IL324996A

IL324996A - Methods for evaluating and managing bladder cancer patients

Info

Publication number: IL324996A
Application number: IL324996A
Authority: IL
Inventors: Danny Frumkin; Adam Wasserstrom; Aharona Shuali; Shmuel Adler
Original assignee: Nucleix Ltd; Danny Frumkin; Adam Wasserstrom; Aharona Shuali; Shmuel Adler
Priority date: 2023-05-31
Filing date: 2023-05-31
Publication date: 2026-01-01
Also published as: EP4720346A1; WO2024246882A1

Description

PCT / IL2023 / 0505 METHODS FOR EVALUATING AND MANAGING BLADDER CANCER PATIENTS FIELD OF THE INVENTION The present invention relates to evaluation and management of bladder cancer patients , particularly patients with non - muscle - invasive bladder cancer ( NMIBC ) , by analyzing DNA methylation markers in DNA from cells of urine samples of the patients . The present invention is advantageous for adjusting / deciding a treatment plan for NMIBC patients .

BACKGROUND OF THE INVENTION Bladder cancer is a cancer that occurs in the urinary bladder . Most bladder cancers are non - muscle invasive at initial diagnosis . The tumors are further characterized as low- grade or high - grade , depending on the similarity of the cancer cells to healthy cells when viewed under a microscope , which translates to their risk to recur or progress ( grow and spread ) . Treatment of non - muscle invasive bladder cancer ( NMIBC ) often includes transurethral resection , optionally followed by intravesical instillations of chemotherapy and / or immunotherapy , typically Bacillus Calmette - niréuG ( BCG ) . More aggressive treatments may be offered , depending on the type , stage and grade of the tumor .

Despite initial combined treatment , still a high proportion of the tumors recur and / or progress to a muscle - invasive form of the disease . In some patients , recurrence and / or progression is seen less than 12 month following intravesical BCG induction treatment , and such patients are considered refractory ( unresponsive ) to BCG . Currently , characteristics of the tumor itself ( e.g. , number , volume , invasion , grade ) remain the main prognostic predictors of recurrence and / or progression , and the main factors that are considered when deciding about a treatment strategy . Prognosis based on these variables has a limited accuracy , and evaluation of response to treatment is sometimes feasible only based on actual detection of tumor recurrence . It would be highly beneficial to have an assay which can assist in identifying subjects with a high risk of high - grade recurrence and / or progression to muscle invasive disease , that should be treated with a more intense treatment , versus subjects with a low risk of high- grade recurrence and / or progression , that can be treated with more moderate treatments . It PCT / IL2023 / 0505 would also be highly beneficial to have an assay to identify those subjects likely to be refractory to BCG , that should be treated with different treatment options .

LO SUMMARY OF THE INVENTION The present invention provides methods for evaluation and management of bladder cancer patients , particularly patients with non - muscle - invasive bladder cancer ( NMIBC ) , by analyzing DNA methylation markers in DNA from cells of urine samples of the patients . In particular , the present invention provides according to some embodiments methods for stratifying NMIBC patients high risk or low risk of high - grade ( HG ) recurrence and / or progression to the muscle invasive form , and adjusting their treatment and monitoring accordingly . In some embodiments , methods for identifying subjects refractory to Bacillus Calmette - niréuG ( BCG ) are provided .

The methods of the present invention are non - invasive and utilize a set of DNA methylation markers that can be detected in cells present in urine samples . More particularly , the methods of the present invention utilize a set of DNA methylation markers previously identified to be hypermethylated in bladder cancer DNA compared to normal DNA . It is now disclosed that these markers can distinguish between bladder cancer patients with a high risk of HG recurrence following tumor resection and BCG induction treatment , compared to those with a low risk . As exemplified herein below , the markers were able to distinguish between the high risk and low risk patients with particularly high negative predictive value ( NPV , over 95 % ) , thus allowing a reliable decision with respect to further treatment of the tested subjects .

It is further disclosed herein that the methylation markers can be tested prior to tumor resection , and distinguish between low - grade ( LG ) tumors that have a high risk to recur as HG tumors , compared to those with a low risk . As exemplified hereinbelow , patients with a LG tumor and a positive methylation assay result ( namely , a methylation assay score above a predefined threshold ) had an increased risk of HG recurrence compared to patients with a LG tumor and a negative methylation assay result . It is noted that a negative result was observed despite the fact that a tumor existed in the patients ( the assay was carried out prior to tumor resection ) . The study showed that a LG tumor with a positive methylation assay result is probably epigenetically different to a LG tumor with a negative methylation assay result . It is now disclosed that the negative result is associated with a low risk of HG recurrence . This finding enables distinguishing between patients at high risk of HG PCT / IL2023 / 0505 LO recurrence , that should be allocated with a more intense treatment , versus patients with a low risk of HG recurrence , that could be treated more moderately . In some embodiments , the methods of the present invention are carried out on subjects that have undergone tumor resection and have received BCG induction treatment . In some embodiments , the methods enable identifying subjects refractory to BCG . In additional embodiments , the methods of the present invention are carried out on subjects prior to tumor resection , and enable identifying subjects with a LG tumor who are at high risk of HG recurrence . According to one aspect , the present invention provides a method for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; and ( c ) stratifying the subject as high risk of developing a HG event when the calculated score is above a predefined threshold , and stratifying the subject as low risk of developing a HG event when the calculated score is below the predefined threshold . In some embodiments , the method further comprises performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event . According to another aspect , the present invention provides a method for managing a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment , the method comprising : PCT / IL2023 / 0505 LO ( a ) determining in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of developing a HG event when the calculated score is above a predefined threshold , and stratifying the subject as low risk of developing a HG event when the calculated score is below the predefined threshold ; and ( d ) adjusting the treatment and / or monitoring of the subject based on the stratification , wherein a subject stratified as high risk of a HG event is provided a more aggressive bladder cancer treatment and / or a more intense monitoring than a subject stratified as low risk of a HG event .

In some embodiments , adjusting the treatment in step ( d ) comprises administering a high - risk or a very high - risk bladder cancer treatment protocol to a subject stratified as high risk of developing a HG event . In some embodiments , administering a high - risk or a very high - risk bladder cancer treatment protocol comprises administering one or more of : a second BCG induction treatment course , BCG maintenance treatment with duration and cycles according to high - risk or very high - risk standard of care , mitomycin - C ( MMC ) hyperthermia , an intravesical chemotherapy selected from valrubicin , gemcitabine , docetaxel , paclitaxel and a combination thereof using a treatment schedule and doses according to high - risk or very high - risk standard of care , intravesical nadofaragene firadenovec , systemic immunotherapy , systemic chemotherapy , radiation therapy , experimental drug or therapy , and cystectomy .

In some embodiments , adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate - risk bladder cancer treatment protocol to a subject stratified as low risk of developing a HG event . In some embodiments , administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of : BCG maintenance treatment and intravesical chemotherapy using a treatment schedule and doses according to low - risk or an intermediate - risk standard of care . In some embodiments , adjusting the monitoring in step ( d ) of a subject stratified as high risk of a HG event comprises at least one of : performing surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology combined with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy .

PCT / IL2023 / 0505 LO In some embodiments , the method further comprises performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein adjusting the treatment in step ( d ) comprises obviating BCG maintenance treatment and administering a bladder cancer treatment other than BCG to the subject stratified as likely to be refractory to BCG . In some embodiments , the method further comprises performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event , and wherein adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate - risk bladder cancer treatment protocol to a subject stratified as low risk of developing a HG event . According to another aspect , the present invention provides a method for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high - grade ( HG ) recurrence , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to the tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; and ( c ) stratifying the subject as high risk of HG recurrence when the calculated score is above a predefined threshold , and stratifying the subject as low risk of HG recurrence when the calculated score is below the predefined threshold . According to a further aspect , the present invention provides a method for managing a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to the tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; PCT / IL2023 / 0505 ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of HG recurrence when the calculated score is above a predefined threshold , and stratifying the subject as low risk of HG recurrence when the calculated score is below the predefined threshold ; and ( d ) adjusting the treatment and / or monitoring of the subject based on the stratification , wherein a subject stratified as high risk of HG recurrence is provided a more aggressive bladder cancer treatment and / or a more intense monitoring than a subject stratified as low risk of HG recurrence .

In some embodiments , adjusting the treatment in step ( d ) comprises administering a high - risk or a very high - risk bladder cancer treatment protocol to a subject stratified as high risk of HG recurrence . In some embodiments , administering a high - risk or a very high - risk bladder cancer treatment protocol comprises administering one or more of : intravesical BCG using a treatment schedule and doses according to high or very high risk standard of care , intravesical chemotherapy using a treatment schedule and doses according to high or very high risk standard of care , intravesical nadofaragene firadenovec , systemic immunotherapy , systemic chemotherapy , radiation therapy , experimental drug or therapy , and cystectomy . In some embodiments , adjusting the monitoring in step ( d ) of a subject stratified as high risk of HG recurrence comprises at least one of : performing surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology combined with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy . In some embodiments , adjusting the treatment in step ( d ) comprises obviating intravesical instillations of BCG or chemotherapy in a subject stratified as low risk of HG recurrence .

In some embodiments , adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate risk bladder cancer treatment protocol to a subject stratified as low risk of HG recurrence . In some embodiments , administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of : intravesical BCG using a treatment schedule and doses according to low - risk or an intermediate risk standard of care , and intravesical chemotherapy using a treatment schedule and doses according to low - risk or an intermediate risk standard of care .

PCT / IL2023 / 0505 LO In some embodiments , adjusting the monitoring in step ( d ) of a subject stratified as low risk of HG recurrence comprises performing surveillance cystoscopy and / or cytology according to a low - risk or an intermediate - risk surveillance schedule , and performing fulguration if recurrence is detected . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject and administering a Bacillus Calmette - niréuG ( BCG ) induction treatment ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value , wherein a score above a predefined threshold identifies the subject as being at high risk of developing a high - grade ( HG ) event ; and ( c ) administering a high - risk or a very high - risk bladder cancer treatment protocol to the subject identified as being at high risk of developing a high - grade ( HG ) event . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject and administering a Bacillus Calmette - niréuG ( BCG ) induction treatment ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value , wherein a score below a predefined threshold identifies the subject as being at low risk of developing a high - grade ( HG ) event ; and ( c ) administering a low - risk or an intermediate - risk bladder cancer treatment protocol to the subject identified as being at low risk of developing a high - grade ( HG ) event . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a first methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a first score for the subject based on the methylation value ; PCT / IL2023 / 0505 LO subject ; ( c ) administering a Bacillus Calmette - niréuG ( BCG ) induction treatment to the ( d ) determining in DNA from cells of a urine sample collected from the subject following ( c ) a second methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a second score for the subject based on the methylation value ; ( e ) comparing the first and second scores to a predefined threshold , wherein both a first and second score above the predefined threshold identifies the subject as likely to be refractory to BCG ; and ( f ) obviating BCG maintenance treatment and administering a bladder cancer treatment other than BCG to the subject identified as likely to be refractory to BCG . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a first methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a first score for the subject based on the methylation value ; subject ; ( c ) administering a Bacillus Calmette - niréuG ( BCG ) induction treatment to the ( d ) determining in DNA from cells of a urine sample collected from the subject following ( c ) a second methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a second score for the subject based on the methylation value ; ( d ) comparing the first and second scores to a predefined threshold , wherein a first score above the predefined threshold and a second score below the predefined threshold identifies the subject as being at low risk of developing a HG event ; and ( e ) administering a low - risk or an intermediate - risk bladder cancer treatment protocol to the subject identified as being at low risk of developing a HG event . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group PCT / IL2023 / 0505 LO consisting of SEQ ID NOs : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score above a predefined threshold identifies the subject as being at high risk of high - grade ( HG ) recurrence ; and ( c ) administering a high - risk anti - bladder cancer treatment protocol to the subject identified as being at high risk of HG recurrence and / or monitoring said subject by performing at least one of : surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology combined with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and ( c ) obviating intravesical instillations of BCG or chemotherapy in the subject . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and PCT / IL2023 / 0505 LO ( c ) administering a low - risk or an intermediate risk bladder cancer treatment protocol to the subject . In some embodiments , there is provided herein a method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and ( c ) performing surveillance cystoscopy and / or cytology according to low - risk or intermediate - risk surveillance schedule , and performing fulguration if recurrence is detected .

According to a further aspect , the present invention provides a system for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the system comprising a computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( i ) receiving a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 determined in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment ; ( ii ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( iii ) outputting a stratification of the subject , wherein the subject is stratified as high risk of developing a HG event when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of developing a HG event when the calculated score is below the predefined threshold . In some embodiments , the computer software further comprises instructions that when executed configure or direct the computer processor to perform steps ( i ) and ( ii ) for DNA from cells of a urine sample collected from the subject prior to the BCG induction PCT / IL2023 / 0505 treatment , and outputting a stratification of the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event . According to a further aspect , the present invention provides a system for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high - grade ( HG ) recurrence , the system comprising a computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( i ) receiving a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 determined in DNA from cells of a urine sample collected from the subject prior to the tumor resection ; ( ii ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( iii ) outputting a stratification of the subject , wherein the subject is stratified as high risk of HG recurrence when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of HG recurrence when the calculated score is below the predefined threshold . In some embodiments , the computer software further comprises instructions that when executed configure or direct the computer processor to determine the methylation value of the at least one marker locus based on data from a methylation assay . According to another aspect , the present invention provides a system for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the system comprising : ( i ) DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment ; ( ii ) components for carrying out a methylation assay on at least one marker locus selected from the group consisting of SEQ ID NO : 1-15 in the DNA of ( i ) ; and PCT / IL2023 / 0505 LO ( iii ) computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( a ) determining a methylation value for the at least one marker locus based on data from the methylation assay ; ( b ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( c ) outputting a stratification of the subject , wherein the subject is stratified as high risk of developing a HG event when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of developing a HG event when the calculated score is below the predefined threshold . In some embodiments , the computer software further comprises instructions that when executed configure or direct the computer processor to perform steps ( i ) and ( ii ) for DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and outputting a stratification of the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event . According to another aspect , the present invention provides a system for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high - grade ( HG ) recurrence , the system comprising : ( i ) DNA from cells of a urine sample collected from the subject prior to the tumor resection ; ( ii ) components for carrying out a methylation assay on at least one marker locus selected from the group consisting of SEQ ID NO : 1-15 in the DNA of ( i ) ; and ( iii ) computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : PCT / IL2023 / 0505 LO ( a ) determining a methylation value for the at least one marker locus based on data from the methylation assay ; ( b ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( c ) outputting a stratification of the subject , wherein the subject is stratified as high risk of HG recurrence when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of HG recurrence when the calculated score is below the predefined threshold . In some embodiments , the at least one marker locus comprises one or more ( and preferably a plurality of ) marker loci selected from the group consisting of SEQ ID NOS : 1-15 . In some embodiments , the at least one marker locus comprises the locus set forth in SEQ ID NO : 1. In some embodiments , the at least one marker locus further comprises the locus set forth in SEQ ID NO : 5. In some embodiments , the at least one marker locus comprises the loci set forth in SEQ ID NO : 1 , SEQ ID NO : 5 , SEQ ID NO : 7 and SEQ ID NO : 11. In some embodiments , the at least one marker locus comprises the loci set forth in SEQ ID NO : 1 , SEQ ID NO : 5 , SEQ ID NO : 7 and SEQ ID NO : 11 , and further comprises at least one additional marker locus selected from the group of loci set forth in SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15. In additional embodiments , the at least one additional marker locus comprises the loci set forth in SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : and SEQ ID NO : 15 . In some embodiments , the methylation value is determined using one or more analysis methods selected from the group consisting of DNA sequencing , real - time PCR , and array hybridization . In some embodiments , determining the methylation value comprises , for a plurality of potential methylation sites in a plurality of marker loci , quantifying methylated read counts at the potential methylation sites and calculating a methylation value based on the number of methylated read counts . In some embodiments , determining a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 and calculating a score comprise : PCT / IL2023 / 0505 LO ( i ) subjecting the DNA from cells of the urine sample of the subject to digestion with at least one methylation - sensitive restriction endonuclease recognizing a sequence within the at least one marker locus that is hypermethylated in cancer DNA compared to non - cancer DNA , to obtain restriction endonuclease - treated DNA ; ( ii ) co - amplifying from the restriction endonuclease - treated DNA the at least one marker locus and a control locus , thereby generating an amplification product for each locus ; ( iii ) determining a signal intensity for each generated amplification product ; and ( iv ) comparing a ratio between the signal intensities of the amplification products of each of said at least one marker locus and the control locus to at least one reference ratio selected from cancer reference ratio and non- cancer reference ratio , to calculate a score . In some embodiments , step ( i ) is performed using a single methylation - sensitive restriction endonuclease . In some embodiments , the methylation - sensitive restriction endonuclease is Hhal . In additional embodiments , the methylation - sensitive restriction endonuclease is HinP1I . In some embodiments , the control locus is a locus that does not contain a nucleotide sequence recognized by the methylation - sensitive restriction endonuclease . In some embodiments , the methylation - sensitive restriction endonuclease is selected from Hhal and HinP1I , and the control locus is the control locus is the locus set forth in SEQ ID NO : 16 . In some embodiments , step ( ii ) is performed using real - time PCR . In some embodiments , step ( ii ) comprises adding fluorescent probes for assisting in detecting the amplification products of the at least one marker locus and the control locus . In some embodiments , determining the methylation value comprises , for a plurality of marker loci , determining a ACq for each marker locus and calculating a single composite methylation value based on the ACq determined for each marker locus . In some embodiments , the ratio between the signal intensities of the amplification products of each of said at least one marker locus and the control locus is calculated by determining the quantification cycle ( Cq ) for each locus and calculating 2 ( Cq control locus- Cq restriction locus ) .

