a NID1 polypeptide. NID1-binding agents include, inter alia, molecules that bind NID1 and deplete NID1-expressing cells, molecules that bind NID1 to NID1-expressing cells and inhibit the amount of NID1 released by the cells, as well as molecules that bind NID1 and modulate the interaction between NID1 and NKp44. Methods for its use are also provided to modulate, optionally enhance, immune responses (e.g., an antitumor immune response, an immune response against a pathogen (e.g. a virus) or a cell infected with pathogens) in an individual. In some embodiments, the NID1 polypeptide is a soluble NID1 polypeptide (sNID1). Soluble NID1, for example, may be a NID1 protein that has been released from cells and is available for binding to NKp44, optionally NID1 which is not associated with the basement membrane. Soluble NID1 can be a complete NID1 protein or a fragment of NID1 (for example, cleaved by the action of cathepsin-S, ADAMTS1 and / or other enzymes such as matrix metalloproteases, optionally MMP2 or MMP9).

In addition to being released, Nidogen-1 polypeptides (NID1) can be associated with the cell surface. Notably, in many tumors, NID1 is released from cells, resulting in possible inhibition of NKp44 on NK and / or other CLIs, which in turn can cause a decrease in host immunity against the tumor cell and promote tumor evasion and progression. In some embodiments, the methods and compositions described herein refer to the inhibition of sNID1, for example by reducing the level and / or activity of sNID1 that is available to interact with cellular receptors. In some embodiments, the inhibition of sNID1 may be a reduction of unbound sNID1, for example sNID1 not bound to a receptor and / or available to be bound by the antibody or by the soluble NKp44 reagents described herein). In some embodiments, the inhibition of sNID1 can be a reduction in the level of sNID1, for example the level of sNID1 in the tumor tissue and / or in the circulation.

Accordingly, it is an object of the invention to provide the use of the compositions and agents provided herein to enhance or stimulate the activity (e.g. cytotoxic activity, proliferation, development and / or maturation, etc.) of NKp44-expressing lymphocytes, in particular CLI expressing NKp44, such as NK cells or ILC3 cells. In one embodiment, the compositions and agents provided herein are used to restore or enhance the expression of the MYSM1 protein in CLIs (e.g., NK cells) and / or to promote the development and / or maturation of CLIs (for example NK cells). The composition can be used for the treatment of a disease in an individual, optionally in which the disease is a cancer, optionally a solid cancer, optionally in which the disease is an infectious disease (for example a viral infection). The composition can be used to restore or improve immunity (for example anti-tumor immunity) in an individual with soluble NID1 (sNID1). The composition can be used to alleviate the NID1-mediated suppression of NK cell activity in an individual. The composition can be used to enhance NK cell-mediated targeting (e.g. lysis) of disease-promoting cells, particularly tumor cells, tumor-promoting cells in the tumor environment, pathogens, or agent-infected cells. pathogens (e.g. virus-infected cells) in particular for the treatment of a disease (e.g. cancer, infectious disease) in an individual. In one embodiment, disease-promoting cells bear membrane-bound NID1 (mNID1) on their surface. In one embodiment, the individual is an individual with soluble NID1, optionally further in which soluble NID is present (for example, its presence has been determined) in the circulation and / or tumor environment, optionally in tumor tissue and / or in the tissue adjacent to the tumor.

The compositions and agents provided herein can be advantageously used for the treatment or prevention of a cancer in an individual, optionally in an individual with a solid tumor, optionally a lung cancer (e.g., non-small cell lung cancer), cancer colon, endometrial cancer, melanoma, ovarian cancer or breast cancer. In one embodiment, the compositions and agents provided herein are used to treat or prevent metastatic cancer, or to prevent disease metastasis and / or progression in an individual with cancer.

One purpose is to provide compositions and methods to alleviate or reduce sNID1-mediated suppression or NK cell activity and / or antitumor immunity by targeting sNID1. Another purpose of the invention is to provide compositions and methods for the treatment of cancers by targeting NID1. In any of the treatment methods, the method may be characterized by a step of administering an agent that targets NID1 to an individual who has a disease or disorder, such as cancer.

In one aspect, a composition (e.g., NKp44 protein or protein fragment, non-NKp44 protein agent, antibody, antibody fragment) is provided that binds NID1. In one aspect, the composition reduces the level and / or activity of sNID1 which is available to interact with a polypeptide of NKp44. In one embodiment, the agents disclosed herein are useful in a method of reducing the amount of sNID1 in circulation and / or in a tissue (e.g. tumor tissue or tissue adjacent to the tumor) in an individual. In one embodiment, the agents are useful in a method for reducing the release of NID1, optionally a method for reducing the release of, or the amount of sNID1 released, into the tumor environment (e.g. tumor tissue and / or adjacent tissue to the tumor).

In one embodiment, agents that interfere with the NKp44-sNID1 interaction are provided. Such agents can enhance immune responses. In one embodiment, agents are provided that interfere with the NKp44-sNID1 interaction, to alleviate the sNID1-mediated suppression of immune responses (for example, the anti-tumor immune response). In one embodiment, the agent is a protein, an Fc protein, an antibody or an antibody fragment that binds sNID1 and interferes with the interaction between sNID1 and NKp44. In one embodiment, the agent does not bond with one or more human Fc receptors, optionally the agent does not bond with human CD16, optionally the agent does not bond with one or more, or each of the , human CD16A, CD16B, CD32A, CD32B and / or CD64 polypeptides. Optionally the agent is an antibody or an Fc protein comprising an Fc domain of isotype human IgG1, IgG2, IgG3, IgG4 comprising an amino acid modification (e.g. one or more substitutions) which decreases the binding affinity of the antibody to one or more more than, or each of the human CD16A, CD16B, CD32A, CD32B and / or CD64 polypeptides. In one embodiment, the agent is a non-depleting agent.

One of the purposes of the disclosure is to provide compositions that inhibit, reduce or block the NKp44-NID1 interaction, in particular the NKp44-sNID1 interaction, and the methods of use of the same, to increase the activity of NK cells. In one embodiment, the composition is a protein (e.g. an antibody or an antibody fragment) that binds to the sNID1 polypeptide. An object of the invention is to provide methods of using such compositions to increase the activation of NK cells, optionally to increase the activation of NK cells towards target cells (e.g. disease cells, cancer cells), optionally also for the treatment of a cancer.

In another embodiment, agents (e.g. depleting agents) are provided that bind mNID1 (e.g., NID1 expressed on the cell surface) and are capable of mediating the depletion of mNID1-expressing cells (e.g. releasing cells NID1; cells present in tumor tissue or tissue adjacent to the tumor, cancer cells or cells that promote cancer). These molecules can be useful for eliminating mNID1 expressing cells that secrete sNID1 in the extracellular space (for example mNID1 expressing cells in cancer or in tissues adjacent to cancer), thus in turn decreasing sNID1 in the tumor environment and / or in the circulation. The molecules can therefore also alleviate the sNID1-mediated suppression of NK cell activity. In one embodiment, the molecule is or comprises a protein, for example an NKp44 protein fragment, an Fc protein, an anti-NID1 antibody or an antibody fragment and a bi-specific or multi-specific antibody that binds to mNID1. In one embodiment, the molecule also binds to sNID1 and interferes with the interaction between sNID1 and NKp44. In another embodiment, the molecule does not interfere with the interaction between NID1 (for example sNID1 and / or mNID1) and NKp44. In one embodiment, the molecule is administered to an individual in an amount effective to deplete sNID1-releasing mNID1-expressing cells in the extracellular space (e.g., mNID1-expressing cells in cancerous tissues or cancer cells).

In one embodiment, the agents disclosed herein are useful in a method for reducing the amount of sNID1 circulating in an individual. In one embodiment, the agents are useful in a method for reducing the release of NID1, optionally a method for reducing the release of, or the amount of sNID1 released, into the tumor environment (e.g. tumor tissue and / or adjacent tissue to the tumor).

In another aspect, a composition is provided comprising an NKp44 ligand (e.g. a sNID1 polypeptide or a related NKp44 binding fragment; an antibody that binds NKp44 and inhibits NKp44 signaling) or compositions comprising these, and related methods of use. to reduce the activity of NK cells and / or to cause immunosuppression, for example in vitro, in vivo or in inflamed tissues, for the treatment of inflammatory disorders or autoimmune disorders.

In another aspect, the assessment of the presence or levels of NID1, in particular sNID1, in an individual (for example in a biological sample of an individual) provides an indicator (for example a biomarker) to evaluate immunosuppression. The presence of sNID1, or elevated levels of sNID1, may be indicative for example of inhibited or suppressed lymphocyte cellular activity (e.g. NK cells), e.g. a state of inhibition of lymphocyte cytotoxicity (e.g. NK cells), activation, maturation or homing of lymphocytes with respect to cancer cells. A finding that sNID1 is present in a biological sample from an individual at significant or elevated levels (e.g. relative to a control value, for example, from healthy individuals or from individuals who are not immunosuppressed) may be indicative of immunosuppression in the individual and / or can be used to assess responsiveness to anticancer therapy, optionally immunotherapy. In many cases, people who have cancer show resistance to treatment with anti-cancer treatments that have immunomodulatory effects (including chemotherapeutic agents, radiotherapy, immunotherapy, or immunotherapeutic agents). Consequently, evaluation of pre-treatment immunosuppression markers may be useful in predicting, evaluating and / or monitoring the response to such anticancer treatments. It is therefore another objective to provide the detection of sNID1 as a biomarker to evaluate, predict or monitor the efficacy of therapies, optionally of cancer therapies. In one embodiment, cancer therapy is a chemotherapeutic agent, radiotherapy, an immunotherapy, optionally an immunotherapeutic agent that has the ability to modulate (for example, enhance) the activity of T cells and NK cells. In one embodiment, immunotherapy is an agent (e.g. comprising a cell, antibody or antibody fragment, protein, nucleic acid, or small molecule organic compound) that modulates cell activity NK infiltrating a tumor and / or tissue adjacent to a cancer, optionally additionally T cells infiltrating a tumor and / or tissue adjacent to a cancer. In one embodiment, the immunotherapeutic agent (e.g., an antibody or a protein agent) binds (e.g., and activates) an activating receptor (including coactivating receptors) expressed by NK and / or T cells (e.g., activating receptors CD16, TMEM173 also known as interferon gene stimulator (STING), CD40, CD27, OX-40, NKG2D, NKG2E, NKG2C, KIR2DS2, KIR2DS4, glucocorticoid induced tumor necrosis factor receptor (GITR), CD137, NKp30, NKp44 or DNAM-1, 2B4 (CD224). Optionally, the immunotherapeutic agent binds and inhibits an NK receptor and / or an inhibitory T cell receptor, or a natural ligand of such an inhibitory receptor (e.g. a member of the Siglec family , LAG-3, PD-1 (CD279) or its natural ligand PD -L1, TIGIT or CD96). Optionally, the immunotherapeutic agent binds and inhibits a polypeptide that is associated with lymphocyte depletion, inhibition or suppression (e.g. T and / or NK cells), for example the marker of TIM-3 depletion, or polypeptides such as indoleamine-2,3-dioxygenase (IDO), CD39 and CD73 which are associated with the production of immunosuppressive metabolites. In one embodiment, the immunotherapeutic agent activates CD16, optionally where the agent is an agent (e.g. a full-length IgG1 antibody, a bispecific antibody) comprising an Fc domain that is bound by FcγR (e.g. human CD16) and that it is capable of inducing ADCC through CD16 (for example through CD16 on NK cells). In one embodiment, immunotherapy is an antibody that binds to an antigen (for example a cancer antigen) on a target cell to be depleted (for example via NK cell-mediated ADCC).

A further object of the invention is to provide compositions and methods for determining the severity or prognosis of a cancer in a person who is suffering or is suspected of having cancer. The presence of sNID1, or elevated levels of sNID1, may be indicative of, for example, an increase in severity, an increased risk of progression, or an increased risk of metastasis in an individual with cancer.

Another purpose of the invention is to provide compositions and methods for determining (for example, predicting, evaluating, etc.) the effectiveness of a treatment for cancer.

Another purpose of the invention is to provide compositions and methods for selecting a subject for treatment for a cancer.

Another object of the invention is to provide compositions and methods for measuring the pharmacokinetic and pharmacodynamic parameters of NKp44 therapies, such as compositions of NK cells expressing NKp44, soluble proteins that mimic the NKp44 ligand or therapies that promote the activity or number of NK cells expressing NKp44 or therapies that promote NKp44-NKp44 ligand interactions.

Another object of the invention is to provide methods for identifying agents (e.g. proteins, antibodies or small molecule based agents) which modulate the activity of NKp44 or NID1, e.g. which modulate (e.g., inhibit or enhance) interaction NKp44-NID1.

In one aspect, methods are provided for identifying agents (e.g. proteins, antibodies or small molecule based agents) which inhibit the NKp44-sNID1 interaction and / or enhance the activity of NK cells, for example, which enhance the recognition and / or lysis of a target cell by an NK NKp44 + cell. In one embodiment, the method comprises identifying one or more agents (e.g., an antibody or antibody fragment, an Fc protein, an NKp44-derived protein or peptide, or a composition comprising one of the above) that binds sNID1 and which inhibits the NKp44-sNID1 interaction.

Methods and assays are also provided to detect the interaction of NKp44 with NID-1. Said NID1 can be for example an isolated sNID1 protein or it can be a NID1 protein expressed on the surface of a cell (for example a NID1 releasing cell). These analyzes can be used in medical or biological research, in diagnostic or prognostic methods, or advantageously to screen or test antibodies or other antigen-binding agents to increase or decrease the activity of NK cells or immune effector cells. In one embodiment, a method is provided comprising the steps of: (i) bringing NKp44 (e.g. as an NKp44 expressing cell or as an NKp44 protein in solution) into contact with NID1 (e.g. as an NID1 expressing cell on its surface, or as soluble NID1 protein), (ii) evaluate (e.g. detect) the interaction of NKp44 and NID1 polypeptides. Optionally, the evaluation of the interaction includes evaluating (for example detecting) the link between NID1 and NKp44. In one embodiment, the NKp44 polypeptide is a membrane bonded polypeptide (expressed for example on the surface of a cell). In another embodiment, the NKp44 polypeptide is a soluble NKp44 polypeptide (for example a fragment of NKp44 fused with an Fc domain). In one embodiment, the NID1 polypeptide is a soluble NID1 polypeptide. In another embodiment, the NID1 polypeptide is a membrane-bound polypeptide (expressed for example on the surface of a cell).

Methods and assays are also provided to identify agents that modulate the interaction between NID1 and NKp44. In one embodiment of such an assay, the method comprises: (i) bringing NKp44 (e.g. as an NKp44 expressing cell or as an NKp44 protein in solution) into contact with NID (e.g. as a NID1 expressing cell on its surface, or as soluble NID1 protein) in the presence of a test agent (e.g. a plurality of test agents) and (ii) assess the binding of NID1 to NKp44. A reduction in the binding (compared to the negative control) indicates that the agent interferes with the binding of NID1 and NKp44. An increase in binding (compared to the negative control) indicates that the agent improves the interaction of NID1 and NKp44.

In one embodiment, a method is provided for identifying agents that increase NK cell activity, comprising the steps of: (i) bringing NKp44 (e.g. as an NKp44-expressing cell or as an NKp44 protein in solution) into contact with NID1 (e.g. as a cell expressing NID1 on its surface, or as a soluble NID1 protein) in the presence of a test agent (e.g. a plurality of test agents), (ii) assess the binding of NID1 to NKp44. Optionally, the method also includes: (iii) selecting (for example for use in therapy, for the production of a batch of therapeutic agent, for further treatment or evaluation) an agent that interferes with the binding of NID1 and NKp44. In one embodiment, the agent is intended for use in the treatment or prevention of a cancer. In one embodiment, the agent comprises an antibody. In one embodiment, the agent (for example an antibody) binds to NID1.

In one embodiment, a receptor complex is provided comprising a NID1 polypeptide and an NKp44 polypeptide, optionally an isolated receptor complex, optionally further comprising a linking agent (e.g. an antibody or a protein) linking NID1 and NKp44. Optionally, the complex comprises one or more further proteins. Optionally, the NKp44 polypeptide is an NKp44 fragment comprising a NID1 binding domain.

In one embodiment, a method is provided for binding (e.g. for targeting, detection, modulation, etc.) NKp44 to the surface of an NK cell, optionally a method for modulating NKp44 to the surface of an NK cell, the method comprising bringing an NKp44 expressing cell (e.g. an NK cell) into contact with a NID1 polypeptide (e.g. a soluble NID1 or a protein comprising NID1, optionally complexed with other molecules).

In one embodiment, a method is provided for binding (e.g. for targeting, detection, modulation, etc.) a polypeptide of NID1 to the surface of a target cell (e.g., a cancer cell, etc.), the method comprising the made of bringing the target cell into contact with a polypeptide of NKp44 (for example a polypeptide of NKp44 comprising the amino acid sequence of SEQ ID NO: 1 or a relative binding fragment NID1, for example a fusion protein NKp44-Ig comprising any of the aforementioned elements).

In other aspects, an object of the invention is to provide the use of NID1 compositions (e.g. a soluble NID1 protein or an NKp44 binding fragment thereof) to reduce activity (e.g. proinflammatory or tissue destructive activity, proliferation, development and / or maturation, etc.) of NKp44-expressing lymphocytes, in particular NKp44-expressing CLI, such as NK cells or ILC3 cells. Such NID1 compositions can be used for the treatment or prevention of an autoimmune or inflammatory disease in an individual, wherein the NID1 composition is administered to the individual who has an autoimmune or inflammatory disease, for example an autoimmune or inflammatory disease characterized by NKp44-expressing lymphocytes that promote disease, in particular CLI-expressing NKp44, such as NK cells or ILC3 cells. The composition of NID1 can be used to cause or enhance the NID1-mediated suppression of NK cell activity in an individual. Examples of autoimmune or inflammatory disease include systemic lupus erythematosus, Wegener's granulomatosis, autoimmune hepatitis, Crohn's disease, scleroderma, ulcerative colitis, Sjögren's syndrome, type 1 diabetes mellitus, uveitis, myocarditis, rheumatic fever, ankylosing spondylitis, rheumatic arthritis multiple sclerosis and psoriasis.

In one embodiment, a method is provided for detecting an NID1 protein on the surface of a target cell (e.g., an NID-releasing cell, a cancer cell, etc.), the method comprising bringing the target cell into contact with a polypeptide of NKp44 comprising a detectable fraction, where the detection of the binding of NKp44 to the target cell indicates the presence of NID1, optionally where the detection of the binding of NKp44 to the target cell indicates an NID1 releasing cell.

