IL323014A - Compositions and methods of use thereof - Google Patents

Description

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 COMPOSITIONS AND METHODS OF USE THEREOF id="p-1" id="p-1" id="p-1" id="p-1"

[0001]This application claims priority to U.S. Provisional Patent Application No. 63/448,753 filed on February 28. 2023, and U.S. Provisional Patent Application No. 63/604,415 filed on November 30, 2023, the entire contents of each of which are incorporated herein by reference in their entireties. [0002]All patents, patent applications and publications cited herein are hereby incorporated by reference in their entirety. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. [0003]This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure as it appears in the U.S. Patent and Trademark Office patent file or records, but otherwise reserves any and all copyright rights.

GOVERNMENT INTERESTS id="p-4" id="p-4" id="p-4" id="p-4"

[0004]This invention was made with government support under R01 DK136685 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION id="p-5" id="p-5" id="p-5" id="p-5"

[0005]The present invention relates to compositions and methods of treating disease.

BACKGROUND OF THE INVENTION id="p-6" id="p-6" id="p-6" id="p-6"

[0006]Affecting one third of the global population, with no pharmacotherapy available, nonalcoholic fatty liver disease (NAFUD) has become the leading cause of chronic liver disease. Surprisingly, the major cause of death in patients with NAFUD, particularly in those with the more severe nonalcoholic steatohepatitis (NASH), is atherosclerotic cardiovascular disease (CVD). Thus, there is a critical need to identify targetable pathways for concurrent Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 treatment of NASH and atherosclerotic CVD, which has been hampered by limited understanding of the pathophysiology and metabolic pathways linking these two diseases.

SUMMARY OF THE INVENTION Formula (1) or a pharmaceutically acceptable salt, prodrug, hydrate, or solvate thereof, wherein: Ri is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, -N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, ،Bu, -(CH2)nCH3, -(CH2) ־ ״ Pr, -(CH2)״،Bu, -(CH2)nOR4, -(CH2)״N(R4)(R5), -(CH2)״COOR4, -(CH2)״CON(R4)(R5), -(CH2)״SR4, - (CH2)״CN, -(CH2)״-C1, -CH=CH-(CH2)״-CH3, -CH=CH-(CH2)nTr, -CH=CH-(CH2)״fBu, - CH=C-(CH2)״OR4. -CH=CH-(CH2)״N(R4)(R5), -CH=CH-(CH2)״COOR4, -ch=ch- (CH2)״CON(R4)(R5). -CH=CH-(CH2)״SR4, -CH=CH-(CH2)״CN, -CH=CH-(CH2)״-C1, -c=c- (CH2)״-CH3, -C=C-(CH2)״׳Pr, -C=C-(CH2)״،Bu. -C=C-(CH2)״OR4, -C=C-(CH2)״N(R4)(R5), - C=C-(CH2)״COOR4. -C=C-(CH2)״CON(R4)(R5). -C=C-(CH2)״SR4. -C=C-(CH2)״CN, or - C=C-(CH2)n-Cl; R2 is a hydrogen. -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, -N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5). -COOH, -COOR4, 'Pr, ،Bu. -(CH2)״CH3, -(CH2)n'Pr. -(CH2)״،Bu, -(CH2)nOR4. -(CH2)nN(R4)(R5), -(CH2)״COOR4, -(CH2)״CON(R4)(R5), -(CH2)nSR4, -(CH2)״CN, -(CH2)״-C1, -CH=CH-(CH2)״-CH3. -CH=CH-(CH2)n'Pr. -CH=CH- (CH2)״،Bu, -CH=C-(CH2)״OR4, -CH=CH-(CH2)nN(R4)(R5), -CH=CH-(CH2)״COOR4. - CH=CH-(CH2)״CON(R4)(R5), -CH=CH-(CH2)nSR4, -CH=CH-(CH2)״CN. -CH=CH-(CH2)n- Cl, -C=C-(CH2)״-CH3. -C=C-(CH2)״׳Pr. -C=C-(CH2)״׳Bu. -C=C-(CH2)״OR4. -C=C- id="p-7" id="p-7" id="p-7" id="p-7"

[0007] Aspects of the invention are drawn towards A compound of Formula (1): Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 (CH2)nN(R4)(R5), -C=C-(CH2)nCOOR4, -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)nSR4, -C=C- (CH2)nCN, or -C=C-(CH2)n-Cl; n is 0-10; R3 is -COOH, -COOR6, or -NO2; R4 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; R5 is hydrogen, acyclic alkyl, C1-C9 alkyd, or aryl; R6 is - CH3 or -CH2CH3; A-B is -CO- or -(CHOH)- and X-Y is -CH2-CH2- or -CH=CH-. In embodiments the halogen is fluorine, chlorine, bromine, or iodine. In embodiments, X-Y is ^0=0 ^CH-OHCH2-CH2 or CH=CH; A-B is or ; R3 is -COOH or -NO2. In embodiments, the compound is a salicylic acid derivative of Formula (II); wherein X-Y is CH2-CH2 or CH=CH; and A-B is "’יי׳ or *1יי׳ In embodiments, the compound is: FAB-548 Formula (II) FAB-544 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-570 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-594A In embodiments, the compound is: id="p-8" id="p-8" id="p-8" id="p-8"

[0008]Aspects of the invention are drawn towards a pharmaceutical composition comprising a compound described herein, or a combination thereof, and a pharmaceutically acceptable carrier, excipient, or diluent. [0009]Aspects of the invention are drawn towards a method of treating a subject afflicted with an oxalate production-related disease the method comprising: measuring the circulating -6- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 oxalate levels of a subject; and administering to the subject a therapeutically effective amount of a compound selected from the group consisting of: Formula (I), In embodiments, Ri is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, -N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, Bu, -(CH2)nCH3, Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 -(CH2)nTr, -(CH2)״،Bu, -(CH2)nOR4, ־(CH2)nN(R4)(R5), -(CH2)״COOR4, -(CH2)״CON(R4)(R5), -(CH2)nSR4, -(CH2)״CN, -(CH2)״-C1, -CH=CH-(CH2)״-CH3, -CH=CH-(CH2)nTr, -CH=CH- (CH2)״،Bu, -CH=C-(CH2)״OR4, -CH=CH-(CH2)nN(R4)(R5), -CH=CH-(CH2)״COOR4, - CH=CH-(CH2)״CON(R4)(R5), -CH=CH-(CH2)״SR4, -CH=CH-(CH2)״CN, -CH=CH-(CH2)n- Cl, -C=C-(CH2)״-CH3, -C=C-(CH2)״،Pr, -C=C-(CH2)״،Bu, -C=C-(CH2)״OR4, -C=C- (CH2)״N(R4)(R5), -C=C-(CH2)״COOR4, -C=C-(CH2)״CON(R4)(R5), -C=C-(CH2)״SR4, -c=c- (CH2)nCN, or -C=C-(CH2)n-Cl. In embodiments, R2 is a hydrogen, -Ph, a furan, a thiophene, a pyndine. a halogen, -CF3, -CN, -N(R4)(R5), -OR4. -SR4. -CH2-NH-(CH2)n-N(R4)(R5). -COOH.

-COOR4. Tr, Bu -(CH2)״CH3, -(CH2)״׳Pr, ־(CH2)n،Bu, -(CH2)״OR4, -(CH2)nN(R4)(R5), - (CH2)״COOR4. -(CH2)״CON(R4)(R5), ־(CH2)nSR4, -(CH2)״CN. -(CH2)n-Cl, -CH=CH-(CH2)n־ CH3, -CH=CH-(CH2)״׳Pr, -CH=CH-(CH2)״fBu, -CH=C-(CH2)״OR4, -CH=CH- (CH2)״N(R4)(R5), -CH=CH-(CH2)״COOR4. -CH=CH-(CH2)״CON(R4)(R5), -CH=CH- (CH2)״SR4, -CH=CH-(CH2)nCN, -CH=CH-(CH2)״-C1, -C=C-(CH2)״-CH3, -C=C-(CH2)״׳Pr. - C=C-(CH2)״،Bu, -C=C-(CH2)״OR4, -C=C-(CH2)״N(R4)(R5), -C=C-(CH2)nCOOR4, -C=C- (CH2)״CON(R4)(R5). -C=C-(CH2)״SR4, -C=C-(CH2)״CN, or -C=C-(CH2)״-C1. In embodiments, n is 0-10. In embodiments, R3 is -COOH, -COOR6, or -NO2. In embodiments, R4 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl. In embodiments, R5 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl. In embodiments, R6 is -CH3 or -CH2CH3. In embodiments, A-B is - CO- or -(CHOH)-; and X-Y is -CH2-CH2- or -CH=CH-. In embodiments, the halogen is fluorine, chlorine, bromine, or iodine. In embodiments,X-Y is CH2-CH2 or CH=CH; A-B is ^3=0 ^CH-OHorL ; R3 is -COOH or -NO2. In embodiments, the compound is a salicylic acid derivative of Formula (II): Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Formula (II) A A C=O CH-OHwherein X-Y is CH2-CH2 or CH=CH; and A-B is "*׳،«׳ or"h In embodiments, the compound is: ־ 9 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-570 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-594A In embodiments, the oxalate production-related disease comprises a cardiometabolic disease, a cardiovascular disease, a metabolic disease, a liver disease, a renal disease, or a combination thereof. In embodiments, the oxalate production-related disease comprises a GO-associated disease and/or an LDHA-associated disease. In embodiments, the cardiometabolic disease, cardiovascular disease, metabolic disease, liver disease, renal disease, or combination thereof, comprises heart failure, myocardial infarction, stroke, diabetes, dyslipidemia, hyperoxaluria, primary hyperoxaluria (PH), hypertension, obesity, hepatitis, cirrhosis, hepatocellular carcinoma, chronic kidney disease, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), atherosclerotic cardiovascular disease (ASCVD), or a combination thereof. In embodiments, the therapeutically effective amount of the composition inhibits GO activity, LDHA activity, or a combination thereof. In embodiments, the therapeutically effective amount comprises less than about 0.1 mg/kg, about 0.1 mg/kg, about 0.5 mg/kg, about 1.0 mg/kg, about 2.5 mg/kg, about 5 mg/kg, about 7.5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 70 mg/kg, about 80 mg/kg, about 90 mg/kg, about 100 mg/kg, about 120 mg/kg, about 135 mg/kg, about 150 mg/kg, about - 12- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 175 mg/kg, about 200 mg/kg, and greater than about 200 mg/kg. The method of claim 8, wherein measuring the circulating oxalate levels of a subject comprises an enzymatic assay, mass spectrometry, or a combination thereof. In embodiments, the subject ’s circulating oxalate level is at least about 1 uM, about 1 uM, about 1.5 uM, about 2 uM, about 2.5 uM, about 3 uM, about 4 uM, about 5 uM, about 6 uM, about 7 uM, about 8 uM, about 9 uM, about 10 uM, or greater than about 10 uM. id="p-10" id="p-10" id="p-10" id="p-10"

[0010]Other objects and advantages of this invention will become readily apparent from the ensuing description.

BRIEF DESCRIPTION OF THE FIGURES id="p-11" id="p-11" id="p-11" id="p-11"

[0011] FIG. 1shows non-limiting, exemplary experimental results. Suppressed AGXT and increased oxalate in livers from humans and mi ce with NASH and in lipid-loaded hepatocy les. Panel A) Plasma oxalate in patients with (n=29) and without NASH (non-NASH, n=33). Panel B) H&E and Picrosirius Red staining of liver samples from patients with NASH compared with disease-free and non-malignant liver samples (non-NASH). Panel C)Expression of AGXT relative to HPRT1 in liver samples from patients with (n=l 1) and w ithout (n=8) NASH. Panel D)Protein abundance and Panel E)quantification of AGXT relative to GAPDH in liver samples from patients with (n=8) and without (n=7) NASH. Panel F)Liver oxalate normalized to protein concentration in samples from patients with (n=8) and without (n=7) NASH. Panel G)Spearman ’s correlation between the relative abundance of AGXT protein and liver oxalate in samples from patients w ith (n=8) and without (n=7) NASH. Panel H)Liver samples w ere collected from C57BL/6J mice fed a standard chow diet (control) or a high-fat, high-fructose, high-cholesterol diet (NASH diet) for 6 months, and Panel 1) stained with H&E and Picrosirius Red. Panel J)Expression of Agxt relative to Gapdh in liver samples from mice with (n=l l) and without (n=7) NASH. Panel K)Protein abundance and Panel L)quantification of AGXT relative to 3-Actin in liver samples from mice with and without NASH (n=4). Panel M)Liver oxalate normalized to protein concentrations in samples from mice with (n=ll) and without (n=7) NASH. Panel N)Primary hepatocytes from mice fed a standard chow diet and HepGcells were treated with either BSA control or BSA-conjugated palmitic acid (200 pM) Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 overnight. Neutral lipids were visualized with Nile Red stain (red) and nuclei were labeled with DAPI (blue). Panel O)Expression of Agxt relative to Actb in primary mouse hepatocytes (n=3), and of AGXT relative to GAPDH in HepG2 cells (11=6). Intracellular oxalate normalized to protein concentrations in Panel P)primary mouse hepatocytes (n=3). and Panel Q)HepGcells (n=3). For primary hepatocytes, each point represents an individual mouse. For HepGcells, each point represents an independent experiment that included at least 2 biological repetitions. Data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (A, C. E, J, M, O-Q), Mann Whitney U test (Panel F), or Spearman ’s correlation (Panel G). All individual points and p values are shown. A p-value <0.05 was considered statistically significant. Scale bars = 200 pm id="p-12" id="p-12" id="p-12" id="p-12"

[0012] FIG. 2shows non-limiting. exemplary experimental results. Oxalate reduction via AGXT overexpression ameliorates NASH. Panel A) Mice were injected with AAV8-GFP or AAV8-AGXT (2xl0״ viral genomes per mouse) and placed on the NASH diet for 6 months prior to tissue and plasma analysis. Panel B)Protein abundance of AGXT relative to p־Actin in liver samples from mice treated with AAV8-GFP or AAV-AGXT (n=4). Panel C)Liver oxalate normalized to protein concentrations in samples from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel D)Liver-to-body weight ratios in mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel E)Plasma samples were analyzed for aspartate transaminase (AST), and Panel F)alanine transaminase (ALT) in mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel G)Representative gross appearance of the abdominal cavity from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel H) Representative gross appearance of the livers from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Liver samples were collected, Panel 1)stained with H&E, and Panel J) scored for steatosis, lobular inflammation, hepatocellular ballooning, and NAS. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels D. E, F, J), or Mann Whitney U test (Panels C, J Lobular inflammation). Individual points and p- values are shown. A p-value <0.05 was considered statistically significant. Scale bars = 2pm. [0013[ FIG. 3shows non-limiting. exemplary experimental results. Oxalate reduction via AGXT overexpression lowers hepatic steatosis through induction of fatty acid P־oxidation pathways. Mice were injected with AAV8-GFP or AAV8-AGXT (2x1011 viral genomes per Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 mouse) and placed on the NASH diet for 6 months prior to tissue and plasma analysis. Panel A)Principal component analysis was performed based on RNA-sequencing of livers from mice treated with AAV8-GFP or AAV8-AGXT (n=4). Panel B)Volcano plots of differentially expressed genes (DEGs) based on RNA-sequencing comparing livers from mice treated with AAV8-GFP or AAV8-AGXT (downregulated, blue and upregulated, red). Panel C)Pathways enriched in the upregulated DEGs based on KEGG pathway analysis comparing livers from mice treated with AAV8-GFP or AAV8-AGXT. Panel D)Heatmap of DEGs related to fatty acid -oxidation (FAO) pathways comparing livers from mice treated with AAV8-GFP or AAV8-AGXT. Scale bar = log2fold change in AAV8-AGXT versus AAV-GFP). Panel E) qRT-PCR validation of selected FAO-related DEGs relative to Gapdh in livers from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel F)Liver samples were collected from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6) and stained with Oil Red O (ORO, red) and Harris Hematoxylin nuclear counterstain. Panel G)Percent-positive ORO area. Panel H)Liver triglycerides normalized to protein concentrations in livers from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels E, G, H)or Mann Whitney U test (Panel E).The significance of the enriched pathways (Panel C)was evaluated by right- tailed Fisher's exact test followed by Benjamini-Hochberg multiple testing adjustment. All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. Scale bar = 200 pm. id="p-14" id="p-14" id="p-14" id="p-14"