These and further aspects and features of the present invention will become apparent from the detailed description , examples and claims which follow .

PCT / IL2023 / 0505 BRIEF DESCRIPTION OF THE FIGURES Figure 1A . Risk of relapse by methylation assay status ( positive / negative ) post- BCG . " Relapse " is defined as HG recurrence > 12mo from BCG induction completion , or LG recurrence at any time during the follow - up period . Figure 1B . Risk of relapse by methylation assay status pre - BCG and post - BCG . Figure 1C . Risk of high - grade ( HG ) event by methylation assay status post - BCG . " HG event " includes BCG refractory ( HG recurrence ≤ 12mo from BCG induction completion ) , HG relapse ( HG recurrence > 12mo from BCG induction completion ) , progression and bladder cancer death . Figure 1D . Risk of high - grade ( HG ) event by methylation assay status pre - BCG and post - BCG . Figure 2A . Patient outcome by methylation assay status post - BCG . Patients who had more than one event were classified according to the first HG event , if such occurred : if refractory and relapse / progression - classified as refractory , if HG relapse and progression ― classified as relapse , if LG relapse and progression - classified as progression . Figure 2B . Patient outcome by to methylation assay status pre- and post - BCG . Figure 3. Risk of progression by methylation assay status post - BCG and CUETO .

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to stratification or classification of non - muscle- invasive bladder cancer ( NMIBC ) patients as high risk or low risk of high - grade recurrence and / or progression . The risk stratification according to the present invention is risk over time , namely , the risk of the patients to experience HG tumor recurrence and / or progression to the muscle invasive form of the disease over time . The methods of the present invention comprise analyzing DNA methylation markers in DNA from cells of urine samples of the patients . In some embodiments , the methods of the present invention are directed to stratifying NMIBC patients that have undergone tumor resection ( TURBT ) and have received a BCG induction treatment as high risk or low risk to develop a high grade event . As used herein , a " high - grade event " ( HG event ) means HG recurrence or progression to the muscle invasive form of bladder cancer ( MIBC ) . " Developing a HG event " means developing HG recurrence and / or MIBC .

PCT / IL2023 / 0505 LO According to the present invention , testing methylation using the markers of the present invention " after BCG induction treatment completion " or " after completion of a BCG induction treatment " refers to testing methylation after instillation of the last dose of the induction treatment . A BCG induction treatment typically begins approximately 2 weeks after tumor resection and is carried out at 5 or 6 cycles , each cycle includes a weekly instillation of BCG . Thus , testing methylation after BCG induction treatment completion means after the 5th or 6th instillation , depending on the induction schedule that was decided for the tested subject . The methylation may be tested at the time of the post - BCG induction treatment follow - up visit ( in which a biopsy is typically taken ) which is usually at 1-months from the last BCG induction dose . Thus , according to the present invention , the methylation assay is carried out within 4 months from the last BCG induction dose , for example , between 7 days to 4 months , between 14 days to 4 months , between 1-4 months , between 1-3 months , after 1 month , after 2 months , after 3 months , after 4 months from the last induction dose . Each possibility represents a separate embodiment of the present invention .

In some embodiments , there is provided herein a method for treating a subject with NMIBC that has undergone tumor resection ( TURBT ) and has received a BCG induction treatment , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of a HG event when the calculated score is above a predefined threshold , and stratifying the subject as low risk of a HG event when the calculated score is below the predefined threshold ; and ( d ) administering a bladder cancer treatment to the subject based on the stratification , wherein a subject stratified as high risk of developing a HG event is provided a bladder cancer treatment that is more aggressive than the bladder cancer treatment provided to a subject stratified as low risk of developing a HG event . In some embodiments , the method further comprises performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior and after the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , PCT / IL2023 / 0505 wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein administering a bladder cancer treatment comprises obviating BCG maintenance treatment and administering a bladder cancer treatment other than BCG to the subject stratified as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event , and wherein administering a bladder cancer treatment comprises administering a low - risk or an intermediate - risk bladder cancer treatment protocol to a subject stratified as low risk of developing a HG event .

As used herein , " refractory to BCG " means that tumor recurrence and / or progression is detected within 12 months following completion of a BCG induction treatment . In some embodiments , there is provided herein a method for treating a subject with low - grade ( LG ) NMIBC that has undergone tumor resection ( TURBT ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to the tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of HG recurrence when the calculated score is above a predefined threshold , and stratifying the subject as low risk of HG recurrence when the calculated score is below the predefined threshold ; and ( d ) administering a bladder cancer treatment to the subject based on the stratification , wherein a subject stratified as high risk of HG recurrence is provided a more aggressive bladder cancer treatment than a subject stratified as low risk of HG recurrence .

As used herein , " above a predefined threshold " may encompass equal or above the threshold . Alternatively , " below a predefined threshold " may encompass equal or below the threshold . A decision regarding how to classify / stratify subjects with a result which equals the threshold may be carried out , for example , using statistical calculations and data from a large population of individuals . In some embodiments , a subject stratified as high risk of a HG event , or as high risk of HG recurrence , is administered with a high - risk or a very high - risk bladder cancer treatment protocol .

PCT / IL2023 / 0505 In some embodiments , a subject stratified as low risk of a HG event , or as low risk of HG recurrence , is administered with a low - risk or an intermediate - risk bladder cancer treatment protocol . As used herein , " high risk " , " very high risk " , " low risk " and " intermediate risk " treatment protocols ( or treatment schedules or treatment doses ) and surveillance schedules refer to the standard of care for treating and monitoring high risk , very high risk , low risk and intermediate risk NMIBC , for example standard of care defined and detailed in acceptable guidelines , such as the guidelines of the European Association of Urology ( EAU ) ( e.g. , EAU 2023 guidelines for non - muscle - invasive bladder cancer , EAU Guidelines . Edn . presented at the EAU Annual Congress Milan 2023. ISBN 978-94-92671-19-6 . ) , and the American Urological Association ( AUA ) / Society of Urologic Oncology ( SUO ) joint guidelines ( e.g. , Chang SS , Boorjian SA , Chou R et al : Diagnosis and treatment of non- muscle invasive bladder cancer : AUA / SUO guideline . J Urol . 2016 ; 196 : 1021 , published 2016 ; amended 2020 ) , both are incorporated by reference . For example , in some embodiments , administering a high - risk or a very high - risk bladder cancer treatment protocol comprises administering one or more of : one or two BCG induction courses , BCG maintenance treatment using treatment schedule and doses according to high - risk or very high - risk standard of care ( e.g. , for one to 3 years , including induction plus 3 - weekly instillations at 3 , 6 , 12 , 18 , 24 , 30 and 36 months ) , mitomycin C ( MMC ) hyperthermia , an intravesical chemotherapy selected from valrubicin , gemcitabine , docetaxel , paclitaxel and a combination thereof using a treatment schedule and doses according to high - risk or very high - risk standard of care , intravesical nadofaragene firadenovec , systemic immunotherapy , systemic chemotherapy , radiation therapy , experimental drug or therapy , and cystectomy . Each possibility represents a separate embodiment of the present invention .

In some embodiments , administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of : a BCG induction course , BCG maintenance treatment using a treatment schedule and doses according to low - risk or intermediate - risk standard of care ( e.g. , one - year full - dose BCG including induction plus 3- weekly instillations at 3 , 6 and 12 months ) , and intravesical chemotherapy using a treatment schedule and doses according to low - risk or an intermediate - risk standard of care , typically for a maximum of one year . Each possibility represents a separate embodiment of the present invention .

PCT / IL2023 / 0505 In some embodiments , a subject stratified as high risk of a HG event , or as high risk of HG recurrence , is administered with a more intense monitoring than a subject stratified as low risk of a HG event , or low risk of HG recurrence , where a more intense monitoring may include a more frequent surveillance schedule , surveillance that combines several surveillance methods ( e.g. , cystoscopy and cytology , cystoscopy and urinary markers , cystoscopy and imaging methods ) and / or surveillance that utilizes enhanced cystoscopy ( e.g. photodynamic diagnosis ( PDD ) cystoscopy ) . For example , a subject stratified as high risk of a HG event , or as high risk of HG recurrence , may be provided with at least one of : surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule ( e.g. , cystoscopy and cytology every 3 months for 2 years , every 6 months thereafter until the 5th year , and then yearly ) , surveillance cystoscopy and / or cytology combined with at least one additional surveillance method ( e.g. , urinary markers , such as the methylation markers disclosed herein , and imaging ) , and enhanced cystoscopy ( e.g. , PDD cystoscopy ) instead of white light cystoscopy . Each possibility represents a separate embodiment of the present invention .

In some embodiments , a subject stratified as low risk of a HG event , or low risk of HG recurrence , is provided with surveillance cystoscopy according to a low - risk or an intermediate - risk surveillance schedule ( e.g. , cystoscopy at 3 months following resection , at months following resection , and then yearly for 5 years , or cystoscopy at 3 months following resection , at 3-6 month intervals until the 5th year , and then yearly ) . Urologists have a treatment option of fulguration for LG tumors . This is an ablation in the office without going to surgery . This is an option only when the urologist is not expecting a HG tumor . Fulgurated tumor stage is not known , and grade is only known if the urologist took biopsy prior to fulguration . The methods of the present invention advantageously allow stratifying a subject with a LG tumor as high risk or low risk for HG recurrence , and decide whether to perform fulguration or tumor resection if recurrence is detected .

In some embodiments , the methods of the present invention comprise : stratifying a subject with a LG tumor as low risk for HG recurrence based on the methylation assay disclosed herein ; performing surveillance cystoscopy and / or cytology according to a low- risk or an intermediate - risk surveillance schedule in the subject ; and performing fulguration if recurrence is detected .

PCT / IL2023 / 0505 LO In other embodiments , the methods of the present invention comprise : stratifying a subject with a LG tumor as high risk for HG recurrence based on the methylation assay disclosed herein ; performing surveillance cystoscopy and / or cytology according to a high- risk or a very high - risk surveillance schedule in the subject ; and performing TURBT if recurrence is detected .

Advantageously , the DNA methylation markers used by the present invention are suitable for methylation analysis using enzymatic digestion of DNA with at least one methylation - sensitive restriction enzyme followed by real - time PCR of the methylation markers and an internal reference locus , and subsequently precise quantification of ratios between the signals obtained from each marker locus and the signal of the internal reference locus . Thus , in some embodiments , methylation analysis according to the present invention does not require evaluating absolute methylation levels at the analyzed genomic loci , but rather calculating a signal ratio ( reflecting the methylation ratio ) between the analyzed genomic loci and an internal reference locus in the same sample . This is in contrast to conventional methods utilizing methylation analysis for distinguishing between tumor- derived and normal DNA , which require determining actual methylation levels at specific genomic loci . Thus , embodiments of the present invention eliminate the need for standard curves and / or additional laborious steps involved in determination of methylation levels per se , thereby offering a simple and cost - effective procedure . An additional advantage over known approaches for analyzing methylation is conferred by the signal ratios obtained according to some embodiments of the present invention , which are calculated between loci amplified in the same reaction mixture ( i.e. , under the same reaction conditions ) . This renders the methods insensitive to various " noise " factors , such as changes in template DNA concentration , PCR conditions , and presence of inhibitors . Such noises are inherent for methods that are based on quantifying methylation levels of loci by comparing signals from separate amplification reactions .

Methylation in the human genome occurs in the form of 5 - methyl cytosine and is confined to cytosine residues that are part of the sequence CG , also denoted as CpG dinucleotides ( cytosine residues that are part of other sequences are not methylated ) . Some CpG dinucleotides in the human genome are methylated , and others are not . In addition , methylation is cell and tissue specific , such that a specific CpG dinucleotide can be methylated in a certain cell and at the same time unmethylated in a different cell , or methylated in a certain tissue and at the same time unmethylated in different tissues . DNA PCT / IL2023 / 0505 LO methylation is an important regulator of gene transcription . Aberrant DNA methylation patterns , both hypermethylation and hypomethylation compared to normal tissue , have been associated with a large number of human malignancies . The term " bladder cancer " refers to a cancer that occurs in the urinary bladder and includes transitional cell carcinoma ( TCC , also referred to as urothelial cell carcinoma ) , squamous cell carcinoma , adenocarcinoma , small cell carcinoma and sarcoma . As used herein , " bladder cancer " does not include cancers that occur at other parts of the urinary systems , such as upper tract urothelial carcinoma ( UTUC ) . TCC , arising from epithelial cells in the inner lining of the bladder ( urothelium ) , is the most common type of bladder cancer accounting for more than 90 % of the cases . TCC typically includes two sub - types , papillary carcinomas , in which the tumors grow in slender , finger - like projections from the inner surface of the bladder toward the hollow center , and flat carcinomas , in which tumors do not grow toward the hollow part of the bladder . Squamous cell carcinoma and adenocarcinoma are less common types of bladder cancer , and small cell carcinoma and sarcoma are relatively rare . Bladder cancer may be typically further classified as either non - invasive , where the cancer cells are confined to the inner layer of the transitional epithelium , or invasive , where cancer cells grow into the lamina propria of the bladder or even deeper into the muscle layer . A bladder cancer can also be described as superficial or non - muscle invasive . These terms include both non - invasive tumors as well as any invasive tumors that have not grown into the main muscle layer of the bladder . One of the common classification of bladder cancer is the T category which describes how far the main tumor has grown into the wall of the bladder ( or beyond ) . Typically , bladder cancers start in the urothelium and , as the cancer grows , may invade into other layers in the bladder , thus becoming more advanced . Classification according to the T category includes the following terms : - - TO : No evidence of a primary tumor Ta : Non - invasive papillary carcinoma Tis or CIS : Non - invasive flat carcinoma ( carcinoma in situ ) T1 : The tumor has grown from the layer of cells lining the bladder into the connective tissue below . It has not grown into the muscle layer of the bladder . T2 : The tumor has grown into the muscle layer .

PCT / IL2023 / 0505 - 。 T2a : The tumor has grown only into the inner half of the muscle layer . T2b : The tumor has grown into the outer half of the muscle layer . T3 : The tumor has grown through the muscle layer of the bladder and into the fatty tissue layer that surrounds it . T3a : The spread to fatty tissue can only be seen by using a microscope . T3b : The spread to fatty tissue is large enough to be seen on imaging tests or to be seen or felt by the surgeon . T4 : The tumor has spread beyond the fatty tissue and into nearby organs or structures . It may be growing into any of the following : the stroma ( main tissue ) of the prostate , the seminal vesicles , uterus , vagina , pelvic wall , or abdominal wall .