These aspects are described more fully, and further aspects, features and advantages will be evident from the description of the invention provided herein. Each of the methods can also be characterized as comprising any phase described in the application, in particular in the "Detailed description of the invention"). The invention also relates to methods of identification, testing and / or production of proteins described herein. The invention also relates to agents obtainable with any of the present methods. The disclosure also relates to pharmaceutical or diagnostic formulations containing at least one of the agents described herein. The disclosure also concerns methods of use of the agents in question in treatment or diagnosis methods.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the results of the analysis of the culture supernatant from HEK293T cells by two-dimensional electrophoresis (2-DE). The concentrated Hek293T-SN was analyzed by two-dimensional electrophoresis (2-DE). After blotting, the membranes were probed with NKp44Fc (Figure 1A), NKp46Fc (Figure 1B) or NKp30Fc (Figure 1C) followed by HRP-conjugated anti-human IgG mAb. HEK293T-SN-biot underwent the same procedure and the membrane was incubated with HRP-conjugated Neutravidin (Figure 1D). In parallel, HEK293T-SN (600 μg) was separated by 2-DE and the proteins were stained with colloidal “blue silver” Coomassie (Figure 1E). The numbers indicate the points selected for mass spectrometry analysis; in panels (A), (D) and (E) point 26 is highlighted with a black circle.

Figure 1F shows the reactivity of NKp44Fc and other chimeric NK receptors with a culture supernatant from HEK293T cells. (a) The ELISA plates were coated with concentrated HEK293T-SN continuing with the incubation with the indicated Fc molecules and detection with human IgG mAb conjugated to HRP. (b) The ELISA plates were coated with NKp44Fc or NKp30Fc, continuing with the incubation with HEK293T-SN labeled with biotin (HEK293T-SN-biot), or HEK293T-SN as a negative control and streptavidin conjugated to HRP. The graphs represent the absorbance at 405 nm after normalization with respect to the background (non-specific binding of the secondary reagent conjugated to HRP). In (a) and (b) the data are medians ± interquartile range of three independent experiments performed in triplicate (a) or duplicate (b). **** p <0.0001 (A), ** p0.0022, ns = 0.0606 (B) by two-tailed Mann-Whitney test.

Figure 1G shows the Western blot analysis of HEK293T-SN and immunoblotting with NKp44Fc and additional chimeric NK receptors. Concentrated SN from HEK293T cells (HEK293T-SN) cultured in protein-free medium was concentrated, analyzed by SDS-PAGE on a 7.5% polyacrylamide gel and immunoblotting with the indicated Fc molecules continuing with anti-human IgG mAb conjugated to HRP. The MW (kDa) markers are indicated on the right. One in three representative experiments is shown.

Figure 2 shows the specific recognition of NID1 by the chimeric NKp44Fc receptor. Figure 2A shows concentrated HEK293T-SN immunoprecipitated with the indicated Fc molecules and analyzed in 7.5% SDS-PAGE under non-reducing conditions; in parallel, concentrated HEK293T-SN was loaded as a positive control. After blotting, the membrane was probed with mouse anti-NID1 mAb followed by HRP-conjugated anti-mouse IgG mAb. One in three representative experiments is shown. Figure 2B shows concentrated HEK293T-SN and rNID1 analyzed in SDS-PAGE on a 7.5% polyacrylamide gel under non-reducing conditions and, after blotting, probed with the indicated Fc molecules or with anti-NID1 mAb, followed respectively from a mouse IgG or HRP conjugated anti-human IgG secondary reagent. The molecular weight (MW) (kDa) markers are indicated on the right. One in five representative experiments is shown. Figure 2C shows ELISA plates coated with rNID1 and incubated with different concentrations of the indicated Fc molecules followed by HRP-conjugated anti-human IgG mAb. The graph represents the absorbance at 405 nm after normalization with respect to the background (non-specific binding of the secondary reagent). Data are triplet medians ± interquartile range and are pooled results from three independent experiments. **** p <0.0001 with two-tailed Mann-Whitney test.

Figure 3A shows the effect of pretreatment with rNID1 on the production of IL-2 induced by NKp44 in Bw-NKp44 cells. Bw-NKp44 and Bw-NKp30 cells were either untreated or pretreated with rNID1 at the indicated concentrations for 1 hour at 37 ° C and then incubated on anti-NKp44 or anti-NKp30 mAb-coated plates, respectively, for 20 hours. The release of IL-2 in the SN was evaluated by ELISA. Background (from GAM-stimulated cells) was subtracted for each value. Data are medians of duplicates ± interquartile range and are pooled results from three independent experiments. ** p = 0.022, ns (not significant) = 0.584, with two-tailed Mann-Whitney test.

Figure 3B shows the mRNA and the expression of the NID1 protein in the Bw cell line and in the transfectants. (a) The expression of NID1 mRNA was evaluated by RT-PCR in Bw cells and in the corresponding NID1 transfectants. Specific primers for β-actin were used as a positive control. The PCR products were carried out on 1.5% agarose gel and visualized by staining with ethidium bromide. One in three representative experiments is shown. (b) SN derived from Bw cells and the corresponding NID1 transfectants were analyzed in SDS-PAGE on a 7.5 polyacrylamide gel; the membrane was probed with mouse anti-NID1 mAb followed by anti-mouse IgG mAb conjugated to HRP. The MW (kDa) markers are indicated on the right. One in two representative experiments is shown. (c) The ELISA plates were coated with mouse anti-NID1 mAb and continued with incubation with SN obtained from the Bw cells and the corresponding NID1 transfectants. NID1 was detected using a goat anti-NID1 antibody followed by an HRP-conjugated anti-goat Ab IgG. The graph represents the absorbance at 405 nm after normalization with respect to the background (non-specific binding of goat anti-NID1 secondary reagent). Data are triplet medians ± interquartile range and are pooled results from three independent experiments. **** p <0.0001 with two-tailed Mann-Whitney test.

Figure 4 shows that NKp44Fc recognizes NID1 released from NID1 transfected K562 cells. Figure 4A shows the expression of NID1 mRNA evaluated by RT-PCR in wild-type or NID1 transfected K562 cells. Specific primers for β-actin were used as a positive control. The PCR products were carried out on 1.5% agarose gel and visualized by staining with ethidium bromide. One in three representative experiments is shown. Figures 4B and C show the results of ELISA plates coated with mouse anti-NID1 mAb (Figure 4B) or with the indicated Fc molecules (Figure 4C), followed by incubation with concentrated SN obtained from non-transfected or transfected K562 cells. NID1 grown in protein-free soil. NID1 was detected using a goat anti-NID1 antibody followed by an HRP-conjugated anti-goat Ab IgG. The graphs represent the absorbance at 405 nm after normalization with respect to the background (non-specific binding of goat anti-NID1 secondary reagent). Data are triplet medians ± interquartile range and are pooled results from three independent experiments. **** p <0.0001 with two-tailed Mann-Whitney test. Figure 4D shows concentrated SN (30 μl for each sample) derived from K562 cells and the corresponding NID1 transfectants cultured in protein-free medium were analyzed in SDS-PAGE on a 7.5% polyacrylamide gel; the membrane was probed with an NKp44Fc molecule or with the mouse anti-NID1 mAb followed by the secondary mAb conjugated to the appropriate HRP. The MW (kDa) markers are indicated on the right. One in two representative experiments is shown.

Figure 4E shows the effect of soluble NID1 on NKp44-induced IL-2 production in Bw-NKp44 cells. Bw-NKp4 and Bw-NKp30 cells were incubated on anti-NKp44 or anti-NKp30 mAb-coated plates, respectively, for 20 hours at 37 ° C in the presence or absence of SN derived from non-transfected or NID1-transfected Bw cells . The release of IL-2 in the SN was evaluated by ELISA. Background (from GAM-stimulated cells) was subtracted for each value. Data are medians of duplicates ± interquartile range and are pooled results from three independent experiments. ** p = 0.0022, ns = 0.8983 with two-tailed Mann Whitney test.

Figure 5 shows the effects of soluble NID1 on NKp44-induced function in Bw-NKp44 cells and human polyclonal NK cells. Figure 5A shows Bw-NKp44 and Bw-NKp30 cells incubated on anti-NKp44 or anti-NKp30 mAb-coated plates, respectively, for 20 hours at 37 ° C in the absence or presence of SN derived from non-transfected K562 cells or transfected with NID1. The release of IL-2 in the SN was evaluated by ELISA. Background (from GAM-stimulated cells) was subtracted for each value. Data are medians of duplicates ± interquartile range and are pooled results from four independent experiments. *** p = 0.0002, ns = 0.1044, with two-tailed Mann Whitney test. Figure 5B shows polyclonal NK cell lines incubated with SN derived from non-transfected or NID1-transfected K562 cells and cultured for 20 hours at 37 ° C on plates coated with anti-NKp44, -NKp30 or -NKp46 mAK. The release of IFN-� in the SN was evaluated by ELISA. Data are medians of six independent experiments ± interquartile range performed with NK cells from three donors. * p = 0.0156, ns = 0.1094 (NK anti-NKp30) and 0.0983 (NK anti-NKp46) with one-sided Wilcoxon test. Figure 5C shows polyclonal NK cell lines incubated with medium or with SN derived from non-transfected or NID1-transfected K562 cells. After 20 hours the cells were used in a redirected kill assay against the target cell line Fc�R P815 in the absence or presence of the indicated mAbs (Ratios E: T 2: 1 and 1: 1). Data are medians of duplicates ± interquartile range and are the pooled results of six experiments performed with NK cells derived from three donors * p = 0.0313 (2: 1 ratio) and 0.0156 (1: 1 ratio) by test One-tailed Wilcoxon.

Figure 6 shows the results of the analysis of NID1 surface expression in the HEK293T cell line and in NID1 cell transfectants. HEK293T cells were stained with a NID1-specific mAb followed by mouse anti-IgG1 mAb conjugated to PE. The figure shows the HEK293T, K652, K562-NID1, Bw and Bw-NID1 cells stained with a specific mAb for NID1 or with NKp44Fc followed by the appropriate secondary mAb conjugated to PE coupled by isotype. Samples were analyzed by flow cytometry. The gray profiles represent cells stained with anti-NID1 or with NKp44Fc, while the white profiles correspond to the isotype control. One in four representative experiments is shown.

Figures 7A to D show the functional effects of cell surface-bound NID1 or plastic-bound rNID1 in Bw-NKp44 and NK cells. Figure 7A shows Bw-NKp44 cells cultured alone or in the presence of non-transfected or NID1-transfected K562 cells for 20 hours at 37 ° C. The release of IL-2 in the SN was evaluated by ELISA. Data are medians of duplicates ± interquartile range and are pooled results from three independent experiments: ns = 0.5714 by two-tailed Man-Whitney test. Figure 7B shows Bw-NKp44 cells incubated on plates coated with rNID1, anti-NID1 rNID1 or anti-His rNID1 for 20 hours at 37 ° C. The release of IL-2 in the SN was evaluated by ELISA. Data are medians of duplicates ± interquartile range and are pooled results from two independent experiments: ns = 0.8286 (-) or ns = 0.6571 (anti-NID1, anti-His) by two-tailed Mann-Whitney test . Figure 7C shows polyclonal NK cell lines evaluated for their cytolytic activity in a 4 hour <51> Cr release assay against Bw and Bw-NID1 cells at the indicated E: T ratios. Data are medians of duplicates ± interquartile range and are pooled results from fifteen experiments performed with NK cells derived from five donors. * p = 0.0277 by one-sided Wilcoxon test. Figure 7D shows polyclonal NK cell lines incubated on rNID1-coated plates for 20 hours at 37 ° C. The release of IFN-� in the SN was evaluated by ELISA. Data are medians of eight independent experiments ± interquartile range performed with NK cells derived from three donors. ns = 0.2305 with a one-sided Wilcoxon test.

Figure 7E shows Venn diagrams showing the protein profile overlap between rNID1- and anti-NKp44-stimulated NK cells. (a) Venn diagram of total proteins identified in NK cells exposed to the indicated controls (CTR, GAM) or stimuli (NID1, mAb anti-NKp44). The Venn diagram shows common and unique proteins. The numbers represent distinct proteins in their respective overlapping and non-overlapping areas. (b) Venn diagram of upregulated and downregulated proteins in NK cells stimulated with rNID1 or anti-NKp44 mAb. The numbers in the non-overlapping areas indicate proteins identified exclusively in the NID1vsCTR or NKp44vsGAM dataset.

Figure 8 shows the proteomic analysis of NK cells stimulated with mAb rNID1 or anti-NKp44. Figures 8A and B show the volcano diagram representation of differentially expressed proteins. The graphs represent stimulated NK cells (rNID1) versus unstimulated NK cells (CTR) (Figure 8A) or stimulated (anti-NKp44 mAb) or unstimulated (GAM) NK cells (Figure 8B). The black points represent proteins that show both changes in times of high magnitude (x axis, the upregulated proteins after treatment are shown on the right) and high statistical significance (-log10 of the P value, y axis). The black line shows where FDR = 0.05 and s0 = 0.1. The red asterisks represent proteins (with the indicated gene names) whose change in times is <2 (log2 = 1) or P> 0.05 and which are present in the two data sets. The gray squares represent non-statistically significant proteins. Figures 8C and D show the categorization of Gene Ontology (GO) proteins significantly modulated by antirNID1 and anti-NKp44 mAb stimuli according to biological processes (Figure 8C) or a cellular component (Figure 8D). The percentage of proteins associated with the indicated GO terms is shown on the x axis.

Figure 9. Analysis of the surface expression of NID1 and the reactivity of NKp44Fc on a panel of human cell lines. The cell lines indicated (neuroblastoma SH-SY-5Y; glioblastoma A172; melanoma C-32; ovarian adenocarcinoma A2774; placental choriocarcinoma JEG-3; lung cancer A549) were stained with a specific mAb for NID1 or with NKp44Fc continuing with the appropriate isotype-matched PE-conjugated secondary mAb. Samples were analyzed by flow cytometry. The gray profiles represent cells stained with anti-NID1 or with NKp44Fc, while the white profiles correspond to the isotype control. One in three representative experiments is shown.

DESCRIPTION OF THE INVENTION

In this study we identified and characterized an extracellular natural cytotoxicity receptor (NCR) ligand known as NKp44. Analysis of the HEK293T cell line culture supernatant which was reactive with an NKp44-Fc (NKp44Fc) fusion protein and the use of 2-DE, combined with high resolution mass spectrometry, revealed that NID1 is a reactive molecule with NKp44. The interaction between NID1 and NKp44 was validated both by immunoprecipitation and by ELISA experiments, indicating that NKp44 recognizes NID1 in its native conformation. Soluble NID1 could downregulate the activation of NK cells mediated by NKp44; furthermore, plastic-bound NID1 induced significant changes in the proteomic profile of NK cells, suggesting a possible effect on various functions of NK cells.

NID1 glycoprotein is an essential component of the basement membrane (BM) that plays a role in both the assembly and stabilization of the BM, and in the adhesion between cells and the extracellular matrix (ECM). Therefore, NKp44-NID1 interactions are likely to occur in tissues, particularly mucous membranes, which contain both NK and ILC3 cells, expressing NKp44. The engagement of NKp44 in ILC3 can induce the production of TNF-a and synergize with IL-1, IL-7 and IL-23 to induce the secretion of IL-22 (a cytokine typically produced by ILC3). In a recent study, transcriptome analysis of NKp44-stimulated CLIs revealed a "broad genomic regulatory effect" (Glatzer et al. Immunity 2013; 38: 1223–35). This result is in line with our current proteomic study which demonstrates that stimulation of NK cells through both mAb-mediated NKp44 cross-linking and plastic-bound NID1 could induce significant changes in a relevant number of proteins. Consistent with the multiple ligand specificities of NKp44 and its ability to mediate different functional responses, NKp44 crosslinking and NID1-induced stimulation led to protein changes that were only partially overlapping. However, the GO analysis suggested some common functional effects induced by the two stimuli. Based on this analysis, NID1 recognition appeared to influence different biological processes related not only to immunological functions but also to cell metabolism, proliferation and development. In this context, it should be noted that among the limited number of proteins upregulated by both stimuli, the highest score was associated with MYSM1, a molecule that has been proposed to play a role in the development / maturation of NK cells. Therefore, the discovery that MYSM1 was induced by stimulation with rNID1 and reticulation of NKp44 mediated by mAb suggests a novel cell function induced by NKp44 and offers insights into the role of the NKp44-NID1 interaction in the maturation and differentiation process of NK cells (and / or CLI).

Functional experiments disclosed herein have revealed that soluble NID1 can play a role as a decoy ligand. In fact, the addition of rNID1 to cell cultures caused the inhibition of NKp44-mediated responses in Bw-NKp44 cells. An inhibitory effect was also shown by soluble NID1 released from cell transfectants. Importantly, NID1 release could significantly reduce NKp44-induced IFN-� secretion (and, to a lesser extent, cytotoxicity) in normal polyclonal human NK cells. Surprisingly, the NID1-mediated inhibition was specific for NKp44, although high concentrations of rNID1 also had a slight inhibitory effect in Bw-NKp30 cells. On the other hand, the supernatant of NID1-releasing cellular transfectants does not inhibit NKp30 function in Bw-NKp30 cells. Furthermore, it was unable to inhibit NKp30 and NKp46 mediated responses in normal polyclonal NK cells (see Figure 5). Finally, rNID1 did not react with NKp30Fc in an ELISA (see Figure 2C). The release of NID1 into extracellular fluids may therefore represent a regulatory mechanism that can act on NKp44 NK cells at specific sites or in the bloodstream.

Recent studies have shown the presence of soluble NID1 in samples of different human cancers, including patients with ovarian cancer (Li et al. Jpn J Clin Oncol 2015; 45: 176-82) or patients with NSCLC (Willumsen et al., Neoplasia N Y N 2017; 19: 271-8) or gastrointestinal tumor samples (Ulazzi et al. Mol Cancer 2007; 6:17), breast cancer and melanoma (Aleckovic et al., Genes Dev 2017; 31: 1439–55). Therefore, NID1 appears to be released into the extracellular environment of various tumor types. In the present disclosure, the inhibitory NID1-NKp44 interaction however provides a suppressive mechanism exploited by tumors to prevent attack mediated by NK cells.

NID1 is generally released as a whole molecule. Therefore, the inhibitory effect on NK cells can be mediated by the intact molecule. In other embodiments, NID1 can be modified in the ECM by the action of extracellular proteases, such as Cat-S and ADAMTS1 (Disintegrin A and Metalloproteinase with ThromboSpondin motifs) (Martino-Echarri et al. Int J Cancer 2013; 133 : 2315–24). Furthermore, NID1 can interact with different BM / ECM proteins including laminin, type IV collagen and perlecan (Ho et al. Microsc Res Tech 2008; 71: 387–95; Kruegel et al. Cell Mol Life Sci CMLS 2010; 67: 2879–95). Therefore, it is possible that the microenvironment of the tissue and the molecular context may further influence the functional outcome of the NID1-NKp44 interaction and that NID1 may be associated with other proteins or co-receptors.

It is important that we show that NID1, in addition to being released into the extracellular space, can also be detected on the cell surface of NID1 releasing cells (see Figure 6). In this context, it has been reported that NID1 can associate through the interaction of its RGD sequence with α3β1 or αvβ3 integrins (Dedhar et al. J Biol Chem 1992; 267: 18908–14; Yelian et al. J Cell Biol 1993 ; 121: 923-9). Specifically, surface NID1 can be detected on a panel of different NKp44Fc-binding human tumor cell lines (Figure 9). Although it has been reported that upregulation of NID1 occurs in different tumor types, there is still a lack of information on whether or not NID1 is associated with the tumor cell surface. We evaluated the possible functional result of the interaction between NID1 associated with the cell surface on cells responsive to NKp44 +. In the Bw-NKp44 model, it was not possible to observe the induction of IL-2 production. In NK NKp44 + cells, no induction of IFN-� production could be detected following exposure to RN1-coated plates or increased cytotoxic activity against target cells expressing NID1. On the other hand, as discussed in the examples, using a proteomic approach, we found that surface-bound rNID1 could induce changes in the proteins involved in different biological processes. Such protein changes can also be induced by cell surface associated NID1.