[0014] FIG. 4shows non-limiting, exemplary experimental results Oxalate induces lipid accumulation in hepatocytes through suppression of PPARa-regulated fatty acid P־ oxidation.Primary hepatocytes isolated from mice fed a standard chow diet (n=4) and HepGcells (n=4) were treated with or without oxalate (250 pM, primary mouse hepatocytes: 500 pM, HepG2 cells). Panel A)Neutral lipids were visualized with Nile Red stain (red) and nuclei were labeled with DAPL Panel B) Intensity of Nile Red staining was normalized to number of nuclei (DAPI) and expressed as fold change. Panel C)Expression of fatty7 acid P־oxidation (FAO)-related genes relative to Actb in primary hepatocytes isolated from mice fed a standard chow diet and treated with or without oxalate overnight and expressed as fold change from control (without oxalate) (n=5). Panel D)Expression of FAO-related genes relative to GAPDH in HepG2 cells treated with or without oxalate overnight and expressed as fold change from Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 control (n=3). Panel E)Protein abundance and quantification of CPTla relative to GAPDH in HepG2 cells treated with and without oxalate overnight and expressed as fold change from control (without oxalate) (n=6). Panel F)PPARA gene expression relative to GAPDH in HepG2 cells treated with (red dots) or without (control, blue dots) oxalate and with (dashed line) or without (vehicle, solid line) actinomycin D (5 ug/mL) overnight and expressed as fold change from control (without oxalate or actinomycin Panel D)(n=4). Panel G)PPRE luciferase activity measured by luminescence relative to Renilla luminescence in HepG2 cells PPRE) transfected with PPREx3-TK-luciferase, human PPARa and Renilla constructs, and treated with vehicle (control), Wy 14,643 (25 uM), or oxalate for 24 hours (n=4). Panel H) Expression of CPTIA and ACADMrelative to GAPDPI in HepG2 cells treated with or without oxalate, Wy 14,643 (10 pM) or vehicle control (ethanol) overnight and expressed as fold change from control (without oxalate with ethanol) (n=5). Panel 1)Oxygen consumption rate (OCR) evaluated by Seahorse analysis in HepG2 cells treated with or without oxalate overnight. OCR was normalized to protein concentrations (n=5). Panel J)HepG2 cells were treated with or without oxalate overnight follow ed by Seahorse analysis of OCR in the absence or presence of etomoxir (n=6). Panel K)HepG2 cells were transfected with either GFP control (GFP) or GFP-tagged AGXT (AGXT) plasmids. Western blot analysis for AGXT protein abundance 48 h post-transfection. HepG2 cells were transfected with either GFP control (GFP) or GFP-tagged AGXT (AGXT) plasmids. After 24 h, the cells were treated with either BSA control or BSA-conjugated palmitic acid (200 pM) overnight followed by analysis of Panel L) intracellular oxalate normalized to protein concentrations (n=4), Panel M)neutral lipids visualized with Nile Red stain (red) with nuclei labeled with DAPI (blue) (n=3), N)expression of CPTIA and ACADM relative to GAPDH (n=4), Panel O)protein abundance of CPTla relative to GAPDH (n=5), and Panel P)OCR evaluated by Seahorse analysis and normalized to protein concentrations (n=3). For primary' hepatocytes, each point represents an individual mouse. For HepG2 cells, each point represents an independent experiment that included at least biological repetitions. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels B-E, L, N, O),two-way ANOVA with Bonferroni ’s multiple comparisons test (Panels F, H),or one-way ANOVA with Tukey ’s multiple comparisons test (G. J). Seahorse analysis and statistical comparisons for Panel I)and Panel P)are shown in Fig. 13 Panel Eand Fig. 14 Panel B,respectively. All individual points and Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 p values are shown. A p-value <0.05 was considered statistically significant. Scale bars = 2pm. [0015[ FIG. 5shows non-limiting, exemplary experimental results. Oxalate reduction via AGXT overexpression lowers hepatic inflammation and leukocyte infiltration in NASH. Mice were injected with AAV8-GFP or AAV8-AGXT (2xl0״ viral genomes per mouse) and placed on the NASH diet for 6 months prior to tissue and plasma analysis. Panel A)Pathways enriched in the downregulated DEGs based on KEGG pathway analysis comparing livers from mice treated with AAV8-GFP or AAV8-AGXT (n=4). Panel B)Heatmap of DEGs related to inflammatory pathways comparing livers from mice treated with AAV8-GFP or AAV8- AGXT. Scale bar = log2fold change in AAV8-AGXT versus AAV-GFP). Panel C)qRT-PCR validation of selected inflammation-related DEGs relative to Gapdh in livers from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel D)Liver samples were collected from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6) and stained with F4/80 (red) and DAPI (blue) to visualize nuclei. Panel E)Percent-positive F4/80 area. Panel F)HepG2 cells plated into the bottom chamber of a transwell and treated with or without oxalate (500 pM) overnight. Fluorescently-labeled human peripheral blood monocytes (hPBMs. green) were loaded into the top chamber of the transwell and allowed to pass through a membrane overnight. Panel G)Number of transmigrated hPBMs per well. Panel H)hPBMs were visualized (green) and shown with HepG2 cells (brightfield, inset) (n=4). All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels C, E, G)or Mann Whitney U test (Panel C).The significance of the enriched pathways (A) was evaluated by right-tailed Fisher ’s exact test followed by Benjamini-Hochberg multiple testing adjustment. All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. Scale bars = 200 pm. [0016[ FIG. 6shows non-limiting. exemplary experimental results. Oxalate reduction via AGXT overexpression lowers hepatic fibrosis in NASH. Mice were injected with AAV8-GFP or AAV8-AGXT (2x1011 viral genomes per mouse) and placed on the NASH diet for 6 months prior to tissue and plasma analysis. Panel A)Heatmap of DEGs related to fibrosis pathways comparing livers from mice treated with AAV8-GFP or AAV8-AGXT. Scale bar = log2fold change in AAV8-AGXT versus AAV-GFP (n=4). Panel B)qRT-PCR validation of selected fibrosis-related DEGs relative to Gapdh in livers from mice treated with AAV8-GFP (n=8) or Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 AAV8-AGXT (n=6). Panel C)Liver samples were collected from mice treated with AAV8- GFP (n=8) or AAV8-AGXT (n=6) and stained with Picrosirius Red (red). Panel D)Percent- positive Picrosirius Red area. Panel E)Liver sections from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6) were scored for fibrosis. Panel F)Hydroxyproline contents normalized to protein concentrations in liver samples from mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel G)Liver samples were collected from mice treated with AAV8- GFP (n=8) or AAV8-AGXT (n=6) and stained with a-SMA (red) and DAPI (blue). Panel H) Percent-positive a-SMA area. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels B, E, H)or Mann Whitney U test (Panels B, D).All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. Scale bars = 200 pm. [0017] FIG. 7shows non-limiting, exemplary experimental results. Pharmacological targeting of hepatic oxalate overproduction ameliorates established NASH. Panel A)Schema of glyoxylate/oxalate metabolism, chemical structure of MDMG-935P and its inhibitory effects (AGXT, alanine-glyoxylate aminotransferase; GO, glycolate oxidase; GPHPR, glyoxalate reductase/hydroxypryruvate reductase; HOGA1, 4-hydroxy-2-oxoglutarate aldolase; LDHA, lactate dehydrogenase). Panel B)Mice were fed the NASH diet for 3 months, then orally administered vehicle (n=7), 5 mg/kg/day (n=8) or 10 mg/kg/day (n=10) of MGMD-935P for an additional three months on the NASH diet prior to tissue and plasma analysis. Panel C) Liver oxalate normalized to protein concentrations in samples from mice administered vehicle, mg/kg/day or 10 mg/kg/day MDMG-935P. Panel D)Liver-to-body weight ratios. Panel E) Plasma samples were analyzed for aspartate transaminase (AST), and Panel F)alanine transaminase (ALT) in mice administered vehicle, 5 mg/kg/day or 10 mg/kg/day MDMG- 935P. Panel G)Representative gross appearance of abdominal cavities and livers. Liver samples were collected, Panel H)stained with H&E, and Panel 1)scored for steatosis, lobular inflammation, hepatocellular ballooning, and NAS. **p<0.01, ***p<0.001 vs. vehicle; ##p<0.01, ###p<0.001 vs. 5 mg/kg/day of MGMD-935P. Panel J)Liver triglycerides normalized to protein concentrations. Panel K)Liver samples were collected from mice treated with vehicle (n=7), 5 mg/kg/day MDMG-935P (n=8). or 10 mg/kg/day MDMG-935P (n=10), and FAO-related genes relative to Gapdh were assessed by qRT-PCR. All data are expressed as mean ± SEM. Statistical comparisons were made using One-way ANOVA with Tukey ’s multiple comparison ’s test (Panels C, D, E, F, I[steatosis, ballooning, and NAS]) or Kruskal- - 18 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Wallis with Dunn ’s multiple comparison ’ test (I [inflammation], A p-value <0.05 was considered statistically significant. Scale bars = 200 pm. [0018[ FIG. 8shows non-limiting, exemplary experimental results. Pharmacological targeting of hepatic oxalate overproduction reduces hepatic inflammation and fibrosis. Mice were fed the NASH diet for 3 months, then orally administered vehicle (n=7), 5 mg/kg/day (n=8) or 10 mg/kg/day (n=10) of MGMD-935P for an additional three months on the NASH diet prior to tissue and plasma analysis. Panel A)Liver samples were collected, and inflammation-related genes were assessed by qRT-PCR relative to Gapdh. Panel B)Liver samples were collected and stained with F4/80 (red) and DAPI (blue) to visualize nuclei. Panel C)Percent-positive F4/80 area. Panel D)Liver samples were collected from the treated mice and fibrosis-related genes were assessed by qRT-PCR relative to Gapdh. Panel E)Liver sections were stained with Picrosinus Red (red) and Panel F)quantified for percent-positive picrosirius red area. Panel G)Hydroxy proline contents normalized to protein concentration in liver samples from mice treated with vehicle, 5 mg/kg/day or 10 mg/kg/day MDMG-935P. Panel H)Liver sections were scored for fibrosis. Panel 1)Liver samples were collected and stained with a-smooth muscle actin (SMA) and DAPI (blue). Panel J)Percent-positive a-SMA area. Panel K)Schematic summary of the effects of oxalate on NASH, and inhibition of oxalate production by either AAV-AGXT overexpression or pharmacological targeting using MDMG- 935P. All data are expressed as mean ± SEM. Statistical comparisons were made using One- way ANOVA with Tukey ’s multiple comparisons (Panels A, C, D, F, G, H)tests or Kruskal- Wallis with Dunn ’s multiple comparisons test (Panel J).All individual points and p-values are shown. A p-value <0.05 w as considered statistically significant. Scale bars = 200 pm. id="p-19" id="p-19" id="p-19" id="p-19"

[0019] FIG. 9shows a schematic of demographics of patients with and without NASH. Panel A)Distribution of race, age, sex (M, male; F, female), and levels aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) in plasma samples from patients with (n=29) or without NASH (Non-NASH, n=33). Panel B) Distribution of race, age. and sex (M, male; F, female) among patients with (n=19) or without NASH (Non-NASH, n=9) that donated liver specimens. All data are expressed as mean ± SEM. Statistical comparisons were made using Fisher ’s exact test (A [Sex], B [Sex]), Mann Whitney U test (A [AST, ALT], B [Age]), Chi squared analysis (A [Race], B [Race]), unpaired t-test (A [Age]). A p-value <0.05 was considered statistically significant.- 19- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-20" id="p-20" id="p-20" id="p-20"

[0020] FIG. 10shows non-limiting, exemplary experimental results. Suppression of AGXT in mice with NASH, and correlation between hepatic oxalate and NASH severity. Liver samples were collected from Panel A)male and Panel B)female mice fed a standard chow diet (control) or the fructose-palmitate-cholesterol (FPC) diet for 4 months and stained with H&E and Picrosirius Red. Protein abundance and quantification of AGXT relative to GAPDH in livers from Panels C, D)males and Panels E, F)female mice with and without NASH (n=6). Each point represents an individual mouse. Panel G)Liver sections from mice without (n=7) or with NASH (n=l 1) induced by 6 months on a high-fat, high-fructose. high-cholesterol NASH diet were scored for steatosis, lobular inflammation, hepatocellular ballooning, and NAS, then correlated with individual hepatic oxalate concentrations. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels E, F),or Spearman ’s correlation (Panel G).A p-value <0.05 was considered statistically significant. id="p-21" id="p-21" id="p-21" id="p-21"

[0021] FIG. 11shows non-limiting, exemplary experimental results. Confirmation of hepatic-specific targeting by AAV8-TBG, body weight, liver weight and lipid peroxidation in mice overexpressing AGXT. Mice were injected with AAV8-GFP or AAV8-AGXT (2x10" viral genomes per mouse) and placed on the NASH diet for 6 months prior to tissue and plasma analysis. Panel A)Livers were sectioned and assessed by immunofluorescence of GFP (green) expression in hepatocytes (Argi, red) following injection of AAV8-GFP injection. Panel B) Kidney lysates from mice injected with AAV8-GFP (n=4) or AAV8-AGXT (n=4) were assessed for AGXT by Western blot. Equal protein loading was verified using GAPDH expression and Ponceau S. Panel C)Body weight, and Panel D)liver weight of mice treated with AAV8-GFP (n=8) or AAV8-AGXT (n=6). Panel E)Relative liver malondialdehyde (MDA) levels normalized to protein concentrations in samples from mice treated with AAV8- GFP (n=8) or AAV8-AGXT (n=6). All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (C-E). All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. Scale bar = 50 pm. id="p-22" id="p-22" id="p-22" id="p-22"

[0022] FIG. 12shows non-limiting, exemplary experimental results. Oxalate dose-response to mimic palmitic acid-induced oxalate accumulation. Panel A)Primary hepatocytes were isolated from mice fed a standard chow diet and treated with 0, 125, or 250 pM sodium oxalate (Oxalate) overnight. Intracellular oxalate was normalized to protein concentrations (n=5). Panel B)HepG2 cells were treated with 0, 125, 250, or 500 pM sodium oxalate (Oxalate) -20- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 overnight. Intracellular oxalate was normalized to protein concentrations. For primary hepatocytes, each point represents an individual mouse. For HepG2 cells, each point represents an independent experiment that included at least 2 biological repetitions. All data are expressed as mean ± SEM. Statistical comparisons were made using one-way ANOVA with Tukey's multiple comparisons test (Panel A)and Kruskal-Wallis test followed by Dunn ’s multiple comparisons test (Panel B).All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. id="p-23" id="p-23" id="p-23" id="p-23"

[0023] FIG. 13shows non-limiting, exemplary experimental results. Effects of oxalate on genes regulating lipid metabolism, bioenergetics and mitochondrial superoxide in hepatocytes. Primary hepatocytes isolated from mice fed a standard chow diet and HepG2 cells were treated with or without oxalate (250 pM, primary mouse hepatocytes: 500 pM, HepG2 cells). Expression of genes regulating fatty acid uptake/transport in Panel A)mouse primary hepatocytes relative to Actb (n=5), and Panel B)in HepG2 cells relative to GAPDH (n=4). Expression of genes regulating fatty acid and lipid biosynthesis in Panel C)mouse primary hepatocytes relative to Actb (n=5), and Panel D)in HepG2 cells relative to GAPDH (n=3). Panel E)Seahorse analysis of non-mitochondrial consumption, basal respiration, maximal respiration, proton leak, and ATP production in HepG2 cells treated with oxalate (500 pM) and expressed as fold change from control cells (n=5). Panel F)Mitochondrial superoxide was visualized with MitoSOX (red) and nuclei were labeled with Hoechst (blue) in HepG2 cells treated with or without oxalate (500 pM). Panel G)Intensity of MitoSOX was normalized to number of nuclei (Hoechst) and expressed as fold change from control (n=3). For primary hepatocytes, each point represents an individual mouse. For HepG2 cells, each point represents an independent experiment that included at least 2 biological repetitions. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels A-E, G).All individual points and p-values are shown. A p-value <0.05 was considered statistically significant. Scale bar = 200 pm. id="p-24" id="p-24" id="p-24" id="p-24"

[0024] FIG. 14shows non-limiting, exemplary experimental results. AGXT overexpression lowers palmitic acid-induced lipid accumulation and mitochondrial superoxide formation while improving mitochondrial respiration. HepG2 cells were transfected with either GFP control (GFP) or GFP-tagged AGXT (AGXT) plasmids. After 24 h, the cells were treated with either BSAcontrol or BSA-conjugated palmitic acid (200 pM)overnight. Panel A)Neutral -21 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 lipids were visualized with Nile Red stain and nuclei were labeled with DAPI. Intensity of Nile Red staining was normalized to number of nuclei (DAPI) and expressed as fold change from GFP control (n=3). Panel B)Seahorse analysis of non-mitochondrial consumption, basal respiration, maximal respiration, proton leak, and ATP production expressed as fold change from GFP control (n=3). Panel C)Mitochondrial superoxide was visualized with MitoSOX (red) and nuclei were labeled with Hoechst (blue). Panel D)Intensity of MitoSOX was normalized to number of nuclei (Hoechst) and expressed as fold change from GFP control (n=3). Each point represents an independent experiment that included at least 2 biological repetitions. All data are expressed as mean ± SEM. Statistical comparisons were made using unpaired t-test (Panels A, B, D).All individual points and p-values are shown. A p-value <0.was considered statistically significant. Scale bar = 200 pm. [0025[ FIG. 15shows non-limiting, exemplary experimental results. Pharmacological low ering of oxalate in vivo and in vitro. Mice were fed the NASH diet for 3 months, then orally administered vehicle (n=7), 5 mg/kg/day (n=8) or lOmg/kg/day (n=10) of MGMD-935P for an additional three months on the NASH diet prior to tissue and plasma analysis. Panel A)Body weight, and Panel B)liver weight at endpoint. Panel C)HepG2 cells were treated with either BSA control or BSA-conjugated palmitic acid (200 pM) for 12 h. The next day, cells were treated with increasing doses of MDMG-935P or vehicle control (DMSO) for 12 h followed by analysis of intracellular oxalate normalized to protein concentrations (n=4). Panel D) HepG2 cells were treated with either BSA control or BSA-conjugated palmitic acid (200 pM) for 12 h. The next day, cells were treated with either MDMG-935P (50 pM) or vehicle control (DMSO) for 12 h followed by analysis of neutral lipids visualized with Nile Red stain and nuclei labeled with DAPI. Panel E)Intensity of Nile Red staining was normalized to number of nuclei (DAPI) and expressed as fold change from DMSO (n=4). Each point represents an individual mouse or an independent expenment in HepG2 cells that included at least biological repetitions (Panels C-E).All data are expressed as mean ± SEM. Statistical comparisons were made using One-way ANOVA with Tukey multiple comparisons test (Panels A, B),Kruskal-Wallis test followed by Dunn ’s multiple comparisons test (Panel C) or unpaired t-test (Panel E).All individual points and p-values are shown. A p-value <0.was considered statistically significant. Scale bar = 200 pm. id="p-26" id="p-26" id="p-26" id="p-26"