T4a : The tumor has spread to the stroma of the prostate ( in men ) , or to the uterus and / or vagina ( in women ) . T4b : The tumor has spread to the pelvic wall or the abdominal wall . Ta , T1 and CIS ( Tis ) tumors are grouped under the heading of non - muscle invasive bladder cancer ( NMIBC ) . It is also common to describe bladder cancer by its grade ( G ) , which represents the similarity of cancer cells to healthy cells when viewed under a microscope . Healthy tissue usually contains various types of cells grouped together . If the cancer looks similar to healthy tissue and contains different cell groupings , it is called differentiated or a low - grade tumor . If the cancerous tissue looks very different from healthy tissue , it is called poorly differentiated or a high - grade tumor . Urologic surgeons may also classify a tumor's grade based on its chance to recur or progress ( grow and spread ) in order to plan treatment based on the grade , using the following categories : - Papilloma ( or benign papillary urothelial neoplasm of low malignant potential ; PUNLMP ) - may recur but has a low risk of progressing . Low grade : likely to recur and progress compared with PUNLMP . High grade : most likely to recur and progress . Bladder cancer can sometimes affect many areas of the bladder at the same time . If more than one tumor is found , the letter m is added to the appropriate T category . If the PCT / IL2023 / 0505 LO cancer is advanced , lymph nodes involvement and metastases typically are also assessed to complete full staging based on Tumor , Node , Metastasis ( TNM ) staging system , in which T describes the size of the tumor and any spread of cancer into nearby tissue ; N describes spread of the cancer to nearby lymph nodes ; and M describes metastasis . The term " subject " as used herein is interchangeable with " individual " and refers to a human subject . The subject is diagnosed with bladder cancer , particularly non - muscle invasive bladder cancer . In some embodiments , the subject is diagnosed with a low - grade ( LG ) tumor . In additional embodiments , the subject is diagnosed with a high - grade ( HG ) tumor . In some embodiments , the bladder cancer is a primary bladder cancer . In other embodiments , the bladder cancer is a recurring bladder cancer . In some embodiments , the subject is tested according to the present invention prior to tumor resection . In other embodiments , the subject is tested after tumor resection . In some embodiments , the subject is tested after tumor resection and BCG induction treatment .

Urine sample collection and processing The DNA to be analyzed by the methods and systems of the present invention is cellular DNA obtained from cells present in the urine . The present invention can be carried out by processing a urine sample or cells which were previously collected from a urine sample . In some embodiments , a urine sample is processed to collect the cells , after which the DNA is extracted from the collected cells . Collection of the cells may be carried out using centrifugation or by the use of other methods that capture the cells , for example , a filtration device which collects the cells without needing centrifugation , such as the filtration device described in Andersson et al . , 2015 , PLoS ONE , 10 ( 7 ) : e0131889 ) . In some embodiments , urine samples may be collected from subjects using conventional collection containers or tubes . Preferably , at least 10ml of urine are collected . In some embodiments , methods of the invention may include a step of extracting genomic DNA from a urine sample . This can be achieved according to methods known in the art . Exemplary procedures are described , e.g. , in Sambrook et al , Molecular Cloning : A Laboratory Manual , Fourth Ed . , Cold Spring Harbor Laboratory Press , Cold Spring Harbor , NY , 2012 . In some embodiments , a urine sample to be analyzed is subjected to centrifugation to create a cell pellet , and DNA is then extracted from the cell pellet . This can be achieved PCT / IL2023 / 0505 LO using a suitable DNA extraction buffer , for example as described in the Examples section hereinbelow .

Preferably , the DNA sample on which the methylation analysis is carried out is substantially free of single - stranded DNA ( ssDNA ) . As used herein , " substantially free of ssDNA " or " substantially devoid of ssDNA " indicates a DNA sample in which less than 7 % of the DNA is ssDNA , preferably less than 5 % of the DNA is ssDNA , more preferably less than 1 % of the DNA is ssDNA ( namely , at least 99 % of the DNA is double - stranded ) ( by number of molecules ) . In some embodiments , the DNA sample contains less than 0.1 % ssDNA . In some embodiments , the DNA sample contains less than 0.01 % ssDNA . In some embodiments , the DNA sample contains no ssDNA ( free of ssDNA ) . Extraction of DNA to obtain a DNA sample substantially free of ssDNA is described , for example , in WO 2020/188561 , assigned to the Applicant of the present invention . In some embodiments , all DNA that was extracted is used according to the present invention . In some embodiments , the DNA is not quantified prior to the methylation analysis according to the present invention . Methods of the invention may be performed on a urine sample , from which DNA is then extracted , or may be performed on cells which have already been obtained from a urine sample ( from which DNA will then be extracted ) , or may be performed on DNA which has already been extracted from a urine sample or from cells therein .

Methylation value A " methylation value " as used herein is a numerical value representing the level of methylation of a particular genomic locus in a DNA sample . As methylation may be analyzed and measured using various methods , a " methylation value " according to the present invention may be expressed as a variety of numerical values . For example , a methylation value may be a methylation level expressed as a ratio or percentage of the DNA molecules that are methylated at a marker locus out of the total number of DNA molecules containing the marker locus in the sample . As a further example , a methylation value may be a methylation level expressed as a copy number of methylated DNA molecules at the marker locus ( e.g. , read count obtained following sequencing , as will be described in more detail below ) . As yet a further example , a methylation value may be a methylation level expressed as an intensity of a signal obtained from a marker locus , e.g. , fluorescent signal obtained using a detectable fluorescent label / probe . A methylation value may be normalized PCT / IL2023 / 0505 LO with respect to a reference locus and / or a reference DNA sample . In some particular embodiments , the methylation value is a methylation ratio between a marker locus and a control locus , expressed as a ratio between signals obtained for these loci following methylation - sensitive enzymatic digestion of the DNA sample and PCR amplification , as will be described in more detail below .

In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 1 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 2 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 3 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 4 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 5 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 6 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 7 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 8 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 9 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 10 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 11 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 12 , and optionally for at least one additional marker locus . In some PCT / IL2023 / 0505 LO embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 13 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 14 , and optionally for at least one additional marker locus . In some embodiments , the methods of the present invention comprise determining a methylation value for the marker locus set forth in SEQ ID NO : 15 , and optionally for at least one additional marker locus . As described herein , each marker locus of the present invention contains a plurality of differentially methylated CG dinucleotides located within restriction sites of methylation- sensitive restriction endonucleases . In some embodiments , when the marker loci are analyzed using methylation - sensitive enzymatic digestion of the DNA , the methylation value for a marker locus is based on CG dinucleotides within restriction site ( s ) of the methylation - sensitive restriction endonuclease ( s ) used in the assay . The following sections describe methylation analyses according to some embodiments of the present invention , which are based on methylation - sensitive enzymatic digestion of the DNA sample followed by quantitative PCR amplification and analysis of amplification products , or methylation - sensitive enzymatic digestion of the DNA sample followed by high - throughput sequencing ( next - generation sequencing ) . A person of skill in the art would appreciate that other methods for analyzing methylation and obtaining methylation value ( s ) of marker loci may be used with the present invention .

Methylation analysis using methylation - sensitive enzymatic digestion and PCR amplification A. DNA digestion In some embodiments , following extraction the DNA is subjected to digestion with at least one methylation - sensitive restriction endonuclease , for example , with one , two , three methylation - sensitive restriction endonucleases . Each number of endonucleases used in the assay represents a separate embodiment of the present invention . In some embodiments , the entire DNA that is extracted from the urine sample is used in the digestion step . In some embodiments , the DNA is not quantified prior to being subjected to digestion . In other embodiments , the DNA may be quantified prior to digestion thereof .

PCT / IL2023 / 0505 LO A " restriction endonuclease " , used herein interchangeably with a " restriction enzyme " , refers to an enzyme that cuts DNA at or near specific recognition nucleotide sequences , known as restriction sites . Restriction sites are usually 4 to 8 nucleotide long and are typically palindromic ( i.e. , reading in a certain direction , e.g. 5 ' to 3 ' , on one strand is identical to the sequence in the same direction ( 5 ' to 3 ' ) on the complementary strand ) . A " methylation - sensitive " restriction endonuclease is a restriction endonuclease that cleaves its recognition sequence only if it is unmethylated ( while methylated sites remain intact ) . Thus , the extent of digestion of a DNA sample by a methylation - sensitive restriction endonuclease depends on the methylation level , where a higher methylation level protects from cleavage and accordingly results in less digestion . Examples of methylation - sensitive restriction endonucleases that may be used according to the present invention include : Acil , Afel , Apal , AscI , Aval , Avall , BanI , Bbel , BcgI , BfuCI , BsaAI , BsaHI , BsaI , BseYI , BsiEI , BslI , BsmAI , BsmFI , BsrBI , BsrFI , BSSHII , BSSKI , BstUI , Cac8I , DpnI , Ecil ,, Faul , Fnu4HI , FspI , Haell , HgaI , HhaI , HinfI , HinPII , HpaII , HpyI66ii , HpyI88iii , Hpy991 , HpyCH4IV , KasI , MmeI , MspAII , MwoI , Nhel , NlaIV , PleI , PmlI ,, PspOMI , SacII , Sau3AI , Sau961 , ScrFI , SfoI , SgrAI , Smal , Tfil , TscI , Tsel , and TspMI , and their ‘ HF ' high fidelity variants where available . Each possibility represents a separate embodiment of the present invention . In general , embodiments which can be performed with methylation - sensitive restriction endonuclease ( s ) can be done alternatively with methylation - dependent restriction endonucleases , and downstream steps will be adjusted accordingly . In some embodiments , the DNA extracted from the urine sample may be subjected to digestion with a single methylation - sensitive restriction endonuclease . In some particular embodiments , the methylation - sensitive restriction endonuclease may be HhaI . In additional particular embodiments , the methylation - sensitive restriction endonuclease may be HinP1I . In other embodiments , the DNA extracted from the urine sample may be subjected to digestion with a plurality of methylation - sensitive restriction endonucleases . As used herein , " a plurality " indicates " at least two " . In some embodiments , DNA digestion may be carried out to complete digestion . In some embodiments , the methylation - sensitive restriction endonuclease may be Hhal , and complete digestion may be achieved following one to two hours incubation with the enzyme at 37 ° C .

PCT / IL2023 / 0505 LO In some embodiments , DNA digestion may be carried out to complete digestion . In some embodiments , the methylation - sensitive restriction endonuclease may be HinP1I , and complete digestion may be achieved following one to two hours incubation with the enzyme at 37 ° C . B. Amplification of genomic loci The terms " genomic locus " or " locus " as used herein are interchangeable and refer to a DNA sequence at a specific position on a chromosome . The specific position may be identified by the molecular location , namely , by the numbers of the starting and ending base pairs on the chromosome . A variant of a DNA sequence at a given genomic position is called an allele . Alleles of a locus are located at identical sites on homologous chromosomes . Loci include gene sequences as well as other genetic elements ( e.g. , intergenic sequences ) . A " marker locus " as disclosed herein refers to a genomic locus that is differentially methylated between sources of DNA , and therefore analysis of its methylation provides an indication with respect to the source of the DNA . A " control locus " and " internal reference locus " are interchangeable and used herein to describe a locus the digestion of which , with the restriction enzyme applied in the digestion step , is independent of the presence or absence of methylation . In some embodiments , the control locus is a locus that exhibits the same digestion and amplification profile in bladder cancer and in healthy tissue . In some embodiments , the control locus is a locus devoid of the recognition sequence of the restriction enzyme applied in the digestion step , and the sequence of the control locus remains intact regardless of its methylation status when the DNA sample is digested . Advantageously , the control locus is an internal locus , i.e. a locus within the analyzed DNA sample , thus eliminating the need for external / additional control sample ( s ) . A marker locus for use according to the present invention include any one or more of the loci set forth in SEQ ID NOs : 1-15 , as follows ( numbering according to the hgbuild of the human genome ) : SEQ ID NO : 1 , corresponds to position 65676359 - 65676418 on chromosome 17 , ( KCNJ2 gene ) ; SEQ ID NO : 2 , corresponds to position 21958446 - 21958585 on chromosome 9 , ( CDKN2A gene ) ; gene ) ; SEQ ID NO : 3 , corresponds to position 336844 - 336903 on chromosome 6 , ( IRF4 PCT / IL2023 / 0505 SEQ ID NO : 4 , corresponds to position 33319507 - 33319636 on chromosome 21 , ( Olig2 gene ) ; SEQ ID NO : 5 , corresponds to position 166502151 – 166502220 on chromosome 6 , intergenic region ; SEQ ID NO : 6 , corresponds to position 896902 - 897031 on chromosome 18 , ( ADCYAP1 gene ) ; SEQ ID NO : 7 , corresponds to position 32747873 - 32748022 on chromosome 5 , ( NPR3 gene ) ; SEQ ID NO : 8 , corresponds to position 27949195 - 27949264 on chromosome 6 , intergenic region ; SEQ ID NO : 9 , corresponds to position 27191603 – 27191672 on chromosome 7 , ( HOXA9 gene ) ; SEQ ID NO : 10 , corresponds to position 170170302 - 170170361 on chromosome , intergenic region ; SEQ ID NO : 11 , corresponds to position 30797737 - 30797876 on chromosome 15 , intergenic region ; SEQ ID NO : 12 , corresponds to position 7936767 - 7936866 on chromosome 1 , intergenic region ; SEQ ID NO : 13 , corresponds to position 170077565 – 170077634 on chromosome , ( DNM3 gene ) ; SEQ ID NO : 14 , corresponds to position 1727592 - 1727661 on chromosome 2 , ( PXDN gene ) ; and SEQ ID NO : 15 , corresponds to position 72919092 - 72919231 on chromosome 8 , ( MSC gene ) . The marker loci set forth in SEQ ID NOs : 1-15 , previously disclosed in WO 2017/006317 , assigned to the Applicant of the present invention , are differentially methylated between cancerous bladder tissue and normal bladder tissue . More particularly , these loci have increased methylation in bladder cancer tissue compared to normal tissue . Each of these loci contains CG dinucleotides that are more methylated in DNA from cancerous bladder tissue compared to DNA from normal non - cancerous bladder tissue . Advantageously , the differentially methylated CG dinucleotides are located within recognition sites of methylation - sensitive restriction enzymes .

PCT / IL2023 / 0505 LO In some embodiments , each of these loci may contain at least one restriction site of a methylation - sensitive restriction enzyme in which the CG dinucleotide is more methylated in bladder cancer cells than in normal cells , meaning that in the cancerous tissue a greater number of cells contain methylation at this position compared to normal tissue . In some embodiments , each of these loci may contain at least one Hhal restriction site ( GCGC ) . In some embodiments , each of these loci may contain at least one HinP1I restriction site . The methylation - sensitive restriction enzyme cleaves its recognition sequence only if it is unmethylated . Thus , a DNA sample containing a higher percentage of DNA molecules in which the CG dinucleotide in the restriction site is methylated would be digested to a lesser extent compared to a DNA sample containing a higher percentage of DNA molecules in which the CG dinucleotide is unmethylated . Based on the methods disclosed herein , DNA digestion by methylation - sensitive restriction enzymes is less extensive for DNA from urine samples of bladder cancer patients compared to DNA from normal ( healthy ) individuals . The difference in digestion efficiency establishes different amplification patterns in subsequent amplification and quantification steps , which enables distinguishing between DNA from a cancerous bladder tissue and DNA from a normal bladder tissue .

In some embodiments , each of the loci set forth in SEQ ID NOs : 1-15 may contain additional CG dinucleotides whose methylation status is of no relevance or influence on the assay only methylation at the recognition sequence of the restriction enzyme ( e.g. Hhal or HinP1I ) is relevant .

- In some embodiments , the control locus is as set forth in SEQ ID NO : 16 , which corresponds to position 121380854 - 121380913 on chromosome 7 ( intergenic region ) . In some embodiments , the control locus , also termed an internal reference locus , does not contain a recognition sequence of the restriction enzyme . In some embodiment , the sequence of the control locus remains intact ( regardless of its methylation status ) when a DNA sample is digested with a methylation - sensitive restriction enzyme . In some embodiments , the sequence of the control locus exhibits the same digestion and amplification profile in bladder cancer tissue and in a healthy bladder tissue . In some embodiments , the control locus comprises the locus set forth in SEQ ID NO : 16 and the amplification pattern of the control locus following digestion with the methylation sensitive restriction enzyme is not affected by methylation . In some embodiments , the methods of the present invention comprise amplifying at least one marker locus and at least one control locus following digestion of the DNA sample .