Taken together, new opportunities are provided for more effective exploitation of NK cells and / or other CLIs expressing activating receptors that are bound and inhibited by NID (e.g. CLI expressing NKp44), for therapeutic purposes, including non limiting immunotherapy of tumors.

Definitions

Where "comprising" is used, this may optionally be replaced by "consisting essentially of" or "consisting of".

The term "antibody", as used herein, refers to polyclonal and monoclonal antibodies. Based on the type of constant domain in the heavy chains, antibodies are assigned to one of five main classes: IgA, IgD, IgE, IgG and IgM. Several of these are further divided into subclasses or isotypes, such as IgG1, IgG2, IgG3, IgG4, and the like. An exemplary structural unit of immunoglobulin (antibody) comprises a tetramer. Each tetramer is composed of two pairs of identical polypeptide chains, each pair having a "light" (about 25 kDa) and a "heavy" (about 50-70 kDa) chain. The amino terminal portion of each chain includes a region ranging from 100 to 110 or more amino acids, mainly responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to such light and heavy chains respectively. The heavy chain constant domains that correspond to the different classes of immunoglobulins are defined respectively "alpha", "delta", "epsilon", "gamma" and "mu". The subunit structures and three-dimensional configurations of the different immunoglobulin classes are well known. IgGs represent exemplary classes of antibodies used herein because they are the most common antibodies in the physiological situation and because they are more easily produced in a laboratory setting. In one embodiment, an antibody is a monoclonal antibody. Humanized, chimeric, human or otherwise suitable for humans antibodies are also included. “Antibodies” includes full-length antibodies but also includes any fragments or derivatives of any of the antibodies described herein.

The term "hypervariable region", when used herein, refers to the amino acid residues of an antibody that are responsible for binding the antigen. The hypervariable region includes amino acid residues from a "complementarity determining region" or "CDR," (ie residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the variable domain of light chain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al. 1991) and / or those residues coming from a "hypervariable loop" (e.g. residues 26–32 (L1), 50–52 (L2) and 91–96 (L3) in the light chain variable domain and 26–32 (H1), 53-55 (H2) and 96–101 ( H3) in the heavy chain variable domain; Chothia and Lesk J. Mol. Biol 1987; 196: 901-917), or a similar system for the determination of the essential amino acids responsible for binding to the antigen. Typically, the numbering of amino acid residues in this region is carried out by the method described in Kabat et al., Above. Phrases such as "position of Kabat", "numbering of variable domain residues as in Kabat" and "according to Kabat" in the present refer to this numbering system for heavy chain variable domains or light chain variable domains. Using this numbering system, the actual linear amino acid sequence may contain a smaller or larger number of amino acids corresponding to a shortening of, or an insertion into, a FR or a CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insertion (residue 52a according to Kabat) after the residue 52 of H2 and inserted residues (e.g. residues 82a, 82b, and 82c, etc. according to Kabat) after the residue FR 82 of heavy chain. The Kabat numbering of the residues can be determined for a given antibody by aligning the antibody sequence with a numbered "standard" Kabat sequence in correspondence with the homology regions of the antibody sequence.

By “frame” or “FR” residues as used herein is meant the region of a variable antibody domain excluding those regions defined as CDR. Each antibody variable domino frame can be further subdivided into contiguous regions separated by the CDRs (FR1, FR2, FR3 and FR4).

The term "binds specifically to" means that an antibody can bind in a competitive binding assay with the binding partner, for example NKp44 or NID1, evaluated using the recombinant forms of the proteins, the epitopes within them or the native proteins present. on the surface of isolated target cells. Competitive binding assays and other methods for determining a specific binding are further described below and are well known in the art.

When it is stated that a first molecule (e.g. NID1, NKp44, another antibody) "competes with" a second molecule (e.g. sNID1, NKp44, another antibody) for binding to a target protein (e.g. NID1, NKp44, another antibody), this indicates that the first molecule competes with the second molecule in a binding assay using both the recombinant target protein and the surface-expressed target protein. For example, if an experimental antibody reduces the binding of NKp44 to a polypeptide of NID1 or to a cell expressing NID1 in a binding analysis, it is stated that the antibody "competes" with NKp44 respectively.

The term "affinity", as used herein, indicates the strength of the binding of an antibody to an epitope. The affinity of an antibody is given by the dissociation constant Kd, defined as [Ab] x [Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antigen-antibody complex, [Ab] is the molar concentration of the unbound antibody and [Ag] is the molar concentration of the unbound antigen. The affinity constant Ka is defined by 1 / Kd. Methods for determining mAb affinity can be found Harlow, et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988), Coligan et al., Ed., Current Protocols in Immunology , Greene Publishing Assoc. and Wiley Interscience, N.Y., (1992, 1993), and Muller, Meth. Enzymol. 92: 589-601 (1983), references of which are fully incorporated herein by reference. A standard method well known in the art to determine the affinity of mAbs is the use of surface plasmon resonance (SPR) screening (for example by analysis with a BIAcore ™ SPR analytical device).

The term "depletion" or "depletion", with respect to cells (for example, cells expressing NID1) means a process, method or compound which results in killing, elimination, lysis or induction of such killing, elimination or lysis, so as to adversely affect the number of such cells present in a sample or subject. “Non-depletion”, referring to a process, method or compound means that the process, method or compound does not cause depletion.

The term "agent" is used herein to denote a chemical compound, a mixture of chemical compounds, a cell or cellular composition, a biological macromolecule or an extract made from biological materials. The term "therapeutic agent" refers to an agent that has biological activity.

A "humanized" or "human" antibody refers to an antibody in which the constant and variable frame region of one or more human immunoglobulins is fused with the binding region, for example the CDR, of an animal immunoglobulin. These antibodies are designed to maintain the binding specificity of the non-human antibody from which the binding regions derive, but to avoid an immune reaction against the non-human antibody. Such antibodies can be obtained from transgenic mice or other animals that have been "engineered" to produce specific human antibodies in response to antigenic challenge (see, for example, Green et al. (1994) Nature Genet 7:13; Lonberg et al. . (1994) Nature 368: 856; Taylor et al. (1994) Int Immun 6: 579, the complete teachings of which are incorporated herein by reference). A fully human antibody can also be constructed by genetic or chromosomal transfection methods, as well as phage exposure technology, all of which are known in the art (see, for example, McCafferty et al. (1990) Nature 348: 552 -553). Human antibodies can also be generated from activated B cells in vitro (see, for example, U.S. Patent Nos. 5,567,610 and 5,229,275, which are incorporated in their entirety by reference).

A "chimeric antibody" is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, substituted or swapped in such a way that the antigen-binding site (variable region) is connected to a constant region of a different or altered class, effector function and / or species or a completely different molecule that confers new properties to the chimeric antibody, e.g. an enzyme, toxin, hormone, growth factor, drug, etc. or (b) the variable region, or a relative portion, is altered, replaced or exchanged with a variable region having a different or altered specificity for the antigen.

The terms "Fc domain", "Fc portion" and "Fc region" refer to a C-terminal fragment of an antibody heavy chain, for example from about amino acid (aa) 230 to about aa 450 of the chain� (gamma ) human or its counterpart sequence in other types of heavy antibody chains (for example, α, δ, ε and μ for human antibodies), or to a naturally occurring allotype. Unless otherwise specified, the commonly accepted Kabat amino acid numbering for immunoglobulins is used throughout this disclosure (see Kabat et al. (1991) Sequences of Protein of Immunological Interest, 5th ed., United States Public Health Service, National Institute of Health, Bethesda, MD).

The term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" is a term well understood in the art and refers to a cell-mediated reaction in which non-specific cytotoxic cells expressing Fc receptors (FcR) recognize the bound antibody on a target cell and subsequently cause lysis of the target cell. Non-specific cytotoxic cells that mediate ADCC include natural killer (NK) cells, macrophages, monocytes, neutrophils and eosinophils.

The terms "isolated", "purified" or "biologically pure" refer to a material that is substantially or essentially devoid of the components that normally accompany it as it is in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein representing the predominant species present in a preparation is substantially purified.

The terms "polypeptide," "peptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues represent an artificial chemical mimetic of a corresponding natural amino acid, as well as to natural amino acid polymers and non-natural amino acid polymers.

The term "recombinant" when used with reference, for example, to a cell, or nucleic acid, protein or vector, indicates that the cell, nucleic acid, protein or vector has been modified by the introduction of an acid nucleic or heterologous protein or alteration of a nucleic acid or native protein, or that the cell is derived from a cell modified in this way. Therefore, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all.

In the context herein, the term antibody that "binds" a polypeptide or epitope designates an antibody that binds said determinant with specificity and / or affinity.

The term "identity" or "identical", when used in a relationship between sequences of two or more polypeptides, refers to the degree of sequence correlation between polypeptides, as determined by the number of matches between strings of two or more amino acid residues. The "identity" measures the percentage of identical matches between the smallest of two or more sequences with interval alignments (if any) managed by a specific mathematical model or computer program (ie "algorithms"). The identity of the related polypeptides can be easily calculated with known methods. Such methods include, while not limited to them, those described in Computational Molecular Biology, (Lesk, A.M., M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed. ., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G. , Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., ed., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48, 1073 (1988 ).

The methods for determining the identity are designed to provide the widest correspondence between the analyzed sequences. Methods for determining identity are described in publicly available computer programs. Computer program methods for determining identity between two sequences include the GCG program package, including GAP (Devereux et al., Nucl. Acid. Res. 12, 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., J. Mol. Biol.

215, 403-410 (1990)). The BLASTX program is publicly accessible through the National Center for Biotechnology Information (NCBI) and other sources (BLAST manual, Altschul et al. NCB / NLM / NIH Bethesda, Md. 20894 Altschul et al., Above). The well-known Smith Waterman algorithm can also be used to determine identity.

In this context, "treatment" or "treating" refers to the prevention, alleviation, management, cure or reduction of one or more clinically relevant symptoms or manifestations of a disease or disorder, unless the context contradicts. For example, the "treatment" of a patient in whom no clinically relevant symptoms or manifestations of a disease or disorder have been identified is preventive or prophylactic therapy, while the "treatment" of a patient in whom the clinically relevant symptoms or manifestations of a disease or disorder has been identified generally does not constitute preventive or prophylactic therapy.

As used herein, "NK cells" refers to a sub-population of lymphocytes that are involved in unconventional immunity. NK cells can be identified by virtue of certain biological characteristics and properties, in particular the expression of NKp46 and / or CD56 surface antigens for human NK cells (as well as NKp44) and the absence of the alpha / beta or gamma TCR complex / delta on the cell surface, the ability to bind and kill cells that fail to express "self" MHC / HLA antigens by activating specific cytolytic machinery, the ability to kill tumor cells or other diseased cells that express a ligand for activating NK receptors and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response. Any of these characteristics and activities can be used to identify NK cells, using methods well known in the art. Any subpopulation of NK cells will also be enclosed in the term NK cells. In the context of the present, “active” NK cells designate biologically active NK cells, including NK cells that have the ability to lysate target cells or enhance the immune function of other cells. NK cells can be obtained by various techniques known in the art, such as isolation from blood samples, cyapheresis, tissue or cell collections, etc. Useful protocols for tests involving NK cells can be found in Natural Killer Cells Protocols (edited by Campbell KS and Column M). Human Press. pp. 219-238 (2000).

"NKp44" refers to a protein or polypeptide encoded by the Ncr2 gene or by a cDNA prepared from this gene, see, for example, the UniprotKB O95944 identifier. Any isoform, allele or natural variant is enclosed in the term NKp44 polypeptide. An NKp44 polypeptide may for example be 90%, 95%, 98% or 99% identical to SEQ ID NO 1, or to a related contiguous sequence of at least 20, 30, 50, 100 or 200 amino acid residues. The amino acid residue sequence of human NKp44 (isoform 1) is shown as follows:

MAWRALHPLL LLLLLFPGSQ AQSKAQVLQS VAGQTLTVRC QYPPTGSLYE KKGWCKEASA LVCIRLVTSS KPRTMAWTSR FTIWDDPDAG FFTVTMTDLR EEDSGHYWCR IYRPSDNSVS KSVRFYLVVS PASASTQTSW TPRDLVSSQT QTQSCVPPTA GARQAPESPS TIPVPSQPQN STLRPGPAAP IALVPVFCGL LVAKSLVLSA LLVWWGDIWW KTMMELRSLD TQKATCHLQQ VTDLPWTSVS SPVEREILYH TVARTKISDD DDEHTL (SEQ ID NO: 1).

SEQ ID NO: 1 corresponds to the Uniprot access number O95944, the disclosure of which is incorporated herein by reference.

Nidogen-1 (NID1), also known as "entactin", is a sulfated glycoprotein widely distributed in the basement membranes and serves as a linker between other basement membrane proteins, namely, type IV collagen, perlecan and laminin. It is synthesized by cells as a precursor of 1247 amino acids (aa) with a signal sequence of 28 aa and a mature protein of 1219 aa. NID1 comprises three globular domains (G1, G2 and G3) connected by two rod-shaped domains. Nidogen-1 has been found to be a substrate for cathepsin-S (CatS) and at least two MMPs, MMP-7 and MMP-19. The degradation of nidogen-1 by CatS results in a compromised bond between nidogen-1 and type IV collagen, laminin and perlecan and can therefore affect the properties of the basement membrane. CatS-degraded Nidogen-1 can reflect the loss of basement membrane integrity (for example, as it can be associated with cancer with an invasive phenotype). The NID1 protein and gene sequences are known in the art. Natural NID1 protein can be purified from biological samples. The recombinant NID1 protein can be expressed and purified using conventional techniques. The NID1 protein may or may not be purified. Exemplary human NID1 amino acid sequences are described in Uniprot access number P14543. The amino acid sequence of the mature human NID1 protein (excluding the 28 amino acid sequence MLASSSRIRA AWTRALLLPL LLAGPVGC) is shown below in SEQ ID NO: 2:

LSRQELFPFG PGQGDLELED GD DFVSPALELS GALRFYDRSD IDAVYVTTNG IIATSEPPAK ESHPGLFPPT FGAVAPFLAD LDTTDGLGKV YYREDLSPSI TQRAAECVHR GFPEISFQPS SAVVVTWESV APYQGPSRDP DQKGKRNTFQ AVLASSDSSS YAIFLYPEDG LQFHTTFSKK ENNQVPAVVA FSQGSVGFLW KSNGAYNIFA NDRESVENLA KSSNSGQQGV WVFEIGSPAT TNGVVPADVI LGTEDGAEYD DEDEDYDLAT TRLGLEDVGT TPFSYKALRR GGADTYSVPS VLSPRRAATE RPLGPPTERT RSFQLAVETF HQQHPQVIDV DEVEETGVVF SYNTDSRQTC ANNRHQCSVH AECRDYATGF CCSCVAGYTG NGRQCVAEGS PQRVNGKVKG RIFVGSSQVP IVFENTDLHS YVVMNHGRSY TAISTIPETV GYSLLPLAPV GGIIGWMFAV EQDGFKNGFS ITGGEFTRQA EVTFVGHPGN LVIKQRFSGI DEHGHLTIDT ELEGRVPQIP FGSSVHIEPY TELYHYSTSV ITSSSTREYT VTEPERDGAS PSRIYTYQWR QTITFQECVH DDSRPALPST QQLSVDSVFV LYNQEEKILR YALSNSIGPV REGSPDALQN PCYIGTHGCD TNAACRPGPR TQFTCECSIG FRGDGRTCYD IDECSEQPSV CGSHTICNNH PGTFRCECVE GYQFSDEGTC VAVVDQRPIN YCETGLHNCD IPQRAQCIYT GGSSYTCSCL PGFSGDGQAC QDVDECQPSR CHPDAFCYNT PGSFTCQCKP GYQGDGFRCV PGEVEKTRCQ HEREHILGAA GATDPQRPIP PGLFVPECDA HGHYAPTQCH GSTGYCWCVD RDGREVEGTR TRPGMTPPCL STVAPPIHQG PAVPTAV IPL PPGTHLLFAQ TGKIERLPLE GNTMRKTEAK AFLHVPAKVI IGLAFDCVDK MVYWTDITEP SIGRASLHGG EPTTIIRQDL GSPEGIAVDH LGRNIFWTDS NLDRIEVAKL DGTQRRVLFE TDLVNPRGIV TDSVRGNLYW TDWNRDNPKI ETSYMDGTNR RILVQDDLGL PNGLTFDAFS SQLCWVDAGT NRAECLNPSQ PSRRKALEGL QYPFAVTSYG KNLYFTDWKM NSVVALDLAI SKETDAFQPH KQTRLYGITT ALSQCPQGHN YCSVNNGGCT HLCLATPGSR TCRCPDNTLG VDCIEQK

(SEQ ID NO: 2)

The inventors have shown that NKp44 binds to NID1. The binding of soluble NID1 (sNID1) which can be released by cells binds NKp44 and inhibits NKp44 signaling in NK cells. Although it is shown that NID1 can bind to NKp44 on its own, it will be recognized that NID1 can also bind NKp44 as part of a complex of proteins that collectively act as a receptor for NKp44.

Detection, diagnosis, pharmacodynamics, as well as patient selection and monitoring. Detection methods

Methods for detecting sNID1 (and / or co-ligands forming a protein complex with sNID1) in a biological sample are also provided. The detection of sNID1 (and / or coligands) in a biological sample obtained from a subject is made possible by a number of conventional methods, including but not limited to electrophoresis, chromatography, mass spectroscopy, and immunoassays. A preferred method includes immunoassays whereby sNID1 proteins are detected by their interaction with a NID1 specific reagent such as an antibody. The specific reagent for NID1 may for example be an antibody that specifically binds a full-length sNID1 (e.g. as secreted by cells) or a fragment thereof. Optionally a fragment is a full-length NKp44-binding fragment of sNID1 (e.g. cleaved by an enzyme such as CatS or MMP. The antibody, for example, may be characterized by a binding of an NKp44-binding sNID1 fragment preferentially on sNID1 at length full-length, or full-length sNID1 preferentially on a cloning fragment of sNID1, e.g. the antibody has binding affinity for a sNID1-binding NKp44 form that is substantially greater (e.g., 100x, 500x, 1000x, 10,000x or more) with respect to its binding affinity for another form of NID1. In other examples, NID1 can be detected using a composition comprising an NKp44 polypeptide or a related NID1 binding fragment. In an exemplary method, an NKp44 polypeptide or a related fragment (e.g. a fragment fused to a detectable portion) that retains the ability to bind NID1 is used to bind and / or detect the presence and / or levels of sNID1, including but not limited to, identify cells that express and / or release NID1 (for example in tumor tissues or in tissues adjacent to a tumor). An exemplary polypeptide of NKp44 comprises an amino acid sequence of SEQ ID NO 1, or a fragment of a related extracellular domain (e.g. a fragment of at least 50, 100 or more contiguous amino acids), or an amino acid sequence with at least 70%, l 80%, 90%, 95% amino acid identity with respect to one of them. Such compounds can be used to detect the presence of NID1 proteins and / or NID1 expressing cells in a qualitative or quantitative way.