[0026] FIG. 16shows a non-limiting, exemplary 1H NMR spectrum of MDMG-409E.-22- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-27" id="p-27" id="p-27" id="p-27"

[0027] FIG. 17shows a non-limiting, exemplary 1H NMR spectrum of tert-Butyl (£)-3-(4- acetylphenyl)acrylate (FAB-564). [0028[ FIG. 18shows a non-limiting, exemplary 13C NMR spectrum of tert-Butyl (£) ־ 3 ־ (4-acetylphenyl)acrylate (FAB-564). id="p-29" id="p-29" id="p-29" id="p-29"

[0029] FIG. 19shows a non-limiting, exemplary 1H NMR spectrum of tert-Butyl 3-(4- acetylphenyl)propanoate (FAB-574). id="p-30" id="p-30" id="p-30" id="p-30"

[0030] FIG. 20shows a non-limiting, exemplar} 7 1H NMR spectrum of 1 -(4-(6-Chlorohex- l-yn-l-yl)phenyl)ethan-l-one (FAB-586). id="p-31" id="p-31" id="p-31" id="p-31"

[0031] FIG. 21shows a non-limiting, exemplary 13C NMR spectrum of l-(4-(6־Chlorohex- l-yn-l-yl)phenyl)ethan-l-one (FAB-586). [0032[ FIG. 22shows a non-limiting, exemplary 1H NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)prop-l-en-l-yl)furan-2-y!)benzoate (FAB- 542). [0033[ FIG. 23shows a non-limiting, exemplary 13C NMR spectrum of Methyl (£)-2- hydroxy-5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)prop-l-en-l-yl)furan-2-yl)benzoate (FAB- 542). [0034[ FIG. 24shows a non-limiting, exemplar} 7 1H NMR spectrum of (£)-5-(5-(3-(4- (dimethylamino)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-544). id="p-35" id="p-35" id="p-35" id="p-35"

[0035] FIG. 25shows a non-limiting. exemplary 13C NMR spectrum of (£)-5-(5-(3-(4- (dimethylamino)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-544). id="p-36" id="p-36" id="p-36" id="p-36"

[0036] FIG. 26shows a non-limiting, exemplar} 7 mass spectrum of Methyl (E)-2-hydroxy- 5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)prop-l-en-l-yl)furan-2-y!)benzoate (FAB-542). id="p-37" id="p-37" id="p-37" id="p-37"

[0037] FIG. 27shows a non-limiting, exemplary 1H NMR spectrum of Methyl (A)-2- hydroxy-5-(5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-545).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-38" id="p-38" id="p-38" id="p-38"

[0038] FIG. 28shows a non-limiting, exemplary 13C NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-545). [0039[ FIG. 29shows a non-limiting, exemplary mass spectrum of Methyl (E)-2-hydroxy- 5-(5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-545). id="p-40" id="p-40" id="p-40" id="p-40"

[0040] FIG. 30shows a non-limiting, exemplary 1H NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-(4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB- 554). id="p-41" id="p-41" id="p-41" id="p-41"

[0041] FIG. 31shows a non-limiting, exemplary 13C NMR spectrum of Methyl (£)-2- hydroxy-5-(5-(3-(4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB- 554). id="p-42" id="p-42" id="p-42" id="p-42"

[0042] FIG. 32shows a non-limiting, exemplary mass spectrum of FAB-445. id="p-43" id="p-43" id="p-43" id="p-43"

[0043] FIG. 33shows a non-limiting, exemplary 1H NMR spectrum of Methyl (£)-5-(5-(3-(4-cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-555). [0044[ FIG. 34shows a non-limiting, exemplary 13C NMR spectrum of Methyl (E)-5-(5- (3-(4-cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-555). id="p-45" id="p-45" id="p-45" id="p-45"

[0045] FIG. 35shows a non-limiting, exemplary' mass spectrum of Methyl (E)-5-(5-(3-(4- cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-555). id="p-46" id="p-46" id="p-46" id="p-46"

[0046] FIG. 36shows a non-limiting, exemplary 1H NMR spectrum of Methyl (£)-5-(5-(3- (4-butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-559). id="p-47" id="p-47" id="p-47" id="p-47"

[0047] FIG. 37shows a non-limiting, exemplary 13C NMR spectrum of Methyl (£)-5-(5- (3-(4-butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-559). [0048[ FIG. 38shows a non-limiting, exemplary ׳ mass spectrum of Methyl (£)-5-(5-(3-(4- butylphenyl)-3-oxoprop-1 -en-1 -yl)furan-2-yl)-2-hydroxybenzoate (FAB-559). id="p-49" id="p-49" id="p-49" id="p-49"

[0049] FIG. 39shows a non-limiting, exemplary 1 ׳H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-hydroxyphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-561).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-50" id="p-50" id="p-50" id="p-50"

[0050] FIG. 40shows a non-limiting, exemplary 13C NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-hydroxyphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-561). [0051 [ FIG. 41shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5-(3- (4-hydroxyphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-561). id="p-52" id="p-52" id="p-52" id="p-52"

[0052] FIG. 42shows a non-limiting, exemplary 1H NMR spectrum of 5-(5-((E)-3-(4-((£)- 3-(tert-butoxy)-3-oxoprop-l-en-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxy benzoic acid (FAB-565). id="p-53" id="p-53" id="p-53" id="p-53"

[0053] FIG. 43shows a non-limiting, exemplary 13C NMR spectrum of 5-(5-((E)-3-(4-((E)- 3-(tert-butoxy)-3-oxoprop-l-en-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxy benzoic acid (FAB-565). id="p-54" id="p-54" id="p-54" id="p-54"

[0054] FIG. 44shows a non-limiting, exemplary' 1H NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoate (FAB-567). id="p-55" id="p-55" id="p-55" id="p-55"

[0055] FIG. 45shows a non-limiting, exemplary 7 13C NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoate (FAB-567). id="p-56" id="p-56" id="p-56" id="p-56"

[0056] FIG. 46shows anon-limiting, exemplary ׳ mass spectrum of FAB-567. id="p-57" id="p-57" id="p-57" id="p-57"

[0057] FIG. 47shows a non-limiting, exemplary' 1H NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB- 568). id="p-58" id="p-58" id="p-58" id="p-58"

[0058] FIG. 48shows a non-limiting, exemplary 13C NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-(4-(hy'droxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB- 568). id="p-59" id="p-59" id="p-59" id="p-59"

[0059] FIG. 49shows a non-limiting, exemplary mass spectrum of Methyl (E)-2-hydroxy- 5-(5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-568). id="p-60" id="p-60" id="p-60" id="p-60"

[0060] FIG. 50shows a non-limiting, exemplary 7 1H NMR spectrum of Methy l (E)-5-(5-(3- (4-ethylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-5716).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-61" id="p-61" id="p-61" id="p-61"

[0061] FIG. 51shows a non-limiting, exemplary 13C NMR spectrum of Methyl (E)-5-(5- (3-(4-ethylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-571e). [0062[ FIG. 52shows a non-limiting, exemplary mass spectrum of Methyl (E)-5-(5-(3-(4- ethylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-57le). id="p-63" id="p-63" id="p-63" id="p-63"

[0063] FIG. 53shows a non-limiting, exemplary 1H NMR spectrum of (E)-5-(5-(3-(4- Ethylphenyl)-3-oxoprop- 1-en- 1-yl)furan-2-yl)-2-hy droxy benzoate (FAB-571a). id="p-64" id="p-64" id="p-64" id="p-64"

[0064] FIG. 54shows a non-limiting, exemplary 13C NMR spectrum of (£)-5-(5-(3-(4- Ethylphenyl)-3-oxoprop- 1 -en-1 -yl)furan-2-yl)-2-hydroxybenzoate (FAB-571 a). id="p-65" id="p-65" id="p-65" id="p-65"

[0065] FIG. 55shows a non-limiting, exemplary mass spectrum of(E)-5-(5-(3-(4- Ethylphenyl)-3-oxoprop- 1 -en-1 -yl)furan-2-yl)-2-hydroxybenzoate (FAB-571 a). [0066[ FIG. 56shows a non-limiting, exemplary 1H NMR spectrum of Methyl (E)-2- hydroxy-5-(5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-572). id="p-67" id="p-67" id="p-67" id="p-67"

[0067] FIG. 57shows a non-limiting, exemplary 13C NMR spectrum of Methyl (£)-2- hydroxy-5-(5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-572). id="p-68" id="p-68" id="p-68" id="p-68"

[0068] FIG. 58shows a non-limiting, exemplary 7 mass spectrum of Methyl (E)-2-hy droxy- 5-(5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoate (FAB-572). id="p-69" id="p-69" id="p-69" id="p-69"

[0069] FIG. 59shows a non-limiting, exemplary 1H NMR spectrum of (£)-5-(5-(3-(3- Ethyl-4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-578a). id="p-70" id="p-70" id="p-70" id="p-70"

[0070] FIG. 60shows a non-limiting, exemplary 13C NMR spectrum of (£)-5-(5-(3-(3- Ethyl-4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-578a). id="p-71" id="p-71" id="p-71" id="p-71"

[0071] FIG. 61shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(3-Ethyl-4- (hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 578a).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-72" id="p-72" id="p-72" id="p-72"

[0072] FIG. 62shows a non-limiting, exemplary 1H NMR spectrum of (E)-5-(5-(3-(4-(3- (tert-Butoxy)-3-oxopropyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-581atBu). id="p-73" id="p-73" id="p-73" id="p-73"

[0073] FIG. 63shows a non-limiting, exemplary 13C NMR spectrum of (E)-5-(5-(3-(4-(3- (tert-Butoxy)-3-oxopropyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-581atBu). id="p-74" id="p-74" id="p-74" id="p-74"

[0074] FIG. 64shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(4-(3-(tert- Butoxy)-3-oxopropyl)phenyl)-3-oxoprop-l-en-1 -yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 581atBu). id="p-75" id="p-75" id="p-75" id="p-75"

[0075] FIG. 65shows a non-limiting, exemplary 1H NMR spectrum of (E)-5-(5-(3-(4-(6- Chlorohex-l-yn-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 583 a). id="p-76" id="p-76" id="p-76" id="p-76"

[0076] FIG. 66shows a non-limiting, exemplary 13C NMR spectrum of (E)-5-(5-(3-(4-(6- Chlorohex-l-yn-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 583 a). id="p-77" id="p-77" id="p-77" id="p-77"

[0077] FIG. 67shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(4-(6- Chlorohex-l-yn-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 583 a). id="p-78" id="p-78" id="p-78" id="p-78"

[0078] FIG. 68shows a non-limiting, exemplary 1H NMR spectrum of Methyl (£)-5-(5-(3- (4-hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hy dr oxybenzoate (FAB-5906). id="p-79" id="p-79" id="p-79" id="p-79"

[0079] FIG. 69shows a non-limiting, exemplary 13C NMR spectrum of Methyl (£)-5-(5- (3-(4-hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-5906). id="p-80" id="p-80" id="p-80" id="p-80"

[0080] FIG. 70shows non-limiting, exemplary mass spectra of Methyl (E)-5-(5-(3-(4- hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-5906). id="p-81" id="p-81" id="p-81" id="p-81"

[0081] FIG. 71shows a non-limiting, exemplary 1H NMR spectrum of (£)-5-(5-(3-(4- Hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-590a).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-82" id="p-82" id="p-82" id="p-82"

[0082] FIG. 72shows a non-limiting, exemplary ljC NMRspectrum of (£)-5-(5-(3-(4- Hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-590a). [0083[ FIG. 73shows non-limiting, exemplary spectra of (£)-5-(5-(3-(4-Hexylphenyl)-3- oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-590a). id="p-84" id="p-84" id="p-84" id="p-84"

[0084] FIG. 74shows a non-limiting, exemplary 7 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-octylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-594a). id="p-85" id="p-85" id="p-85" id="p-85"

[0085] FIG. 75shows a non-limiting, exemplary' 13CNMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-octylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-594a). id="p-86" id="p-86" id="p-86" id="p-86"

[0086] FIG. 76shows non-limiting, exemplary spectra of (£)-2-Hydroxy-5-(5-(3-(4- octylphenyl)-3-oxoprop-l -en-l-yl)furan-2-yl)benzoic acid (FAB-594a). [0087[ FIG. 77shows anon-limiting, exemplary 1H NMR spectrum of Methyl 2-hydroxy- 5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)propyl)furan-2-yl)benzoate (FAB-546). id="p-88" id="p-88" id="p-88" id="p-88"

[0088] FIG. 78shows a non-limiting, exemplary 1'C NMR spectrum of Methyl 2-hydroxy- 5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)propyl)furan-2-yl)benzoate (FAB-546). id="p-89" id="p-89" id="p-89" id="p-89"

[0089] FIG. 79shows a non-limiting, exemplary' 1H NMR spectrum of Methyl 5-(5-(3-(4- butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoate (FAB-582). id="p-90" id="p-90" id="p-90" id="p-90"

[0090] FIG. 80shows a non-limiting, exemplary 7 15C NMR spectrum of FAB-582. id="p-91" id="p-91" id="p-91" id="p-91"

[0091] FIG. 81shows a non-limiting, exemplary 1H NMR spectrum of Methyl 5-(5-(3-(4-butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoate (FAB-584). id="p-92" id="p-92" id="p-92" id="p-92"

[0092] FIG. 82shows anon-limiting, exemplary 7 13C NMR spectrum of Methyl 5-(5-(3-(4- butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoate (FAB-584). id="p-93" id="p-93" id="p-93" id="p-93"

[0093] FIG. 83shows a non-limiting, exemplary 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-iodopheny 7l)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-548). [0094[ FIG. 84shows a non-limiting, exemplary 7 13C NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-548).-28 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-95" id="p-95" id="p-95" id="p-95"

[0095] FIG. 85shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5-(3- (4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-548). [0096 [ FIG. 86shows a non-limiting, exemplary 1H NMR spectrum of 2-Hydroxy-5-(5-(3- oxo-3-(4-(trifluoromethyl)phenyl)propyl)furan-2-yl)benzoic acid (FAB-549). id="p-97" id="p-97" id="p-97" id="p-97"

[0097] FIG. 87shows a non-limiting. exemplary mass spectrum of 2-Hy droxy-5-(5-(3-oxo- 3-(4-(trifluoromethyl)phenyl)propyl)furan-2-yl)benzoic acid (FAB-549). id="p-98" id="p-98" id="p-98" id="p-98"

[0098] FIG. 88shows a non-limiting, exemplary' 1H NMR spectrum of (E)-5-(5-(3-(4- Cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-558). id="p-99" id="p-99" id="p-99" id="p-99"

[0099] FIG. 89shows a non-limiting, exemplary 7 ljC NMR spectrum of (E)-5-(5-(3-(4- Cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-558). [00100[ FIG. 90shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(4- Cyanophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-558). id="p-101" id="p-101" id="p-101" id="p-101"

[00101] FIG. 91shows a non-limiting, exemplary' 1H NMR spectrum of (E)-5-(5-(3-(4- Butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-563). id="p-102" id="p-102" id="p-102" id="p-102"

[00102] FIG. 92shows a non-limiting, exemplary 13C NMR spectrum of (E)-5-(5-(3-(4- Butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-563). id="p-103" id="p-103" id="p-103" id="p-103"

[00103] FIG. 93shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(4- Butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxy benzoic acid (FAB-563). [00104[ FIG. 94shows a non-limiting, exemplary 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-566). id="p-105" id="p-105" id="p-105" id="p-105"

[00105] FIG. 95shows a non-limiting, exemplary 13CNMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-566). id="p-106" id="p-106" id="p-106" id="p-106"

[00106] FIG. 96shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5-(3- (4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-566).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-107" id="p-107" id="p-107" id="p-107"

[00107] FIG. 97shows a non-limiting, exemplary 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-573). [00108[ FIG. 98shows a non-limiting, exemplary 13C NMR spectrum of (E)-2-Hydroxy-5- (5-(3-oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-573). id="p-109" id="p-109" id="p-109" id="p-109"

[00109] FIG. 99shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5-(3- oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-573). id="p-110" id="p-110" id="p-110" id="p-110"

[00110] FIG. 100shows anon-limiting, exemplary 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-575). id="p-111" id="p-111" id="p-111" id="p-111"

[00111] FIG. 101shows anon-limiting, exemplary 13C NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-575). [00112[ FIG. 102shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5- (3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-y!)benzoic acid (FAB-575). id="p-113" id="p-113" id="p-113" id="p-113"

[00113] FIG. 103shows anon-limiting, exemplary 1H NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-576). id="p-114" id="p-114" id="p-114" id="p-114"

[00114] FIG. 104shows anon-limiting, exemplary 13C NMR spectrum of (E)-2-Hydroxy-5- (5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-576). id="p-115" id="p-115" id="p-115" id="p-115"