PCT / IL2023 / 0505 LO As used herein , " at least one ( marker / control ) locus " , may encompass a single locus or a plurality of separate loci . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 1 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 2 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 3 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 4 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 5 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 6 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 7 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 8 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 9 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 10 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 11 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 12 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 13 and a control locus , and optionally at least one additional marker locus . In some embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 14 and a control locus , and optionally at least one additional marker locus . In some PCT / IL2023 / 0505 embodiments , the methods of the present invention comprise amplifying the marker locus set forth in SEQ ID NO : 15 and a control locus , and optionally at least one additional marker locus .

In some embodiments , the methods of the present invention comprise amplifying a marker locus selected from SEQ ID NOs : 1-15 , and a control locus as set forth in SEQ ID NO : 16 .

In some embodiments , the methods of the present invention comprise amplifying a plurality of marker loci ( i.e. , at least two marker loci ) and a control locus . In some embodiments , the plurality of marker loci comprises the locus set forth in SEQ ID NO : 1 and the locus set forth in SEQ ID NO : 5. In some embodiments , the plurality of marker loci further comprises at least one marker locus selected from the loci set forth in SEQ ID NO : 7 and SEQ ID NO : 11. In some embodiments , the plurality of marker loci comprises the loci set forth in SEQ ID NO : 1 , SEQ ID NO : 5 , SEQ ID NO : 7 and SEQ ID NO : 11 .

In some embodiments , the plurality of marker loci comprises the loci set forth in SEQ ID NO : 1 , SEQ ID NO : 5 , SEQ ID NO : 7 and SEQ ID NO : 11 , and further comprises at least one additional marker locus selected from the group consisting of SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15. Each possibility represents a separate embodiment of the present invention . In some embodiments , the plurality of marker loci comprises the locus set forth as SEQ ID NO : 1 and further comprises one , two , three , four , five , six , seven , eight , nine , ten , eleven , twelve , thirteen or fourteen additional marker loci selected from the group consisting of SEQ ID NOs : 2-15 . Each possibility represents a separate embodiment of the present invention .

In some embodiments , the plurality of marker loci comprises the loci set forth as SEQ ID NOs : 1 and 5 , and further comprises one , two , three , four , five , six , seven , eight , nine , ten , eleven , twelve or thirteen additional marker loci selected from the group consisting of SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 11 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15. Each possibility represents a separate embodiment of the present invention .

PCT / IL2023 / 0505 LO In some embodiments , the plurality of marker loci comprises the loci set forth as SEQ ID NOS : 1,5 and 7 , and further comprises one , two , three , four , five , six , seven , eight , nine , ten , eleven or twelve additional marker loci selected from the group consisting of SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 11 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15. Each possibility represents a separate embodiment of the present invention . In some embodiments , the plurality of marker loci comprises the loci set forth as SEQ ID NOS : 1 , 5 , 7 and 11 , and further comprises one , two , three , four , five , six , seven , eight , nine , ten or eleven additional marker loci selected from the group consisting of SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15 . Each possibility represents a separate embodiment of the present invention . In some embodiments , the plurality of marker loci comprises the loci set forth in SEQ ID NOs : 1-15 . In some embodiments , the plurality of marker loci is consisting of the loci set forth in SEQ ID NOs : 1-15 . In some embodiments , the methods of the present invention comprise amplifying a plurality of marker loci as set forth SEQ ID NOs : 1-15 . As used herein , " amplification " refers to an increase in the number of copies of one or more particular nucleic acid target of interest . Amplification is typically performed by polymerase chain reaction ( PCR ) in the presence of a PCR reaction mixture which may include a suitable buffer supplemented with the DNA template , polymerase ( usually Taq Polymerase ) , dNTPs , primers and probes ( as appropriate ) . The term " polynucleotide " as used herein include polymeric forms of nucleotides of any length , either deoxyribonucleotides or ribonucleotides , or analogs thereof . The term " oligonucleotide " is also used herein to include a polymeric form of nucleotides , typically of up to 100 bases in length . An " amplification product " collectively refers to nucleic acid molecules of a particular target sequence that are generated and accumulated in an amplification reaction . The term generally refers to nucleic acid molecules generated by PCR using a given set of amplification primers . As used herein , a " primer " defines an oligonucleotide which is capable of annealing to ( hybridizing with ) a target sequence , thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions . The terminology " primer pair " refers herein to a pair of oligonucleotides which are selected to be used PCT / IL2023 / 0505 LO together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes , preferably PCR . As commonly known in the art , the primers may be designed to bind to a complementary sequence under selected conditions . The primers may be of any suitable length , depending on the particular assay format and the particular needs . In some embodiments , the primers may include at least nucleotides in length , preferably between 15-25 nucleotides in length , or 19-25 nucleotides in length . The primers may be adapted to be especially suited to a chosen nucleic acid amplification system . The oligonucleotide primers may be designed by taking into consideration the melting point of hybridization thereof with their targeted sequence ( Sambrook et al , ibid ) . In some embodiments , the marker and control loci may be amplified from the same DNA sample ( the digested sample ) using pairs of reverse and forward primers designed to specifically amplify each locus . In some embodiments , the primers may be designed to amplify a locus along with 5 ' and 3 ' flanking sequences thereof . In some embodiments , the 5 ' flanking sequences may include between 1-60 bases immediately upstream of the locus . In additional embodiments , the 5 ' flanking sequences are between 10-50 bases immediately upstream of the locus . For example , the 5 ' flanking sequences may include 10 bases , 15 bases , 20 bases , 25 bases , 30 bases , 35 bases , 40 bases . bases , or 50 bases immediately upstream of the locus . Each possibility represents a separate embodiment of the present invention . In some embodiments , the 3 ' flanking sequences may include between 1-90 bases immediately downstream of the locus . In some embodiments , the 3 ' flanking sequences may include between 5-80 bases immediately downstream of the locus . In some embodiments , the 3 ' flanking sequences may include 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 , 63 , 64 , 65 , 66 , 67 , 68 , , 70 , 71 , 72 , 73 , 74 , 75 , 76 , 77 , 78 , 79 , or 80 bases immediately downstream of the locus . Each possibility represents a separate embodiment of the present invention . In some embodiments , the primers may be designed to generate amplification products of between 75-225 bases in length when the locus is intact . In some embodiments , the method involves simultaneous amplification of more than one target sequence ( e.g. , at least one marker locus and one control locus ) in the same reaction mixture , a process known as multiplex amplification or co - amplification . This PCT / IL2023 / 0505 LO process requires simultaneous use of multiple primer pairs . The primers may be designed such that they can work at the same annealing temperature during amplification . In some embodiments , primers with similar melting temperature ( Tm ) are used in the method disclosed herein . A Tm variation of between about 3 ° -5 ° C is considered acceptable for primers used in a pool . In some embodiments , all marker and control loci may be amplified in a single reaction mixture . In other embodiments , for example due to technical limitation of a particular machine , the digested DNA sample may be divided into several aliquots , each of which is supplemented with primer pairs for amplification of one or more marker loci and the control locus . Thus , even if a DNA sample is divided into several aliquots , the control locus is amplified in each aliquot , and calculation of signal ratios is performed for the control locus and a marker locus that are amplified together , i.e. , from the same aliquot . In some embodiments , the method may use control constructs comprising non- human DNA sequences in the digestion and amplification step ( s ) . In some embodiments , the control constructs comprise artificial ( synthetic ) DNA sequences . The control constructs may be used for controlling the digestion and amplification processes , for example , monitoring the efficacy and quality of the digestion and amplification steps . In some embodiments , the control constructs and the DNA sample are digested , by the at least one methylation - sensitive restriction enzyme , at the same time , and optionally , within the same container ( e.g. test tube , vial and the like ) . In some embodiments , the method may include the step of subjecting the control constructs to digestion with the at least one methylation- sensitive restriction enzyme , together with the DNA sample . In some embodiments , the method may include adding the control constructs to the DNA sample and subjecting both to digestion with the at least one methylation - sensitive restriction enzyme . In some embodiments , a methylation - sensitive restriction endonuclease may be used in the digestion step , together with one or more of the following control constructs : a first control construct comprising a DNA sequence devoid of a recognition sequence of the methylation - sensitive restriction endonuclease , and a second control construct comprising a DNA sequence containing a recognition sequence of the methylation - sensitive restriction endonuclease and being completely unmethylated , such that , the first control construct remains intact , whereas the second control construct is digested completely , or at least partially . In the subsequent amplification steps , primers ( and optionally probes ) which are specific for the control constructs may be added . Detection of adequate amplification for the PCT / IL2023 / 0505 first construct concomitant with sufficiently lower amplification for the second construct is indicative of proper DNA digestion . In some embodiments , detecting adequate amplification for the first construct concomitant with sufficiently lower amplification for the second construct may include detecting a difference of at least 5 cycles between quantification cycles ( Cq ) of the first and second control constructs in Real - Time PCR . In some embodiments , the difference may be of at least 6 cycles , at least 7 cycles or at least 8 cycles . Each possibility represents a separate embodiment of the present invention .

In some embodiments , the first and second control constructs may include SEQ ID NOS : 17 and 18 , respectively . In some embodiments , primers and probes for amplifying and detecting the first control construct may include SEQ ID NO : 19 ( forward ) , SEQ ID NO : ( reverse ) and SEQ ID NO : 21 ( probe ) . In some embodiment , primers and probes for amplifying and detecting the second control construct may include SEQ ID NO : ( forward ) , SEQ ID NO : 23 ( reverse ) and SEQ ID NO : 24 ( probe ) . In some embodiments , amplification of the genomic loci may be carried out using Real - Time PCR ( RT - PCR ) , also known as quantitative PCR ( qPCR ) , in which simultaneous amplification and detection of the amplification products are performed . In some embodiments , detection of the amplification products in RT - PCR may be achieved using polynucleotide probes , typically fluorescently - labeled polynucleotide probes . As used herein , " polynucleotide probes " or " oligonucleotide probes " are interchangeable and refer to labeled polynucleotides which are complementary to specific sub - sequences within the nucleic acid sequences of loci of interest , for example , within the sequence of a marker locus or a control locus . In some embodiments , detection is achieved by using TaqMan assays based on combined reporter and quencher molecules ( Roche Molecular Systems Inc. ) . In such assays , the polynucleotide probes have a fluorescent moiety ( fluorophore ) attached to their 5 ' end and a quencher attached to the 3 ' end . During PCR amplification , the polynucleotide probes selectively hybridize to their target sequences on the template , and as the polymerase replicates the template it also cleaves the polynucleotide probes due to the polymerase's 5'- nuclease activity . When the polynucleotide probes are intact , the close proximity between the quencher and the fluorescent moiety normally results in a low level of background fluorescence . When the polynucleotide probes are cleaved , the quencher is decoupled from the fluorescent moiety , PCT / IL2023 / 0505 LO resulting in an increase of intensity of fluorescence . The fluorescent signal correlates with the amount of amplification products , i.e. , the signal increases as the amplification products accumulate .

As used herein , " selectively hybridize to " ( as well as " selective hybridization , " " specifically hybridize to , " and " specific hybridization " ) refers to the binding , duplexing , or hybridizing of a nucleic acid molecule ( such as a primer or a probe ) preferentially to a particular complementary nucleotide sequence under stringent conditions . The term " stringent conditions " refers to conditions under which a nucleic acid molecule will hybridize preferentially to its target sequence and to a lesser extent to , or not at all to , other non - target sequences . A " stringent hybridization " in the context of nucleic acid hybridization is sequence - dependent , and differs under different conditions , as known in the art .

Polynucleotide probes may vary in length . In some embodiments , the polynucleotide probes may include between 15-30 bases . In additional embodiments , the polynucleotide probes may include between 25-30 bases . In some embodiments , the polynucleotide probes may include between 20-30 bases , for example , 20 bases , 21 bases , 22 bases , 23 bases , bases , 25 bases , 26 bases , 27 bases , 28 bases , 29 bases , 30 bases . Each possibility represents a separate embodiment of the present invention . Polynucleotide probes may be designed to bind to either strand of the template . Additional considerations include the Tm of the polynucleotide probes , which should preferably be compatible to that of the primers . Computer software may be used for designing the primers and probes .

As noted above , the methods disclosed herein may involve simultaneous amplification of more than one target sequence ( at least one marker locus and one control locus ) in the same reaction mixture . In order to distinguish between multiple target sequences that are amplified in parallel , polynucleotide probes labeled with distinct fluorescent colors may be used . In some embodiments , the polynucleotide probes form a fluorophore / quencher pairs as known in the art and include , for example , FAM - TAMRA , FAM - BHQ1 , Yakima Yellow - BHQ1 , ATTO550 - BHQ2 and ROX - BHQ2 . In some embodiments , the dye combinations may be compatible to the RT - PCR thermocycler of choice .

PCT / IL2023 / 0505 LO In some embodiments , fluorescence may be monitored during each PCR cycle , providing an amplification plot showing the change of fluorescent signals from the probes as a function of cycle number . In the context of RT - PCR , the following terminology is used : " Quantification cycle " ( " Cq " ) refers to the cycle number in which fluorescence increases above a threshold , set automatically by software or manually by the user . In some embodiments , the threshold may be constant for all loci and may be set in advance , prior to carrying out the amplification and detection . In other embodiments , the threshold may be defined separately for each locus after the run , based on the maximum fluorescence level detected for this locus during the amplification cycles . " Threshold " refers to a value of fluorescence used for Cq determination . In some embodiments , the threshold value may be a value above baseline fluorescence , and / or above background noise , and within the exponential growth phase of the amplification plot . " Baseline " refers to the initial cycles of PCR where there is little to no change in fluorescence .

Computer software may be used to analyze amplification plots and determine baseline , threshold and Cq . Following digestion with the at least one methylation - sensitive restriction enzyme , loci in which the CG dinucleotide ( s ) in the enzyme's recognition site ( s ) are methylated are amplified with high efficiency , because the DNA molecules are protected from cleavage . The result is relatively low Cq values because detectable amplification products are shown following a relatively small ( low ) number of amplification cycles . Conversely , loci in which the CG dinucleotide ( s ) in the enzyme's recognition site ( s ) are unmethylated are cut more extensively during the digestion step , and thus result in higher Cq values in the amplification and quantification step ( i.e. , show detectable amplification products following a relatively high number of amplification cycles ) . In alternative embodiments , amplification and detection of amplification products may be carried out by conventional PCR using fluorescently - labeled primers followed by capillary electrophoresis of amplification products . In some embodiments , following amplification the amplification products are separated by capillary electrophoresis and fluorescent signals are quantified . In some embodiments , an electropherogram plotting the change in fluorescent signals as a function of size ( bp ) or time from injection may be generated , wherein each peak in the electropherogram corresponds to the amplification PCT / IL2023 / 0505 LO product of a single locus . The peak's height ( provided for example using " relative fluorescent units " , rFU ) may represent the intensity of the signal from the amplified locus . Computer software may be used to detect peaks and calculate the fluorescence intensities ( peak height ) of a set of loci whose amplification products were run on the capillary electrophoresis machine , and subsequently the ratios between the signal intensities . For DNA samples digested with a methylation - sensitive restriction enzyme , e.g. , Hhal or HinP1I , loci in which the CG dinucleotide ( s ) in the enzyme's recognition site ( s ) are methylated produce a relatively strong signal ( higher peak ) in the electropherogram . Conversely , loci in which the CG dinucleotide ( s ) in the enzyme's recognition site ( s ) are unmethylated produce a relatively weak signal ( lower peak ) in the electropherogram . In some embodiments , the fluorescent labels of the primers include any one of fluorescein , FAM , lissamine , phycoerythrin , rhodamine , Cy2 , Cy3 , Cy3.5 , Cy5 , Cy5.5 , Cy7 , FluorX , JOE , HEX , NED , VIC and ROX .