Exemplary immunoassays that can be used for the detection of NID1 and co-ligands include, but are not limited to, radioimmunoassays, ELISAs, immunoprecipitation assays, Western blot, fluorescent immunoassays, and immunohistochemistry.

A biological sample that may contain NID1 (for example sNID1) can be obtained from an individual. In one embodiment, the sample is a tumor or tissue sample adjacent to a tumor. If the biological sample is of tissue or cellular origin, the sample can be solubilized in a lysis buffer optionally containing a chaotropic agent, detergent, reducing agent, buffer and salts. The sample can be a sample of biological fluid taken from a subject, for example a sample of urine, blood, serum, plasma, tears, saliva, cerebrospinal fluid, tissue, lymph, synovial fluid or sputum, etc. In one embodiment, the biological fluid is whole blood, or more preferably serum or plasma. Serum is the component of whole blood that is neither a red blood cell (serum contains no white or red blood cells) nor a clotting factor. It is the blood plasma with the fibrinogens removed. Consequently, serum includes all proteins not used in blood clotting (coagulation) and all electrolytes, antibodies, antigens, hormones and any exogenous substances (for example drugs and microorganisms). The sample can be diluted with a suitable diluent before making the sample come into contact with the antibody.

In general, a sample obtained from a subject can be put in contact with the antibody that specifically binds an NID1 antigen. Optionally, the antibody can be fixed to a solid support to facilitate washing and subsequent isolation of the complex before putting the antibody in contact with an experimental sample. Examples of solid supports include glass or plastic in the form of, for example, a microtiter plate, a stick, a ball or a microsphere. Antibodies can also be attached to a probe substrate or ProteinChip® matrix and can be analyzed by gas phase ion spectrometry as described above.

Immunological assays for the detection of NID1 include the ability to put a biological sample in contact with a specific antibody for a NID1 under conditions such that an immunospecific antigen-antibody interaction can occur, continuing with the detection or measurement of this interaction. The binding of the antibody to NID1 can be used to detect the presence and altered production of NID1.

An exemplary immunoassay is an ELISA. The ELISA generally includes the use of two different specific antibodies for NID1 or co-ligand: a capture antibody and a detection antibody. In some embodiments an antibody or an antigen binding fragment of this which recognizes NID1 is used to capture most or all of NID1 in the sample. A detection antibody capable of recognizing most or all of NID1 can be used to determine the total level of NID1 in the biological sample. In some embodiments, the detection antibody recognizes a domain or epitope different from the capture antibody.

In some embodiments, anti-sNID1 receptor antibodies and sNID1 detection methods can be used to detect the presence and altered (e.g. increased) production of sNID1.

Detecting NID1 in a biological sample (for example, as sNID1 and / or as mNID1 on cells in the biological sample) from an individual may be useful in methods for assessing or predicting whether the individual has a disease or condition characterized by immunosuppression, optionally a disease or condition characterized by insufficient NK and / or CLI activity, for example in an individual who is receiving or is a candidate for treatment with a therapeutic agent that enhances anti-tumor immunity, including but not limited to agents that inhibit immunosuppression or enhance NK and / or CLI-mediated activity. These agents can be tested to evaluate their effectiveness in individuals having (or not having) detectable sNID1 or mNID1 expressing cells and can therefore be administered (or not) as a function of the individual's NID1 status. In one embodiment, the therapeutic agent is a composition of NK cells or CLI cells. In one embodiment, the therapeutic agent is an agent that acts as an agonist for an activating receptor on an NK and / or CLI cell. In one embodiment, the therapeutic agent is an agent that acts as an antagonist for an inhibitory receptor on an NK and / or CLI cell. In one embodiment, the therapeutic agent is an agent that is able to bind a cancer antigen and is able to mediate the ADCC. In one embodiment, NK cells are NK cells expressing NKp44.

Diagnosis

A disease or disorder in an individual (for example, cancer) characterized by immunosuppression, including insufficient anti-tumor activity of NK cells and / or CLI, can be detected by quantifying the amount of sNID1 or co-ligands of the same in a biological sample of the individual, where a high amount of sNID1 or co-ligand in the individual's biological sample compared to a control (single values or more preferably pooled or mean values of normal individuals in the same assay) is indicative of a state pathological or a disorder characterized by immunosuppression. In one embodiment, sNID1 (e.g. at high levels relative to a control, e.g. a healthy individual or a non-immunosuppressed individual) in circulation or in a tissue of interest (e.g. tumor tissue or tissue adjacent to a tumor) is indicative of a disorder characterized by immunosuppression, optionally low and / or insufficient activation of NK cells. In one embodiment, mNID1-expressing cells (e.g. NID1-releasing cells) in a tissue of interest (e.g. tumor tissue or tissue adjacent to the tumor) are indicative of a disease characterized by immunosuppression, optionally low and / or insufficient activation of NK cells. In one embodiment, sNID1 and / or mNID1 expressing cells are indicative of a dysfunction characterized by susceptibility to disease control by NK cells, optionally NKp44 expressing cells.

A biological sample includes a biological tissue or fluid such as a fluid coming from the individual, for example blood, plasma, synovial fluid or lymph, or tumor tissue or tissue adjacent to a tumor. A control refers to a biological sample from an individual that does not find the disease or disorder to be tested. In some embodiments, the receptor or co-ligand is a membrane-bound, transmembrane, or membrane-associated receptor or co-ligand. Therefore, in some embodiments, the biological sample consists of cells obtained from the subject.

The amount of NID1 or co-ligand in a sample can be determined using conventional techniques such as chromatography, electrophoresis, immunohistochemistry, immunofluorescence, enzyme-linked immunosorbent assays, mass spectrometry, spectrophotometry, or a combination thereof.

The severity of a disorder or disease can be detected or assessed by quantifying the level of NID1 or co-ligand in an individual's biological sample and correlating the amount of NID1 in the individual's biological sample with an indicative NID1 quantity or expression of coligand of different phases of a disorder or disease. The amounts of NID1 or co-ligand related to different stages of disease or disorder or different levels of severity can be predetermined by quantifying the levels of NID1 or co-ligand in patients at different stages or with different severity of a disease or disorder.

Pharmacodynamic markers

The efficacy of treatments using immunotherapeutic agents can be determined by testing a sample obtained from a subject receiving treatment with the immunotherapeutic agent for changes in sNID1 and / or co-ligand levels or for the presence or levels of expressing cells. mNID1 in the tissues of interest. For example, baseline levels of sNID1 in a biological sample obtained from a subject can be determined prior to treatment. After or during treatment with the immunotherapeutic agent (for example an agent that acts as an agonist or antagonist of the function of NK or CLI cells, it is possible to monitor the levels of sNID1 in biological samples from the subject.

A change in the level of biomarkers, for example a decrease in sNID1, compared to baseline levels may indicate that the treatment is effective in reducing immunosuppression. In some embodiments, the level of only one biomarker is monitored. In other embodiments, the levels of 2, 3, 4, 5 or more biomarkers are monitored.

Patient selection

Methods for determining the level of NID1 (e.g. sNID1) and / or co-ligand may also allow for the selection of patients who are most likely to respond to a therapeutic agent, optionally a therapy that provides, enhances or inhibits cell activity immunity, in particular the activity of NK cells and / or CLI cells. For example, as shown herein, sNID1 mediates immune suppression via binding to NKp44. sNID1 may therefore reduce the ability of NK cells and / or other NKp44 expressing cells to control disease, particularly cancer. sNID1 can therefore indicate insufficient anti-tumor immunity, in particular a deficiency in the activity of NK cells.

Individuals with sNID1 and / or NID1 releasing cells may be selected for treatment with an immunotherapeutic agent that reduces the level and / or activity of sNID1. In another example, individuals with sNID1 and / or NID1 releasing cells (or who have an elevated or increased level of sNID1 and / or NID1 releasing cells) could be selected for treatment with an immunotherapy and / or a chemotherapeutic agent that is effective in increasing antitumor immunity in patients with such immunosuppression (e.g. in patients with sNID1 and / or NID1 stem cells). Optionally, immunotherapy improves the activity of NK and / or CLI cells. A further example could be selection for treatment with a composition comprising NK and / or CLI cytotoxic cells.

Examples of immunotherapeutic agents include agents (for example a monoclonal antibody) that bind an antigen expressed on the surface of a malignant cell, optionally in which the agent is a depleting agent that mediates ADCC, CDC and / or ADCP. Other examples of immunotherapeutic agents include agents (e.g., a monoclonal antibody) that bind (e.g. and lead to the activation of) an activating receptor (including coactivating receptors) expressed by NK and / or T cells. Examples of activating receptors are CD16. , TMEM173 also known as interferon gene stimulators (STING), CD40, CD27, OX-40, NKG2D, NKG2E, NKG2C, KIR2DS2, KIR2DS4, glucocorticoid induced tumor necrosis factor receptor (GITR), CD137, NKp44, NKp30 or DNAM-1, 2B4 (CD224). Still further examples of immunotherapeutic agents include agents (e.g., a monoclonal antibody) that bind and inhibit an NK receptor and / or an inhibitory T cell receptor, or a natural ligand of such an inhibitory receptor (e.g., a member of the Siglec family inhibitory, LAG-3, PD-1 (CD279) or its natural ligand PD-L1, TIM-3, TIGIT or CD96).

Identification of new NID1-NKp44 interaction modulators

Agents that interfere or enhance the NID1-NKp44 interaction can be useful in a variety of applications. For example, these compositions can be used to measure NID1-NKp44 interactions, to measure inhibition or enhancement of NID1-NKp44 interactions, for the identification of NID1 expressing cells, for the identification of new cell types and / or for studies into the molecular mechanisms of action of NID1 and NKp44.

Bioactive agents that can be screened for their ability to inhibit or improve the NID1-NKp44 interaction include, but are not limited to, proteins, small organic molecules, carbohydrates (including polysaccharides), polynucleotides and lipids. Generally, a plurality of assay mixes are analyzed in parallel with different agent concentrations to obtain a differential response at various concentrations. Typically, one of these concentrations acts as a negative control, i.e. at zero concentration or below the detection level. In addition, positive controls can be used, namely the use of agents known to induce agonistic or antagonistic activity of NKp44.

Candidate agents comprise numerous chemical classes, although typically they are organic molecules, preferably small organic compounds having a molecular weight greater than 100 and less than about 2,500 daltons, more preferably between 100 and 2000, more preferably between about 100 and about 1250, more preferably between about 100 and about 1000, more preferably between about 100 and about 750, more preferably between about 200 and about 500 daltons. These candidate agents include functional groups necessary for a structural interaction with proteins, in particular for hydrogen bonds, and typically include at least one amino, carbonyl, hydroxyl or carboxylic group, preferably at least two of the functional chemical groups. Candidate agents often comprise cyclic or heterocyclic carbon structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, proteins, antibodies, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

Other candidate agents include peptidomimetics. The peptidomimetics can be produced as described, for example in WO 98/156401. Peptidomimetics, as used herein, refer to molecules that mimic peptide structures. Peptidomimetics have general characteristics similar to their relative structures, polypeptides, such as amphiphilicity. Peptidomimetics have been developed in a number of classes, such as peptoids, azapeptides, urea peptidomimetics, sulfonamide peptides, oligoureas, oligocarbamates, Ν, Ν-bonded oligoureas, oligopyrrolinones, oxazolidine-2-oni, azatides and hydrazeptides.

Candidate agents are obtained from a wide range of sources, including libraries of natural or synthetic compounds. For example, numerous means are available for the random and direct synthesis of a wide range of organic compounds and biomolecules, including the expression of randomized oligonucleotides. Antibody variable domain libraries can be produced by phage exposure techniques. Alternatively, libraries of natural compounds are available or readily produced in the form of bacterial, fungal, plant and animal extracts. In addition, libraries and natural or synthetically produced compounds are easily modified through conventional chemical, physical and biochemical means. Known pharmacological agents can be subjected to direct or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogues. In a preferred embodiment, the candidate bioactive agents are organic chemical fractions or chemical compositions based on a small molecule, a large variety of which are available in the art.

In an exemplary assay, NKp44 and NID1 proteins (e.g., independently as soluble proteins or as proteins bound to a surface such as a cell surface or solid support) are used to identify antibodies, small molecules, and other NKp44- interaction modulators. NID1.

In another exemplary assay, NKp44 or other cells produced to express NKp44 can be used to identify antibodies, small molecules, and other modulators that are NKp44 agonists or antagonists, in the presence of NID1 or NID1 expressing cells.

In another exemplary assay, NK cells expressing NKp44 or other cells produced to express NKp44 can be used to identify antibodies, small molecules, and other modulators that enhance the activity (e.g. cytolytic activity) of NK cells expressing NKp44, towards target cells (e.g. cancer cells).

In another exemplary assay, NK expressing NKp44 or other cells produced to express NKp44 can be used to identify antibodies, small molecules, and other modulators that inhibit the activity (e.g. cytolytic activity) of NK cells expressing NKp44, towards target cells.

In one embodiment of such an assay, the method comprises the steps of: (i) bringing NKp44 (e.g. as an NKp44 expressing cell or as a soluble NKp44 protein) into contact with NID1 (e.g. as an NID1 expressing cell, or as soluble NID1 protein) in the presence of a test agent (e.g., a plurality of test agents), and (ii) assess the binding of NID1 to NKp44. A reduction in the binding (compared to the negative control) indicates that the agent interferes with the binding of NID1 and NKp44. An increase in binding (compared to the negative control) indicates that the agent improves the interaction of NID1 and NKp44.

In one embodiment, a method is provided for identifying agents that increase NK cell activity, comprising the steps of: (i) bringing NKp44 (e.g. as an NKp44 expressing cell or as a soluble NKp44 protein) into contact with a composition comprising a NID1 polypeptide (e.g. sNID1) or a fragment thereof, (ii) assessing the binding of the composition to NKp44. In another embodiment, a method is provided for identifying agents that increase NK cell activity, comprising the steps of: (i) bringing NKp44 (e.g. as an NKp44 expressing cell or as a soluble NKp44 protein) into contact with a composition comprising a NID1 polypeptide (e.g. sNID1) or a fragment thereof, (ii) assessing whether the composition increases the activity of NK cells. Optionally, the method further comprises the steps of: (iii) selecting (e.g. for use in therapy, for the production of a batch of therapeutic agent, for further treatment or evaluation) an agent that interferes with the binding of NID1 to NKp44 and / or increases the activity of NK cells. In one embodiment, the agent is for use in the treatment or prevention of a cancer.

In one embodiment, a method is provided for evaluating the activity of NK cells (or other NKp44 expressing cells) towards target cells (e.g. tumor cells), comprising the steps of: (i) contacting an NKp44 expressing cell (e.g. an NK cell) with a target cell in the presence of sNID1, (ii) assessing the activity of the NKp44 expressing cell (e.g. an NK cell) towards the target cell. Optionally, the evaluation of the activity of the NKp44-expressing cell towards the target cell includes the evaluation of a parameter or marker of cellular maturation and / or development, optionally, the evaluation of MYSM1 expression. Optionally, evaluating the activity of the NKp44-expressing cell towards the target cell includes evaluating cytokine production and / or any measure of effector cell-mediated cytotoxicity towards the target cell, e.g. target cell lysis, a marker of cytotoxicity / cytotoxic potential, e.g. expression of CD107 and / or CD137 (mobilization) on the effector cell.

When the test agent is an antibody, for example for the identification of antibodies that interfere with and / or inhibit the NID1-NKp44 interaction, any of the variety of techniques known in the art can be used. Typically, they are produced by immunizing a non-human animal, preferably a mouse, with an immunogen, for example an immunogen comprising a NID1 polypeptide, preferably a human NID1 polypeptide. The NID1 polypeptide may comprise the full-length sequence of a human NID1 polypeptide, or a relative fragment or derivative, typically an immunogenic fragment, i.e. a portion of the polypeptide comprising an epitope exposed on the sNID1 polypeptide, optionally not present on mNID1 polypeptides (for example, as expressed by cells). Such fragments typically contain at least about 7 consecutive amino acids of the mature polypeptide sequence, even more preferably at least about 10 consecutive amino acids thereof.

Use of agents that alleviate the immunosuppressive effect of sNID-1 for the treatment of cancer or infectious diseases

Agents that alleviate the immunosuppressive effect of sNID-1 and / or restore and / or enhance NKp44 NK cell activity may be particularly useful for treating cancer and / or restoring anti-tumor immunity in individuals with cancer. or to treat an infectious disease and / or restore immunity to a pathogen or cell infected with pathogens. Optionally, the tumor is characterized by a solid tumor, optionally an invasive and / or metastatic cancer, in particular a cancer characterized by the presence of detectable NID1, for example as can happen during the loss of basement membrane integrity. Loss of basement membrane integrity is typically associated with invasive and / or metastatic disease. Agents that block the interaction of NID1 with NKp44 and / or reduce the amount of sNID1 present in an individual may be useful for improving or restoring the activity of NK cells, in particular NK cells expressing NKp44.

Furthermore, since the immunosuppressive effect of sNID1 can attenuate the antitumor response mediated by immunotherapeutic agents, agents that block the interaction of NID1 with NKp44 and / or reduce the amount of sNID1 present in an individual may be useful to enhance the effect. treatment of an immunotherapy, for example an immunotherapy that directly or indirectly enhances the activity of T cells and / or NK cells.

Reducing the amount of sNID1 present in an individual can be achieved by a variety of methods. In one example, sNID1 that can be found in the circulation and / or tissues can be sequestered, destroyed or otherwise eliminated, for example by targeting with an agent such as a protein or antibody that binds sNID1, optionally the agent binds sNID1 and targets sNID1 for degradation by proteolysis. In another example, NID1-releasing cells, e.g., cells expressing membrane-bound NID1 (mNID1) on the surface, may be sequestered, removed, destroyed or otherwise eliminated, for example by targeting with a composition comprising an agent such as a protein or antibody that binds mNID1. In another example, the immunosuppressive efficacy of sNID1 on immune cells expressing NKp44 is blocked with an agent such as a protein or an antibody that interferes with the interaction between NKp44 and sNID1.

In one aspect of any embodiment herein, an agent, antibody or protein is in purified or at least partially purified form. In one aspect of any embodiment herein, the antibody is in isolated form.

In one aspect of any embodiment herein, an agent, antibody, or protein can be characterized as a ligand specifically sNID1 and mNID1. In one aspect of the invention, the antibody can be characterized as specifically sNID1 ligand but not mNID1 ligand.

In one aspect of any embodiment herein, the agent is an antibody selected from a full-length antibody, an antibody fragment and a molecule derived from synthetic or semi-synthetic antibodies.

In one aspect of any embodiment herein, the agent is an antibody selected from a fully human antibody, a humanized antibody and a chimeric antibody.

In one aspect of any embodiment herein, the agent is a fragment of an antibody comprising a constant domain or Fc selected from IgG1, IgG2, IgG3 and IgG4, optionally modified with respect to a constant domain or natural Fc.