[00115] FIG. 105shows a non-limiting, exemplary mass spectrum of (E)-2-Hydroxy-5-(5- (3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-576). [00116[ FIG. 106shows a non-limiting, exemplary 1H NMR spectrum of 5-(5-(3-(4- Butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-585). id="p-117" id="p-117" id="p-117" id="p-117"

[00117] FIG. 107shows a non-limiting, exemplary 13CNMR spectrum of 5-(5-(3-(4- Butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-585). id="p-118" id="p-118" id="p-118" id="p-118"

[00118] FIG. 108shows a non-limiting, exemplary mass spectrum of 5-(5-(3-(4-Butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-585).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-119" id="p-119" id="p-119" id="p-119"

[00119] FIG. 109shows a non-limiting, exemplary 1H NMR spectrum of 5-(5-(3-(4- Butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-587). [00120[ FIG. 110shows a non-limiting, exemplary 13C NMR spectrum of 5-(5-(3-(4- Butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-587). id="p-121" id="p-121" id="p-121" id="p-121"

[00121] FIG. Illshows a non-limiting, exemplary mass spectrum of 5-(5-(3-(4- Butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB-587). id="p-122" id="p-122" id="p-122" id="p-122"

[00122] FIG. 112shows a non-limiting, exemplary 1H NMR spectrum of 5-(5-((E)-3-(4- ((E)-2-Carboxyvinyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 570). id="p-123" id="p-123" id="p-123" id="p-123"

[00123] FIG. 113shows a non-limiting, exemplary 13C NMR spectrum of 5-(5-((E)-3-(4- ((E)-2-Carboxyvinyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 570). id="p-124" id="p-124" id="p-124" id="p-124"

[00124] FIG. 114shows a non-limiting, exemplary mass spectrum of 5-(5-((E)-3-(4-((E)-2- Carboxyvinyl)phenyl)-3-oxoprop-1-en-l-y!)furan-2-yl)-2-hydroxybenzoic acid (FAB-570). id="p-125" id="p-125" id="p-125" id="p-125"

[00125] FIG. 115shows a non-limiting, exemplary 1H NMR spectrum of (E)-5-(5-(3-(4-(2- Carboxyethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-58 laa). [00126[ FIG. 116shows a non-limiting, exemplary 13C NMR spectrum of (E)-5-(5-(3-(4-(2- Carboxyethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-58 laa). id="p-127" id="p-127" id="p-127" id="p-127"

[00127] FIG. 117shows a non-limiting, exemplary mass spectrum of (E)-5-(5-(3-(4-(2- Carboxyethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-58laa). id="p-128" id="p-128" id="p-128" id="p-128"

[00128] FIG. 118shows a non-limiting, exemplary 1H NMR spectrum of 5-(4-hydroxy-3- nitrophenyl)-2-furaldehyde (FAB-536). id="p-129" id="p-129" id="p-129" id="p-129"

[00129] FIG. 119shows a non-limiting, exemplary 15C NMR spectrum of 5-(4-hydroxy-3- nitrophenyl)-2-furaldehyde (FAB-536).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-130" id="p-130" id="p-130" id="p-130"

[00130] FIG. 120shows a non-limiting, exemplary 1H NMR spectrum of (E)-l-(4- Bromophenyl)-3-(5-(4-hydroxy-3-nitrophenyl)furan-2-yl)prop-2-en-l-one (FAB-541). [00131[ FIG. 121shows a non-limiting, exemplary 13C NMR spectrum of (E)-l-(4- Bromophenyl)-3-(5-(4-hydroxy-3-nitrophenyl)furan-2-yl)prop-2-en-l-one (FAB-541). id="p-132" id="p-132" id="p-132" id="p-132"

[00132] FIG. 122shows a non-limiting, exemplary 7 mass spectrum of (E)-l-(4- Bromophenyl)-3-(5-(4-hydroxy-3-nitrophenyl)furan-2-yl)prop-2-en-l-one (FAB-541). id="p-133" id="p-133" id="p-133" id="p-133"

[00133] FIG. 123shows activities of selected salicylate derivatives against recombinant human glycolate oxidase and lactate dehydrogenase A. [00134[ FIG. 124shows a non-limiting, exemplary 1 list of compounds for evaluation of intracellular oxalate in hepatocytes of Primary Hyperoxaluria mice (AGXT-/-). Compounds named FAB are salicylate derivatives, compounds named FL are flavonoids. id="p-135" id="p-135" id="p-135" id="p-135"

[00135] FIG. 125shows anon-limiting, exemplary schematic of a study design. id="p-136" id="p-136" id="p-136" id="p-136"

[00136] FIG. 126shows a graph of non-limiting, exemplary 7 results of DMSO with and without glycolate. id="p-137" id="p-137" id="p-137" id="p-137"

[00137] FIG. 127shows graphs of non-limiting, exemplary results of MDMG-935P, FAB- 541, FAB-544, and FAB-548. [00138[ FIG. 128shows graphs of non-limiting, exemplary results of FAB-549, FAB-563, FAB-566, and FAB-570. id="p-139" id="p-139" id="p-139" id="p-139"

[00139] FIG. 129shows graphs of non-limiting, exemplary results 0fFAB-571a, FAB-573, FAB-576, and FAB-578a. id="p-140" id="p-140" id="p-140" id="p-140"

[00140] FIG. 130shows graphs of non-limiting, exemplary 7 results of FAB-581 aa, FAB- 581atBu, FAB-583a, and FAB-585. id="p-141" id="p-141" id="p-141" id="p-141"

[00141] FIG. 131shows graphs of non-limiting, exemplary results of FAB-587, FL-6, FL- 19, and FL-22. [00142[ FIG. 132shows a non-limiting, exemplary heat map of compounds described herein.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-143" id="p-143" id="p-143" id="p-143"

[00143] FIG. 133shows a non-limiting schema of the proposal. id="p-144" id="p-144" id="p-144" id="p-144"

[00144] FIG. 134shows a non-limiting schema of glyoxylate/oxalate metabolism. Orange boxes: enzymes known to promote glyoxylate or oxalate production. Blue boxes: enzymes with known loss-of-function mutations that cause primary hyperoxaluria (PH). id="p-145" id="p-145" id="p-145" id="p-145"

[00145] FIG. 135shows non-limiting data indicating increased oxalate and suppressed AGXT in NASH. (Panel A) Male C57BL/6J mice were fed a NASH diet or SD for 24 weeks (n=8). (Panel B) Confirmation of NASH by H&E (scale bar: 50 pm). (Panel C) AGXT protein normalized to |3-Actin. (Panel D) Liver oxalate normalized to protein concentrations. Data are means ± SEM. Unpaired t test. id="p-146" id="p-146" id="p-146" id="p-146"

[00146] FIG. 136shows non-limiting data indicating suppressed AGXT in atherosclerosis. (Panel A) Male Apoe-/- mice were fed a WD or SD for 12 weeks (n=5). (Panel B) Confirmation of atherosclerosis using oil red O (ORO) staining of whole aortas. (Panel C) AGXT protein normalized to |3-Actin. as we reported. 14 Data are means ± SEM. Unpaired t test. id="p-147" id="p-147" id="p-147" id="p-147"

[00147] FIG. 137shows non-limiting, exemplary data indicating increased oxalate and suppressed AGXT in steatotic hepatocytes. (Panel A) Primary mouse (C57BL/6J) hepatocytes and HepG2 cells were incubated with BSA-conjugated PA (200 pM) or BSA for 18 h. Lipid accumulation was confirmed using Nile Red (scale bar: 100 pm). Intracellular oxalate in (Panel B) primary hepatocytes (n=3). (Panel C) AGXT mRNA normalized to GAPDH (n=6), and (Panel D) AGXT protein normalized to ]3-Actin in HepG2 cells (n=3). Data are means ± SEM. Unpaired t test. id="p-148" id="p-148" id="p-148" id="p-148"

[00148] FIG. 138shows non-limiting, exemplary data indicating oxalate exacerbates lipid accumulation and mitochondrial dysfunction in vitro. HepG2 cells were incubated with NaOX (500 pM), PA (200 pM) or both for 18 h (n=3-4). (Panel A) Lipid accumulation assessed by Nile Red. Mitochondrial metabolism and superoxide assessed by (Panel B) Seahorse Mito Stress assay, and (Panel C) MitoSOX (scale bar: 100 pm). Data are means ± SEM. Two-way ANOVA followed by Holm-Sidak ’s test. [00149[ FIG. 139shows non-limiting, exemplary data indicating enhanced NASH in Agxt־'־ mice. (A) Western blot confirming AGXT loss in livers from Agxt־'־ mice, as we reported.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 (B) Male4g.v7 and Agxt־'־ mice were fed the NASH diet for 12 weeks. (Panel C) Liver oxalate (n=8). (Panels D-E) Gross morphology, and H&E analysis of NAFLD activity score (NAS, scale bar: 50 um, n=12). Data are means ± SEM. Mann-Whitney U test (Panels C, E). (Panels F-G) Pathway analysis after RNA-seq of livers from 4g.r/ and Agr ־ mice (n=4). Pathways enriched in downregulated (blue) or upregulated (red) differentially expressed genes (DEGs). Fisher ’s exact test followed by Benjamini-Hochberg multiple testing adjustment. id="p-150" id="p-150" id="p-150" id="p-150"

[00150] FIG. 140shows non-limiting, exemplary data indicating oxalate suppresses PPARa targets and induces CCL5 in vitro. HepG2 cells were treated with NaOX (0-500 pM, 18h h) followed by qPCR analyses of PPARa targets (Panel X)ACADVL and (Panel W) ACADM, and (C) CCL5 normalized to GAPDH (n=3). Data are means ± SEM. One-way ANOVA followed by Tukey test. id="p-151" id="p-151" id="p-151" id="p-151"

[00151] FIG. 141shows non-limiting, exemplary data indicating enhanced atherosclerosis in Agxtv־ / Apoe ־ ־ mice. (Panel A) Male Agxi / Apoe ־ and Agxt־'־ / Apoe־^ mice were fed a WD for 12 weeks, as we reported. 14 Analysis of atherosclerosis in (Panel B) whole aortas using ORO, and (Panel C) aortic sinuses using H&E (scale bar: 200 pm. n=10-12). (Panel D) Upregulated pathways after RNA-seq of livers from Agxt+I+ / Apoe-I- and Agxtz־! Apoe־z״ mice with Fisher ’s exact test followed by Benjamini-Hochberg multiple testing adjustment (n=5). (Panel E) Liver Ccl5 normalized to Gapdh. and (Panel F) plasma CCL5 (n=9- 10). Data are means ± SEM. Mann-Whitney U test. id="p-152" id="p-152" id="p-152" id="p-152"

[00152] FIG. 142shows non-limiting, exemplary data indicating WD +HLP increases oxalate and atherosclerosis. (Panel A) Male Apoe ־ 1 ־ mice were fed WD or WD +HLP (3%) for weeks (n=8). (Panel B) Liver oxalate. (Panel C) Atherosclerosis in whole aortas using ORO. Data are means ± SEM. Unpaired t test. id="p-153" id="p-153" id="p-153" id="p-153"

[00153] FIG. 143shows non-limiting, exemplary data indicating liver-specific loss of PPARa confirmed by (Panel A) Western blot. (Panel B) Morphology of male Ppara^0 and Pparattox mice on NASH diet (12 weeks). id="p-154" id="p-154" id="p-154" id="p-154"

[00154] FIG. 144shows non-limiting, exemplar}' data indicating concurrent (Panel A) NASH, and (Panel B)atherosclerosis confirmed by H&E histology in male Ldlr-!- mice fed NASH diet for 16 weeks (scale bar: 50 um).-34- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-155" id="p-155" id="p-155" id="p-155"

[00155] FIG. 145shows non-limiting, exemplary data indicating AGXT overexpression reduces oxalate, mitochondrial dysfunction and lipid accumulation in vitro. HepG2 cells were transfected with GFP-tagged AGXT or GFP plasmids and incubated with PA (200 pM) for h (n=3). (Panel A) Western blot confirming AGXT overexpression with (Panel B) decreased cellular oxalate. (Panel C) Seahorse Mito Stress assay. (Panel D) Mitochondrial superoxide assessed by MitoSOX. (Panel E) Lipid accumulation assessed by Nile Red. Data are means ± SEM. Unpaired t test. id="p-156" id="p-156" id="p-156" id="p-156"

[00156] FIG. 146shows non-limiting, exemplary data indicating oxalate reduction via AGXT overexpression lowers NASH. (Panel A) Male C57BL6/J mice were injected once with AAV8-TBG-GFP or AAV8-TBG-AGXT (2x1011 vg/mouse) and fed the NASH diet for weeks (n=6-8). (Panel B) AGXT overexpression was confirmed by Western blot. (Panel C) Liver oxalate. (Panel D) Plasma AST. (Panel E) Gross morphology. (Panels F-G) H&E histology (scale bar: 50 pm) used for NAS. Data are means ± SEM. Unpaired t test (Panels C- D). Mann-Whitney U test (Panel G). [00157[ FIG. 147shows non-limiting, exemplary data indicating unbiased transcriptomics following AGXT overexpression in NASH. RNA-seq was performed on livers from mice described in Fig. 14. (Panel A) PCA. Pathways enriched in the (Panel B) upregulated (red) or (Panel C) downregulated (blue) DEGs. Fisher ’s exact test followed by Benjamini -Hochberg multiple testing adjustment (n=4). (Panel D) qPCR for Hadha and Ccl5 normalized to Gapdh. Unpaired t test or Mann-Whitney U test depending on normality tests (n=6-8). id="p-158" id="p-158" id="p-158" id="p-158"

[00158] FIG. 148shows non-limiting, exemplary data indicating oxalate reduction via AGXT overexpression attenuates atherosclerosis. (Panel A) Male Apoe־'־ mice were injected with AAV8- TBG-GFP or AAV8-TBG-AGXT (2x1011 vg/mouse) and fed a WD for 12 weeks (n=8), as we reported. 14 (Panel B) Western blot confirming hepatic AGXT overexpression with (Panel C) reduced oxalate. (Panel D) Plasma CCL5. (Panel E) Atherosclerosis in whole aortas using ORO. Unpaired t test (Panels C. E). Mann-Whitney U test (Panel D). id="p-159" id="p-159" id="p-159" id="p-159"

[00159] FIG. 149shows non-limiting, exemplary data indicating similarities between human NASH and our mouse NASH model. Pathway analysis of liver RNA-seq from patients with NASH (n=43, NAS>4) vs. healthy controls (n=6) (GSE130970).140 and our mice with diet- induced NASH vs. SD-fed control mice (n=4) (PRJNA556537).13 Significance of the enriched -35 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 pathways was evaluated by right- tailed Fisher ’s exact test followed by Benjamini-Hochberg multiple testing adjustment. Scale bar: log2fold-change. [00160[ FIG. 150shows non-limiting, exemplary data indicating dysregulated glyoxylate/oxalate metabolic genes in NAFLD/NASH. (Panel A) DEGs assessed by RNA-seq in humans and mice with NASH/ controls as described in Fig. 147. Scale bar: log2fold-change. (Panel B) Spearman ’s correlation between glyoxylate/oxalate metabolic gene expression and hepatic fat in livers from transplantation donors (n=206, GSE26106). *p<0.05. **p<0.01, ***p<0.001. id="p-161" id="p-161" id="p-161" id="p-161"

[00161] FIG. 151shows data indicating increased hepatic oxalate and decreased AGXT in human NASH. Liver samples were collected from patients with NASH and compared to non- malignant and disease-free liver tissues (no NASH) (n=7-8). (Panel A) Liver oxalate. (Panel B) AGXT protein normalized to GAPDH. Data are means ± SEM. Unpaired t test. id="p-162" id="p-162" id="p-162" id="p-162"

[00162] FIG. 152shows data indicating circulating oxalate is increased in patients with sCAD. (Panel A) Patients with acute chest pain underwent coronary computed tomography angiography to assess atherosclerosis in the coronary arteries (n=95). (Panel B) Serum oxalate in 24 patients found to have sCAD vs. 71 patients with no sCAD. 14,60 Data are shown as violin plots. Unpaired t-test.