C. Signal ratio The term " ratio " or " signal ratio " as used herein refers to the ratio between the intensities of signals obtained from co - amplification of a pair of genomic loci in a single DNA sample ( in the same reaction mixture ) , particularly co - amplification of a marker locus and a control locus . A signal ratio between a marker locus and a control locus of the present invention , obtained following methylation - sensitive enzymatic digestion and co- amplification , reflects the methylation ratio between these marker and control loci , and represents a " methylation value " according to the present invention . The term " signal intensity " as used herein refers to a measure reflecting the amount of locus - specific amplification products corresponding to the initial amount of intact copies of the locus . However , the signal intensity may not indicate actual amounts of amplification products / intact loci , and may not involve calculation of any absolute amounts of amplification products / intact loci . Thus , for calculating ratios of amplicon signals , no standard curve or reference DNA may be needed since it is unnecessary to calculate actual DNA concentrations or DNA methylation level per se . In some exemplary embodiments , amplification and detection of amplification products are carried out by real - time PCR where the signal intensity of a specific locus may be represented by the Cq calculated for this locus . The signal ratio in this case may be represented by the following calculation : 2 Cq of control locus - Cq of marker locus ) PCT / IL2023 / 0505 LO In additional exemplary embodiments , detection of amplification products is carried out by capillary electrophoresis wherein the signal intensity of a specific locus is the number of relative fluorescence units ( rfus ) of its corresponding peak . The signal ratio may be calculated by dividing the heights of peaks of each marker locus by the height of the peak of a control locus .

In some embodiments , calculating a ratio between signal intensities of the amplification products of a marker locus and a control locus in a DNA sample comprises : ( i ) determining the signal intensity of the amplification product of the marker locus ; ( ii ) determining the signal intensity of the amplification product of the control locus ; and ( iii ) calculating a ratio between the two signal intensities . In some embodiments , calculating a ratio between signal intensities of the amplification products of a marker locus and a control locus in the DNA sample comprises determining the Cq for each locus , and calculating the difference between the Cq of the control locus and the Cq of the marker locus . In some embodiments , the calculating further comprises applying the following formula : 2 ^ ( Cq of control locus - Cq of marker locus ) . In some embodiments , calculating a signal ratio may be calculating a plurality of signal ratios , between each marker locus and a control locus . In some embodiments , a plurality of loci among the loci set forth in SEQ ID NOs : 1-15 are amplified and the methods of the present invention comprise calculating a plurality of signal ratios , e.g. , between each of the loci set forth SEQ ID NOs : 1-15 and a control locus , e.g. , between the locus set forth in SEQ ID NO : 1 and the control locus , between the locus set forth in SEQ ID NO : 2 and the control locus , and so forth . In some embodiments , computer software may be used for calculating a ratio between signal intensities of amplification products . As noted above , a signal ratio between a marker locus and a control locus of the present invention , obtained following methylation - sensitive enzymatic digestion and co- amplification , reflects the methylation ratio between these marker and control loci , and represents a " methylation value " according to the present invention .

Methylation analysis using methylation - sensitive enzymatic digestion and high- throughput sequencing " High throughput sequencing " ( also termed " next generation sequencing " , abbreviated " NGS " ) includes sequence determination using methods that determine many PCT / IL2023 / 0505 LO ( typically thousands to billions ) of nucleic acid sequences in parallel . High throughput sequencing generally involves three basic steps : library preparation , sequencing and data analysis . Examples of high throughput sequencing techniques include sequencing - by- synthesis and sequencing - by - ligation ( employed , for example , by Illumina Inc. , Life Technologies Inc. , Roche ) , nanopore sequencing methods and electronic detection - based methods such as Ion Torrent ™ technology ( Life Technologies Inc. ) . High - throughput sequencing include whole genome high - throughput sequencing and target - specific high- throughput sequencing . Each possibility represents a separate embodiment of the present invention .

According to some embodiments of the present invention , following extraction the DNA is subjected to digestion with at least one methylation - sensitive restriction endonuclease as described herein , and subsequently a sequencing library is prepared . In some embodiments , preparing a sequencing library comprises introducing adapter oligonucleotides , also termed " sequencing adapters " , to DNA fragments , and enriching DNA fragments corresponding to marker loci of interest and optionally one or more control loci . Enrichment of genomic regions of interest may be carried out , for example , using locus- specific PCR , or using capture agents in a solution - phase or a solid - phase hybridization- based process . The sequencing adapters are oligonucleotides at the 5 ' and 3 ' ends of each DNA fragment in a sequencing library . Sequencing adapters typically include platform - specific sequences for fragment recognition by a particular sequencer : for example , sequences that enable library fragments to bind to the flow cells of Illumina platforms . Each sequencing instrument typically employs a specific set of sequences for this purpose . The sequencing adapters may include sample indices , which are sequences that enable multiple samples to be sequenced together ( i.e. , multiplexed ) on the same instrument flow cell or chip . Each sample index , typically 6-10 bases , is specific to a given sample library and is used for demultiplexing during data analysis to assign individual sequence reads to the correct sample . Sequencing adapters may contain single or dual sample indexes depending on the number of libraries combined and the level of accuracy desired . Sequencing adapters may be introduced into analyzed DNA fragments by ligation or via PCR . In some embodiments , a 2 - step PCR is used , in order to enrich genomic regions of interest and introduce sequencing adapters to the enriched fragments . The first PCR is carried out using primers that contain locus - specific sequences and overhang sequences that introduce a first portion of the PCT / IL2023 / 0505 LO sequencing adapters , and the second PCR is carried out using primers that introduce a second portion of the sequencing adapters and optionally sample indices . A sequencing library is subjected to sequencing to obtain multiple sequence reads . The sequence reads are analyzed using a computer software to determine a read count ( copy number ) for each locus of interest . The read count of a marker locus reflects the number of methylated copies of this locus that were present in the tested DNA sample ( the methylated copies remain intact when the sample is digested with methylation - sensitive restriction endonucleases ) . Relative copy number may be calculated for a marker locus , for example , with respect to a control locus , as follows : Relative copy number = Read count of marker locus / Read count of control locus A read count of a marker locus or alternatively a relative copy number of a marker locus represent " methylation values " according to the present invention . In some embodiments , analysis of methylation values according to the present invention comprises : ( a ) subjecting a DNA sample to digestion with at least one methylation - sensitive restriction endonuclease , thereby obtaining restriction endonuclease - treated DNA ; ( b ) generating a sequencing library from the restriction endonuclease - treated DNA , the sequencing library comprising DNA fragments corresponding to at least one marker locus as disclosed herein ( preferably a plurality of marker loci as disclosed herein ) and at least one control locus ; ( c ) subjecting the sequencing library to high - throughput sequencing and determining a copy number for each of the at least one marker locus and the control locus ; and ( d ) comparing a ratio between the copy numbers of each of said at least one marker locus and the control locus to at least one reference ratio .

In some embodiments , generating a sequencing library comprises enriching DNA fragments corresponding to the at least one marker locus and the at least one control locus .

Reference ratio The terms " reference ratio " or " reference signal ratio " are used interchangeably and refer to a signal intensity ratio determined in DNA from a known source . A reference ratio for a given pair of marker and control loci may be represented in a number of ways . In some embodiments , the reference ratio for a given pair of loci may be a single ratio . In some embodiments , the reference ratio for a given pair of loci may be a statistic value , such as , PCT / IL2023 / 0505 LO the mean value of a large set of reference ratios , obtained from a large set of DNA samples from a known source , e.g. , mean value determined in a large group of cancer patients or a mean value determined in a large group of healthy individuals . In other embodiments , the reference ratio for a given pair of loci may be a plurality of ratios , such as a distribution of ratios determined for this pair of loci in a large set of DNA samples from a known source . In some embodiments , the reference ratio may a reference scale .

In some embodiments , a reference scale for a given pair of loci may include signal ratios measured for this pair of loci in a plurality of DNA samples from the same reference source . For example , a reference scale of reference bladder cancer patients or a reference scale of reference healthy individuals . In other embodiments , a reference scale for a given pair of loci may include signal ratios from both healthy and diseased individuals , i.e. a single scale combining reference ratios from both sources . Generally , when a single scale is used , the values are distributed such that the values from the healthy individuals are at one end of the scale , e.g. below a threshold , while the values from the cancer patients are at the other end of the scale , e.g. , above the threshold . In some embodiments , a signal ratio calculated for a tested DNA sample from an unknown source may be compared against the reference scale of healthy and cancer reference ratios , and a bladder cancer probability / likelihood score may be assigned to the calculated signal ratio based on its relative position within the scale . In some embodiments , the higher the calculated signal ratio the higher the score assigned thereto , and accordingly the probability with respect to bladder cancer is high . The terms " bladder cancer reference ratio " or " reference ratio in bladder cancer DNA " interchangeably refer to the signal intensity ratio measured between a given marker locus and a given control locus in DNA from urine samples of bladder cancer patients . The bladder cancer reference ratio represents the signal intensity ratio in bladder cancer DNA , namely , DNA from a cancerous bladder tissue . The bladder cancer reference ratio may be a single ratio , a statistic value or a plurality of ratio ( e.g. , distribution ) , as detailed above . The terms " healthy reference ratio " , " normal reference ratio " or reference ratio in healthy DNA " interchangeably refer to the signal intensity ratio measured between a given restriction locus and a given control locus in urine samples from normal individuals . A " healthy " or " normal " individual is defined herein as an individual without detectable bladder diseases or symptoms , bladder associated diseases including bladder cancer determined by conventional diagnostic methods . The healthy reference ratio represents the PCT / IL2023 / 0505 signal intensity ratio in normal bladder DNA , namely , DNA from a normal , non - cancerous bladder tissue . The healthy reference ratio may be a single ratio , a statistic value or a plurality of ratio ( e.g. , distribution ) , as detailed above . In some embodiments , the methods disclosed herein comprise pre - determination of reference ratios from cancerous bladder DNA . In some embodiments , the methods of the present invention comprise pre - determination of reference ratios from normal bladder DNA . As noted above , a signal ratio may be determined by various methods , including for example measuring peaks following capillary electrophoresis or calculating Cq following real - time PCR . It is to be understood that the reference ratios and ratios measured for a tested sample of an unknown source in order to determine bladder cancer are obtained using the methods disclosed herein .

Determining a positive or a negative methylation assay result In some embodiments , the methods disclosed herein comprise calculating a score for a tested subject based on methylation values and determining whether the score is above or below a predetermined threshold . As used herein , a " positive " result is when the score is above the predefined threshold , and a " negative " result is when the score is below the predefined threshold . As noted above , a decision regarding how to classify a result which equals the threshold may be carried out , for example , using statistical calculations and data from a large population of individuals . A person of skill in the art would appreciate that the comparison of signal ratios calculated for a tested sample to corresponding reference signal ratios may be performed in a number of ways , using various statistical means . In some embodiments , comparing a test signal ratio calculated for a given pair of loci to a reference signal ratio comprises comparing the test signal ratio against a single reference value . The single reference value may correspond to a mean value obtained for reference signal ratios from a large population of cancer patients or healthy individuals . In other embodiments , comparing a test signal ratio calculated for a given pair of loci to a reference signal ratio comprises comparing the test signal ratio against a distribution , or scale , of a plurality of reference signal ratios . Known statistical means may be employed in order to determine whether the signal ratio calculated between a given marker locus and a control locus corresponds to bladder cancer reference ratio or to normal reference ratio . In some embodiments , detecting close PCT / IL2023 / 0505 approximation of a calculated ratio to bladder cancer reference ratio identifies a subject as a subject having bladder cancer . Conversely , in some embodiments , detecting close approximation of a calculated ratio to normal reference ratio identifies a subject as a subject not having bladder cancer . In some embodiments , the method comprises comparing a calculated signal ratio to its corresponding bladder cancer reference ratio ( i.e. , to a signal ratio determined for the same pair of loci in bladder cancer ) to obtain a probability score reflecting the likelihood that the calculated signal ratio is a bladder cancer ratio . The better approximation of the calculated signal ratio to the reference ratio , the higher the probability score and accordingly the likelihood that the calculated signal ratio is a bladder cancer ratio . In some embodiments , the probability score is based on the relative position of the calculated signal ratio within the distribution of bladder cancer reference ratios .

In some embodiments , the method comprises comparing a plurality of signal ratios , calculated for a plurality of marker loci with respect to a control locus , to their corresponding bladder cancer references ratios .

In some embodiments , a pattern of signal ratios may be analyzed using statistical means and computerized algorithm to determine if it represents a pattern of bladder cancer or a normal , healthy pattern . Exemplary algorithms include machine learning and pattern recognition algorithms In some exemplary embodiments , each calculated ratio ( for each pair of marker and control locus ) may be compared against a scale of reference ratios generated for this pair from a large set of urine samples from both cancer patients and individuals not afflicted with cancer . The scale may represent signal ratios calculated between the pair of marker locus and control locus in a large number of samples from cancer patients and normal individuals . The scale may exhibit a threshold value , ( or ' cutoff ' ) or ' pre - defined threshold ' , above which are reference ratios corresponding to bladder cancer and below are reference ratios corresponding to healthy individuals . In some embodiments , the lower ratios , at the bottom of the scale and / or below a threshold , may be from samples of normal individuals ( healthy , i.e. , not afflicted with bladder cancer ) , while the higher ratios at the top of the scale and / or above a predetermined threshold , may be from the cancer patients . For each ratio ( between each marker locus and the control locus ) , a score may be given based on its relative position on the scale , and the individual scores for each locus are combined to give a single score . In some embodiments , PCT / IL2023 / 0505 the individual scores may be summed to give a single score . In other embodiments , the individual scores may be averaged to give a single score . In some embodiments , the single score may be used for determining whether the subject is having cancer , where a score above a pre - defined threshold is indicative of bladder cancer . In some embodiments , a score is a number between 0-100 reflecting the probability that the calculated signal ratio is a bladder cancer ratio , wherein 0 being the lowest probability and 100 being the highest probability . In some embodiments , a threshold score is determined , wherein a score equal to or above which is indicative of bladder cancer . In additional exemplary embodiments , for each calculated ratio ( between each marker locus and the control locus ) , the probability that it represents bladder cancer DNA may be determined based on comparison to corresponding bladder cancer reference ratio and normal reference ratio , and a score ( probability / likelihood score ) may be allocated . Consequently , the individual probability scores calculated for each ratio ( for each locus ) are combined ( e.g. summed or averaged ) to give a combined score . In some embodiments , the combined score is used for determining whether the subject is at high or low risk of developing a high - grade event . In additional embodiments , the combined score is used for determining whether the subject is at high or low risk of high - grade tumor recurrence .

Thus , in some embodiments , a threshold score is determined . In some embodiments , a score above the threshold is indicative of a high risk of a HG event . In other embodiments , a score above the threshold is indicative of a high risk of HG recurrence . In some embodiments , the methods of the present invention comprise providing a threshold score . In some embodiments , determining the threshold score includes measuring signal ratios in a large population of subjects that are either healthy or have bladder cancer . In some embodiments , the threshold values are statistically significant values . Statistical significance is often determined by comparing two or more populations , and determining a confidence interval ( CI ) and / or a p value . In some embodiments , the statistically significant values refer to confidence intervals ( CI ) of about 90 % , 95 % , 97.5 % , % , 99 % , 99.5 % , 99.9 % and 99.99 % , while preferred p values are less than about 0.1 , 0.05 , 0.025 , 0.02 , 0.01 , 0.005 , 0.001 or less than 0.0001 . Each possibility represents a separate embodiment of the present invention . According to some embodiments , the p value of the threshold score is at most 0.05 .

PCT / IL2023 / 0505 As used herein , the term " about " , when referring to a measurable value is meant to encompass variations of +/- 10 % , more preferably +/- 5 % , even more preferably +/- 1 % , and still more preferably +/- 0.1 % from the specified value . In some embodiments , the method further comprises comparing the signal ratio calculated between a given marker locus and a control locus to its corresponding normal bladder reference ratio to obtain a probability score , wherein detecting a low probability score for said ratio with respect to corresponding healthy reference ratio is indicative that the subject has bladder cancer .

In some embodiments , the " sensitivity " of a diagnostic assay as used herein refers to the percentage of diseased individuals who test positive ( percent of " true positives " ) . Accordingly , diseased individuals not detected by the assay are " false negatives " . Subjects who are not diseased and who test negative in the assay are termed " true negatives . " The " specificity " of the diagnostic assay is one ( 1 ) minus the false positive rate , where the " false positive " rate is defined as the proportion of those without the disease who test positive . While a particular diagnostic method may not provide a definitive diagnosis of a condition , it suffices if the method provides a positive indication that aids in diagnosis .