In one aspect of any embodiment herein, the agent is or comprises an antibody fragment selected from a Fab fragment, a Fab 'fragment, a Fab'-SH fragment, an F (ab) 2 fragment, an F fragment (ab ') 2, a Fv fragment, a heavy chain Ig (a llama or camel Ig), a VHH fragment, a single FV domain and a single chain antibody fragment.

In one aspect of any embodiment herein, the agent is or comprises a molecule derived from synthetic or semisynthetic antibodies selected from a scFV, a dsFV, a minibody, a diabody, a triabody, a kappa body, an IgNAR; and a multispecific antibody (e.g. bispecific, tri-specific).

Agents that inhibit NKp44-sNID1 interaction can restore NKp44 NK cell activity and may be particularly useful for treating disease characterized by the sNID1 protein, optionally circulating sNID1, optionally sNID1 in tumor tissue and / or tissue adjacent to the cancer. For example, antibodies or other agents (for example a composition or a protein that includes a sNID1 binding fragment of NKp44) that inhibit the NKp44-sNID1 interaction can inhibit the effect of sNID1 on NKp44. Optionally, the antibody or other agent reduces the sNID1-mediated inhibition of the activity of cells expressing NKp44, for example antibodies can restore the NKp44 signaling pathway. Agents (for example antibodies) that inhibit the NKp44-sNID1 interaction can therefore be referred to as "neutralizing" or "inhibitory" or "blocking" agents (or, for example, antibodies). Such agents are useful, inter alia, to restore, enhance or enhance the activity of NKp44-expressing immune cells, for example for the treatment or prevention of conditions in which enhancement or increase in NK cell activity may improve, prevent, eliminate or in any way improve the condition or any symptoms thereof.

A series of cellular assays can be used to evaluate the ability of antibodies to inhibit the NKp44-sNID1 interaction. In addition, it is possible to use a large number of assays, including molecular, cell-based and animal models to evaluate the ability of anti-NKp44 antibodies to modulate the activity of cells expressing NKp44. An antibody may advantageously be a human, humanized or chimeric antibody, for example comprising human constant regions and optionally further structure segments of the human variable domain. The analyzes include, without limitation, any of the essays in the “Examples” section herein.

In one embodiment, an agent or composition that inhibits the NKp44-sNID1 interaction is a protein that comprises a sNID1 binding fragment of a human NKp44 protein. Optionally, the protein further comprises an Fc domain, optionally a dimeric Fc domain that binds to human FcRn polypeptides.

In one embodiment, an agent or composition that inhibits the NKp44-sNID1 interaction comprises an antibody that binds specifically to a sNID1 protein. In one embodiment, the antibody is able to bind to human sNID1 and human mNID1. In one embodiment, the antibody binds to human sNID1 but not to human mNID1.

In one embodiment, an antibody or other agent that inhibits the NKp44-sNID1 interaction has no substantial specific binding to human Fcγ receptors, for example, one or more of CD16A, CD16B, CD32A, CD32B and / or CD64) . Such antibodies may comprise constant regions of various heavy chains which are known to have no or reduced binding with Fcγ receptors. Alternatively, antibody fragments that do not include (or include portions of) constant regions, such as F (ab ') 2 fragments, can be used to avoid binding of the Fc receptor. The binding to the Fc receptor can be evaluated according to methods known in the art, including for example the binding test of an antibody to the Fc receptor protein in a BIACORE assay. Furthermore, it is generally possible to use any isotype of antibody IgG in which the Fc portion is modified (for example by introducing 1, 2, 3, 4, 5 or more amino acid substitutions) to minimize or eliminate binding to the Fc receptors (see, for example, WO 03/101485, the disclosure of which is incorporated herein by reference). Assays such as cell-based assays for evaluating Fc receptor binding are well known in the art and are described, for example, in WO 03/101485.

In one embodiment, the antibody or another protein that comprises an Fc domain may include one or more specific mutations in the Fc region that determine "silent Fc" antibodies that have minimal interaction with the effector cells. The silenced effector functions can be obtained by mutation in the Fc region of the antibodies and have been described in the branch: N297A mutation, LALA mutations, (Strohl, W., 2009, Curr. Opin. Biotechnol. Vol. 20 (6): 685 -691); and D265A (Baudino et al., 2008, J. Immunol. 181: 6664-69) see also Heusser et al., WO2012 / 065950, the disclosures of which are incorporated herein by reference. In one embodiment, an antibody comprises one, two, three or more amino acid substitutions in the hinge region. In one embodiment, the antibody is an IgG1 or IgG2 and comprises one, two or three substitutions at residues 233-236, optionally 233-238 (EU numbering). In one embodiment, the antibody is an IgG4 and includes one, two or three substitutions at residues 327, 330 and / or 331 (EU numbering). Examples of silent Fc lgG1 antibodies are the LALA mutant comprising the L234A and L235A mutation in the amino acid sequence of Fc LgG1. Another example of a silent Fc mutation is a mutation at residue D265, or at residue D265 and P329 for example as used in an IgG1 antibody such as the DAPA mutation (D265A, P329A) (US 6,737,056). Another silent IgG1 antibody comprises a mutation at the N297 residue (e.g. N297A, N297S mutation), resulting in glycosylated / non-glycosylated antibodies. Other silent mutations include: substitutions at residues L234 and G237 (L234A / G237A); substitutions at residues S228, L235 and R409 (S228P / L235E / R409K, T, M, L); substitutions at residues H268, V309, A330 and A331 (H268Q / V309L / A330S / A331S); substitutions at residues C220, C226, C229 and P238 (C220S / C226S / C229S / P238S); substitutions at residues C226, C229, E233, L234 and L235 (C226S / C229S / E233P / L234V / L235A; substitutions at residues K322, L235 and L235 (K322A / L234A / L235A); substitutions at residues L234, L235 and P331 (L234F / L235E / P331S); substitutions at residues 234, 235 and 297; substitutions at residues E318, K320 and K322 (L235E / E318A / K320A / K322A); substitutions at residues (V234A, G237A, P238S); substitutions at residues 243 and 264; substitutions at residues 297 and 299; substitutions such that residues 233, 234, 235, 237 and 238 defined by the EU numbering system, comprise a sequence selected from PAAAP, PAAAS and SAAAS (ref. WO2011 / 066501).

In one embodiment, the antibody can comprise one or more specific mutations in the Fc region which result in improved stability of an antibody of the disclosure, for example comprising multiple aromatic amino acid residues and / or having high hydrophobicity. For example, such an antibody may comprise an Fc domain of human IgG1 origin, comprises a mutation at one or more Kabat residues 234, 235, 237, 330 and / or 331. An example of such an Fc domain includes substitutions in correspondence of Kabat L234, L235 and P331 residues (for example, L234A / L235E / P331S or (L234F / L235E / P331S). Another example of such Fc domain includes substitutions at Kabat residues L234, L235, G237 and P331 ( for example, L234A / L235E / G237A / P331S). Another example of such Fc domain includes substitutions at the Kabat residues L234, L235, G237, A330 and P331 (for example, L234A / L235E / G237A / A330S / P331S) In one embodiment, the antibody comprises an Fc domain, optionally of the human IgG1 isotype, comprising: a L234X1 substitution, an L235X2 substitution and a P331X3 substitution, where X1 is any amino acid residue other than leucine, X2 is any amino acid residue different from leucine and X3 is any amino acid residue other than proline; optionally in which X1 is an alanine or phenylalanine or a relative conservative substitution; optionally where X2 is glutamic acid or a relative conservative substitution; optionally where X3 is a serine or a relative conservative substitution. In another embodiment, the antibody comprises an Fc domain, optionally of the human IgG1 isotype, comprising: an L234X1 substitution, an L235X2 substitution and a G237X4 substitution and a P331X4 substitution, where X1 is any amino acid residue different from leucine, X2 is any amino acid residue other than leucine and X3 is any amino acid residue other than glycine and X4 is any amino acid residue other than proline; optionally in which X1 is an alanine or phenylalanine or a relative conservative substitution; optionally where X2 is glutamic acid or a relative conservative substitution; optionally, X3 is alanine or a relative conservative substitution; optionally X4 is a serine or a relative conservative substitution. In another embodiment, the antibody comprises an Fc domain, optionally of the human IgG1 isotype, comprising: a L234X1 substitution, an L235X2 substitution and a G237X4 substitution, a G330X4 substitution and a P331X5 substitution, where X1 is any amino acid residue other than leucine, X2 is any amino acid residue other than leucine and X3 is any amino acid residue other than glycine, X4 is any amino acid residue other than alanine and X5 is any amino acid residue other than proline; optionally in which X1 is an alanine or phenylalanine or a relative conservative substitution; optionally where X2 is glutamic acid or a relative conservative substitution; optionally, X3 is alanine or a relative conservative substitution; optionally X4 is a serine or a relative conservative substitution, optionally X5 is a serine or a relative conservative substitution. In the abbreviated notation used in this case, the format is: Wild-type residues: Position in the polypeptide: Mutant residues, in which the positions of the residues are indicated according to the UE numbering according to Kabat.

In some examples, reducing the level and / or activity of sNID1 that is available to interact with NKp44 can, in one example, be achieved by targeting NID1-releasing cells with an agent such as a protein or antibody that binds mNID1 on the surface of a cell releasing NID1 and preventing the generation and / or secretion of NID1 from the cell. Although such an agent (e.g. proteins or antibodies) may also be depleting with respect to cells expressing mNID1 (e.g. it may comprise an Fc domain mediating ADCC, CDC, ADCP), the agent which prevents the release of sNID1 from the cells must not be of depletion towards mNID1-expressing cells. The agent may or may not interfere with the interaction between NKp44 and sNID1. A non-depleting agent may have the advantage of reducing the toxicity of healthy cells. For example, in one embodiment, an antibody or other agent that prevents the release of NID1 from cells does not have substantial specific binding to human Fcγ receptors, for example, one or more of CD16A, CD16B, CD32A, CD32B and / or CD64). Such agents may comprise constant regions of various heavy chains which are known to have absent or reduced binding with Fcγ receptors.

The affinities and binding properties of anti-NID1 antibodies for a FcγR can be determined using in vitro assays (biochemical or immunoassays) known in the art to determine antibody-antigen or Fc-FcγR interactions, i.e. the specific binding of an antigen to an antibody or the specific binding of an Fc region to an FcγR, including but not limited to an ELISA, a surface plasmon resonance assay, immunoprecipitation assays.

Examples of cancer that may be particularly advantageously treated with agents described herein (e.g., an agent that restores NKp44 NK cell activity; an antibody binding domain or NID1 binding antigen) include, inter alia, tumors solids, for example carcinomas and sarcomas. Malignant tumors that can be treated are classified herein according to the embryonic origin of the tissue from which the tumor is derived. Carcinomas are tumors arising from endodermal or ectodermal tissues such as the skin or the epithelial lining of internal organs and glands. Sarcomas, which occur less frequently, arise from mesodermal connective tissues such as bone, fat, and cartilage. Malignant tumors can occur in many organs or tissues in the body to cause cancer. Examples of cancers that can be treated include, but are not limited to: bladder, skin, breast, cervical, head and neck, colon or bowel (e.g. colorectal), esophagus, kidney, liver cancer , lung, prostate, skin, stomach, uterine, ovarian, endometrial and testicular. Additional examples include neuroblastoma and glioblastoma.

Examples of infectious diseases that can be particularly advantageously treated with immune response enhancing agents described herein (e.g., an agent that restores NKp44 NK cell activity; an antigen-binding domain or an antibody that binds NID1) include among others, infections caused by an infection with viruses, bacteria, protozoa, molds or fungi. Such viral infectious organisms include, but are not limited to, hepatitis type A, hepatitis type B, hepatitis type C, influenza, chicken pox, adenovirus, herpes simplex type I (HSV-1), herpes simplex type 2 (HSV -2), rinderpest, rhinovirus, echovirus, rotavirus, respiratory syncytial virus, papilloma virus, papilloma virus, cytomegalovirus, echinovirus, arbovirus, huntavirus, coxsackie virus, mumps virus, measles virus, rubella virus, poliovirus and virus human immunodeficiency type I or type 2 (HIV-1, HIV-2). Bacteria constitute another preferred class of infectious organisms including, but not limited to, the following: Staphylococcus; Streptococcus, including S. pyogenes; Enterococci; Bacillus, including Bacillus anthracis, and Lactobacillus; Listeria; Corynebacterium diphtheriae; Gardnerella including G. vaginalis; Nocardia; Streptomyces; Thermoactinomyces vulgaris; Treponerna; Camplyobacter, Pseudomonas including P. aeruginosa; Legionella; Neisseria including N. gonorrhoeae and N. meningitides; Flavobacterium including F. meningosepticum and F. odoraturn; Brucella; Bordetella including B. pertussis and B. bronchiseptica; Escherichia including E. coli, Klebsiella; Enterobacter, Serratia including S. marcescens and S. liquefaciens; Edwardsiella; Proteus included P. mirabilis and P. vulgaris; Streptobacillus; Rickettsiaceae including R. rickettsia, Chlamydia including C. psittaci and C. trachornatis; Mycobacterium including M. tuberculosis, M. intracellulare, M. folluiturn, M. laprae, M. avium, M. bovis, M. africanum, M. kansasii, M. intracellulare, and M. lepraernurium; and Nocardia. Protozoa may include, but are not limited to, leishmania, kokzidioa, and trypanosome. Parasites include, but are not limited to, chlamydia and rickettsia.

An antibody or antigen-binding domain that binds NID1 can be produced by a variety of techniques known in the art. In one example, the antigen binding domain comprises a polypeptide of NKp44 (for example an extracellular domain of the polypeptide of NKp44 or a relative fragment that binds human NID1). In another embodiment, an antibody or antibody fragment comprising an antigen-binding domain (e.g., hypervariable immunoglobulin region) that binds to NID1 is generated, for example, by selection from antigen-binding domains of a library or by immunization of a non-human animal. The step of immunizing a non-human mammal with an antigen can be carried out in any way well known in the art to stimulate the production of antibodies in a mouse (see, for example, E. Harlow and D. Lane, Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988), disclosure of which is incorporated herein by reference). Antibodies can also be produced by selection of combinatorial immunoglobulin libraries, as described for example in (Ward et al. Nature, 341 (1989) p. 544 whose disclosure is incorporated herein by reference).

Once antibodies are identified that are capable of binding a NID1 polypeptide and / or having other desired properties, they will also typically be evaluated, using standard methods including those described herein, for their ability to bind to other polypeptides. Ideally, the antibodies bind only with substantial affinity to the NID1 polypeptide (sNID1 and / or mNID1, depending on the specific mode of action desired) and do not bind to a significant level with unrelated polypeptides. However, it will be recognized that antibodies can also be characterized as suitable if the affinity for NID1 (or sNID1 or mNID1) is substantially greater (e.g., 100x, 500x, 1000x, 10,000x, or more) than it is for one. specific other polypeptide).

At the time of antibody production, for example by immunization and production of antibodies in a vertebrate or cell or by phage exposure, particular selection steps can be carried out to identify and / or isolate the antibodies as claimed. In this regard, the disclosure also relates to methods for producing such antibodies, comprising the steps of: (a) providing a plurality of antibodies that bind sNID1; and (b) selecting antibodies from step (a) that are capable of interfering with the interaction between sNID1 and an NKp44 polypeptide (e.g., an NKp44 polypeptide expressed by a cell; an NKp44 polypeptide in solution or bound to a solid support). The disclosure also relates to methods of producing such antibodies, comprising: (a) providing a plurality of antibodies that bind mNID1; and (b) selecting antibodies from step (a) that are capable of mediating the depletion of mNID1-expressing cells.

Anti-NID1 antibodies, for example, can be prepared as depletion antibodies that mediate the lysis of mNID1-expressing cells from effector immune cells, e.g. NK and / or T cells. In one example, a bispecific anti-NID1 antibody comprises a first antigen-binding domain that binds mNID1 and a second antigen-binding domain that binds a protein (e.g. an activator receptor such as CD3, CD8, CD16, NKp44, NKp30, NKG2D etc.) expressed by an immune effector cell. The bispecific antibody will direct the effector cell to lysate the cell expressing mNID1.

In one example, anti-NID1 antibodies can be prepared as depletion antibodies which, in addition or alternatively, mediate ADCC through the incorporation of the Fc domain that binds to human Fcγ receptors. Such antibodies, whether monospecific or multispecific, may include constant regions of various heavy chains that are known to bind or have a high binding affinity for human Fcγ receptors, in particular CD16. One such example is a constant region of human IgG1. Furthermore, any antibody isotype in which the Fc moiety is modified to enhance or enhance binding to the Fc receptors may be used, as further discussed herein.

In another embodiment, anti-NID1 antibodies can be prepared for example as non-depleting antibodies that interfere with the interaction between NKp44 and sNID1. The ability to interfere with the interaction between NKp44 and sNID1 can be tested with the methods described herein. Such antibodies may include constant regions of various heavy chains that are known not to bind or have a low binding affinity for human Fcγ receptors, in particular CD16. One such example is a constant region of human IgG4. Another example is an antibody of any isotype (e.g. IgG1, IgG2, IgG3 or IgG4) that includes an amino acid substitution to reduce binding to human Fcγ receptors, especially CD16.

The binding to the Fc receptor can be evaluated according to methods known in the art, including for example by testing the binding of an antibody to the Fc receptor protein by surface plasmon resonance (for example in a BIACORE assay).

The DNA that encodes an antibody that binds an epitope present on the NID1 polypeptides is isolated from the hybridoma and placed in an appropriate expression vector for transfection into an appropriate host. The host is then used for recombinant production of the antibody or variants thereof, such as a humanized version of that monoclonal antibody, active fragments of the antibody, chimeric antibodies comprising the antigen recognition portion of the antibody, or versions comprising a detectable portion.

The monoclonal antibodies encoding DNA can be easily isolated and sequenced using conventional procedures (for example, using oligonucleotide probes that are able to bind specifically to genes encoding the heavy and light chains of the antibody). Once isolated, the DNA can be placed in expression vectors, which are subsequently transfected into host cells such as E. coli cells, Cos like cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce. an immunoglobulin protein, to achieve the synthesis of monoclonal antibodies in recombinant host cells. As described elsewhere in this specification, such DNA sequences can be modified for any of a large number of purposes, for example, to humanize antibodies, produce fragments or derivatives, or to modify the antibody sequence, for example, at the site. antigen binding in order to optimize the specificity of the antibody binding. Recombinant expression in bacteria of the DNA encoding the antibody is well known in the art (see, for example, Skerra et al., Curr. Opinion in Immunol., 5, pp. 256 (1993); and Pluckthun, Immunol 130, page 151 (1992).

The identification of one or more antibodies that bind to NID1 and / or inhibit interaction with NKp44 can be readily determined using any of the various immunological screening assays in which antibody competition can be assessed. Many of these assays are routinely practiced and are well known in the art (see, for example, U.S. Patent No. 5,660,827, which is incorporated herein by reference). For example, if the experimental antibodies to be tested are obtained from animals of different origins or even from a different Ig isotype, a simple competition test can be used in which the control and experimental antibodies are mixed (or pre-absorbed) and applied to a sample containing NID1 polypeptides.