DETAILED DESCRIPTION OF THE INVENTION id="p-163" id="p-163" id="p-163" id="p-163"

[00163]Aspects described herein provide for compositions and methods for treating an oxalate-related disease. [00164]Detailed descriptions of one or more embodiments are provided herein. It is to be understood, however, that the invention can be embodied in various forms. Therefore, specific details disclosed herein are not to be interpreted as limiting, but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the invention in any appropriate manner. [00165]The singular forms "a", "an" and "the " include plural reference unless the context clearly dictates otherwise. The use of the word "a" or "an" when used in conjunction with the term "comprising " in the claims and/or the specification can mean "one, " but it is also consistent with the meaning of "one or more, " "at least one, " and "one or more than one. "-36- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-166" id="p-166" id="p-166" id="p-166"

[00166]Wherever any of the phrases "for example, " "such as," "including " and the like are used herein, the phrase "and without limitation" is understood to follow unless explicitly stated otherwise. Similarly, "an example, " "exemplary ־’ and the like are understood to be nonlimiting. [00167]The term ־‘substantially " allows for deviations from the descriptor that do not negatively impact the intended purpose. Descriptive terms are understood to be modified by the term "substantially " even if the word "substantially ־’ is not explicitly recited. [00168]The terms "comprising " and "including " and "having " and ־‘involving" (and similarly ־‘comprises ", ־‘includes, " ־‘has, " and "involves ") and the like are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the common United States patent law definition of "comprising " and is therefore interpreted to be an open term meaning "at least the following,־’ and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, "a process involving steps a, b. and c " means that the process includes at least steps a, b and c. Wherever the terms "a" or "an" are used, "one or more " is understood, unless such interpretation is nonsensical in context. [00169]As used herein, the term "about " can refer to approximately, roughly, around, or in the region of. When the term "about " is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about " is used herein to modify a numerical value above and below the stated value by a variance of 20 percent up or down (higher or lower). In embodiments, the term "about " can be denoted by [00170[As used herein, the term "substantially the same " or "substantially " can refer to variability typical for a particular method is taken into account. [00171]The terms "sufficient " and "effective ", as used interchangeably herein, can refer to an amount (e.g., mass, volume, dosage, concentration, and/or time period) needed to achieve one or more desired result(s). [00172]Before explaining at least one embodiment of the disclosure in detail, it is to be understood that the disclosure is not necessarily limited in its application to the details set forth in the following description or exemplified by the examples. The disclosure can be used for other embodiments or of being practiced or carried out in various ways. Other compositions, compounds, methods, features, and advantages of the disclosure will be or become apparent to one having ordinary skill in the art upon examination of the following drawings, detailed -37- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 description, and examples. All such additional compositions, compounds, methods, features, and advantages can be included within this description, and be within the scope of the disclosure. [00173]The term "alkyl" refers to the radical of saturated aliphatic groups, including straight- chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl- substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. [00174]In some embodiments, a straight chain or branched chain alkyl has 30 or fewer carbon atoms in its backbone (e.g., C1-C30 for straight chains, C3-C30 for branched chains), or fewer, 12 or fewer, or 7 or fewer. Likewise, in some embodiments cycloalkyls have from 3-10 carbon atoms in their ring structure, e.g., have 5, 6 or 7 carbons in the ring structure. The term "alkyl" (or "lower alkyl") as used throughout the specification, examples, and claims can include both "unsubstituted alkyls" and "substituted alkyls", the latter of which refers to alkyl moieties having one or more substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents include, but are not limited to, halogen, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, a hosphinate, amino, amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, aralkyl, or an aromatic or heteroaromatic moiety. [00175]Unless the number of carbons is otherwise specified, "lower alkyl" as used herein can refer to an alkyl group, as defined herein, but having from one to ten carbons, or from one to six carbon atoms in its backbone structure. Likewise, "lower alkenyl" and "lower alkynyl" have similar chain lengths. In some embodiments, alkyl groups are lower alkyls. In some embodiments, a substituent described herein as alkyl can be a lower alkyl. [00176]It will be understood by those skilled in the art that the moieties substituted on the hydrocarbon chain can themselves be substituted, if appropriate. For instance, the substituents of a substituted alkyl can include halogen, hydroxy, nitro, thiols, amino, azido, imino, amido, phosphoryl (including phosphonate and phosphinate), sulfonyl (including sulfate, sulfonamido, sulfamoyl and sulfonate), and silyl groups, as well as ethers, alkyllhios. carbonyls (including ketones, aldehydes, carboxylates, and esters), -CF3, -CN and the like. Cycloalkyls can be substituted in the same manner.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-177" id="p-177" id="p-177" id="p-177"

[00177]The term "heteroalkyl", as used herein, refers to straight or branched chain, or cyclic carbon-containing radicals, or combinations thereof, containing at least one heteroatom. Suitable heteroatoms include, but are not limited to, O, N, Si, P, Se, B, and S, wherein the phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quatemized. Heteroalkyls can be substituted as defined herein for alkyl groups. [00178]The term "alkylthio" refers to an alky l group, as defined herein, having a sulfur radical attached thereto. In some embodiments, the "alkylthio" moiety is represented by one of -S-alkyl, -S-alkenyl, and -S-alkynyl. Representative alkylthio groups include methylthio, and ethylthio. The term ‘־alkylthio " also encompasses cycloalkyl groups, alkene and cycloalkene groups, and alkyne groups. "Arylthio" refers to aryl or heteroaryl groups. Alkylthio groups can be substituted as defined herein for alkyl groups. [00179]The terms "alkenyl" and "alkynyl", refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described herein, but that contain at least one double or triple bond respectively. For example, [00180]The terms "alkoxyl" or "alkoxy" as used herein refers to an alkyl group, as defined herein, having an oxygen radical attached thereto. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, and tert-butoxy. An "ether," for example, can be two hydrocarbons covalently linked by an oxygen. Accordingly, the substituent of an alkyl that renders that alkyl an ether is or resembles an alkoxyl, such as can be represented by one of -0- alkyl, -O-alkenyl, and -O-alkynyl. Aroxy can be represented by -O-aryl or O-heteroaryl, wherein aryl and heteroaryl are as defined herein. The alkoxy and aroxy groups can be substituted as described herein for alkyl. [00181]The terms "amine" and "amino" are art-recognized and refer to both unsubstituted and substituted amines, e.g., a moiety 7 that can be represented by the general formula: ־N'Kl or ^N-R1oRg R9wherein R9, R10, and Rio7 each independently represent a hydrogen, an alkyl, an alkenyl, - (CH2)m- Rs or R9 and Rio taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure; Rs represents an aryl, a cycloalkyl, a cycloalkenyl, a heterocycle or a polycycle; and m is zero or an integer in the range of 1 to 8. In some embodiments, only one of R9 or Rio can be a carbonyl, e.g., R9, Rio and the nitrogen -39- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 together do not form an imide. In still other embodiments, the term "amine " does not encompass amides, e.g., wherein one of R9 and Rio represents a carbonyl. In additional embodiments, R9 and Rio (and optionally Rio־) each independently represent a hydrogen, an alkyl or cycloalkyl, an alkenyl or cycloalkenyl, or alkynyl. Thus, the term "alkylamine" as used herein can refer to an amine group, as defined herein, having a substituted (as described hereinfor alkyl) or unsubstituted alkyl attached thereto, i.e., at least one of R9 and Rio is an alkyl group. [00182]As used herein, the term "imide " can refer to -C(O)NR’R", wherein R’ and R" are each independently hydrogen, or a substituted or unsubstituted alkyl, cycloalkyl, alkenyl, alkynyl, aryl aralkyl, heterocyclyl or heterocyclyl alkyl group as defined herein. [00183]As used herein, the term "halogen " can refer to -F, -Cl, -Br or -I; the term "sulfhydryl" can refer to -SH; the term "hydroxyl" can refer to -OH; and the term "sulfonyl" can refer to -SO2-. [00184]The term "substituted " as used herein, refers to permissible substituents of the compounds described herein. In the broadest sense, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, but are not limited to, halogens, hydroxyl groups, or any other organic groupings containing any number of carbon atoms, for example 1-14 carbon atoms, and optionally include one or more heteroatoms such as oxygen, sulfur, or nitrogen grouping in linear, branched, or cyclic structural formats. Representative substituents include alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, phenyl, substituted phenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, halo, hydroxyl, alkoxy, substituted alkoxy, phenoxy, substituted phenoxy, aroxy, substituted aroxy, alkylthio, substituted alkydthio, phenylthio, substituted phenylthio. aiylthio, substituted arylthio, cyano, isocyano, substituted isocyano, carbonyl, substituted carbonyl, carboxyl, substituted carboxyl, amino, substituted amino, amido, substituted amido, sulfonyl, substituted sulfonyl, sulfonic acid, phosphoryl, substituted phosphoryl, phosphonyl, substituted phosphonyl, polyaryl, substituted polyaryl, C3-Ccyclic, substituted C3-C20 cyclic, heterocyclic, substituted heterocyclic, amino acid, peptide, and polypeptide groups. As used herein in reference to an "R" group, the name used to describe said "R" group can be the chemical name prior to the removal of a hydrogen. For example, wherein "R" is described as an "alkane " can refer to an "alkyl " group.-40- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-185" id="p-185" id="p-185" id="p-185"

[00185]Heteroatoms such as nitrogen can have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. It is understood that "substitution " or "substituted " includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. [00186]In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described herein. The permissible substituents can be one or more and the same or different for appropriate organic compounds. The heteroatoms such as nitrogen can have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. [00187]In various aspects, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester, ether, formyl. halogen, haloalkyl. heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, each of which optionally is substituted with one or more suitable substituents. In some embodiments, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl. heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, wherein each of the alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl, heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone can be further substituted with one or more suitable substituents. [00188]Examples of substituents include, but are not limited to, halogen, azide, alkyd, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, thioketone, ester, heterocyclyl, -CN, ary1, aryloxy, perhaloalkoxy, aralkoxy, heteroaryl, heteroaryloxy, heteroaryl alkyl, heteroaralkoxy, azido, alkylthio, oxo, acylalkyl, carboxy esters, carboxamido, acyloxy, aminoalkyl, alkylaminoaryl, alky lary 1, alkylaminoalkyl, -41 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 alkoxyaryl, arylamino, aralkylamino, alkylsulfonyl, carboxamidoalkylaryl, carboxamidoaryl, hydroxyalkyl, haloalkyl, alkyl aminoalkyl carboxy, aminocarboxamidoalkyl, cyano, alkoxyalkyl, perhaloalkyl, arylalkyloxyalkyl, and the like. In some embodiments, the substituent is selected from cyano, halogen, hydroxyl, and nitro. [00189]Aspects of the invention are drawn to a compound of Formula (I) or a pharmaceutically acceptable salt, prodrug, hydrate, or solvate thereof: Formula (1). [00190]Pharmaceutically acceptable salts can include, but are not limited to, amine salts, such as but not limited to N,N'-dibenzylethylenediamine, chloroprocaine, choline, ammonia, diethanolamine and other hydroxyalkylamines, ethylenediamine, N-methylglucamine, procaine, N-benzylphenethylamine, 1 -para-chlorobenzyl-2-pyrrolidin-1'-ylmethylbenzimidazole, diethylamineand other alkylamines. piperazine and tris(hydroxymethyl) aminomethane; alkali metal salts, such as but not limited to lithium, potassium and sodium; alkali earth metal salts, such as but not limited to barium, calcium and magnesium; transition metal salts, such as but not limited to zinc; and other metal salts, such as but not limited to sodium hydrogen phosphate and disodium phosphate; and also including, but not limited to, salts of mineral acids, such as but not limited to hydrochlorides and sulfates; and salts of organic acids, such as but not limited to acetates, lactates, malates, tartrates, citrates, ascorbates, succinates, butyrates, valerates and fumarates. [00191]Compounds of those described herein, for example, can exist in the form of salts, for example acid addition salts or, in certain cases salts of organic and inorganic bases such as phenolate, carboxylate, sulphonate and phosphate salts. All such salts are within the scope of this disclosure. [00192]The salts of the disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods such as methods described in Pharmaceutical Salts: Properties. Selection, and Use, P Heinrich Stahl (ed), Camille G Wermuth (ed), ISBN:3-90639-026-8, Hardcover, 388 pages, August 2002. In embodiments, such salts can be prepared by reacting the free acid or base forms of these compounds with the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; for -42- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 example, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. [00193]Pharmaceutically acceptable esters can include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl and heterocyclyl esters of acidic groups, including, but not limited to, carboxylic acids, phosphoric acids, phosphinic acids, sulfonic acids, sulfinic acids and boronic acids. [00194]Pharmaceutically acceptable enol ethers can include, but are not limited to, derivatives of formula C=C(OR) where R is hydrogen, alkyl, alkenyl, alky nyl, aryd, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl, or heterocyclyl. Pharmaceutically acceptable enol esters can include, but are not limited to, derivatives of formula C=C(OC(O)R) where R is hydrogen, alkyl, alkenyl, alkynyl, ary l, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl ar heterocyclyl. [00195]Pharmaceutically acceptable solvates and hydrates are complexes of a compound with one or more solvent or water molecules, or 1 to about 100, or 1 to about 10, or one to about 2, 3 or 4, solvent or water molecules. [00196]A reference to a compound of the disclosure and sub-groups thereof also includes ionic forms, salts, solvates, isomers, tautomers, esters, prodrugs, isotopes and protected forms thereof; such as, the salts or tautomers or isomers or solvates thereof: and more advantageously, the salts or tautomers or solvates thereof. As used herein, the term "isomer " can refer to molecules or polyamtoic ions with identical molecular formulas, but distinct arrangements of atoms in space. For example, constitutional isomers and stereoisomers of compounds described herein are also embodiments of the invention. For example, the enantiomers and diastereomers of compounds described herein can be aspects of the invention. For example, if (R .S) of a compound is described herein, (R, R), (S, R), and (S, S) can also be aspects of the invention. As used herein, the term "enantiomer " can refer to molecules which are nonsuperimposable mirror images of each other. As used herein, the term "diastereomer " can refer to a stereoisomer of a compound having two or more chiral centers that is not a mirror image of another stereoisomer of the same compound.

Formula (1) Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-197" id="p-197" id="p-197" id="p-197"

[00197]in embodiments, Ri comprises a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, -N(R4)(R5), -OR., -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, ،Bu, -(CH2)nCH3, -(CH2)n'Pr, ־(CH2)״׳Bu. -(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4, -(CH2)nCON(R4)(R5), -(CH2)nSR4, -(CH2)nCN, ־(CH2)n־Cl, -CH=CH-(CH2)״-CH3, -CH=CH- (CH2)nTr, -CH=CH-(CH2)״׳Bu. -CH=C-(CH2)״OR4, -CH=CH-(CH2)nN(R4)(R5), -CH=CH- (CH2)״COOR4, -CH=CH-(CH2)nCON(R4)(R5), -CH=CH-(CH2)nSR4, -CH=CH-(CH2)nCN, - CH=CH-(CH2)n-Cl, -C=C-(CH2)n-CH3, -C=C-(CH2)״׳Pr. -C=C-(CH2)n؛Bu, -C=C-(CH2)״OR4. -C=C-(CH2)nN(R4)(R5), -C=C-(CH2)nCOOR4. -C=C-(CH2)״CON(R4)(R5), -C=C-(CH2)nSR4. - C=C-(CH2)nCN, or -C=C-(CH2)״-C1; [00198]In embodiments, R2 comprises a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, -N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, ‘Bu, -(CH2)nCH3, -(CH2)nTr, ־(CH2)n،Bu, -(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4, -(CH2)nCON(R4)(R5), -(CH2)nSR4, -(CH2)nCN, -(CH2)n־CL -CH=CH-(CH2)״-CH3, -CH=CH- (CH2)nTr, -CH=CH-(CH2)n،Bu, -CH=C-(CH2)״OR4, -CH=CH-(CH2)nN(R4)(R5), -CH=CH- (CH2)nCOOR4, -CH=CH-(CH2)nCON(R4)(R5), -CH=CH-(CH2)nSR4, -CH=CH-(CH2)nCN, - CH=CH-(CH2)n-Cl, -C=C-(CH2)n-CH3, -C=C-(CH2)nTr, -C=C-(CH2)n؛Bu, -C =C-(CH2)״OR4. -C=C-(CH2)nN(R4)(R5), -C=C-(CH2)nCOOR4. -C=C-(CH2)״CON(R4)(R5), -C=C-(CH2)nSR4. - C=C-(CH2)nCN, or -C=C-(CH2)״-C1; In embodiments, n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 carbons. In embodiments, R4 is hydrogen, alkyl, aryl and R5 is hydrogen, alky l, ary l. In embodiments, R3 comprises -COOH, -COOR6, or -NO2. In embodiments, R4 comprises hydrogen, acyclic alkyl. C1-C9 alkyl, or aryl. In embodiments, R5 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl. [00199]In embodiments, R6 is -CHa or -CH2CH3. In embodiments, A-B is -CO- or (CHOH)- . In embodiments, X-Y is -CH2-CH2- or -CH=CH-. In embodiment, the halogen is fluorine, chlorine, bromine, or iodine. [00200[Aspects of the invention are drawn towards a salicylic acid derivative of Formula (11): Formula (II), Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 wherein X-Y is CH2-CH2 or CH=CH. In embodiments, A-B is C=O CH-OHT, or"u !00201|For example, the compound comprises: FAB-570 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-594A id="p-202" id="p-202" id="p-202" id="p-202"

[00202]In embodiments, the compound is; Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-203" id="p-203" id="p-203" id="p-203"