Management of a subject with NMIBC When a tumor is identified ( e.g. during cystoscopy ) , its size and location is documented . A small papillary tumor can be removed either with cold cup biopsy forceps or by transurethral resection of a bladder tumor ( TURBT ) . Narrow Band Imaging may be used to aid in complete resection of bladder tumors . Alternatively , fluorescence cystoscopy may be used .

Following initial resection , tumor might still be present , and repeat resection of the tumor area ( repeat TURBT ) is recommended within 6 weeks of initial TURBT in high risk patients ( e.g. , T1 or high grade disease ) and in patients with concern of incomplete resection ( e.g. no detrusor muscle in specimen ) . Despite pathologically complete resection , there is a high rate of recurrence in patients with non - muscle - invasive bladder cancer ( NMIBC ) . Thus , current American Urologic Association ( AUA ) guidelines and European Association of Urology ( EAU ) guidelines each recommend the use of intravesical Bacillus Calmette- niréuG ( BCG ) immunotherapy or intravesical chemotherapy immediately after TURBT . Several chemotherapeutic agents have shown clinical efficacy in reducing recurrence rates in the post - TURBT setting , including intravesical docetaxel , mitomycin C ( MMC ) , PCT / IL2023 / 0505 LO doxorubicin , and epirubicin . Intravesical Bacillus Calmette - niréuG ( BCG ) immunotherapy is an established first - line agent in the management of carcinoma in situ ( CIS ) and high- grade non muscle invasive urothelial carcinoma ( UC ) . These agents may be used in conjunction with one another , for example by administration of MMC prior to scheduled BCG dosing . Intravesical gemcitabine and valrubicin have demonstrated modest activity , with valrubicin being an FDA - approved therapy for the treatment of BCG - refractory CIS . Systemic platinum - based chemotherapy is commonly used for the treatment of locally advanced and metastatic bladder cancer .

Although response rates to traditional therapy is high , many bladder cancer patients suffer from recurrence within 1-5 years . In most subjects , tumor will recur as NMIBC , requiring additional bladder resection and instillations . For patients unresponsive to BCG , treatment options are limited ; radical cystectomy remains the standard of care . Immune checkpoint inhibitors have become an increasingly used therapeutic option in many solid tumors , including bladder cancers . PD - L1 expression in such tumors may be associated with resistance to intravesical BCG therapy . Thus , the evaluation of patients may include determining the status of PD - L1 expression in bladder tumor tissue , and anti - PD - L1 or anti- PD - 1 antibodies may be administered alone or in combination with intravesical BCG or chemotherapy . Since 2016 , four checkpoint inhibitor drugs have been approved for bladder cancer : atezolizumab ( ⓇqirtneceT ) , pembrolizumab ( ⓇadurtyeK ) , nivolumab ( ⓇovidpO ) , and avelumab ( ®oicnevaB ) . Immune checkpoint inhibitors have also demonstrated a higher benefit in heavy CD8 immune cell infiltrated tumors and in tumors with high tumor mutational burden ( TMB ) , such as the case of bladder cancer . Thus , the evaluation of patients may include determining the TMB of bladder tumor tissue . Administration of a checkpoint inhibitor may be by a conventional systemic route , by an intravesical route , or both .

Other biologic therapies that find use in bladder cancer include Enfortumab vedotin , an antibody - drug conjugate targeting nectin - 4 , which is expressed in many bladder cancers , that contains monomethyl auristatin E. Nadofaragene firadenovec ( also known as rAd- IFNa / Syn3 ) is a replication - deficient recombinant adenovirus that delivers human interferon alfa - 2b cDNA into the bladder epithelium . Such agents may be delivered by systemic or intravesical routes , particularly in BCG - unresponsive non - muscle - invasive bladder cancer . In some embodiments , the methods of managing a subject comprises administering treatment to the subject . In some embodiments , the treatment comprises one or more of : PCT / IL2023 / 0505 LO fulguration , transurethral resection of bladder tumor ( TURBT ) , cystectomy ( partial or radical ) , chemotherapy ( intravesical or systemic ) , radiation therapy , immunotherapy ( intravesical or systemic ) and targeted therapy . Intravesical chemotherapy may include one or more of mitomycin , gemcitabine , epirubicin and valrubicin . Intravesical chemotherapy may be given as is , as hyperthermic intravesical chemotherapy , as microwave - induced hyperthermia or as electromotive drug administration . Systemic immunotherapy may include one or more of platinum - based ( for example , cisplatin , carboplatin ) fluorouracil ( 5- FU ) , mitomycin , gemcitabine , methotrexate , vinblastine , doxorubicin , docetaxel , paclitaxel and vinflunine . Intravesical immunotherapy may include one or more of Bacillus Calmette- Guerin ( BCG ) , interferon - a and Nadofaragene firadenovec . Systemic immunotherapy may include one or more of immune checkpoint inhibitors , such as PD - 1 and PD - L1 inhibitors ( for example : avelumab , nivolumab , atezolizumab and pembrolizumab ) and antibody - drug conjugates , such as enfortumab vedotin and sacituzumab govitecan . Targeted therapy may include fibroblast growth factor receptor ( FGFR ) inhibitors such as erdafitinib . Treatment may further include supportive care . Various treatment options may be combined , ( e.g. , chemoradiation , instillation combination therapy ) . Each treatment possibility and combination represents a separate embodiment of the present invention . In addition to the methods described herein for evaluating bladder cancer patients and guiding their treatment and / or monitoring , clinical evaluation of the patient and various individual parameters of the subject can provide additional information , and combined with the methods of the present invention to guide therapy . In some embodiments , the methods of the present invention include a step of administering or performing treatment ( s ) on a subject . As an alternative to a step of administering or performing a treatment , methods of the invention may include a step of assigning / allocating or scheduling a treatment procedure for the subject .

Systems and kits In some embodiments , there is provided a kit for assessing a subject with NMIBC as disclosed herein . In additional embodiments , there is provided a system for assessing a subject with NMIBC as disclosed herein . Systems according to the present invention comprise computer processor ( s ) for performing the assays and / or processing the results e.g. , for performing the calculations . In some embodiments , computer - implemented methods are provided herein .

PCT / IL2023 / 0505 LO In some embodiments , a system according to the present invention comprises : DNA extracted from cells of a urine sample of a human subject ; components for carrying out a methylation assay on at least one marker locus hypermethylated in bladder cancer DNA compared to non - cancer DNA selected from the group consisting of SEQ ID NO : 1-15 ; and computer software stored on a non - transitory computer readable medium , the computer software directs a computer processor to determine a methylation value for the at least one marker locus based on the methylation assay , and compare the methylation value of each of said at least one marker locus to at least one reference methylation value selected from a cancer methylation value and a non - cancer methylation value , to perform stratification of subjects according to the methods disclosed herein . Components for carrying out a methylation assay encompass biochemical components ( e.g. , enzymes , primers , probes , nucleotides ) , chemical components ( e.g. , buffers , reagents ) , and technical components ( e.g. , a PCR system , such as a real - time PCR system , and equipment such as tubes , vials , plates , pipettes ) . In some particular embodiments , a system according to the present invention comprises : DNA extracted from cells of a urine sample of a human subject ; at least one methylation - sensitive restriction endonuclease recognizing a sequence within at least one marker locus that is hypermethylated in bladder cancer DNA compared to non - cancer DNA selected from the group consisting of SEQ ID NO : 1-15 ; a plurality of primer pairs for co - amplification of the at least one marker locus and a control locus following digestion with the at least one methylation - sensitive restriction endonuclease ; components for detecting amplification products of the at least one marker locus and the control locus ; and computer software stored on a non - transitory computer readable medium , the computer software directs a computer processor to determine a signal intensity for each of the amplification products of the at least one marker locus and the control locus , and compare a ratio between the signal intensities of the amplification products of each of said at least one marker locus and the control locus to at least one reference ratio selected from cancer reference ratio and non - cancer reference ratio , to perform stratification of subjects according to the methods disclosed herein .

PCT / IL2023 / 0505 Components for detecting amplification products of the at least one marker locus and the control locus encompass for example fluorescent labels , e.g. , in the form of fluorescent primers or fluorescent probes capable of specific hybridization to the amplification products . In some embodiments , a system according to the present invention prepares and communicates a report to the subject and / or to a healthcare provider of the subject based on the methylation values . In some embodiments , there is provided herein a system for stratification of subjects according to the methods disclosed herein , the system comprising a computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( i ) receiving a methylation value determined in DNA extracted from cells of a urine sample of the subject for at least one marker locus that is hypermethylated in bladder cancer DNA compared to DNA selected from the from the group consisting of SEQ ID NO : 1-15 ; and non - cancer ( ii ) comparing the methylation value of each of said at least one marker locus to at least one reference methylation value selected from a cancer methylation value and a non- cancer methylation value , and based on the comparison , outputting a stratification of the subject as disclosed herein . In some embodiments , the computer software further comprises instructions that when executed configure or direct the computer processor to determine the methylation value of each of said at least one marker locus based on data from a methylation assay . In some embodiments , a computer software according to the present invention receives as an input raw data of a real - time PCR run . In some embodiments , the computer software directs a computer processor to analyze the real - time PCR data to determine methylation values , e.g. , methylation ratios , as disclosed herein . The computer software includes processor - executable instructions that are stored on a non - transitory computer readable medium . The computer software may also include stored data . The computer readable medium is a tangible computer readable medium , such as a compact disc ( CD ) , magnetic storage , optical storage , random access memory ( RAM ) , read only memory ( ROM ) , or any other tangible medium . It is understood that the computer - related methods , steps , processes described herein are implemented using software stored on non - volatile or non - transitory computer readable PCT / IL2023 / 0505 LO instructions that when executed configure or direct a computer processor or computer to perform the instructions . Each of the system , server , computing device , and computer described in this application can be implemented on one or more computer systems and be configured to communicate over a network . They all may also be implemented on one single computer system . In one embodiment , the computer system includes a bus or other communication mechanism for communicating information , and a hardware processor coupled with bus for processing information . The computer system also includes a main memory , such as a random - access memory ( RAM ) or other dynamic storage device , coupled to bus for storing information and instructions to be executed by processor . Main memory also may be used for storing temporary variables or other intermediate information during execution of instructions to be executed by processor . Such instructions , when stored in non - transitory storage media accessible to processor , render computer system into a special - purpose machine that is customized to perform the operations specified in the instructions . The computer system further includes a read only memory ( ROM ) or other static storage device coupled to bus for storing static information and instructions for processor . A storage device , such as a magnetic disk or optical disk , is provided and coupled to bus for storing information and instructions . The computer system may be coupled via bus to a display , for displaying information to a computer user . An input device , including alphanumeric and other keys , is coupled to bus for communicating information and command selections to processor . Another type of user input device is cursor control , such as a mouse , a trackball , or cursor direction keys for communicating direction information and command selections to processor and for controlling cursor movement on display . According to one embodiment , the techniques herein are performed by the computer system in response to the processor executing one or more sequences of one or more instructions contained in main memory . Such instructions may be read into main memory from another storage medium , such as storage device . Execution of the sequences of instructions contained in main memory causes the processor to perform the process steps described herein . In alternative embodiments , hard - wired circuitry may be used in place of or in combination with software instructions .

PCT / IL2023 / 0505 LO The term storage media as used herein refers to any non - transitory media that store data and / or instructions that cause a machine to operation in a specific fashion . Common forms of storage media include , for example , a floppy disk , a flexible disk , hard disk , solid state drive , magnetic tape , or any other magnetic data storage medium , a CD - ROM , any other optical data storage medium , any physical medium with patterns of holes , a RAM , a PROM , and EPROM , a FLASH - EPROM , NVRAM , any other memory chip or cartridge . Storage media is distinct from but may be used in conjunction with transmission media . Transmission media participates in transferring information between storage media . For example , transmission media includes coaxial cables , copper wire and fiber optics , including the wires that comprise bus . In some embodiments , a kit according to the present invention comprises components for carrying out a methylation assay on at least one marker locus as described herein on DNA extracted from cells of a urine sample of a subject . In some embodiments , the kit comprises at least one methylation - sensitive restriction enzyme ; pairs of primers for amplification of at least one marker locus and at least one control locus ; and components for detecting amplification products of the at least one marker locus and at least one control locus . In some embodiments , the kit comprises an instruction manual for carrying out the stratification of subjects as disclosed herein . In some embodiments , the instruction manual may include instructions for performing the method steps described above . In some embodiments , the kit or system comprises a single methylation - sensitive endonuclease . In some embodiments , the methylation - sensitive endonuclease is Hhal . In some embodiments , the kit or system comprises a single methylation - sensitive endonuclease . In some embodiments , the methylation - sensitive endonuclease is HinP1I . In some embodiments , the kit may further comprise a non - transitory computer readable medium storing a computer software comprising instructions that when executed configure or direct a computer processor to perform the method steps described herein . In some embodiments , the computer software may be a computer software that calculates at least one of signal intensities , signal ratios and marker scores . In some embodiments , the kit or system comprises : Hhal ; primer pairs complementary to at least one marker locus and at least one control locus as described herein ; and fluorescent polynucleotide probes complementary to the at least one marker locus and at least one control locus .

PCT / IL2023 / 0505 LO In some embodiments , the kit or system comprises : HinP1I ; primer pairs complementary to at least one marker locus and at least one control locus as described herein ; and fluorescent polynucleotide probes complementary to the at least one marker locus and at least one control locus .

Exemplary primers for amplifying the marker loci set forth in SEQ ID NOs : 1-are set forth in SEQ ID NOs : 25-155 as follows ( for = forward , rev = reverse ) : Locus 1 for .: SEQ ID NOs : 25-29 ; Locus 1 rev .: SEQ ID NOs : 30-Locus 2 for .: SEQ ID NOs : 36-38 ; Locus 2 rev .: SEQ ID NOs : 39-Locus 3 for .: SEQ ID NOs : 43-51 ; Locus 3 rev .: SEQ ID NOs : 52-Locus 4 for .: SEQ ID NOs : 62-64 ; Locus 4 rev .: SEQ ID NOs : 65-Locus 5 for .: SEQ ID NOs : 68-70 ; Locus 5 rev .: SEQ ID NOs : 71-Locus 6 for .: SEQ ID NOs : 74-76 ; Locus 6 rev .: SEQ ID NOs : 77-Locus 7 for .: SEQ ID NOs : 80-85 ; Locus 7 rev .: SEQ ID NOs : 86-Locus 8 for .: SEQ ID NOs : 90-92 ; Locus 8 rev .: SEQ ID NOs : 93-Locus 9 for .: SEQ ID NOs : 96-99 ; Locus 9 rev .: SEQ ID NOS : 100-1Locus 10 for .: SEQ ID NOS : 103-106 ; Locus 10 rev .: SEQ ID NOS : 107-1Locus 11 for .: SEQ ID NOs : 113-116 ; Locus 11 rev .: SEQ ID NOs : 117-1Locus 12 for .: SEQ ID NOS : 121-125 ; Locus 12 rev .: SEQ ID NOS : 126-1Locus 13 for .: SEQ ID NOs : 131-135 ; Locus 13 rev .: SEQ ID NOs : 136-1Locus 14 for .: SEQ ID NOs : 141-145 ; Locus 14 rev .: SEQ ID NOs : 146-1Locus 15 for .: SEQ ID NOs : 152-153 ; Locus 15 rev .: SEQ ID NOs : 154-155 . Exemplary primers for amplifying the control locus set forth in SEQ ID NO : 16 are set forth in SEQ ID NOs : 156 – 167 as follows : Control for .: SEQ ID NOs : 156-161 ; Control rev .: SEQ ID NOs : 162-167 . In some embodiments , the kit or system comprises at least one of a first control construct and a second control construct , each comprising non - human / artificial DNA sequences as described above . In some embodiments , the kit comprises both first and second control constructs as described above .