Antibody fragments and derivatives (which are understood by the term "antibody" or "antibodies" as used in this application, unless otherwise indicated or clearly contradicted by the context) can be produced by techniques that are known in the art. The "fragments" include a part of the intact antibody, generally the antigen binding site or a variable region. Examples of antibody fragments include Fab, Fab ', Fab'-SH, F (ab') 2 and Fv fragments; diabody; any antibody fragment that is a polypeptide having a primary structure consisting of an uninterrupted sequence of contiguous amino acid residues (hereinafter referred to as "single-chain antibody fragment" or "single-chain polypeptide"), including without limitation (1) molecules Single-chain PV (2) single-chain polypeptides containing only a light chain variable domain, or a relative fragment containing the three CDRs of the light chain variable domain, without an associated heavy chain fraction and (3) chain polypeptides single containing a single heavy chain variable region, or a relative fragment containing the three CDRs of the heavy chain variable region, without an associated light chain fraction; and multispecific antibodies formed from antibody fragments. Among other things, a nanobody, a domain antibody, a single domain antibody or a "dAb" are included.

In certain embodiments, the DNA of an antibody-producing hybridoma can be modified prior to insertion into an expression vector, for example by substituting the sequence coding human heavy and light chain constant domains in place of the non-human homologous sequences. (e.g. Morrison et al., PNAS pp. 6851 (1984)), or by covalently joining to the immunoglobulin coding sequence all or part of the non-immunoglobulin polypeptide coding sequence. In this way, "chimeric" or "hybrid" antibodies are prepared that have the binding specificity of the original antibody. Typically, such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody.

Therefore, according to another embodiment, the antibody is humanized. The "humanized" forms of antibodies are specific chimeric immunoglobulins, immunoglobulin chains or related fragments (such as Fv, Fab, Fab ', F (ab') 2 or other antigen binding sequences of antibodies) which contain a minimal sequence derived from the murine immunoglobulins. For the most part, humanized antibodies are human immunoglobulins (recipient antibodies) in which the residues of a complementarity determining region (CDR) of the recipient are replaced by residues of a CDR of the original antibody (donor antibody) while maintaining specificity, affinity and desired capacity of the original antibody.

In some instances, the Fv frame residues of human immunoglobulin can be replaced with corresponding non-human residues. Furthermore, humanized antibodies may include residues that are not found either in the recipient's antibody or in the imported CDR or in the frame sequences. These modifications are made to further refine and optimize the performance of the antibody. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of the original antibody and all or substantially all of the FR regions are those of a sequence consent of a human immunoglobulin. Optionally, the humanized antibody will also include at least a portion of a constant region of immunoglobulin (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321, pp.

522 (1986); Reichmann et al, Nature, 332, pp. 323 (1988); Lend, Curr. Op. Struct. Biol., 2, pp. 593 (1992); Verhoeyen et Science, 239, pp. 1534 and U.S. Pat.

4,816,567, the entire disclosures of which are incorporated herein by reference). Methods for humanizing non-human antibodies are well known in the art.

Another method to create "humanized" monoclonal antibodies is to use a XenoMouse (Abgenix, Fremont, CA) as a mouse used for immunization. A XenoMouse is a mouse host in which its immunoglobulin genes have been replaced with functional human immunoglobulin genes. Therefore, antibodies produced by this mouse or in hybridomas produced by B cells of this mouse, are already humanized. The XenoMouse is described in U.S. Pat. 6,162,963, which is incorporated herein in its entirety by reference.

Human antibodies can also be produced according to various other techniques, for example using, for immunization, other transgenic animals that have been designed to express a repertoire of human antibodies (Jakobovitz et al., Nature 362 (1993) 255), or selecting antibody repertoires using phage exposure methods. These techniques are known to the expert and can be implemented starting from monoclonal antibodies as described in the present application.

Once an antigen-binding compound is obtained, it can be evaluated for its ability to mediate biological activity, for example, mediate the depletion of a cell, induce ADCC or CDC towards, inhibit the activity of, cell proliferation. , modulate (e.g. enhance) the activity of NK cells, reduce the amount and / or activity of sNID1, inhibit the production or secretion of NID1 from target cells expressing mNID1 and / or inhibit the binding between sNID1 and NKp44 .

An agent that relieves the immunosuppressive effect of sNID1 and / or restores and / or enhances the activity of NKp44 NK cells can be used in the treatment of a cancer as monotherapies, or advantageously as a combined treatment with one or more other therapies or therapeutic agents. , including agents and therapies normally used for the particular therapeutic purpose for which the agent is administered. The additional therapeutic agent will normally be administered in quantities and treatment regimens typically used for that agent in a monotherapy for the particular disease or condition being treated. Such therapies and therapeutic agents include, but are not limited to radiotherapy, anti-cancer agents and chemotherapeutic agents.

In one embodiment, the agent that relieves the immunosuppressive effect of sNID1 and / or restores and / or enhances the activity of NKp44 NK cells can be used particularly advantageously in combination with an immunotherapy (e.g. immunotherapy or immunotherapeutic agent) which is designed to deliver, stimulate and / or enhance an anti-cancer immune response. Since sNID1 can limit the effectiveness of this immunotherapy, the use of this immunotherapy in combination with an agent that alleviates the immunosuppressive effect of sNID1 can be beneficial. Examples of immunotherapeutic agents include agents (e.g. a monoclonal antibody) which bind an antigen expressed on the surface of a malignant cell, optionally where the agent is a depleting agent which mediates ADCC, CDC and / or ADCP, optionally in which the The agent is a multispecific agent which also specifically binds a protein on the surface of T and / or NK cells (e.g. CD3, CD16). Examples of immunotherapeutic agents include agents (e.g. a monoclonal antibody) which bind (e.g., and lead to the activation of) an activating receptor (including coactivating receptors) expressed by NK and / or T cells. Examples of activating receptors are CD16, TMEM173 also known as interferon gene stimulators (STING), CD40, CD27, OX-40, NKG2D, NKG2E, NKG2C, KIR2DS2, KIR2DS4, glucocorticoid-induced tumor necrosis factor receptor (GITR), CD137, NKp30, NKp30, or NKp30 DNAM-1, 2B4 (CD224). Still further examples of immunotherapeutic agents include agents (e.g., a monoclonal antibody) that bind and inhibit an NK receptor and / or an inhibitory T cell receptor, or a natural ligand of such an inhibitory receptor (e.g., a member of the Siglec family inhibitory, LAG-3, PD-1 (CD279) or its natural ligand PD-L1, TIM-3, TIGIT or CD96). In another example, the immunotherapeutic agent is a chemotherapeutic agent that has an immunomodulatory effect, in particular an immunostimulating effect.

In the treatment methods, the agent that alleviates the immunosuppressive effect of sNID1 and the second therapeutic agent can be administered separately, together or sequentially, or in a cocktail. In some embodiments, the antigen binding compound is administered prior to the administration of the second therapeutic agent. For example, the agent that relieves the immunosuppressive effect of sNID1 can be administered from 0 to 30 days before the administration of the second therapeutic agent. In some embodiments, the agent that relieves the immunosuppressive effect of sNID1 is administered for about 30 minutes to about 2 weeks, about 30 minutes to about 1 week, about 1 hour to about 2 hours, about 2 hours about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to 1 day, or about 1 to 5 days before the administration of the second therapeutic agent. In some embodiments, the agent that relieves the immunosuppressive effect of sNID1 is administered concurrently with the administration of the therapeutic agents. In some embodiments, the agent that relieves the immunosuppressive effect of sNID1 is administered after the administration of the second therapeutic agent. For example, the agent that relieves the immunosuppressive effect of sNID1 can be administered from 0 to 30 days after the administration of the second therapeutic agent. In some embodiments, the agent that relieves the immunosuppressive effect of sNID1 is administered for about 30 minutes to about 2 weeks, about 30 minutes to about 1 week, about 1 hour to about 2 hours, about 2 hours about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to 1 day, or about 1 to 5 days after the administration of the second therapeutic agent.

Exemplary Embodiments

1. A method for evaluating the interaction of an NKp44 polypeptide with a related ligand, comprising the steps of: (i) bringing an NKp44 polypeptide into contact with a NID1 polypeptide and (ii) detecting the binding of NKp44 to the polypeptide of NID1.

The method according to embodiment 1, wherein the NKp44 protein is brought into contact with NID1 in the presence of a test agent, optionally a plurality of test agents.

3. The method according to embodiment 2, in which step (ii) comprises evaluating whether the test agent modulates the binding of NKp44 to NID1.

4. The methods of embodiments 1 to 3, wherein the NID1 polypeptide is a soluble NID1 polypeptide (sNID1).

5. The methods of embodiments 1 to 3, wherein the NID1 polypeptide is a membrane bonded NID1 polypeptide (mNID1).

6. The methods of embodiments 1 to 5, wherein the NKp44 polypeptide is expressed on the surface of a cell.

7. A composition comprising an agent that binds NID1, for use in the prevention or treatment of a tumor or an infectious disease in an individual.

8. The composition of embodiment 7, in which the agent binds sNID1 and inhibits the binding of NKp44 to sNID1.

9. The composition of embodiments 7 or 8, in which the agent that binds mNID1 on the surface of a cell that releases NID1.

10. The composition of embodiments 7 to 9, in which the agent is a non-depleting antigen-binding protein.

11. The composition of embodiments 7 to 9, in which the agent is a depleting antigen binding protein.

12. The composition of embodiments 9 to 11, in which the agent decreases the release of sNID1 from NID1 releasing cells.

13. The composition according to any of the embodiments from 7 to 12, in which the method comprises the fact of administering the agent to the individual in an amount sufficient to reduce the immunosuppression mediated by sNID1.

14. The composition according to any of the embodiments from 7 to 13, wherein the method comprises administering the agent to the individual in an amount sufficient to reduce the sNID1-mediated suppression of the cells expressing NKp44.

15. The composition according to any of the embodiments from 7 to 8 or from 10 to 14, wherein the method comprises the fact of administering the agent to the individual in a sufficient quantity to purge the NID1 releasing cells.

16. The composition according to any of the embodiments from 7 to 15, in which the method comprises the fact of administering the agent to the individual in a sufficient quantity to decrease sNID1 in circulation or in the tumor environment.

17. The composition according to any of the embodiments from 7 to 16, in which the individual has a solid tumor.

18. The composition according to any one of embodiments 7 to 17, wherein the individual has a cancer selected from the group consisting of: bladder cancer, skin cancer, breast cancer, cervical cancer, head and neck cancer , colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, prostate cancer, stomach cancer, uterine cancer, ovarian cancer, endometrial cancer and testicular cancer.

19. The composition according to any of the embodiments from 7 to 18, in which the individual has an immunosuppressive state, optionally a state characterized by a deficiency in the activity of NK cells.

20. The composition according to any of the embodiments 7 to 19, in which the individual has sNID1 in circulation and / or tumor tissue, optionally at an increased level compared to a healthy individual.

21. The composition according to any of the embodiments from 7 to 20, in which the individual has a tumor tissue or adjacent to a tumor characterized by the presence of NID1 releasing cells.

22. A composition comprising an agent that binds NID1, for use in a method of evaluating immunosuppression in an individual with cancer.

23. The composition of the embodiment 22, in which the method comprises detecting sNID1, in which the presence of, or high levels of, sNID1 indicate that the individual has a disease characterized by immunosuppression.

24. The composition of the embodiment 22, in which the method comprises detecting NID1-releasing cells, in which the presence or high number of NID1-releasing cells indicates that the individual has a disease characterized by immunosuppression.

25. A composition comprising an agent that binds NID1, for use in the treatment of a tumor in an individual with detectable and / or elevated levels of sNID1.

26. A composition comprising an agent that binds NID1, for use in the treatment of a tumor or an infectious disease in an individual with a disease characterized by immunosuppression.

27. The composition of any of the embodiments 25 to 26, in which the agent inhibits the binding of NKp44 to sNID1.

28. The composition of any of the embodiments 25 to 27 in which the agent is a depleting antigen binding protein.

29. The composition of any of the embodiments 25 to 28, in which the agent decreases the release of sNID1 from NID1 releasing cells.

30. The composition of any of the embodiments 7 to 29 in which the agent is an antibody fragment or an antibody.

31. The composition of any of the embodiments from 7 to 29, in which the agent comprises a polypeptide of NKp44.

32. The composition of the embodiment 31, in which the agent the polypeptide of NKp44 is a NID1 binding fragment of NKp44, optionally fused with an Fc domain.

33. The composition of any of the embodiments 7 to 32, in which the agent binds a full-length sNID1 protein and / or a cleaved sNID1 protein.

34. The composition of the embodiment 33, in which the agent specifically binds a cleavage site of CatS on NID1.

35. The agent of the embodiments 26 to 34, in which the individual has sNID1 in circulation.

36. The agent of the embodiments 26 to 34, in which the individual has tumor tissue or adjacent to a tumor characterized by the presence of NID1 releasing cells.

37. A composition comprising an agent that reduces the level and / or activity of sNID1 which is available to interact with a polypeptide of NKp44.

38. The composition of the embodiment 37, in which the agent is an antibody or an antibody or an antibody fragment that binds sNID1, optionally in which the antibody competes with the NKp44 polypeptide for binding with a sNID1 polypeptide.

39. The composition of the embodiment 37, in which the agent comprises a sNID1 binding fragment of NKp44.

40. The composition of Embodiments 37 to 39, wherein the agent does not have an Fc domain or comprises an Fc domain that is modified to have reduced human CD16A, CD16B, CD32A, CD32B and / or CD64 polypeptides or to don't have them.

41. The composition of any of the above embodiments, wherein the agent is a protein, optionally an antibody fragment or an antibody, having a divalent Kd of less than 10 <-9> M for binding to a polypeptide of NID1.

42. The composition of the embodiments 37 to 41, for use as a medicine, optionally for use in the restoration or reduction of immunosuppression.

43. The composition of embodiment 37 to 42, for the treatment of a cancer or an infectious disease.

44. A pharmaceutical composition comprising a composition according to any of the above embodiments, and a pharmaceutically acceptable carrier.

45. An NKp44 polypeptide or fragment thereof, for use in the detection of NID1 on the surface of a cell, optionally for detecting an NID1 releasing cell, optionally where the cell is a cell present in tumor tissue or adjacent to a tumor.

46. A kit comprising the NKp44 polypeptide or related fragment of Embodiment 45, optionally further comprising a labeled secondary antibody that specifically recognizes the NKp44 polypeptide or related fragment.

47. A method for detecting NID1 on the surface of a cell, the method comprising binding of a cell in contact with an NKp44 polypeptide and detecting binding of NKp44 polypeptide to the cell, wherein a detection of the binding indicates that the cell bears NID1 on its surface.

48. A method for detecting the polypeptide of NID1 in a biological sample, the method comprising binding of a biological sample in contact with a polypeptide of NKp44 and detecting the binding of the polypeptide of NKp44 to the polypeptide of NID1.

49. The method according to any one of embodiments 45 to 48, wherein the cell or biological sample is from an individual with cancer.

50. An in vitro method for assessing disease in an individual with cancer, the method comprising bringing a biological sample from an individual into contact with an agent that is capable of specifically binding an sNID1 polypeptide and detecting the presence and / or sNID1 polypeptide levels, where a detection of the presence and / or increase in sNID1 levels indicates that the individual has an immunosuppressive state and / or that the individual has sNID1 capable of mediating activity immunosuppressive.

51. A method of treating or preventing a disease in an individual comprising:

a) determine whether tumor or adjacent tumor tissues carry detectable NID1 cells on their surface, optionally at higher levels than a control, and b) following a determination that tumor or adjacent tumor tissues bear detectable NID1 cells on their surface their surface, optionally at higher levels than a control, administer to the individual an agent that enhances the activity or number of lymphocytes, optionally NK cells.

52. A method of treating or preventing a disease in an individual comprising the steps of:

a) determine if the individual has sNID1, optionally at higher levels than a control, e

b) following a determination that the individual has sNID1, optionally at higher levels than a control, administer to the individual an agent that enhances the activity or number of lymphocytes, optionally NK cells.

53. The method of embodiments 51 to 52, wherein the disease is a cancer.

54. The method according to any of the embodiments from 51 to 53, in which the agent is an agent that reduces the level and / or activity of sNID1 that is available to interact with NKp44.

55. The method according to the embodiment 54, in which the agent is an agent that inhibits the interaction between a polypeptide of NKp44 and NID1.

56. A composition comprising a NID1 protein or a related NKp44 binding fragment, for use in the treatment of an autoimmune or inflammatory disease in an individual.

EXAMPLES

Materials and methods

Antibodies

The following monoclonal antibodies (mAb), produced in our laboratory, were used in this study: BAB281 (IgG1, anti-NKp46), AZ20 (IgG1, anti-NKp30) and Z231 (IgG1, anti-NKp44). The following commercial antibodies were also used: mouse anti-Nidogen-1 mAb (IgG1, clone 302117, R&D, MAB2570) and polyclonal goat anti-NID1 Ab (R&S, AF2570); mouse anti-NKp46 (IgG1, clone 29A1.4.9, Miltenyi Biotec, 130-095-118); goat human IgG antibody conjugated to horseradish peroxidase (HRP), (Southern Biotech, 2040-05) HRP-conjugated goat anti-mouse Ig mAb (Southern Biotech, 1031-05), mouse anti-IgG mAb HRP-conjugated goat (Southern Biotech, 6164-05) and phycoerythrin-conjugated goat mouse IgI1 mAb (PE) (Southern Biotech, 1070-09); PE-conjugated goat anti-human IgG mAb (Jackson ImmunoResearch, 109-116-170); polyclonal Ab anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) rabbit (ThermoFisher, PA1-16780); mouse anti-His mAb (IgG1, clone BMG-His-1, Roche Diagnostics, 1922416).

Cell lines

The following cell lines, purchased from the American Type Culture Collection (ATCC), were used in this study: HEK293T (human embryonic kidney), K562 (human erythroleukemia), Bw1547 (Bw, murine thymoma), SH-SY-5Y (neuroblastoma human), A172 (human glioblastoma), C-32 (human melanoma), A2774 (human ovarian adenocarcinoma), JEG-3 (human placental choriocarcinoma), A549 (human lung cancer). Cell lines were maintained in DMEM medium (HEK293T) or RPMI1640 supplemented with 10% (v / v) fetal calf serum (FCS), L-glutamine and antibiotics (penicillin and streptomycin). For some experiments, the HEK293T and K562 cell lines were also grown in protein-free CD medium (ThermoFisher, 11279023). The stably transfected K562 cells were selected and cultured in the presence of G418 sulfate (Calbiochem, 345810) at the final concentration of 1.2 mg / ml. All cell lines were periodically tested and were free of mycoplasma.