[00203]While the compounds described herein can be administered without formulation, they can also be formulated as pharmaceutical compositions. Aspects of the invention are drawn tow ards a pharmaceutical composition comprising a compound of any one of the compounds described herein, or a combination thereof, and a pharmaceutically acceptable carrier, excipient, or diluent. [00204]The formulations or pharmaceutical composition can also be included, or packaged, with other non-toxic compounds, such as pharmaceutically acceptable carriers, excipients, binders and fillers including, but not limited to, glucose, lactose, gum acacia, gelatin, mannitol, xanthan gum, locust bean gum, galactose, oligosaccharides and/or polysaccharides, starch paste, magnesium trisilicate, talc, com starch, starch fragments, keratin, colloidal silica, potato starch, urea, dextrans, dextrins, and the like. For example, the pharmaceutically acceptable carriers, excipients, binders, and fillers for use in the practice of the present invention are those which render the compounds of the invention amenable to intranasal delivery 7, oral delivery, parenteral delivery 7, intravitreal delivery, intraocular delivery 7, ocular delivery, subretinal delivery, intrathecal delivery, intravenous delivery, subcutaneous delivery, transcutaneous delivery, intracutaneous delivery, intracranial delivery, topical delivery and the like. Moreover, the packaging material can be biologically 7 inert or lack bioactivity, such as plastic polymers or silicone, and can be processed internally by the subject without affecting the effectiveness of the composition/formulation packaged and/or delivered therewith. [00205]In embodiments, compounds and compositions described herein can be administered via oral administration. In some embodiments, the disclosed compositions are formulated in a pharmaceutically acceptable oral dosage form. Oral dosage forms can comprise oral liquid dosage forms (such as tinctures, drops, emulsions, symps, elixirs, suspensions, and solutions, and the like) and oral solid dosage forms. The pharmaceutical compositions can also be prepared as formulations suitable for parenteral administration, intramuscular, subcutaneous, intraperitoneal, or intravenous injection, comprising physiologically acceptable sterile aqueous FAB-541 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 or non-aqueous solutions, dispersions, suspensions or emulsions, liposomes, and sterile powders for reconstitution into sterile injectable solutions or dispersions. [00206]"Parenteral administration" can refer to administration via injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, intramuscular administration. For example, compounds and compositions described herein can be administered via intraperitoneal injection (I P), intravenous injection (I.V.), and intramuscular injection (I.M.). [00207]For oral preparations, the composition or pharmaceutical composition can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, com starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, com starch or gelatins; with disintegrators, such as com starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents. [00208]Oral solid dosage can comprise lozenges, troches, tablets, capsules, caplets, powders, pellets, multiparticulates, beads, spheres, and/or any combinations thereof. Oral solid dosage forms can be formulated as immediate release, controlled release, sustained release, extended release, or modified release formulations. Accordingly, in some embodiments, the disclosed oral solid dosage forms can be in the form of a tablet (including a suspension tablet, a fast-melt tablet, a bite-disintegration tablet, a rapid-disintegration tablet, an effervescent tablet, or a caplet), a pill, a powder (including a sterile packaged powder, a dispensable powder, or an effervescent powder), a capsule (including both soft or hard capsules, e.g., capsules made from animal-derived gelatin or plant-derived HPMC, or "sprinkle capsules "), solid dispersion, solid solution, bioerodible dosage form, controlled release formulations, pulsatile release dosage forms, multiparticulate dosage forms, pellets, granules, or an aerosol. In other embodiments, the pharmaceutical formulation can be in the form of a powder. In still other embodiments, the pharmaceutical formulation can be in the form of a tablet, including a fast-melt tablet. Additionally, pharmaceutical formulations can be administered as a single capsule or in multiple capsule dosage form. In some embodiments, the pharmaceutical formulation can be administered in two, three, four, or more capsules or tablets. [00209]Oral solid dosage forms can contain pharmaceutically acceptable excipients such as fillers, diluents, lubricants, surfactants, glidants, binders, dispersing agents, suspending agents, -49- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 disintegrants, viscosity-increasing agents, film-forming agents, granulation aid, flavoring agents, sweetener, coating agents, solubilizing agents, and combinations thereof. Oral solid dosage forms also can comprise one or more pharmaceutically acceptable additives such as a compatible carrier, complexing agent, ionic dispersion modulator, disintegrating agent, surfactant, lubricant, colorant, moistening agent, plasticizer, stabilizer, penetration enhancer, wetting agent, anti-foaming agent, alone or in combination, as well as supplementary active compound(s). [00210]Oral liquid dosage forms include tinctures, drops, emulsions, syrups, elixirs, suspensions, and solutions, and the like. These oral liquid dosage forms may be formulated with any pharmaceutically acceptable excipient known to those of skill in the art for the preparation of liquid dosage forms, and with solvents, diluents, carriers, excipients, and the like chosen as appropriate to the solubility and other properties of the active agents and other ingredients. Solvents may be. for example, water, glycerin, simple syrup, alcohol, medium chain triglycerides (MCT), and combinations thereof. [00211]Liquid dosage forms for oral administration may be in the form of pharmaceutically acceptable emulsions, syrups, elixirs, suspensions, and solutions, which may contain an inactive diluent, such as water. Pharmaceutical formulations can be prepared as liquid suspensions or solutions using a sterile liquid, such as but not limited to, an oil, water, an alcohol, and combinations of these pharmaceutically suitable surfactants, suspending agents, emulsifying agents, can be added for oral or parenteral administration. Liquid formulations also may be prepared as single dose or multi-dose beverages. Suspensions may include oils. Such oils include peanut oil, sesame oil, cottonseed oil, com oil, and olive oil. Suitable oils also include carrier oils such as MCT and long chain triglyceride (LCT) oils. Suspension preparation may also contain esters of fatty7 acids such as ethyl oleate, isopropyl myristate, fatty acid glycerides, and acetylated fatty7 acid glycerides. Suspension formulations may7 include alcohols, (such as ethanol, isopropyl alcohol, hexadecyl alcohol), glycerol, and propylene glycol. Ethers, such as poly(ethylene glycol), petroleum hydrocarbons such as mineral oil and petrolatum, and water may also be used in suspension formulations. Suspension can thus include an aqueous liquid or a non-aqueous liquid, an oil-in-w ater liquid emulsion, or a w ater- in-oil emulsion. [00212]In some embodiments, formulations are provided comprising the disclosed compositions and at least one dispersing agent or suspending agent for oral administration to a -50- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 subject. The formulation may be a powder and/or granules for suspension, and upon admixture with water, a substantially uniform suspension is obtained. The aqueous dispersion can comprise amorphous and non-amorphous particles consisting of multiple effective particle sizes such that a drug is absorbed in a controlled manner over time. [00213]Supplementary active compounds include preservatives, antioxidants, antimicrobial agents including biocides and biostats such as antibacterial, antiviral and antifungal agents. Preservatives can be used to inhibit microbial growth or increase stability of the active ingredient thereby prolonging the shelf life of the formulation. Suitable preservatives are known in the art and include EDTA, EGTA, benzalkonium chloride or benzoic acid or benzoates, such as sodium benzoate. Antioxidants include vitamin A, vitamin C (ascorbic acid), vitamin E, tocopherols, other vitamins or provitamins, and compounds such as alpha lipoic acid. [00214[Unit dosage forms for oral administration, such as syrups, elixirs, and suspensions, can be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet or suppository', contains a predetermined amount of the composition containing one or more compositions. Similarly, unit dosage forms for injection or intravenous administration can comprise the composition or pharmaceutical composition in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier. [00215]Embodiments of the composition or pharmaceutical composition can be formulated into preparations for injection by dissolving, suspending, or emulsifying them in an aqueous or non-aqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. [00216]Embodiments of the composition or pharmaceutical composition can be utilized in aerosol formulation to be administered via inhalation. Embodiments of the composition or pharmaceutical composition can be formulated into pressurized acceptable propellants such as dichiorodifluoromethane, propane, nitrogen and the like. [00217]Embodiments of the composition or pharmaceutical composition can be formulated in an injectable composition in accordance with the disclosure. For example, injectable compositions are prepared as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation can -51 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 also be emulsified or the active ingredient (triamino-pyridine derivative and/or the labeled triamino-pyridine derivative) encapsulated in liposome vehicles in accordance with the disclosure. [00218]In an embodiment, the composition or pharmaceutical composition can be formulated for delivery by a continuous delivery system. The term "continuous delivery system" is used interchangeably herein with "controlled delivery system " and encompasses continuous (e.g., controlled) delivery' devices (e.g., pumps) in combination with catheters, injection devices, and the like, a wide variety of which are known in the art. [00219]Embodiments of the composition or pharmaceutical composition can be administered to a subject in one or more doses. Those of skill will readily appreciate that dose levels can vary as a function of the specific composition or pharmaceutical composition administered, the severity of the symptoms and the susceptibility of the subject to side effects. Dosages for a given compound are readily determinable by those of skill in the art by a variety of means. [00220]In an embodiment, multiple doses of the composition or pharmaceutical composition are administered. The frequency of administration of the composition or pharmaceutical composition can vary depending on any of a variety of factors, e.g.. severity of the symptoms, and the like. For example, in an embodiment, the composition or pharmaceutical composition can be administered once per month, twice per month, three times per month, every other week (qow), once per week (qw), twice per week (bi w)_ three times per week (tiw), four times per week, five times per week, six times per week, every other day (qod), daily (ad), twice a day (qid). three times a day (tid), or four times a day. As discussed above, in an embodiment, the composition or pharmaceutical composition is administered 1 to 4 times a day over a 1 to 10- day time period. [00221]The duration of administration of the composition or pharmaceutical composition analogue, e.g., the period of time over which the composition or pharmaceutical composition is administered, can vary, depending on any of a variety of factors, including patient response. For example, the composition or pharmaceutical composition in combination or separately, can be administered over a period of time of about one day to one week, about one day to two weeks. [00222]Embodiments of the composition or pharmaceutical composition can be administered to a subject using available conventional methods and routes suitable for delivery of Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 conventional drugs, including systemic or localized routes. Routes of administration can include, but are not limited to, enteral administration, parenteral administration, or inhalation. [00223]Other compositions, compounds, methods, features, and advantages of the disclosure will be or become apparent to one having ordinary skill in the art upon examination of the following drawings, detailed description, and examples. It is intended that all such additional compositions, compounds, methods, features, and advantages be included within this description, and be within the scope of the disclosure. [00224]Aspects of the invention are drawn towards method of treating a subject afflicted with an oxalate production-related disease or disorder, the method comprising: administering to the subject a therapeutically effective amount of a compound described herein. In embodiments, the disease comprises a cardiometabolic disease, a cardiovascular disease, a metabolic disease, a liver disease, a renal disease, or a combination thereof. [00225[As used herein, a metabolic disease can refer to to a group of diseases and/or disorders in which errors of metabolism, imbalances in metabolism, or sub-optimal metabolism occur. The metabolic diseases as described herein can comprise diseases that can be treated through the modulation of metabolism, although the disease itself can by a specific metabolic defect. Such metabolic diseases can involve, for example, glucose and fatty acid oxidation pathways. As used herein, "metabolic disorder" or "metabolic disease" refers to a condition characterized by an alteration or disturbance in metabolic function. "Metabolic" and "metabolism" are terms known in the art and can comprise a range of biochemical processes that occur within a living organism. Metabolic and cardiovascular disease includes, but is not limited to. obesity, diabetes, atherosclerosis, metabolic syndrome, dyslipidemia, coronary heart disease, coronary artery disease, arteriosclerosis, atherothrombotic stroke, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis, (NASH), hyperfattyacidemia or metabolic syndrome, 9״ liver fibrosis, obesity, heart disease, atherosclerosis, arthritis, cystinosis, phenylketonuria, proliferative retinopathy. Keams-Sayre disease, or a combination thereof. In embodiments, the dyslipidemia can be hyperlipidemia. The hyperlipidemia can be hypercholesterolemia, hypertriglyceridemia, or both hypercholesterolemia and hypertriglyceridemia. The NAFLD can be hepatic steatosis or steatohepatitis. The diabetes can be type 2 diabetes or type 2 diabetes with dyslipidemia. [00226]In embodiments, methods are presented herein that are applicable to metabolic diseases related to glucose dysregulation and/or accumulation of lipids in the body, circulation -53 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 or various organs, for example, the liver, and the pathological sequelae resulting therefrom, for example, (non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hyperglycemia, prediabetes, diabetes (type 1 and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia. Certain such metabolic diseases, disorders or conditions include, but are not limited to, hyperglycemia, prediabetes, diabetes (type 1 and type II), obesity 7, insulin resistance, metabolic syndrome and diabetic dyslipidemia. In embodiments, the metabolic disease, disorder or condition can be characterized by numerous physical symptoms. Any symptom known to one of skill in the art to be associated with the metabolic disease, disorder or condition can be prevented, treated, ameliorated or otherwise modulated with the compounds and methods described herein. In certain embodiments, the symptom can be any of, but not limited to, excessive urine production (polyuria), excessive thirst and increased fluid intake (polydipsia), blurred vision, unexplained weight loss and lethargy. [00227[As used herein, cardiovascular diseases, disorders or conditions can comprise aortic stenosis, aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery 7 disease, carotid artery disease, coronary heart disease, dyslipidemia, heart failure, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g.. peripheral artery disease, peripheral artery occlusive disease), thromboembolic diseases, retinal vascular occlusion, or stroke. [00228]As used herein, the term nonalcoholic steatohepatitis (NASH) and metabolic dysfunction-associated steatohepatitis (MASH) can be used interchangeably. As used herein, the term nonalcoholic fatty liver disease (NAFLD) and metabolic dysfunction-associated steatotic liver disease (MASLD) can be used interchangeably. [00229]As used herein, the term "liver disease " and "hepatic disease " can be used interchangeably and can refer to damage to or a disease of the liver. Non-limiting examples of liver disease include intrahepatic cholestasis (e.g.. Alagille syndrome, biliary liver cirrhosis), fatty liver (e.g., alcoholic fatty liver, Reye's syndrome), hepatic vein thrombosis, hepatolenticular degeneration (i.e., Wilson's disease), hepatomegaly, liver abscess (e.g., amebic liver abscess), liver cirrhosis (e.g., alcoholic, biliary, and experimental liver cirrhosis), alcoholic liver diseases (e.g., fatty liver, hepatitis, cirrhosis), parasitic liver disease (e.g., hepatic echinococcosis, fascioliasis, amebic liver abscess), jaundice (e.g., hemolytic, hepatocellular, cholestatic jaundice), cholestasis, portal -54- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 hypertension, liver enlargement, ascites, hepatitis (e.g., alcoholic hepatitis, animal hepatitis, chronic hepatitis (e.g., autoimmune, hepatitis B, hepatitis C, hepatitis D, dmg induced chronic hepatitis), toxic hepatitis, viral human hepatitis (e.g., hepatitis A, hepatitis B. hepatitis C, hepatitis D, hepatitis E), granulomatous hepatitis, secondary biliary cirrhosis, hepatic encephalopathy, varices, primary biliary cirrhosis, primary sclerosing cholangitis, hepatic steatosis or steatohepatitis, hepatocellular adenoma, hemangiomas, bile stones, liver failure (e.g., hepatic encephalopathy, acute liver failure), angiomyolipoma, calcified liver metastases, cystic liver metastases, fibrolamellar hepatocarcinoma, hepatic adenoma, hepatoma, hepatic cysts (e.g., Simple cysts, Polycystic liver disease, hepatobiliary cystadenoma, choledochal cyst), mesenchymal tumors (mesenchymal hamartoma, infantile hemangioendothelioma, hemangioma, peliosis hepatis, lipomas, inflammatory pseudotumor), epithelial tumors (e.g., bile duct hamartoma, bile duct adenoma), focal nodular hyperplasia, nodular regenerative hyperplasia, hepatoblastoma, hepatocellular carcinoma, cholangiocarcinoma, cystadenocarcinoma, tumors of blood vessels, angiosarcoma, Karposi’s sarcoma, hemangioendothelioma, embryonal sarcoma, fibrosarcoma, leiomyosarcoma, rhabdomyosarcoma, carcinosarcoma, teratoma, carcinoid, squamous carcinoma, primary lymphoma, peliosis hepatis. erythrohepatic porphyria, hepatic porphyria (e.g.. acute intermittent porphyria, porphyria cutanea tarda), and Zellweger syndrome. In embodiments, the liver disease can comprise fibrosis, a liver disease characterized in that the liver has excess cholesterol, triglycerides or other lipids that is illustrative of liver diseases such as NAFLD, NASH or alcoholic related steatosis of the liver, liver cirrhosis or liver inflammation or hepatocellular carcinoma. [00230]As used herein, the terms "renal disease " and "kidney disease " can be used interchangeably and can refer to a disease or condition in which the function of a subject ’s kidney is impaired. For example, the renal disease can comprise Abderhalden- Kaufmann- Lignac syndrome (Nephropathic Cystinosis), Nephrotoxicity. Acute Kidney Failure/ Acute Kidney Injury, Acute Lobar Nephroma, Acute Phosphate Nephropathy, Acute Tubular Necrosis, Adenine Phosphoribosyltransferase Deficiency, Adenovirus Nephritis, Alagille Syndrome, Alport Syndrome, Amyloidosis, ANCA Vasculitis Related to Endocarditis and Other Infections, Angiomyolipoma, Analgesic Nephropathy, Antiphospholipid Syndrome, Anti-TNF-a Therapy-related Glomerulonephritis, APOLI Mutations, Apparent Mineralocorticoid Excess Syndrome, Aristolochic Acid Nephropathy, Chinese Herbal-55 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Nephropathy, Balkan Endemic Nephropathy, Arteriovenous Malformations and Fistulas of the Urologic Tract, Autosomal Dominant Hypocalcemia, Bardet-Biedl Syndrome, Bartter Syndrome, 0-Thalassemia Renal Disease, Bile Cast Nephropathy, Clq Nephropathy, CGlomerulopathy. C3 Glomerulopathy with Monoclonal Gammopathy, C4 Glomerulopathy, Calcineurin Inhibitor Nephrotoxicity, Callilepsis Laureola Poisoning, Cardiorenal syndrome, CFHR5 nephropathy, Charcot-Marie-Tooth Disease with Glomerulopathy, Cholesterol Emboli, Churg-Strauss syndrome, Chyluria, Ciliopathy, Cold Diuresis, Collagenofibrotic Glomerulopathy. Collapsing Glomerulopathy, Collapsing Glomerulopathy Related to CMV, Combination Antiretroviral (cART) Related-Nephropathy, Congenital Anomalies of the Kidney and Urinary Tract (CAKUT), Congenital Nephrotic Syndrome, Congestive Renal Failure, Conorenal syndrome (Mainzer-Saldino Syndrome or Saldino-Mainzer Disease), Contrast Nephropathy, Cortical Necrosis. Cryocrystalglobulinemia, Cryoglobuinemia, Cystic Kidney Disease, Acquired, Cystinuria, Dasatinib-Induced Nephrotic-Range Proteinuria, Dense Deposit Disease (MPGN Type 2), Dent Disease (X-linked Recessive Nephrolithiasis), DHA Cry stalline Nephropathy, Dialysis Disequilibrium Syndrome, Diabetes and Diabetic Kidney Disease, Diabetes Insipidus, Diffuse Mesangial Sclerosis, Diuresis, Duplicated Ureter. EAST syndrome, Ebola and the Kidney, Ectopic Kidney, Ectopic Ureter, Edema, Swelling, Erdheim-Chester Disease, Fabry 's Disease, Familial Hypocalciuric Hypercalcemia, Fanconi Syndrome, Fraser syndrome, Fibronectin Glomerulopathy, Fibrillary Glomerulonephritis and Immunotactoid Glomerulopathy, Fraley syndrome, Fluid Overload, Hypervolemia, Focal Segmental Glomerulosclerosis, Focal Sclerosis. Focal Glomerulosclerosis, Galloway Mowat syndrome, Giant Cell (Temporal) Arteritis with Kidney Involvement, Gestational Hypertension, Gitelman Syndrome, Glomerular Diseases, Glomerular Tubular Reflux, Glycosuria, Goodpasture Syndrome, HANAC Syndrome, Heat Stress Nephropathy, Hematuria (Blood in Urine), Hemolytic Uremic Syndrome (HUS), Atypical Hemolytic Uremic Syndrome (aHUS). Hemophagocytic Syndrome, Hemorrhagic Cystitis, Hemorrhagic Fever with Renal Syndrome (HFRS, Hantavirus Renal Disease, Korean Hemorrhagic Fever, Epidemic Hemorrhagic Fever, Nephropalhis Epidemica), Hemosiderinuria, Hemosiderosis related to Paroxysmal Nocturnal Hemoglobinuria and Hemolytic Anemia. Hepatic Glomerulopathy, Hepatic Veno- Occlusive Disease, Sinusoidal Obstruction Syndrome, Hepatitis C-Associated Renal Disease, Hepatocyte Nuclear Factor 10-Associated Kidney Disease, Hepatorenal Syndrome, Herbal -56- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Supplements and Kidney Disease, High Altitude Renal Syndrome, High Blood Pressure and Kidney Disease, HIV- Associated Immune Complex Kidney Disease (HIVICK), HIV- Associated Nephropathy (HIVAN), HNFIB-related Autosomal Dominant Tubulointerstitial Kidney Disease. Horseshoe Kidney (Renal Fusion), Hunner ’s Ulcer, Hydroxychloroquine-induced Renal Phospholipidosis, Hyperaldosteronism, Hypercalcemia, Hyperkalemia, Hypermagnesemia, Hypernatremia, Hyperoxaluria, primary hyperoxaluria, Hyperphosphatemia, Hypocalcemia, Hypocomplementemic Urticarial Vasculitic Syndrome, Hypokalemia, Hypokalemia-induced renal dysfunction, Hypokalemic Periodic Paralysis, Hypomagnesemia, Hyponatremia, Hypophosphatemia, Hypertension, Hypertension, Immersion Diuresis, Immune-Checkpoint Therapy-Related Interstitial Nephritis, Interstitial Cystitis, Interstitial Nephritis, Interstitial Nephritis, Karyomegalic, JC Virus Nephropathy, Joubert Syndrome, Kidney Stones, Nephrolithiasis, Lecithin Cholesterol Acy!transferase Deficiency (LCAT Deficiency), Leptospirosis Renal Disease. Light Chain Deposition Disease, Monoclonal Immunoglobulin Deposition Disease, Light Chain Proximal Tubulopathy, Liddle Syndrome, Lightwood- Albright Syndrome, Lipoprotein Glomerulopathy, LMX1B Mutations Cause Hereditary FSGS, Loin Pain Hematuria. Lupus Kidney Disease, Lupus Nephritis, Lupus Nephritis with Antineutrophil Cytoplasmic Antibody Seropositivity, Lupus Podocytopathy, Lyme Disease- Associated Glomerulonephritis, Lysinuric Protein Intolerance, Lysozyme Nephropathy, Malarial Nephropathy, Malignancy- Associated Renal Disease, Malignant Hypertension, Malakoplakia, McKittrick-Wheelock Syndrome, Meatal Stenosis, Medullary Cystic Kidney Disease, Urolodulin- Associated Nephropathy, Juvenile Hyperuricemic Nephropathy Type 1, Medullary Sponge Kidney, Megaureter. Melamine Toxicity and the Kidney, MELAS Syndrome, Membranoproliferative Glomerulonephritis, Membranous Nephropathy, Membranous-like Glomerulopathy with Masked IgG Kappa Deposits, MesoAmerican Nephropathy, Metabolic Acidosis, Metabolic Alkalosis, Microscopic Polyangiitis, Milk-alkalai syndrome, Minimal Change Disease, Monoclonal Gammopathy of Renal Significance, Dysproteinemia. MUCI Nephropathy, Multicystic dysplastic kidney, Multiple Myeloma, Myeloproliferative Neoplasms and Glomerulopathy, Nail-patella Syndrome, NARP Syndrome, Nephrocalcinosis, Nephrogenic Systemic Fibrosis, Nephroptosis (Floating Kidney, Renal Ptosis), Nephrotic Syndrome. Neurogenic Bladder, Nodular Glomerulosclerosis, Non-Gonococcal Urethritis, Nutcracker syndrome, Oligomeganephronia, Orofaciodigital Syndrome, Orotic Aciduria, Orthostatic Hypotension, Orthostatic Proteinuria, -57 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Osmotic Diuresis, Osmotic Nephrosis, Ovarian Hyperstimulation Syndrome, Oxalate Nephropathy, Page Kidney, Papillary Necrosis, Papillorenal Syndrome (Renal-Coloboma Syndrome, Isolated Renal Hypoplasia), PARN Mutations and Kidney Disease, The Peritoneal- Renal Syndrome, POEMS Syndrome, Podocyte Infolding Glomerulopathy, Post-infectious Glomerulonephritis, Post-streptococcal Glomerulonephritis, Post-infectious Glomerulonephritis, Polyarteritis Nodosa, Polycystic Kidney Disease, Proliferative Glomerulonephritis with Monoclonal IgG Deposits (Nasr Disease), Proteinuria (Protein in Urine), Pseudohyperaldosteronism, Pseudohypobicarbonatemia, Pseudohypoparathyroidism, Pulmonary-Renal Syndrome, Pyelonephritis (Kidney Infection), Pyonephrosis, Pyridium and Kidney Failure, Radiation Nephropathy, Refeeding syndrome, Reflux Nephropathy, Rapidly Progressive Glomerulonephritis, Renal Abscess, Peripnephric Abscess, Renal Agenesis, Renal Arcuate Vein Microthrombi-Associated Acute Kidney Injury, Renal Artery Aneurysm. Renal Artery Dissection, Spontaneous, Renal Artery Stenosis, Renal Cell Cancer, Renal Cyst, Renal Hypouricemia with Exercise-induced Acute Renal Failure, Renal Infarction, Renal Osteodystrophy, Renal Tubular Acidosis, Renin Mutations and Autosomal Dominant Tubulointerstitial Kidney Disease, Renin Secreting Tumors (Juxtaglomerular Cell Tumor), Reset Osmostat, Retroperitoneal Fibrosis. Rhabdomyolysis, Rheumatoid Arthritis-Associated Renal Disease, Sarcoidosis Renal Disease, Salt Wasting, Renal and Cerebral, Schistosomiasis and Glomerular Disease, Schimke immuno-osseous dysplasia, Scleroderma Renal Crisis, Serpentine Fibula- Polycystic Kidney Syndrome, Exner Syndrome, Sickle Cell Nephropathy, Silica Exposure and Chronic Kidney Disease, Sri Lankan Farmers' Kidney Disease, Sjogren's Syndrome and Renal Disease, Kidney Disease Related to Stem Cell Transplantation, TAFRO Syndrome, Tea and Toast Hyponatremia, Tenofovir-Induced Nephrotoxicity, Thin Basement Membrane Disease, Benign Familial Hematuria, Thrombotic Microangiopathy Associated with Monoclonal Gammopathy, Trench Nephritis. Genitourinary, Tuberous Sclerosis, Tubular Dysgenesis, Immune Complex Tubulointerstitial Nephritis Due to Autoantibodies to the Proximal Tubule Brush Border, Tumor Lysis Syndrome, Uremia, Vasomotor Nephropathy, Vesicointestinal Fistula, Vesicoureteral Reflux, VGEF Inhibition and Renal Thrombotic Microangiopathy, Von Hippel- Lindau Disease. Waldenstrom's Macroglobulinemic Glomerulonephritis, Warfarin-Related Nephropathy, Wegener's Granulomatosis, Granulomatosis with Polyangiitis, Wunderlich syndrome, Zellweger Syndrome, or Cerebrohepatorenal Syndrome.-58- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-231" id="p-231" id="p-231" id="p-231"