In some embodiments , the kit or system comprises one or more containers filled with at least one nucleotide primer pair . In some embodiments , each nucleotide primer pair included in the kit of the present invention may include primers that are complementary to sub - sequences within a marker locus selected from the marker loci set forth in PCT / IL2023 / 0505 LO SEQ ID NOS : 1-15 or to flanking sequences thereof , wherein said each nucleotide primer pair is designed to selectively amplify a fragment of the genome that includes the locus . In some embodiments , the kit or system may comprise primer pairs for selectively amplifying the combinations of loci described above . In some embodiments , the kit or system may further comprise nucleotide primer pairs for selectively amplifying the first and second artificial control constructs . In some embodiments , the kit or system may further include oligonucleotide probes for detecting amplification products of the loci amplified using the primers in the kit . Each oligonucleotide probe may be complementary to a sub - sequence within a locus and may be capable of hybridizing thereto . In some embodiments , the oligonucleotide probes may be fluorescently - labeled . In some embodiments , the kit or system may further include at least one additional ingredient needed for DNA digestion , loci amplification and detection of amplification products , such as DNA polymerase and nucleotide mix . In some embodiments , the kit or system may further include suitable reaction buffers for digestion and amplification , and a written protocol for performing bladder cancer identification . The written protocol may comprise instructions for performing any of the steps disclosed herein , including but not limited to , DNA digestion parameters , PCR cycling parameters , signal ratio analysis , and comparison to reference ratios . The following examples are presented in order to more fully illustrate certain embodiments of the invention . They should in no way , however , be construed as limiting the broad scope of the invention . One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention .

EXAMPLES - Example 1 – Methylation markers SEQ ID NOs : 1-15 predict short- and long - term high - grade ( HG ) events in bladder cancer patients treated with Bacillus Calmette - niréuG ( BCG ) A cohort of 64 non - muscle - invasive bladder cancer ( NMIBC ) patients planned for trans - urethral resection of bladder tumor ( TURBT ) and subsequently BCG induction cycles were enrolled and analyzed . Patient characteristics are summarized in Table 1. Median age was 72 and the majority of patients were male ( 87.5 % ) . The rates of Ta and T1 were similar LO PCT / IL2023 / 0505 ( ~ 40 % ) , most of them with high - grade tumors ( 93.8 % ) and a high rate of CIS ( 37.5 % ) . Except for one patient who moved to another city after 8 months and was lost to follow - up , all patients were followed up for at least 12 month and up to 48 months with median follow- up of 26 months . Most patients completed 6 cycles of BCG induction ( 93.8 % ) and 79.7 % continued to maintenance treatment with a median of 9 cycles .

Characteristic - Table 1 Patient characteristics n Age , median ( range ) Sex M / F Primary / Recurrent disease Stage prior to BCG induction , n ( % ) Ta TUnknown stage CIS alone / concomitant Grade prior to BCG induction High - grade Low - grade Number of BCG induction cycles , n ( % ) Six induction cycles Five induction cycles 72 ( 42-96 ) ( 87.5 % ) / 8 ( 12.5 % ) ( 57.8 % ) / 27 ( 42.2 % ) 26 ( 40.6 % ) ( 39.1 % ) ( 6.3 % ) ( 14.1 % ) / 15 ( 23.4 % ) 60 ( 93.8 % ) ( 6.3 % ) 60 ( 93.8 % ) ( 6.3 % ) Days from last BCG induction cycle to control visit , median ( range ) ( 34-112 ) 51 ( 79.7 % ) 9 ( 1-20 ) ( range ) ( 10.9 % ) ( 4.7 % ) Intravesical treatment continuation ( maintenance and / or re - induction ) , n ( % ) Number of instillation cycles post induction , median Re - induction , n ( % ) Conversion to mitomycin , n ( % ) A methylation assay using methylation markers SEQ ID NOS : 1-15 was carried out in voided urine samples collected at three timepoints : prior to TURBT , on the day of BCG treatment initiation and on the day of random biopsies after completion of BCG induction ( approximately 1-4 months after the last dose of BCG induction ) . Patients underwent the routine BCG induction treatment and follow - up cystoscopies with cytology . Random biopsies of the bladder were performed after BCG induction completion , as per standard of care . Patients continued follow up as per standard of care . Data was collected from medical records .

PCT / IL2023 / 0505 LO Methylation assay status ( positive or negative ) post - BCG , and changes in the methylation assay status before and after BCG were analyzed , in order to assess the ability to predict HG events after BCG induction treatment according to Kaplan - Meier method . Cox regression analysis was used to determine the relative risk of presenting a HG event according to the methylation assay status pre / post BCG . CUETO risk was calculated using an online calculator and the WHO 1973 , if grade by WHO 1973 was not reported , grade by 2004/2022 was used . Methylation markers SEQ ID NOS : 1-15 are detailed in Table 2 ( previously disclosed in WO 2017/006317 , assigned to the Applicant of the present invention ) .

Table 2 Methylation markers - SEQ Nucleic acid sequence ID NO .

GGCGCTGAA Description * TTTTTAGGGGTCTGCGCGCTCTCGCC Position 65676359 - 65676418 on TGGCTGCTGGGAAGGAGGGCTGGGA Chromosome 17 , KCNJ2 gene TCCAGGCGCGCCGACCGCTCAAGCG Position 21958446 - 21958585 on CTCCAGGTCCACCCGGCGGAGGGCA GAGAAAGCGCGACCGCGCGGCCCG CAGGGTTGCAAGAAGAAAACGAGT GTTATATAATGAGTCTCAGTGGTTG Chromosome 9 , CDKN2A gene CTCACAA TGCCAGGCGC GGCTGATACCAGAGAGGACCCGGA GCGCGAACCAGAGGTTCGACCTCCA G GGCAGCGCAG Position 336844 - 336903 on Chromosome 6 , IRF4 gene GGGGCGCCAAATGCCCACGTGTTGA Position 33319507 - 33319636 on TGAAACCAGTGAGATGGGAACAGG Chromosome 21 , Olig2 gene CGGCGGGAAACCAGACAGAGGAAG AGCTAGGGAGGAGACCCCAGCCCCG GATCCTGGGTCGCCAGGGTTTTCCG CGCGCAT TCTGAGAAGTGTCCTCCTCGCTCTCT TATAAAAACAGGACTTGTTGCCGAG GTCAGCGCG CGCATCGAGT ATCAGCGCGAACTATTCGTTTAGTG Position 166502151 – 1665022on Chromosome 6 , intergenic region Position 896902-897031 on GCCTTAAAACACCCTGGTTTCACCCT Chromosome 18 , ADCYAP1 gene CAGCTATTTTCAAGTTCCCGTGTGCC TGGCACTTTCTCCGTGCGAGAAGCA CCGGAGGGTGCGGACGCGCCACAGT CTG TGCTCTGCGCAGCGTGGAGGGCAAC GGGACTGGGAGGCGGCTTCTGCCGC CGGGCACTCGCTTCCAGGTGGCTTA CGAGGATTCAGACTGTGGGAACCGT GCGCTCTTCAGCTTGGTGGACCGCG PCT / IL2023 / 0505 Position 32747873 – 32748022 on Chromosome 5 , NPR3 gene TGGCGGCGGCGCGGGGCGCCAAGCC CGCGCAGAACTTTGCGGTGGCGCTT Position 27949195 – 27949264 on AGCGCCTCCTTTGCCCAGACCCTTCC Chromosome 6 , intergenic region CGCCTTTGCCGCGCCCAGA CGTAATCGCCGGTGTAACTCATGTT GGCTGGGGGGCCTCCCGGCGCGCGC GGAGAGGCTG GGGTGCGCCC CGATTCAGAGGGCCCCGGTCGGAGC TGTCGGAGATTGAGCGCGCGCGGTC CCGGGATCTC CGCGCGGCAGCCCTCCGTGCGCGCA GGCTCGGGTGCGTTGTTCGCGGGGG TGAATTGTGAAGAACCATCGCGGGG TCCTTCCTGCTGAGGCCGCGGACAC CGTGACCTCGCTGCTCTGGGTCTGC AGGGAAACGTAGGAA Position 27191603 – 27191672 on Chromosome 7 , HOXA9 gene Position 170170302 – 1701703on Chromosome 16 , intergenic region Position 30797737 – 30797876 on Chromosome 15 , intergenic region TGACCTTTAGGGGCTGTTACTCTCAG Position 7936767 - 7936866 on ACCAGGCCCAGCAGCACCCGGCGCA Chromosome 1 , intergenic region TTTACGTCGGATCTGACCCCTGCAA GCACCGGCGCGACCGCGCTAGCGG CAGGGCGCGGAGTAAGGATGCGGC AGTGGGGCGACCCCGCTGCGG AGAACTTCGTGGGCAGGTAAGCGCG Position 170077565 - 1700776on Chromosome 1 , DNM3 gene : 14 CTGCCTGCGCTCACTACGGGTTTTTT Position 1727592 – 1727661 on AGTTGGCGCCTTAATGTTTGTAACA Chromosome 2 , PXDN gene CTTTTAGAGCGCTTGCTCT GGCCGGGAAGCGCGGGGTGAGAAA Position 72919092 – 72919231 on GCGAGGTGGGTGGCGAGAGCGTGA GCGCCCCTCTGCTGACCCCGGGGAG CGTGGACTACGAGTTGGCGCCCAAG Chromosome 8 , MSC gene TCCAGAATCCGCGCGCACCGCGGTA AGCTGCGCCTTTTGAAA * The description refers to position on hg18 genomic build Urine samples were obtained from the subjects ( at least 10ml of urine from each subject ) and a methylation assay was carried out as described in WO 2017/006317 , as follows : PCT / IL2023 / 0505 LO First , each urine sample was processed using centrifugation in order to separate the cells ( both normal and cancerous , if present ) from the urine liquid and create a cell pellet . In particular , each urine sample container was mixed thoroughly such that the sample was homogenous . Next , 10-50ml urine were transferred to a 50ml centrifuge tube . For centrifugation the volume was adjusted with PBS 0.01M pH 7.4 . Centrifugation was carried out at 1000g for 10 min at room temperature ( 15-25 ° C ) . Following centrifugation the supernatant ( urine ) was discarded and the pellet ( cells ) was resuspended in the residual urine left in the tube . Following resuspension 40ml PBS 0.01M pH 7.4 were added to the tube and the pellet was mixed with the PBS by inverting the tube a few times to ensure efficient wash of the cells . Next , a second centrifugation was carried out at 1000g for 10 min at room temperature ( 15-25 ° C ) . The PBS was discarded and the pellet was resuspended in the remaining PBS in the tube . The entire pellet volume was then transferred to a 1.5ml microcentrifuge tube . The required volume for the DNA extraction step is ~ lμ004 . If the volume was in the range of 400- lμ005 , the entire volume was used in the DNA extraction step . If the volume was lμ005 , the tube was centrifuged at 1000g for 1 min and the supernatant was carefully discarded until reaching approximately 1μ004 . Next , DNA was extracted from the cell pellet using QIAamp blood mini kit ( QIAGEN , Hilden , Germany ) and subjected to digestion with the methylation - sensitive restriction endonuclease Hhal or HinP1I . The digestion reaction ( total volume 120 microliter ) included all of the extracted DNA ( not quantified ) and Hhal or HinP1I in a digestion buffer . The digestion was carried out at 37 ° C for 2 hours .

Next , quantitative Real - Time PCR was carried out on the digested DNA samples to amplify in each DNA sample the fifteen marker loci detailed in Table 2 above and a control locus as set forth in SEQ ID NO : 16. The control locus does not contain a recognition sequence of Hhal or HinP1I ( does not contain a nucleotide sequence recognized by any of these enzymes , whether methylated or not ) and remains intact upon digestion with these enzymes regardless of its methylation status . More specifically , each digested DNA sample was divided into eight ( 8 ) aliquots containing 10 microliters of the digested DNA . Seven aliquots were supplemented with primer pairs for amplification of two marker loci out of the fifteen and the control locus ( the control locus is to be amplified in every aliquot ) . The eighth aliquot was supplemented with a primer pair for amplification of one remaining marker locus and the control locus . Amplicons of between 75 to 225 bases were amplified , each containing one of the 16 loci PCT / IL2023 / 0505 LO along with 5 ' and 3 ' flanking sequences of 5-80 bases . Each amplification reaction ( total volume 25 microliter ) further contained dNTPs , Taq DNA polymerase and a reaction buffer . To enable detection of amplification products during amplification , fluorescently - labeled polynucleotide probes ( one for each locus ) were added to the reaction . Real - Time PCR reactions were carried out in an ABI 7500 FastDx instrument with the following PCR program : initial activation of the enzyme of 95 ° C for 10 minutes followed by 45 cycles of seconds at 95 ° C followed by 1 minute at 60 ° C . Following amplification , quantitative PCR plots showing the change of fluorescent signals from the probes as a function of cycle number were analyzed to calculate the quantification cycle ( Cq ) for each locus . Next , a ACq between the Cq of the control locus and the Cq of each marker locus was calculated and used in the following formula : ( Cq of control locus – Cq of marker locus ) It is to be understood that the calculation was performed for a marker locus and a control locus that were co - amplified in the same aliquot . The numerical value obtained for each marker locus with respect to the control locus represents a ratio between the signal intensities of the amplification products of the marker locus and the control locus , and reflects the methylation ratio between the marker locus and the control locus in the DNA sample . Next , a marker score was calculated for each marker locus , the score being the signal ratio normalized in respect to reference ratios such that the highest signal ratio is scored " 100 " and the lowest signal ratio is scored " 0 " . Altogether , fifteen ( 15 ) marker scores were calculated for each DNA sample . The fifteen individual marker scores obtained for each DNA sample were combined into a single sample score , termed " EpiScore " , which is a number between 0 and 100 , reflecting the overall relative methylation level of the DNA sample at the panel of fifteen marker loci . A threshold score was set , above which the DNA sample was classified as Positive . An EpiScore below the threshold classified the DNA sample as Negative .

Results Clinical outcomes : Twenty - one ( 32.8 % ) patients had at least 1 bladder cancer event , 13 ( 20.3 % ) of them had one or more HG events . Eight ( 12.5 % ) patients were refractory to BCG ( " refractory " defined as HG recurrence ≤ 12mo from last BCG instillation ) , 12 ( 18.8 % ) had a relapse after BCG , of which nine ( 14.1 % ) were LG and three ( 4.7 % ) were HG ( " LG PCT / IL2023 / 0505 LO relapse " defined as LG recurrence at any time during the follow - up period , " HG relapse " defined as HG recurrence > 12mo from BCG induction completion ) , and six ( 9.4 % ) patients had a progression , including extra - bladder progression and bladder cancer death ( three ( 4.7 % ) patients died due to bladder cancer during the study period ) .

Methylation assay performance : Twenty - two patients had a positive methylation assay result after BCG induction . Patients with a positive methylation assay result after BCG induction had 3.3 times higher risk of relapse ( either LG or HG ) , and 14.4 times higher risk of a HG event ( BCG refractory , HG relapse and / or progression ) during follow up compared to patients with a negative methylation assay result post - BCG ( p = 0.012 and p < 0.001 , respectively ) ( Figures 1A , 1C ) . When comparing methylation assay status pre- and post - BCG , the results have shown that patients who maintained a positive methylation assay result before and after BCG had higher probability of being refractory . Patients who changed their methylation assay status from negative pre - BCG to positive post - BCG had higher probability of either LG recurrences and / or late HG events ( HG recurrence or progression ) . Patients who changed their methylation assay status from positive pre - BCG to negative post - BCG had no events ( Figures 1B , 1D , 2A - 2B ) . The methylation assay result post - BCG predicted 85 % of the HG events through the entire period of the study . In addition , out of the 43 subjects who had no bladder cancer event ( HG / LG / progression / bladder cancer death ) , 35 had a negative methylation assay result post - BCG . Thus , 81.4 % of those without an event through the entire period of the study were correctly identified by the methylation assay of the present invention . The methylation assay result post - BCG had 97.6 % negative predictive value ( NPV ) for HG events at 12 months , and 95.2 % NPV for HG events through the entire period of the study . CUETO risk was available for 60 ( 93.8 % ) patients , of which 5 experienced a progression . A positive methylation assay post - BCG was strongly prognostic for progression , and performed better than CUETO ( Figure 3 ) . To conclude , the methylation assay disclosed herein was shown to be a strong prognosticator for immediate and long - term HG events after BCG induction treatment , with very high negative predictive values . The methylation assay could therefore be useful for stratifying patients for further therapies and inclusion in clinical trials .