Preparation of soluble chimeric receptors

For the preparation of the soluble receptors NKp44Fc, NKp30Fc and NKp46Fc, the sequences encoding the extracellular portion of the different receptors were subcloned in the vector pRB1-2B4Fcmut (Dr. M Falco, Istituto G. Gaslini, Genoa) in the frame with the sequence coding the portion of human IgG1, which was mutagenized to obtain a mutated Fc that did not bind to the Fc receptors. These constructs were transfected into the HEK293 cell line using JetPEI (Polyplus, 101-10) following the manufacturer's instructions; after 48-72 hours, the cells were selected with 0.5 mg / ml of G418 sulphate, in order to obtain stably transfected and subcloned cells by limiting dilution. SNs were collected from cell clones grown in DMEM / 10% Ultra-low IgG FCS (ThermoFisher) or in Ex-CELL ACF CHO medium (Sigma, C5467) and soluble Fc molecules were purified by affinity chromatography using Protein A Sepharose 4 Fast Flow (G-Biosciences, 786-283). Purified recombinant proteins were checked by SDS-PAGE continuing with silver staining and by ELISA using mAbs specific for the different receptors.

Preparation of cell culture supernatants

Cell culture (SN) supernatants were obtained from wild-type or transfected K562 or Bw cells. After 48-72 hours of culture in 1% (v / v) FCS supplemented medium or in protein-free CD medium, the SN was collected and used for subsequent experiments, as such or after concentration (up to 30 times) with Amicon Ultracel-10K (Millipore, UFC901024). The protein content in SN derived from culture in protein-free CD medium was determined using the Bradford Protein Assay (Bio-Rad, 5000006).

Metabolic labeling

HEK293T cells were cultured in protein-free CD medium in the presence of ManAz (N-azidoacetylmannosamine-tetraacylate) (ThermoFisher, 88904) at the final concentration of 40 μM. After 72 hours, SN was collected, concentrated (up to 24 times) with Amicon Ultracel-10K, and incubated with Biotin-PEG3-phosphine (final concentration 200 μM, ThermoFisher, 88901) O / N at room temperature, in in order to label the secreted glycoproteins containing sugar azide. Labeled SN was dialyzed in PBS using D-Tube Dialyzer Maxi, MWCO 6-8 kDa (Novagen, 71509-3).

Enzyme conjugated immunosorbent assay (ELISA)

Direct ELISA: 100 μl of concentrated SN derived from HEK293T cells cultured in protein-free CD medium was applied to O / N ELISA plates at 4 ° C. Subsequently, the wells were saturated with PBS / 3% (w / v) bovine serum albumin (BSA) for 3 hours per week, washed in PBS and incubated with Fc molecules at different concentrations ranging from 20 to 2, 5 μg / mL or with 1 μg / mL anti-NID1 mAb followed by the appropriate HRP-conjugated secondary reagent. Similar experiments were performed on ELISA plates coated with 5 μg / ml of recombinant human Nidogen-1 (rNID1) (R & D, 2570-ND-050; source: Mouse myeloma cell line, Leu29-Lys1114 NID-1 protein derived from NS0 with a 9-His N-terminal tag) in PBS.

Indirect ELISA (sandwich): a similar procedure was applied. Briefly, the ELISA plates were coated with Fc molecules (5 μg / mL in PBS), saturated and incubated with 100 μl of HEK293T-SN-biot followed by HRP-conjugated streptavidin (Southern Biotech, 7100-05). Alternatively, the ELISA plates were coated with mouse anti-NID1 mAb molecules or Fc (5 μg / mL in PBS), saturated and incubated with 100 μl SN derived from K562 cells transfected with cultured wild-type NID1 or Bw. in 1% (v / v) CSF medium or in a protein-free CD medium. Next, a goat anti-NID1 polyclonal antibody was added, followed by an HRP-conjugated anti-goat Ig mAb.

A final incubation with the HRP substrate ABTS (2,2'-azino-di- acid (3-ethylbenzthiazolin sulfonic)) was performed in all experiments (Roche Diagnostics, 102 946). The colorimetric signal was measured with a reader of microplates (TECAN Sunrise) at an optical density (OD) of 405 nm.

Western blot analysis

Samples (6-28 μg of SN obtained in protein-free medium, 30 μl of SN obtained on average / 1% FCS, 160 ng of rND1) were subjected to 7.5% or 10% polyacrylamide gel under conditions non-reducing and transferred to membranes of Immobilon-P PVDF (Millipore, IPVH00010). For some experiments, gels were prepared with TGX dye-free 7.5% acrylamide solutions (Bio-Rad, 161-0181). Membranes were blocked with 5% BSA in tris-buffered buffer containing 0.05% Tween-20 (TBS-T) and probed with anti-NID1 mAb, a rabbit anti-GAPDH polyclonal Ab or Fc molecules (7 μg / mL) followed by the appropriate HRP conjugated secondary reagent. SuperSignal West Pico chemiluminescent substrate (ThermoFisher, 34080) was used for detection. Images were acquired with ChemiDoc Touch Imaging System (Bio-Rad) and analyzed with Image Lab (Bio-Rad) software.

Two-dimensional electrophoresis (2-DE) and Western blot

Concentrated HEK293T-SN and HEK293T-SN-biot (300 μg for Western blot and 600 μg for preparative gel) were solubilized in the reduction / alkylation solution containing 8 M urea, 4% CHAPS, 5 mM tributylphosphine (TBP), iodoacetamide 20 mM (IAA), 40 mM Tris and 0.1 mM EDTA for 1 hour. To avoid excessive alkylation during the isoelectric focusing (IEF) phase, the excess of IAA was neutralized by adding an equimolar amount of DTT. Finally, the samples were dissolved in the focusing / rehydration solution, i.e. 7 M urea, 2 M thiourea, 4% CHAPS and 15 mM dithioerythritol (DTE) and 0.6% (v / v) of an ampholyte cocktail. , containing 40% pH 3.5-10 and 60% pH ranges 4-8 (BDH Biochemical, 444302F) and loaded onto internally produced non-linear pH 3-10 strips. After running the IEF, the strips were equilibrated in 6 M Urea, 50 mM Tris-HCl at pH 8.8, 2% (w / v) of SDS, 30% (v / v) of glycerol and trace of bromophenol blue; the proteins were separated using SDS-PAGE (T% 8-16) and transferred to nitrocellulose membranes (Protran BA85, Whatman, 10402588) with a semi-dry system. Membranes were saturated with 3% w / v polyvinylpyrrolidone (PVP) in TBS and incubated overnight separately with NKp44Fc, NKp30Fc or NKp46Fc in 3% w / v BSA in 0.15% v / TBS-Tween. v (TBS-T). The membranes were then rinsed in TBS-T and incubated with HRP-conjugated anti-human IgG mAb. HEK293T-SN-biot underwent the same procedure and immunoblotting with Neutravidin-HRP (ThermoFisher, 31001). For preparation experiments, the SDS gels were stained with colloidal “blue silver” Coomassie. The images were digitized using ChemiDoc Touch (Bio-Rad) and analyzed with PDQuest software (Bio-Rad).

Identification of 2-DE spots

The spots excised from the 2D-PAGE were completely decoloured and digested with trypsin. All mass spectrometric measurements were made using an LTQ (Thermo Electron) linear trap mass spectrometer coupled to an HPLC Surveyor (Thermo Electron) equipped with a 250 mm × 1 mm Jupiter C18 column (Phenomenex). Protein identification was carried out using the SEQUEST software by searching a human protein database. The MS / MS assignments of the peptide were filtered according to very strict criteria: Xcorr ≥1.9 for single-charged ions, Xcorr ≥2.2 for double-charged ions, Xcorr ≥3.7 for triple-charged ions charge, peptide probability ≤0.01, delta Cn ≥0.1 and Rsp ≤4.26.

Immunoprecipitation

Immunoprecipitation experiments were performed using 12 μg of NKp44Fc, NKp30Fc or DNAM-1Fc molecules bound to 50 μl of Dynabeads Protein G (ThermoFisher, 10003D) and incubated O / N at 4 ° C with 400 μl of concentrated SN HEK293T (corresponding to 500 μg of protein). Samples were eluted using non-reducing sample buffer (10% glycerol, 2% SDS, 62.5 mM Tris-HCl at pH 6.8, 0.01% bromophenol blue) for 5 '- 60 ° C and subsequently analyzed with SDS-PAGE using TGX Stain-Free Acrylamide Solutions; the membrane was probed with mouse anti-NID1 mAb followed by anti-mouse Ig mAb conjugated to HRP.

RT-PCR analysis

Total RNA was extracted using RNAeasy Mini Kit (Qiagen, 74104) from the following cells: K562, K562-NID1, Bw, Bw-NID1. The Oligo (dT) primed cDNA was prepared by standard technique using a Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, 04379012001) following the manufacturer's instructions. Amplifications were performed for 30 cycles using Platinum TAQ DNA polymerase (ThermoFisher, 10966034) with a pairing T of 58 ° C (β-actin) or 62 ° C (NID1). The primers used were: β-actin for 5 'ACTCCATCATGAAGTGTGACG and β-actin rev 5' CATACTCCTGCTTGCTGATCC; NID1 for 5 'CTCCATTGGGCCTGTGAGG and NID1 rev 5' AGACACGGGGGC GTCATC. The PCR products (249 bp fragment for β-actin and 795 bp for NID1) were separated by 1.5% (weight / volume) agarose gel electrophoresis and visualized by ethidium bromide staining.

Stable cell transfectants

The K562 cell line was transfected with the pcDNA3.1-NID1 construct (Geneart, ThermoFisher) using JetPEI following the manufacturer's instructions. After 72 hours, cells were cultured in medium containing 1.2 mg / ml of G418 sulphate. At the end of the selection period, the surviving cells were sub-cloned by limiting dilution.

Bw-NID1 cells were prepared by retrovirus gene transfer. The ORF cDNA of NID1 was sub-cloned into the pMXs-IG retrovirus vector (IRES-GFP) (kindly provided by Dr. Kitamura, Tokyo, Japan). The pMXs-IG-NID1 construct was transiently transfected into the Plat-E packing cell line to generate viral particles which were used to infect Bw cells. NID1 positive cells were selected according to GFP expression; subsequently, the NID1 positive cells were sub-cloned by limiting dilution. Bw-NKp44 / DAP12 (Bw-NKp44) cells were obtained with a similar approach, using the pMXS-IG vector, in which the NKp44 ORF and DAP12 ORF cDNAs were sub-cloned into the two available cloning sites (the GFP coding sequence has been replaced by CDNA DAP12 ORF). Cells expressing NKp44 were selected and subcloned by limiting dilution.

For the recovery of SN from K562 and BW cells and transfectants, cell culture was carried out in RPMI / 1% FCS or in protein-free CD medium and the SN was collected after 48-72 hours. In the latter case, the SN was concentrated up to 10 times using Amicon Ultracel-10K.

Functional assays on Bw cells

1x10 <5> Bw cells were pretreated 1 hour at 37 ° C with 20 or 7.5 μg / ml of rNID1 or with 100 μl of SN obtained from wild-type or transfected K562 and Bw cells, cultured in RPMI / 1% of FCS and then plated on 96-well cell culture plates (1X105 cells / well) coated with 5 μg / ml of goat mouse anti-IgG (GAM, MP Cappel, 55481) individually or with GAM plus anti-NKp44 mAb or -NKp30. For co-culture experiments, Bw cells were pre-incubated 1 hour at 37 ° C with wild-type K562 and Bw cells or transfected with NID1 with an effector / target (E / T) ratio of 1: 1 and then transferred to mAb coated plates. In other experiments, Bw-NKp44 cells were incubated on plates in which rNID1 was coated directly or via anti-NID1 or anti-His mAb. For all these assays, after 20 hours at 37 ° C, the SNs were collected and analyzed for their IL-2 content by ELISA using the Mouse IL-2 ELISA Ready-SET-Go (eBioscience, BMS88-7024-77 ) according to the manufacturer's instructions. Each sample was tested in duplicate.

Generation of polyclonal NK cell lines

NK cells from healthy donors were purified from peripheral blood using the RosetteSep ™ NK Cell Enrichment Cocktail (StemCell Technologies, 15025). Populations showing more than 95% CD56 + CD3-CD14 NK cells were selected. Polyclonal NK cell lines were obtained by culturing purified NK cells at appropriate dilutions on irradiated feed cells in the presence of 100 U / ml of rhIL-2 (Proleukin, Novartis) and 1.5 ng / ml of phytohaemagglutinin (PHA, Gibco Ltd , 10576-015) in 96-well microtiter plates with round bottom. After 3/4 weeks of culture, the expanded NK cells were used for NK cell stimulation experiments.

Functional assays on NK cells

Evaluation of NK-mediated cytotoxicity against transfected Bw and Bw-NID-1 cells or against the murine P815 Fc�R + cell line (redirected kill assay) was performed in a 4-hour 51Cr release assay. In the redirected kill assay, mAb was added at the final concentration of 1.25 μg / mL (anti-NKp30 and anti-NKp46 mAb) or 0.5 μg / mL (anti-NKp44 mAb) (the appropriate concentration was determined after titration to induce specific functional response in NK cells). When indicated, K562-SN or K562-NID1-SN was added to NK cells (50% v / v) 1 hour before the start of the test.

For the IFN-� secretion assay, NK cells (10X10 <4> cells / well) were cultured overnight in 96-well microtiter plates pre-coated with GAM in the absence or presence of anti-NKp44 mAb. NKp30, -NKp46. When indicated, K562-SN or K562-NID1-SN was added at the start of the culture. The culture SN was then collected and analyzed for the presence of IFN-� using the IFN gamma Human ELISA Kit (ThermoFisher, EHIFNG).

Flow cytometry with imaging

HEK293T cells were incubated with anti-NID1 mAb followed by PE-conjugated anti-IgG1 mAb. Before analysis, the cells were stained with the Hoechst 33342 nuclear dye (ThermoFisher, 62249) (dilution 1: 1000). Cells were acquired with an ImageStreamX Mark II (IFC) 12-channel MultiMag system imaging flow cytometer (Merck) using INSPIRE acquisition software (Amnis Corporation). Three ImageStream channels were used: channel 1 for brightfield, channel 3 for NID1-PE (excited by a 488-nm laser), channel 7 for Hoechst44432 (excited by a 405nm laser). To collect only on single focused cells, we first narrowed our attention to the analysis of bright field (BF) parameters. The individual cells were selected using a biparametric dot plot representing the BF aspect ratio (i.e. width / height) versus the BF cell area, then, by the BF RMS gradient (square root of the mean of the sum of the squares), which measures the sharpness quality of an image, we filtered only the cells in focus. For each staining condition, 4,000 raw images were collected using a 40x objective. To avoid spectral overlap, single color compensation controls (500 cells each) were collected and a compensation matrix was generated. The raw image files were then analyzed using IDEAS 6.0.3 setup compensation (Amnis Corporation) based on the computed matrix. To verify the correspondence between the data derived from traditional cytometry and IFC, we compared the NID expression with its negative control (i.e. the cells labeled only with mAb conjugated to secondary PE) by means of their MFI (mean fluorescence intensity ). To ensure a better view of this data, we have merged the two files.

Flow cytometry

The cells were incubated with the primary molecules of mAb or Fc (20 μg / ml) for 30 minutes at 4 ° C, washed and stained with the appropriate secondary mAbs matched by isotype-PE for 30 'at 4 ° C. All samples were analyzed using a FACSCalibur flow cytometer and CellQuest Pro software (BD Biosciences).

Proteomic analysis of polyclonal NK cell populations

IL-2-activated polyclonal NK cells derived from four different healthy donors were cultured for 20 hours at 37 ° C in FCS- and IL-2-free medium in the absence or presence of rNID1 (20 μg / mL) directly applied to the plate or anti-NKp44 mAb applied via GAM. Subsequently, for the subsequent proteomic analysis, the cells were treated with the inTestTip (iST) 73 method. Briefly, the pellets were lysed, reduced, alkylated in one step using a buffer containing 2% (w / v) SDC (sodium deoxycholate), 10 mM TCEP (tris (2-carboxyethyl) phosphine hydrochloride), CAA 40 mM (chloroacetamide), Tris HCl 100 mM pH 8.0 and loaded in StageTip. The lysates were diluted with 25 mM Tris pH 8.5 containing 1 μg of trypsin. The samples were acidified with 100 μl of 1% (v / v) TFA (trifluoroacetic acid) and washed three times with 0.2% (v / v) of TFA. Elutions were performed with 60 μl of 5% (v / v) ammonium hydroxide, 80% (v / v) of ACN.

Samples were loaded from the sample loop directly into a 75 μm x × 50 cm 2 μm, 100 Å C18 column mounted in the thermostatted column compartment and the peptides were separated with a growing organic solvent at a flow rate of 250 nl / min using a non-linear gradient of 5-45% solution B (80% CAN and 20% H2O, 5% DMSO, 0.1% FA) over 180 min.

Eluent peptides were analyzed using a TriPort Fusion Fusion mass spectrometer (ThermoFisher Scientific). Orbitrap detection was used for both MS1 and MS2 measurements at resolving power of 120K and 30K (at m / z 200), respectively. Data-dependent MS / MS analysis was performed in maximum speed mode with a cycle time of 2 seconds, during which precursors detected in the range of m / z 375-1500 were selected for activation in order of abundance. Quadrupolar insulation with a 1.8 m / z insulation window was used and dynamic exclusion was enabled for 30 seconds. The automatic gain control targets were 2.5 × 105 for MS1 and 5 × 104 for MS2, with maximum injection times of 50 and 54 ms respectively. The signal strength threshold for MS2 was 1 × 10 <4>. The HCD was performed using 28% normalized collision energy. A microscan was used for the MS1 and MS2 events.

MaxQuant74 software, version 1.6.0.1, was used to process the raw data, setting a false discovery rate (FDR) of 0.01 for the identification of proteins, peptides and PSM (peptide spectrum matching), a length was required minimum of 6 amino acids for peptide identification. The Andromeda engine, incorporated into the MaxQuant software, was used to search MS / MS spectra against the Uniprot human database (version UP000005640_9606 February 2017). In processing, the variable modifications are the oxidation of acetyl (N-terminal of the protein) (M), deamidation (NQ); on the contrary, carbamidomethyl (C) was selected as a fixed modification. Intensity values were extracted and statistically evaluated using the ProteinGroup table and Perseus software. The MaxLFQ algorithm was selected for protein quantification with the 'match between runs' option activated to reduce the number of missing proteins.

Statistical analysis

Data was analyzed using GraphPad Prism 6, R or Perseus software. The details of the statistical analysis for each experiment are indicated in the legend of the corresponding figure.

Example 1: Identification of Nidogen-1 as an extracellular ligand for NKp44 which activates the NK receptor.

The aim of this study was the identification of presumed extracellular ligands for NKp44. To this end, we analyzed HEK293T cells as a possible source of such ligands since these cells were found to bind the chimeric NKp44Fc receptor on their cell surface. These data suggested that HEK293T cells could synthesize a hypothetical NKp44 ligand. It is important to emphasize that these cells could be grown extensively in a protein-free medium, thus facilitating the analysis of the proteins released in the culture supernatant.

Therefore, HEK293T cells were cultured in protein-free medium and the supernatants (HEK293T-SN) were collected, concentrated and applied to ELISA plates. The direct ELISA was performed using the soluble chimeric receptors NKp44Fc, NKp30Fc, NKp46Fc and DNAM-1Fc (Fc molecules). As shown in Figure 1F, panel (a), NKp44Fc strongly bonded to the wells coated with SN-HEK293T. As for the other Fc molecules tested, only NKp46Fc showed some reactivity (although significantly weaker than NKp44Fc), while NKp30Fc and DNAM-1Fc showed no binding. These data suggested that NKp44 might recognize ligand (s) released by HEK293T cells.