[00231]In embodiments, the term hyperoxaluria can refer to a high concentration of oxalate in urine. In embodiments, the hyperoxaluria can comprise primary hyperoxalurias (PH-1, PH- and PH-3), secondary hyperoxaluria, idiopathic calcium oxalate urolithiasis. For example, the disease can comprise primary hyperoxaluria, for example PH-1. [00232]The term hyperoxaluria refers to a high concentration of oxalate in urine. This situation may have a number of different causes. Hyperoxalurias can be classified as primary and secondary. Primary hyperoxalurias (PH) are a group of autosomal recessive genetic disorders involving enzyme failures that lead to an endogenous surplus production of oxalate. PH can comprise PHI, PH2, and PH3, with PHI being the most common and the most aggressive. [(1) Bhasin, B. Primary and Secondary Hyperoxaluria: Understanding the Enigma. World Journal of Nephrology 2015, 4 (2), 235]. The same genetic error that gives rise to PHhas also been linked to idiopathic oxalate lithiasis. [(l)Monico, C. G.; Rossetti, S.: Belostotsky, R; Cogal, A. G; Herges, R. M.: Seide, B. M.; Olson, J. B.; Bergstrahl, E. J.; Williams, H. 1: Haley, W. E.; et al. Primary Hyperoxaluria Type III Gene HOGA1 (Formerly DHDPSL) as a Possible Risk Factor for Idiopathic Calcium Oxalate Urolithiasis. CJASN 2011, 6 (9), 2289- 2295.] [00233]Secondary hyperoxalurias can be due to an excessive absorption of oxalate or its precursors in the bowel. This is linked to a diet rich in said precursors, or in the case of enteric hyperoxaluria, to an absorption disorder after bowel resection. [(1) Cochat, P.; Rumsby, G. Primary Hyperoxaluria. New England Journal of Medicine 2013, 369 (7), 649-658. (2) Lorenz, E. C.; Michet, C. J.; Milliner. D. S.; Lieske, J. C. Update on Oxalate Crystal Disease. Curr Rheumatol Rep 2013, 15 (7), 340. (3) Karaolanis, G.; Lionaki, S.; Moris, D.; Palla, V.-V.; Vernadakis, S. Secondary Hyperoxaluria: A Risk Factor for Kidney Stone Formation and Renal Failure in Native Kidneys and Renal Grafts. Transplantation Reviews 2014, 28 (4), 182-187], [00234]Primary hyperoxaluria type 1 [00235[Primary hyperoxaluria type 1 (PH-1) is a serious hereditary disease due to a deficiency of the AGT enzyme (encoded by the Agxtl gene) in hepatocytes [Zhang, X; Roe, S.M.; Hou, Y.; Bartlam, M.; Rao, Z.; Pearl, L.H.; Danpure, C.J. J. Mol. Biol. 2003, 331, 643- 652]. This enzyme, AGT, is in charge of metabolizing glyoxylate in hepatic peroxisomes by transamination into glycine. In PH-L where AGT activity is absent or the enzyme is erroneously located in the mitochondria, glyoxylate accumulation occurs as a result. Glyoxylate, then, comes to be metabolized by oxidation to oxalate, a process that is catalyzed -59- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 by glycolate oxidase (GO) enzymes in peroxisomes and lactate dehydrogenase (LDH) in the cytoplasm. An excess production of oxalate, which can only be excreted in urine, produces renal capacity saturation and causes oxalate to precipitate in the form of insoluble calcium oxalate crystals. These crystals damage the renal tissue, reducing the excretory capacity of the kidney until ultimately leading to terminal kidney disease. As kidney damage progresses, oxalate accumulation becomes widespread and causes blood vessel, bonejoint, retinal, skin, bone marrow, heart and central nervous system disorders, ultimately leading to the patient ’s death. PH-1 is a rare disease with an estimated incidence in Europe of 1:100000 births per year [Cochat, P.; Hulton, S.A.; Acquaviva, C.; Danpure, C. J.; Daudon, M.; Marchi, M. D.; Fargue, S.; Groothoff, J.; Harambat, 1; Hoppe, B.; et al. Nephrol. Dial. Transplant. 2012, 27, 1729- 1736.], but it presents at an unusually high frequency in the Canary7 Islands [(1) Lorenzo, V.; Alvarez, A.; Torres, A.; Torregrosa, V.; Hernandez, D.; Salido, E. Kidney Int. 2006, 70, 1115- 1119. (2) Santana, A.; Salido, E.; Torres, A.; Shapiro. L. J. PNAS 2003, 100. 7277-7282], [00236]In embodiments, the disease comprises a GO-associated disease and/or lactate dehydrogenase (LDHA)-associated disease. [00237]For example, the compound described herein comprises: Formula (I), Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 OH O FL-22 id="p-238" id="p-238" id="p-238" id="p-238"

[00238]The term "subject " or "patient " can refer to any organism to which aspects of the invention can be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. For example, subjects to which compounds of the disclosure can be administered include animals, such as mammals. Non-limiting examples of mammals include primates, such as humans. For veterinary applications, a wide variety of subjects will be suitable, e.g., livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals for example pets such as dogs and cats. For diagnostic or research applications, a wide variety of mammals will be suitable subjects, including rodents (e.g., mice, rats, hamsters), rabbits, primates, and swine such as inbred pigs and the like. The term "living subject " can refer to a subject noted above or another organism that is alive. The term "living subject " can refer to the entire subject or organism and not just a part excised (e.g., a liver or other organ) from the living subject. As used herein, "pharmaceutically acceptable derivatives" of a compound can include salts, esters, enol ethers, enol esters, acetals, ketals, orthoesters, hemiacetals, hemiketals, acids, bases, solvates, hydrates or prodrugs thereof. Such derivatives can be readily prepared by those of skill in this art using known methods for such derivatization. The compounds produced can be Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 administered to animals or humans without substantial toxic effects and either are pharmaceutically active or are prodrugs. [00239]In embodiments, the method can comprise measuring the circulating oxalate levels of a subject. In embodiments, if the subjects circulating oxalate levels are elevated, therapeutic levels of the compounds described herein can be administered. In embodiments a subject's oxalate levels can be measured by enzymatic assay, mass spectrometry, or a combination thereof. For example, the mass spectrometry can comprise LC-MS/MS. In embodiments, a clinician of ordinary skill in the art can determine if the subject ’s oxalate levels are elevated. [00240]In embodiments, elevated circulating oxalate levels can comprise less than about uM, about 1 uM, about 1.5 uM, about 2 uM, about 2.5 uM, about 3 uM, about 4 uM, about uM, about 6 uM, about 7 uM, about 8 uM, about 9 uM, about 10 uM, or greater than about uM. [00241[As used herein, the term "administering" can refer to introducing a substance, such as the compounds described herein, or derivatives thereof, isomers thereof, or a combination thereof into a subject. Any route of administration can be utilized including, for example, intranasal, topical, oral, parenteral, intravitreal, intraocular, ocular, subretinal, intrathecal, intravenous, subcutaneous, transcutaneous, intracutaneous, intracranial and the like administration. In embodiments, "administering" can also refer to providing a therapeutically effective amount of a formulation or pharmaceutical composition to a subject. The formulation or pharmaceutical compound can be administered alone, but can be administered with other compounds, excipients, fillers, binders, carriers or other vehicles selected based upon the chosen route of administration and standard pharmaceutical practice. Administration can be by way of carriers or vehicles, such as injectable solutions, including sterile aqueous or non- aqueous solutions, or saline solutions; creams; lotions; capsules; tablets; granules; pellets; powders; suspensions, emulsions, or microemulsions; patches; micelles; liposomes; vesicles; implants, including microimplants; eye drops; other proteins and peptides; synthetic polymers; microspheres; nanoparticles; and the like. [00242]In embodiments, the therapeutically effective amount of the composition inhibits GO activity, LDHA activity, or a combination thereof. [00243]In embodiments a therapeutically effective amount of a composition described herein can comprise less than about 0.1 mg/kg, about 0.1 mg/kg, about 0.5 mg/kg, about 1.0 mg/kg, about 2.5 mg/kg, about 5 mg/kg, about 7.5 mg/kg, about 10 mg/kg, about 15 mg/kg, about -62- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 70 mg/kg, about 80 mg/kg, about mg/kg, about 100 mg/kg, about 120 mg/kg, about 135 mg/kg, about 150 mg/kg. about 175mg/kg, about 200 mg/kg, about 225 mg/kg, about 250 mg/kg, about 275 mg/kg. about 300mg/kg, about 325 mg/kg, about 350 mg/kg, about 375 mg/kg, about 400 mg/kg, about 425mg/kg, about 450 mg/kg, about 475 mg/kg, about 500 mg/kg, about 525 mg/kg, about 550mg/kg, about 575 mg/kg, about 600 mg/kg, about 625 mg/kg, about 650 mg/kg, about 675mg/kg, about 700 mg/kg, about 725 mg/kg, about 750 mg/kg, about 775 mg/kg. about 800mg/kg, about 825 mg/kg, about 850 mg/kg, about 875 mg/kg, about 900 mg/kg, about 1.0 g/kg, about 1.5 g/kg, about 2.0 g/kg, about 2.5 g/kg, about 5 g/kg, about 10 g/kg, about 25 g/kg, about 50 g/kg, or more than 50 g/kg of compound per body weight of a subject. [00244]In embodiments a therapeutically effective amount of a composition described herein can comprise a concentration of less than about 1 nM, about 1 nM, about nM, about 10 nM, about 20 nM, about 25 nM, about 30 nM, about 40 nM, about 50 nM, about nM, about 75 nM, about 80 nM, about 90 nM, about 100 nM, about 200 nM, about 250 nM, about 300 nM, about 400 nM. about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1000 nM. and greater than about 1000 nM. For example, the concentration can be about 500 nM. For example, the concentration can be about 700 nM.