PCT / IL2023 / 0505 Example 2 - Methylation markers SEQ ID NOS : 1-15 predict progression to HG in LG bladder cancer patients The study analyzed urine samples of non - muscle - invasive bladder cancer ( NMIBC ) patients coming for TURBT . The urine samples were collected prior to the resection of the tumor , and a methylation assay was carried out as described in Example 1. The patients were followed up for a median of 36 ( 0-54 ) months . All patients were treated and followed - up according to the standard of care . A total of 241 patients were enrolled , of which 4 were re - TURBT and were not included in the present analysis . Of the 237 patients , 109 patients had LG or PUNLMP without concomitant CIS , and of those 105 had a valid methylation assay result . The results of their analysis were as follows : subjects with LG tumors and a positive methylation assay result - 8 ( 22.9 % ) had a HG recurrence within median time of 7 ( 3.7-24.5 ) months . subjects with LG tumors and a negative methylation assay result- 1 ( 1.4 % ) had a HG recurrence after 8 months , the rest were without HG recurrence with median follow - up of 39 ( 0-54 ) months . This study shows that LG with a positive methylation assay result is probably epigenetically different to LG with a negative methylation assay result , and the methylation assay can differentiate between patients with high risk and those with very low risk of HG recurrence over long time . Thus , the test provides prognostic value for the long term and can aid in the selection of treatment for LG patients .

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can , by applying current knowledge , readily modify and / or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept , and therefore , such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments . It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation . The means , materials , and steps for carrying out various disclosed chemical structures and functions may take a variety of alternative forms without departing from the invention .

Claims

PCT / IL2023 / 0505 CLAIMS

1. A method for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; and ( c ) stratifying the subject as high risk of developing a HG event when the calculated score is above a predefined threshold , and stratifying the subject as low risk of developing a HG event when the calculated score is below the predefined threshold .

2. The method of claim 1 , further comprising performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment . wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event .

3. A method for managing a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of developing a HG event when the calculated score is above a predefined threshold , and stratifying the subject as low risk of PCT / IL2023 / 0505 LO developing a HG event when the calculated score is below the predefined threshold ; and ( d ) adjusting the treatment and / or monitoring of the subject based on the stratification , wherein a subject stratified as high risk of a HG event is provided a more aggressive bladder cancer treatment and / or a more intense monitoring than a subject stratified as low risk of a HG event .

4. The method of claim 3 , wherein adjusting the treatment in step ( d ) comprises administering a high - risk or a very high - risk bladder cancer treatment protocol to a subject stratified as high risk of developing a HG event .

5. The method of claim 4 , wherein administering a high - risk or a very high - risk bladder cancer treatment protocol comprises administering one or more of : a second BCG induction treatment course , BCG maintenance treatment with duration and cycles according to high - risk or very high - risk standard of care , mitomycin - C ( MMC ) hyperthermia , an intravesical chemotherapy selected from valrubicin , gemcitabine , docetaxel , paclitaxel and a combination thereof using a treatment schedule and doses according to high - risk or very high - risk standard of care , intravesical nadofaragene firadenovec , systemic immunotherapy , systemic chemotherapy , radiation therapy , experimental drug or therapy , and cystectomy .

6. The method of claim 3 , wherein adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate - risk bladder cancer treatment protocol to a subject stratified as low risk of developing a HG event .

7. The method of claim 6 , wherein administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of : BCG maintenance treatment and intravesical chemotherapy using a treatment schedule and doses according to low - risk or an intermediate - risk standard of care .

8. The method of any one of claims 3-5 , wherein adjusting the monitoring in step ( d ) of a subject stratified as high risk of a HG event comprises at least one of : performing surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology combined PCT / IL2023 / 0505 with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy .

9. The method of claim 3 , further comprising performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein adjusting the treatment in step ( d ) comprises obviating BCG maintenance treatment and administering a bladder cancer treatment other than BCG to the subject stratified as likely to be refractory to BCG .

10. The method of claim 3 , further comprising performing steps ( a ) and ( b ) on DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and stratifying the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event , and wherein adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate - risk bladder cancer treatment protocol to a subject stratified as low risk of developing a HG event .

11. The method of claim 10 , wherein administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of : BCG maintenance treatment and intravesical chemotherapy using a treatment schedule and doses according to low - risk or intermediate - risk standard of care .

12. A method for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high- grade ( HG ) recurrence , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to the tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 ; PCT / IL2023 / 0505 ( b ) calculating a score for the subject based on the methylation value ; and ( c ) stratifying the subject as high risk of HG recurrence when the calculated score is above a predefined threshold , and stratifying the subject as low risk of HG recurrence when the calculated score is below the predefined threshold .

13. A method for managing a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to the tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 ; ( b ) calculating a score for the subject based on the methylation value ; ( c ) stratifying the subject as high risk of HG recurrence when the calculated score is above a predefined threshold , and stratifying the subject as low risk of HG recurrence when the calculated score is below the predefined threshold ; and ( d ) adjusting the treatment and / or monitoring of the subject based on the stratification , wherein a subject stratified as high risk of HG recurrence is provided a more aggressive bladder cancer treatment and / or a more intense monitoring than a subject stratified as low risk of HG recurrence .

14. The method of claim 13 , wherein adjusting the treatment in step ( d ) comprises administering a high - risk or a very high - risk bladder cancer treatment protocol to a subject stratified as high risk of HG recurrence .

15. The method of claim 14 , wherein administering a high - risk or a very high - risk bladder cancer treatment protocol comprises administering one or more of : intravesical BCG using a treatment schedule and doses according to high or very high risk standard of care , intravesical chemotherapy using a treatment schedule and doses according to high or very high risk standard of care , intravesical nadofaragene firadenovec , systemic immunotherapy , systemic chemotherapy , radiation therapy , experimental drug or therapy , and cystectomy .

16. The method of any one of claims 13-14 , wherein adjusting the monitoring in step ( d ) of a subject stratified as high risk of HG recurrence comprises at least one of : performing surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology PCT / IL2023 / 0505 10 combined with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy .

17. The method of claim 13 , wherein adjusting the treatment in step ( d ) comprises obviating intravesical instillations of BCG or chemotherapy in a subject stratified as low risk of HG recurrence .

18. The method of claim 13 , wherein adjusting the treatment in step ( d ) comprises administering a low - risk or an intermediate risk bladder cancer treatment protocol to a subject stratified as low risk of HG recurrence .

19. The method of claim 18 , wherein administering a low - risk or an intermediate - risk bladder cancer treatment protocol comprises administering one or more of :, intravesical BCG using a treatment schedule and doses according to low - risk or an intermediate risk standard of care , and intravesical chemotherapy using a treatment schedule and doses according to low - risk or an intermediate risk standard of care .

20. The method of claim 13 , wherein adjusting the monitoring in step ( d ) of a subject stratified as low risk of HG recurrence comprises performing surveillance cystoscopy and / or cytology according to a low - risk or an intermediate - risk surveillance schedule , and performing fulguration if recurrence is detected .

21. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject and administering a Bacillus Calmette - niréuG ( BCG ) induction treatment ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value , wherein a score above a predefined threshold identifies the subject as being at high risk of developing a high - grade ( HG ) event ; and ( c ) administering a high - risk or a very high - risk bladder cancer treatment protocol to the subject identified as being at high risk of developing a high - grade ( HG ) event . PCT / IL2023 / 0505

22. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject and administering a Bacillus Calmette - niréuG ( BCG ) induction treatment ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value , wherein a score below a predefined threshold identifies the subject as being at low risk of developing a high - grade ( HG ) event ; and ( c ) administering a low - risk or an intermediate - risk bladder cancer treatment protocol to the subject identified as being at low risk of developing a high - grade ( HG ) event .

23. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a first methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a first score for the subject based on the methylation value ; ( c ) administering a Bacillus Calmette - niréuG ( BCG ) induction treatment to the subject ; ( d ) determining in DNA from cells of a urine sample collected from the subject following ( c ) a second methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a second score for the subject based on the methylation value ; ( e ) comparing the first and second scores to a predefined threshold , wherein both a first and second score above the predefined threshold identifies the subject as likely to be refractory to BCG ; and ( f ) obviating BCG maintenance treatment and administering a bladder cancer treatment other than BCG to the subject identified as likely to be refractory to BCG .

24. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : PCT / IL2023 / 0505 ( a ) performing transurethral resection of bladder tumor ( TURBT ) on the subject ; ( b ) determining in DNA from cells of a urine sample collected from the subject following ( a ) a first methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a first score for the subject based on the methylation value ; ( c ) administering a Bacillus Calmette - niréuG ( BCG ) induction treatment to the subject ; ( d ) determining in DNA from cells of a urine sample collected from the subject following ( c ) a second methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a second score for the subject based on the methylation value ; ( d ) comparing the first and second scores to a predefined threshold , wherein a first score above the predefined threshold and a second score below the predefined threshold identifies the subject as being at low risk of developing a HG event ; and ( e ) administering a low - risk or an intermediate - risk bladder cancer treatment protocol to the subject identified as being at low risk of developing a HG event .

25. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score above a predefined threshold identifies the subject as being at high risk of high - grade ( HG ) recurrence ; and ( c ) administering a high - risk anti - bladder cancer treatment protocol to the subject identified as being at high risk of HG recurrence and / or monitoring said subject by performing at least one of : surveillance cystoscopy and / or cytology according to high - risk or a very high - risk surveillance schedule , performing surveillance cystoscopy and / or cytology combined with at least one additional surveillance method , and performing enhanced cystoscopy instead of white light cystoscopy . PCT / IL2023 / 0505

26. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and ( c ) obviating intravesical instillations of BCG or chemotherapy in the subject .

27. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and ( c ) administering a low - risk or an intermediate risk bladder cancer treatment protocol to the subject .

28. A method for treating a subject with non - muscle - invasive bladder cancer ( NMIBC ) , the method comprising : ( a ) determining in DNA from cells of a urine sample collected from the subject prior to tumor resection a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 , and calculating a score for the subject based on the methylation value ; ( b ) performing transurethral resection of bladder tumor ( TURBT ) on the subject , and characterizing the type , stage and grade of the tumor , LO PCT / IL2023 / 0505 wherein a low - grade ( LG ) tumor and a score below a predefined threshold identifies the subject as being at low risk of high - grade ( HG ) recurrence ; and ( c ) performing surveillance cystoscopy and / or cytology according to low - risk or intermediate - risk surveillance schedule , and performing fulguration if recurrence is detected .

29. The method of any one of claims 1-28 , wherein the at least one marker locus comprises a plurality of marker loci selected from the group consisting of SEQ ID NOS : 1-15 .

30. The method of any one of claims 1-28 , wherein the at least one marker locus comprises the locus set forth in SEQ ID NO : 1 .

31. The method of claim 30 , wherein the at least one marker locus further comprises the locus set forth in SEQ ID NO : 5 .

32. The method of claim 31 , wherein the at least one marker locus further comprises the locus set forth in SEQ ID NO : 7 and the locus set forth in SEQ ID NO : 11 .

33. The method of claim 32 , wherein the at least one marker locus further comprises at least one additional marker locus selected from the group of loci set forth in SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15 .

34. The method of claim 33 , wherein the at least one additional restriction locus comprises the loci set forth in SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 6 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 and SEQ ID NO : 15 .

35. The method of any one of the preceding claims , wherein the methylation value is determined using one or more analysis methods selected from the group consisting of DNA sequencing , real - time PCR , and array hybridization .

36. The method of any one of the preceding claims , wherein determining the methylation value comprises , for a plurality of potential methylation sites in a plurality of marker PCT / IL2023 / 0505 LO loci , quantifying methylated read counts at the potential methylation sites and calculating a methylation value based on the number of methylated read counts .

37. The method of any one of claims 1-36 , wherein determining a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 and calculating a score comprise : ( i ) subjecting the DNA from the cells of the urine sample of the subject to digestion with at least one methylation - sensitive restriction endonuclease recognizing a sequence within the at least one marker locus that is hypermethylated in cancer DNA compared to non - cancer DNA , to obtain restriction endonuclease - treated DNA ; ( ii ) co - amplifying from the restriction endonuclease - treated DNA the at least one marker locus and a control locus , thereby generating an amplification product for each locus ; ( iii ) determining a signal intensity for each generated amplification product ; and ( iv ) comparing a ratio between the signal intensities of the amplification products of each of said at least one marker locus and the control locus to at least one reference ratio selected from cancer reference ratio and non - cancer reference ratio , to calculate a score .

38. The method of claim 37 , wherein step ( i ) is performed using a single methylation- sensitive restriction endonuclease .

39. The method of claim 38 , wherein the methylation - sensitive restriction endonuclease is selected from Hhal and HinP1I .

40. The method of claim 39 , wherein the control locus is the control locus is the locus set forth in SEQ ID NO : 16 .

41. The method of any one of claims 37-40 , wherein step ( ii ) is performed using real - time PCR .

42. A system for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the system comprising a computer software stored on a non - transitory computer PCT / IL2023 / 0505 readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( i ) receiving a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOS : 1-15 determined in DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment ; ( ii ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( iii ) outputting a stratification of the subject , wherein the subject is stratified as high risk of developing a HG event when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of developing a HG event when the calculated score is below the predefined threshold .

43. The system of claim 42 , wherein the computer software further comprises instructions that when executed configure or direct the computer processor to perform steps ( i ) and ( ii ) for DNA from cells of a urine sample collected from the subject prior to the BCG induction treatment , and outputting a stratification of the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event .

44. A system for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high- grade ( HG ) recurrence , the system comprising a computer software stored on a non- transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( i ) receiving a methylation value for at least one marker locus selected from the group consisting of SEQ ID NOs : 1-15 determined in DNA from cells of a urine sample collected from the subject prior to the tumor resection ; ( ii ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and PCT / IL2023 / 0505 ( iii ) outputting a stratification of the subject , wherein the subject is stratified as high risk of HG recurrence when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of HG recurrence when the calculated score is below the predefined threshold .

45. The system of any one of claims 42-44 , wherein the computer software further comprises instructions that when executed configure or direct the computer processor to determine the methylation value of the at least one marker locus based on data from a methylation assay .

46. A system for stratifying a subject with non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection and has received a Bacillus Calmette - niréuG ( BCG ) induction treatment as high risk or low risk of developing a high - grade ( HG ) event , the system comprising : ( i ) DNA from cells of a urine sample collected from the subject after completion of the BCG induction treatment ; ( ii ) components for carrying out a methylation assay on at least one marker locus selected from the group consisting of SEQ ID NO : 1-15 in the DNA of ( i ) ; and ( iii ) computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( a ) determining a methylation value for the at least one marker locus based on data from the methylation assay ; ( b ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( c ) outputting a stratification of the subject , wherein the subject is stratified as high risk of developing a HG event when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of developing a HG event when the calculated score is below the predefined threshold .

47. The system of claim 46 , wherein the computer software further comprises instructions that when executed configure or direct the computer processor to perform steps ( i ) and ( ii ) for DNA from cells of a urine sample collected from the subject prior to the BCG PCT / IL2023 / 0505 induction treatment , and outputting a stratification of the subject based on the calculated scores before and after the BCG induction treatment , wherein a score above the predefined threshold both before and after the BCG induction treatment stratifies the subject as likely to be refractory to BCG , and wherein a score above the predefined threshold before the BCG induction treatment and a score below the predefined threshold after the BCG induction treatment stratifies the subject as low risk of developing a HG event .

48. A system for stratifying a subject with low - grade ( LG ) non - muscle - invasive bladder cancer ( NMIBC ) that has undergone tumor resection as high risk or low risk of high- grade ( HG ) recurrence , the system comprising : ( i ) DNA from cells of a urine sample collected from the subject prior to the tumor resection ; ( ii ) components for carrying out a methylation assay on at least one marker locus selected from the group consisting of SEQ ID NO : 1-15 in the DNA of ( i ) ; and ( iii ) computer software stored on a non - transitory computer readable medium comprising instructions that when executed configure or direct a computer processor to perform the following steps : ( a ) determining a methylation value for the at least one marker locus based on data from the methylation assay ; ( b ) calculating a score based on the methylation value and comparing the calculated score to a predefined threshold ; and ( c ) outputting a stratification of the subject , wherein the subject is stratified as high risk of HG recurrence when the calculated score is above the predefined threshold , and wherein the subject is stratified as low risk of HG recurrence when the calculated score is below the predefined threshold .