To obtain further information on such putative NKp44 soluble ligand (s), a metabolic labeling of HEK293T cells was performed in the presence of sugar azide. As a result of this procedure, cells synthesize glycoproteins characterized by modified glycosylated residues, capable of covalently binding to biotin, allowing the detection of glycosylated proteins. The supernatant of the labeled HEK293T cells (HEK293T-SN-biot) was analyzed by ELISA on plates coated with NKp44Fc or NKp30Fc molecules. As shown in Figure 1F, panel (b), HEK293T-SN-biot reacted with the wells coated with NKp44Fc- (and not with NKp30Fc-), indicating that NKp44Fc can bind glycosylated protein (s) secreted (e) by HEK293T cells.

Reactive glycoprotein (s) NKp44Fc were further analyzed by Western blot. Proteins from concentrated HEK293T-SN were separated by SDS-PAGE and immunoblot with NKp44Fc. As shown in Figure 1G, NKp44Fc, but not the other Fc molecules analyzed (NKp30Fc, NKp46Fc, DNAM-1Fc), recognized a band of about 180 KDa under non-reducing conditions.

In order to characterize the high molecular weight glycoprotein (s) recognized by NKp44Fc, concentrated HEK293T-SN was resolved by two-dimensional electrophoresis (2-DE) and analyzed by Western blot with NKp44Fc, NKp30Fc or NKp46Fc ( Fig.1A-C). HEK293T-SN-biot concentrate underwent the same procedure and immunoblot with Neutravidin-HRP (for the detection of glycoproteins) (Figure 1D). In parallel, a preparative 2-D gel was stained with Blue Coomassie to visualize all proteins and excise the machines of interest (Figure 1E). After 2-DE and immunoblotting, NKp44Fc was found to recognize different proteins present in HEK293T-SN (Figure 1A). Therefore, 27 spots, visualized in an NKp44Fc blot, were excised, digested and analyzed by high resolution mass spectrometry. Thanks to the comparison with the colored spots with the soluble receptors NKp46Fc and NKp30Fc (Figure 1B, 1C) it was possible to subtract the background and further limit the analysis to 17 spots. Finally, from the comparative analysis with the stain stained with Neutravidin (Figure 1D), we were able to further select 7 stains recognized by NKp44Fc and corresponding to glycosylated proteins. We focused on spot no. 26 since it corresponded to high MW proteins. Among the proteins identified at this point, Nidogen-1 (NID1) showed an expected MW compatible with the electrophoretic mobility of the one or more glycoproteins that had been detected by NKp44Fc in a one-dimensional SDS-PAGE (i.e. approximately 180 kDa) (see Figure 1G).

The direct and specific binding of NKp44 to NID1 was confirmed by experimental evidence. Therefore, the immunoprecipitation experiments demonstrated that NKp44Fc (but not NKp30Fc nor DNAM-1Fc used as controls) was able to immunoprecipitate the NID1 protein from concentrated HEK293T-SN (Figure 2A). Furthermore, the ability of NKp44Fc to bind purified NID1 was investigated by Western blot. Recombinant human Nidogen-1 (rNID1) and HEK293T-SN were eluted in SDS-PAGE in parallel and immunoblot with NKp44Fc (and NKp30Fc or DNAM1Fc as controls). Figure 2B shows that NKp44Fc was able to recognize both rNID1 and NID1 released by HEK293T-SN. In contrast, NKp30Fc and DNAM-1Fc showed no reactivity. Finally, the interaction between NKp44 and rNID1 was evaluated by ELISA. As shown in Figure 2C, different concentrations of NKp44Fc bound to wells coated with rN1, while NKp30Fc, NKp46Fc and DNAM-1Fc did not. This experiment shows that soluble NKp44Fc can specifically bind to NID1 in its native conformation.

Example 2: Effect of soluble NID1 on NKp44-mediated cell activation To investigate the potential effect of the NID1-NKp44 interaction, we exploited a model available in our laboratory based on the use of murine transfectants Bw5147 (Bw) expressing the complex of NKp44 / DAP12 receptors (Bw-NKp44) or the chimeric NKp30-CD3ζ receptor (Bw-NKp30). In this model, the cell activation induced by the mAb-mediated cross-linking of NKp44 or NKp30 determines the release of IL-2 in SN culture, which can be measured by ELISA. Since soluble ligands of different activating receptors have been shown to interfere with receptor function, we wondered whether rNID1 pretreatment of Bw-NKp44 cells had a similar inhibitory effect. As shown in Figure 3, different concentrations of rNID1 inhibited NKp44-induced IL-2 production. As a control, Bw-NKp30 cells were also analyzed. A minor inhibition of NKp30-induced IL-2 production could only be detected at the highest concentration of rNID1.

Subsequently, we wondered whether the release of NID1 from cells could also inhibit NKp44-mediated cell activation. To this end, the NID1 construct was transfected into NID1 negative cells. The culture supernatant of these transfected cells was evaluated in functional assays. The human cell line K562 was used as the recipient, since it does not express NID1 mRNA (Figure 4A). A stable transfection with the NID1 construct led to the expression of the NID1 transcript and to protein secretion in supernatants of cell cultures (Figures 4A-B). In the ELISA, NKp44Fc reacted with K562-NID1-SN and not with K562-SN (Figure 4C) and in Western blot experiments it reacted specifically with the band corresponding to the NID1 protein, while it did not associate with any band of K562- SN (Figure 4D). To investigate the potential functional consequences of the NID1-NKp44 interaction we again used Bw-NKp44 and Bw-NKp30. Bw-NKp44 cells were stimulated with anti-NKp44 mAb in the absence or presence of K562-SN or K562-NID1-SN. As shown in Figure 5A, K562-SN had no effect, while K562-NID1-SN inhibited NKp44-induced IL-2 release. In contrast, K562-NID1-SN did not induce any inhibitory effect in NKp30-stimulated Bw-NKp30 cells, compared to K562-SN. A similar inhibitory effect on NKp44-induced IL-2 production was also detected with an SN culture from NID1 transfected Bw cells (Figures 3B and 4E).

We therefore investigated whether NID1 released by NID1-expressing cells could exert an inhibitory effect on the NKp44-mediated activation of normal polyclonal NK cells. To this end, NK cells isolated from PB were cultured in the presence of IL-2 to induce the expression of NKp44 (absent on resting PB-NK cells). NK cells were then stimulated with anti-NKp44, anti-NKp30 or anti-NKp46 antibodies in the absence or presence of K562-SN or K562-NID1-SN. After stimulation, NK cell SNs were collected and analyzed by ELISA for their IFN-� content. As shown in Figure 5B, a significant reduction in NKp44-induced IFN-� production was observed in the presence of K562-NID1-SN, compared to K562-SN. On the other hand, neither K562-NID1-SN nor K562-SN inhibited the secretion of IFN-� activated by NKp46 or NKp30. Finally, we investigated whether NID1-containing SN could influence NKp44-induced NK cell cytotoxicity. To this end, NK cells were analyzed in a redirected kill assay either in the absence or in the presence of K562-SN or K562-NID1-SN. K562-NID1-SN (but not K562-SN) reduced the killing of P815 target cells triggered by anti-NKp44, while it was ineffective on the cytotoxic activity mediated by NKp30 and NKp46 (Figure 5C).

Collectively, these results show that NID1 can interfere with the recognition of target cells by NKp44, exerting a regulatory effect on NKp44-induced activation of NK cells.

Example 3: Surface NID1 expression and functional effects on NKp44 Having demonstrated that soluble NID1 is able to interfere with NKp44-mediated activation of NK cells, we then asked whether NID1 could also be expressed on the cell surface and be recognized as a molecule associated with the surface with possible functional outcomes. To this end, we evaluated the cellular expression and distribution of NID1 in HEK293T, a cell line capable of binding NKp44Fc to its surface (see above). Therefore, HEK293T cells were stained with a specific mAb for NID1 and analyzed by flow cytometry with imaging. This analysis revealed a weak but detectable surface expression of NID1. Individual cells were stained with anti-NID1 mAb, while the histogram profiles showed NID1 staining based on the average fluorescence intensity of all the cells analyzed. The presence of the NID1 protein on the cell surface suggested that it could be accessible for direct interaction with NKp44. Therefore, we analyzed by flow cytometry the surface expression of NID1 and, in parallel, the reactivity of NKp44Fc on HEK293T, K562 and K562-NID1 cells. As shown in Figure 6, HEK293T and K562-NID1 cells stained with anti-NID1 mAb, but not K562 cells. Consistently, NKp44Fc binds to HEK293T and K562-NID1 but not to K562 cells. Comparable results were obtained with the Bw-NID1 cell transfectants. Taken together, the data indicate that NID1 can be expressed on the cell surface and recognized by the NKp44 (Fc) receptor.

Based on these results, we further investigated the possible effect of NID1 expressed on the cell surface on NKp44-induced activation of NK cells. To this end, Bw-NKp44 cells were cultured in the presence of K562 or K562-NID1 cells or in RNID1-coated plates. After 20 hours, IL-2 was measured in the culture SN. As shown in Figure 7A neither K562 nor K562-NID1 could induce increases in IL-2 production by Bw-NKp44 cells. Similarly, no increase in IL-2 production occurred on culture of Bw-NKp44 in rNID1-coated plates (Figure 7B). Comparable results were obtained when rNID1 coating was performed via anti-NID1 (or anti-His) mAb.

We then analyzed whether cell surface NID1 had any effect on NK cells expressing NKp44 after activation. To this end, IL-2-activated polyclonal NK cells were obtained from different healthy donors and used in functional assays. Since, in NK cells, NKp44 triggers cytotoxicity, we analyzed the susceptibility to NK cell-mediated killing of NID1 + or NID1- cells in a cytolytic assay. Since NK cells express different activating receptors that recognize ligands on human K562 cells, this assay was performed using murine Bw cell transfectants (see Figure 3B). As shown in Figure 7C, Bw-NID1 and Bw cells showed no significant differences in their susceptibility to NK-mediated cytolysis.

We also evaluated the possible effect of plastic-bound rNID1 on IFN-� release from NK cells cultured in rNID1-coated plates. As shown in Figure 7D, exposure to NID1 failed to induce significant increases in the production of IFN-� by NK cells.

Example 4: Effect of NID1 on the NK cell proteome

The above data suggest that NID1 exposed at the target cell surface or bound to a solid support could not significantly modify cytokine release or cytotoxicity in NKp44 cells. Hence, to obtain information on the possible effects of surface-exposed NID1 on NK cells, we used a proteomic approach. To this end, populations of expanded polyclonal NKp44 + NK cells from four healthy donors were cultured for 20 hours on rNID1 (NID1) coated (or uncoated as control, CTR) plates. In parallel, NK cells were also cultured on plates coated with goat mouse IgG mAb antibody (GAM) anti-NKp44 (NKp44) (or GAM singly as a control, GAM). The NK cells were then collected and lysed; total cell lysates were analyzed by high resolution mass spectrometry.

Data processing using MaxQuant software allowed the identification of a total of 6903 proteins (of which 5682 were quantified using a markerless quantification approach). Most proteins (5317) could be identified under all experimental conditions analyzed (i.e. CTR, NID1, GAM and NKp44), while few proteins were exclusive to specific conditions (Figure 7E, panel (a)). An initial analysis of the full set of data (i.e. without any restrictions on statistical significance and threshold of change in times) indicated that both stimuli could modify the proteomic profile of NK cells and could induce concordant expression changes (for eg up- or down-regulation) in a substantial number of proteins (Figure 7E, panel (b)).

To analyze statistically significant regulated proteins and to define possible relationships between rNID1 and anti-NKp44 stimulation, two volcano plots were generated from the NID1vsCTR and NKp44vsGAM datasets and the proteins were selected based on a two-sample t-test (FDR = 0.05 S0 = 0.1) (Figures 8A-B). With this selection, 112 proteins were modulated by rNID1 (64 up- and 44 down-regulated, compared to CTR) and 129 proteins were modulated by anti-NKp44 mAbs (41 up- and 88 down-regulated, compared to GAM). 15 modulated proteins were common to the two conditions (indicated in red in Figure 8A-B). GO analysis indicated that an important part of the NID1-modulated proteins were involved in the regulation of cellular metabolism, but a substantial number of proteins were also involved in processes related to cell proliferation, signal transduction, endo / exocytosis, immune response, indicating that stimulation of NID1 could induce effective functional responses on NK cells (Figure 8C). Interestingly, proteins modulated with NID1 and NKp44 appeared to be similarly involved in the same biological processes and were similarly distributed among major cellular components, with the highest percentage of proteins located in membrane compartments (Figure 8C-D). In order to further compare the two stimuli, we delved into biological processes / GO molecular functions and constructed a functional heat map describing the quantitative modulation of the NK cell prototype in response to NID1 or anti-NKp44 stimuli. This analysis indicated that part of the effects on the modulation of biological processes is shared by the two stimuli.

Our data suggest that NID1 can bind NKp44 and induce still undetected functional responses on NK cells. GO analysis provides substantial information on these new presumed functions, which, however, remain incompletely defined. In this context, the evaluation of the proteins modulated by both stimuli provides guidance. Within this group, one of the most upregular proteins is represented by MYSM1 (see Figure 8). Interestingly, MYSM1 has recently been shown to be essential for NK cell maturation and differentiation (Alsultan et al. Blood 2013; 122: 3844-5; Nandakumar et al., Proc Natl Acad Sci USA 2013; 110: E3927 -3936), suggesting that the NKp44-NID1 interaction could be relevant to these processes and play a key role in the homeostasis of the mature NK cell population.

Example 5: Analysis of the surface expression of NID1 and the reactivity of NKp44 on a panel of human cell lines.

Different human cell lines including SH-SY-5Y neuroblastoma, ovarian adenocarcinoma A2774, placental choriocarcinoma JEG3, and lung cancer A549 were stained with a specific mAb NID1 or NKp44Fc, followed by the appropriate secondary reagent conjugated to PE matched by isotype. Samples were analyzed by flow cytometry. As shown in Figure 9, NID1 was expressed in neuroblastoma, ovarian adenocarcinoma, placental choriocarcinoma and lung cancer. The gray profiles represent cells stained with anti-NID1 or with NKp44Fc, while the white profiles correspond to the isotype control. One in three representative experiments is shown.

All references, including publications, patent applications and patents cited herein are incorporated by reference in their entirety and as if each reference were individually and specifically referred to as incorporated by reference, and are set forth in their entirety herein (to the extent maximum permitted by law), regardless of any separate incorporation of particular documents made elsewhere herein.

The use of the terms "a, one / a" and "the / the / the" and similar references in the context of the description of the invention must be interpreted to cover both the singular and the plural, unless otherwise indicated herein or contradicted explicitly from the context.

Unless otherwise stated, all exact values provided herein are representative of the corresponding approximate values (for example, all exemplary exact values provided with respect to a particular factor or measure may also be considered as a corresponding approximate measure, modified from "about", where appropriate).

The description herein of any aspect or embodiment of the invention using terms such as "comprising", "having", "including" or "containing" with reference to an element or elements is intended to provide support for an aspect or shape of similar embodiment of the invention that "consists of", "consists essentially of", or "substantially comprises" that particular element or elements, unless otherwise indicated or clearly contradicted by the context (for example, a composition herein described as comprising a particular element must be understood as also describing a composition that consists of that element, unless otherwise indicated or clearly contradicted by the context).

The use of any of the examples and all examples, or exemplary language (for example, "how") provided herein is intended merely to better clarify the invention and does not place a limitation on the scope of the invention if not otherwise claimed. No expression in the patent application should be interpreted as indicating any element not claimed as essential for the implementation of the invention.

Claims (22)

CLAIMS 1. Composition comprising an agent that binds NID1, for use in the prevention or treatment of a tumor or an infectious disease in an individual. 2. Composition according to claim 1, wherein the agent binds sNID1 and inhibits the binding of NKp44 to sNID1. 3. Composition according to claim 1 or 2, wherein the agent that binds mNID1 on the surface of a cell that releases NID1. 4. Composition according to any one of the above claims, in which the method comprises administering the agent to the individual in a sufficient quantity to reduce the immunosuppression mediated by sNID1. 5. Composition according to any one of the above claims, wherein the method comprises administering the agent to the individual in a sufficient quantity to purge the NID1 releasing cells. 6. Composition according to any one of the above claims, wherein the method comprises administering the agent to the individual in a sufficient quantity to decrease sNID1 in circulation or in the tumor environment. 7. Composition according to any one of the above claims, in which the individual has a solid tumor. Composition according to any one of the above claims, wherein the individual has a cancer selected from the group consisting of: bladder cancer, skin cancer, breast cancer, cervical cancer, head and neck cancer, colon cancer -rectum, esophageal cancer, kidney cancer, liver cancer, lung cancer, prostate cancer, stomach cancer, uterus cancer, ovarian cancer, endometrial cancer and testicular cancer. 9. Composition according to any one of the above claims, in which the individual has a disease characterized by immunosuppression, optionally a state characterized by a lack of NK cell activity. 10. Composition according to any one of the above claims, in which the individual has sNID1 in circulation and / or in a tumor tissue, optionally at an increased level compared to a healthy individual. 11. Composition according to any one of the above claims, in which the individual has a tumor tissue or adjacent to the tumor characterized by the presence of NID1 releasing cells. 12. Composition comprising an agent that binds NID1, for use in a method for evaluating immunosuppression in an individual with cancer. 13. Composition according to claim 12, wherein the method comprises detecting sNID1, in which the presence of sNID1 or high levels of sNID1 indicates that the individual has a disease characterized by immunosuppression. 14. Composition according to claim 12 or 13, wherein the method comprises detecting NID1 releasing cells, in which the presence or high number of NID1 releasing cells indicates that the individual has a disease characterized by immunosuppression. 15. Composition according to any one of the above claims, in which the agent is an antibody or an antibody fragment. 16. Composition according to any one of claims 1 to 14, wherein the agent comprises a polypeptide of NKp44, optionally a NID1 binding fragment of NKp44. 17. Composition comprising an agent that reduces the level and / or activity of sNID1 which is available to interact with a polypeptide of NKp44, for use in the treatment of cancer or an infectious disease. 18. Composition according to any of the preceding claims, for use in the restoration or reduction of immunosuppression. 19. Composition according to any one of the above claims, in which the agent is an antibody or antibody fragment that competes with the NKp44 polypeptide for binding with a sNID1 polypeptide. 20. Composition according to claim 17 or 18, wherein the agent comprises a sNID1 binding fragment of NKp44. 21. In vitro method for assessing disease in an individual with cancer, the method comprising bringing a biological sample of an individual into contact with an agent that is capable of specifically binding a sNID1 polypeptide and detecting the presence and / or levels of the sNID1 polypeptide, where a detection of the presence and / or increased levels of sNID1 indicates that the individual has an immunosuppressive state and / or that the individual has sNID1 capable of mediating immunosuppressive activity. 22. Method of treating or preventing cancer in an individual including: a) determining whether the individual has sNID1, optionally at higher levels than a control, and b) following a determination that the individual has sNID1, optionally at higher levels than a control, administer to the individual an agent that enhances the activity or number of lymphocytes, optionally NK cells.