EXAMPLES id="p-245" id="p-245" id="p-245" id="p-245"

[00245]Examples are provided herein to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only, since alternative methods can be utilized to obtain similar results.

EXAMPLE 1 id="p-246" id="p-246" id="p-246" id="p-246"

[00246]Example 1: Genetic and pharmacological targeting of hepatic oxalate overproduction ameliorates nonalcoholic steatohepatitis [00247] Abstract Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-248" id="p-248" id="p-248" id="p-248"

[00248]The prevalence of nonalcoholic steatohepatitis (NASH) is increasing, and with no pharmacological therapy available, identification of new metabolic targets is urgently needed. The liver-specific alanine-gly oxy late aminotransferase (AGXT) detoxifies glyoxylate, preventing the accumulation of the metabolic end-product oxalate. Here, we report that AGXT is suppressed in livers from patients and mice with NASH and multiple in vitro systems of lipid-loaded hepatocytes, leading to oxalate overproduction. In turn, oxalate promotes lipid accumulation in hepatocytes by impairing the transcription of peroxisome proliferator activated receptor-alpha (PPARa) and inhibiting fatty acid (?-oxidation (FAO). In male mice with diet-induced NASH, blocking oxalate overproduction through hepatocyte-specific AGXT overexpression or pharmacological inhibition of glycolate oxidase and lactate dehydrogenase potently lowers hepatic oxalate, steatosis, inflammation, and fibrosis by inducing PPARa- driven FAO, and suppressing leukocyte chemotaxis, and nuclear factor-kappaB and transforming growth factor-beta targets. These findings highlight hepatic oxalate overproduction as a new target for the treatment of NASH [00249]Introduction [00250]Nonalcoholic fatty liver disease (NAFLD) has become the most common chronic liver disease worldwide, affecting an alarming one-third of the global population 1. NAFLD encompasses a spectrum of liver pathologies, ranging from simple steatosis, nonalcoholic steatohepatitis (NASH) that can or cannot be accompanied by hepatic fibrosis, and ultimately cirrhosis, which is associated with late-stage liver disease and can lead to hepatocellular carcinoma and liver failure 23־. Central to the pathogenesis of NASH, hepatic lipid overload occurs with excessive uptake of fatty acids released from the adipose tissue 4, enhanced de novo lipogenesis from excessive carbohydrate intake 5, or inhibition of fatty acid ]?-oxidation (FAO). These lead to the accumulation of reactive oxygen species, mitochondrial dysfunction, and endoplasmic reticulum (ER) stress 4, which culminate in lipotoxicity. Consequently, inflammasome activation leads to the release and accumulation of proinflammatory mediators, which facilitate leukocyte infiltration and hepatic stellate cell activation, promoting NASH and hepatic fibrosis2,3,4. Despite major advances in our current understanding of the metabolic and molecular mechanisms driving NASH, and considerable efforts in the development of drugs targeting lipid and carbohydrate metabolism, no approved therapy currently exists for the treatment of NASH6. Therefore, identification of alternative metabolic targets for the treatment of NASH is urgently needed.-64- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-251" id="p-251" id="p-251" id="p-251"

[00251]While abnormal metabolism of lipids and carbohydrates are known features of NAFLD7, accumulating evidence indicates impaired amino acid metabolism and its causative role in the pathogenesis of NASH. Notably, lower circulating glycine is consistently reported in association with worsen NASH symptoms in humans 8,9, and its deficiency accelerates the disease in mice 10. The liver-specific enzyme, alanine-glyoxylate aminotransferase (AGXT), plays a central role in catalyzing glycine formation from glyoxylate 11,12, and recent transcriptomics studies from our group and others consistently reported suppression of AGXT in livers from patients and mice with NASH10,13,14. AGXT loss-of-function results in the accumulation of glyoxylate 15. Glyoxylate can also be produced from glycolate by glycolate oxidase (GO) and is rapidly converted by lactate dehydrogenase (LDHA) to the terminal end- product oxalate 16. While our recent studies demonstrated that the loss of AGXT exacerbates diet-induced NASH in mice 10, the circulating and hepatic levels of oxalate in patients with NASH, the effects of oxalate accumulation in hepatocytes, the primary cells responsible for its formation, and the therapeutic potential of targeting impaired oxalate metabolism in NASH, have not been systematically studied. [00252]Considering the consistent reports of suppressed AGXT in NASH10,13,14, the known deleterious effects of oxalate in renal and cardiovascular diseases 1721־, together with the rising prevalence of NASH and lack of available therapies 1,6, there is a strong rationale to better understand impaired oxalate metabolism in NASH and to evaluate the therapeutic potential of targeting this pathway. In the study, we evaluated the circulating and hepatic levels of oxalate in well-defined human cohorts as well as in multiple mouse models of NASH and hepatocellular in vitro systems. Furthermore, we evaluated the effects of oxalate on molecular drivers of NASH within hepatocytes regulating lipid metabolism, mitochondrial function, and inflammatory' responses. Finally , utilizing hepatocyte-specific overexpression of AGXT and pharmacological inhibition of GO and LDHA in vivo and in vitro combined with transcriptomics and functional assays, we defined the protective effects of genetic and pharmacological targeting of oxalate overproduction in NASH and the underlying mechanisms behind this newly identified approach. [00253]Results [00254]Suppressed AGXT and increased oxalate in livers from humans and mice with NASH and in lipid-loaded hepatocytes.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-255" id="p-255" id="p-255" id="p-255"

[00255]While previous studies reported lower transcript levels of AGXT in livers from patients with NASH1022■14 ־ 13 ־ , AGXT protein abundance, the circulating and hepatic levels of oxalate have not been assessed in a well-defined cohort of patients with or without NASH. We evaluated the concentrations of oxalate in plasma samples from patients diagnosed with NASH compared to healthy controls (Non-NASH). While patients with NASH had significantly elevated levels of plasma transaminases, there were no significant differences in race, age, or sex between the patients with or without NASH (Fig. 9 Panel A). Plasma oxalate levels in Non-NASH controls were similar to previous reports, 23 and were significantly increased in patients with NASH (Fig. 1Panel A).Consistent with increased plasma oxalate and previous reports 10,13,14-22, we confirmed a significant reduction in AGXTmRNA levels in liver samples from an additional cohort of patients with NASH (Fig. 1Panel B and 1Panel C).Importantly, there were no significant differences in race, age, or sex between the patients with NASH and Non-NASH controls (Fig. 9Panel B).Additionally, we found a significant decrease in AGXT protein abundance in livers from patients with NASH (Fig. 1Panel D and 1Panel E).Aligned with the known consequence of AGXT loss-of-flmction 1,,,2,1’,24, we found that oxalate concentrations were significantly increased in livers from patients with NASH compared to those without NASH (Fig. 1 Panel F). Notably, a highly significant inverse correlation was found between reduced AGXT protein abundance and the accumulation of oxalate in the liver (Fig. 1 Panel G). We evaluated if suppressed AGXT and the ensuing accumulation of oxalate are consistently observed in livers from mice with NASH. We fed male C57BL/6J mice a. standard chow diet (control) or a high-fat, high-fructose, high-cholesterol diet (NASH diet) for months (Fig. 1 Panel H). This dietary model is known to induce steatohepatitis and hepatic fibrosis that mimic the human disease 10,2’’26,27, as we confirmed using H&E and Picrosirius Red staining (Fig. 1 Panel I). Similar to patients with NASH, livers from mice with NASH demonstrated a significant reduction in Agxt niRNA expression (Fig. 1 Panel J) and AGXT protein abundance (Fig. 1 Panel K and Panel L). To confirm that the suppression of AGXT in mice with NASH is not diet- or sex-specific, we further assessed the protein abundance of AGXT in male and female C57BL/6J mice fed the fructose-palmitate-cholesterol (FPC) diet for 4 months, another established model of NASH28, as we confirmed using H&E staining (Fig. 11) Panels A B). A significant decrease in AGXT protein abundance was found in livers from both male (Fig. 10 Panels C and D) and female (Fig. 10 Panels E and F) mice with NASH induced by the FPC diet. Consistent with the suppression of AGXT and the human data, oxalate -66- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 concentrations were significantly enhanced in livers from mice with NASH (Fig. 1 Panel M), and positively correlated with the histological scores of hepatic steatosis, inflammation, ballooning, and the overall NAFLD activity score (NAS) (Fig. 10 Panel G). Next, we evaluated if lipid loading in hepatocytes is sufficient to suppress AGXT and enhance oxalate accumulation in vitro. We isolated primary hepatocytes from mice, treated them with 200 pM of BSA-conjugated palmitic acid or BSA control and confirmed the accumulation of lipids in the hepatocytes (Fig. 1 Panel N). Following palmitic acid treatment, primary- hepatocytes showed a. significant reduction in Agxt expression (Fig. 1 Panel O). These observations were consistent in the HepG2 human hepatoma cell line, which largely retain the biochemical pathways of oxalate metabolism 29. HepG2 cells also demonstrated a. significant reduction in AGXT following palmitic acid treatment (Fig. 1 Panel N and Panel O). Accordingly, a significant accumulation of intracellular oxalate was found in both primary' hepatocytes (Fig. Panel P) and HepG2 cells (Fig. 1 Panel Q). In summary, hepatic AGXT is suppressed leading to oxalate overproduction in both humans and mice with NASH as well as in lipid- loaded hepatocytes. [00256]Oxalate reduction via AGXT overexpression ameliorates NASH [00257]Considering that AGXT is suppressed in NASH leading to hepatic oxalate overproduction and that the loss of AGXT accelerates NASH progression in mice 10, we next evaluated whether overexpression of AGXT in hepatocytes can improve NASH outcomes by lowering oxalate production. We injected C57BL/6J mice with AAV8-AGXT or AAV8-GFP (control) driven by the hepatocyte-specific thyroxine binding globulin (TBG) promoter 19, and placed them on the NASH diet for 6 months (Fig. 2Panel A).At endpoint, we confirmed that TBG-driven GFP expression was only observed in hepatocytes (Fig. 11Panel A),and that there was no overexpression of AGXT in extrahepatic tissues following AAV8-AGXT injection (Fig. 11Panel B).We further confirmed the overexpression of AGXT (Fig. 2Panel B)aligned with a significant decrease in oxalate (Fig. 2Panel C)in livers from mice treated with AAV8-AGXT. The mice were further assessed for alterations in body weight, liver weight, and circulating transaminases. While mice overexpressing AGXT had no significant differences in body weight (Fig. 3Panel C), they showed significantly reduced liver weight (Fig. 3Panel D),and liver-to-body weight ratio compared to mice treated with AAV8-GFP (Fig. 2Panel D).Accordingly, plasma aspartate aminotransferase (AST, Fig. 2Panel E)and alanine aminotransferase (ALT, Fig.2 Panel F),established biomarkers of liver injury, were-67- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 significantly decreased in mice overexpressing AGXT in hepatocytes. Despite no obvious differences in adiposity based on body weight and gross morphology 7 of the abdominal cavity (Fig.2 Panels G and H).Histopathological analyses based on H&E staining (Fig. 2Panel I) demonstrated significant reductions in the scores of hepatic steatosis, lobular inflammation, and the overall NAS (Fig. 2Panel J). Altogether, these data indicate that lowering hepatic oxalate overproduction through hepatocyte-specific overexpression of AGXT ameliorates NASH. [00258]Oxalate reduction via AGXT overexpression lowers hepatic steatosis through induction of fatty acid -oxidation pathways [00259]To explore potential mechanisms by which lowering oxalate via AGXT overexpression ameliorates NASH, we performed unbiased RNA-sequencing of livers from mice treated with AAV8-GFP or AAV8-AGXT following 6 months on the NASH diet. Principal component analysis (PCA) revealed that the gene expression pattern of livers from mice treated with AAV8-GFP was distinct from those treated with AAV8-AGXT (Fig. 3Panel A).Volcano plot showed over 700 differentially expressed genes (DEGs), with 5significantly reduced and 199 significantly elevated in livers from mice overexpressing AGXT compared to mice treated with AAV8-GFP (Fig. 3Panel B).KEGG pathway analysis showed a most significant enrichment in the peroxisome pathway together with other key pathways related to FAO, including fatty acid degradation and PPAR signaling pathways (Fig. 3Panel C).RNA-sequencing analysis (Fig. 3Panel D),validated by qRT-PCR analyses (Fig. 3Panel E),revealed that key genes driving hepatic FAO, including peroxisome proliferator activated receptor alpha (Ppara the master regulator of FAO30’, PPARy coactivator-la (Ppargcla and numerous of PPARa target genes (carnitine palmitoyltransferase 1A, Cptla. acyl-CoA dehydrogenase, medium chain Acadm, acyl-CoA dehydrogenase, long Chain Acadl, acyl- CoA dehydrogenase very long Chain AcadvI. acyl-CoA oxidase l [Xcox7], hydroxyacyl-CoA dehydrogenase subunit alpha Hadha. Hadhb. acetyl-CoA acyltransferase 2 Acaa2V and acyl-CoA synthetase long chain 1 [v4c.sZ7] )3° were significantly upregulated in livers from mice overexpressing AGXT in hepatocytes. Because enhanced utilization of fatty acids can reduce hepatic lipid accumulation, we next measured neutral lipids using Oil Red O staining of liver sections from mice treated with AAV8-GFP or AAV8-AGXT and fed the NASH diet. Consistent with the transcriptional alterations, livers from mice overexpressing AGXT had significantly reduced neutral lipid accumulation (Fig. 3Panels F and G).Furthermore, -68- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 biochemical analysis of liver lysates confirmed a significant reduction in hepatic triglycerides with AGXT overexpression (Fig. 3Panel H).In addition, livers from mice overexpressing AGXT had significantly reduced levels of the lipid peroxidation marker, malondialdehyde (MDA), assessed by the thiobarbituric acid reactive substances (TEARS) assay (Fig. 11Panel E).Taken together, these findings indicate that lowering oxalate via AGXT overexpression attenuates hepatic steatosis through induction of FAO. [00260]Oxalate induces lipid accumulation in hepatocytes through suppression of PPARa- regulated fatty acid (3-oxidation [00261]Considering that lipid loading enhances oxalate in hepatocytes, and that lowering hepatic oxalate attenuates steatohepatitis through induction of FAO pathways, we evaluated the effects of oxalate on lipid metabolism in hepatocytes. We evaluated the concentration of exogenous oxalate needed to achieve the levels of endogenous oxalate increased intracellularly following palmitic acid treatment (Fig. 1Panels P and Q)in both primary hepatocytes (2pM sodium oxalate, Fig. 12Panel A)and HepG2 cells (500 pM sodium oxalate, Fig. 4Panel B).Oxalate induced lipid accumulation as assessed by Nile Red staining in both mouse primary hepatocytes and HepG2 cells (Fig. 4Panels A and B).To evaluate the mechanisms by which oxalate promotes lipid accumulation in hepatocytes, we assessed the expression of key genes regulating fatty acid uptake and transport, fatty acid and lipid biosynthesis, as well as FAO by qRT-PCR. In both primary' hepatocytes (Fig. 13Panel A)and HepG2 cells (Fig. 13Panel B), oxalate did not significantly alter the expression of key genes regulating fatty' acid uptake and transport including CD36, solute carrier family 27 member 2 (SLC27A2 SLC27A4, and SLC27A5. In regards to fatty acid and lipid biosynthesis, primary hepatocytes treated with oxalate showed a significant increase in the key lipogenic genes, fatty acid synthase (Fasn) and acetyl-CoA carboxylase alpha C4caca). with no significant differences in the expression of stearoyl-Coenzyme A desaturase 1 (Scdl) or sterol regulatory element binding transcription factor 1 ^Srebfl the master regulator of fatty acid and lipid biosynthesis 31 (Fig. 13Panel C). Furthermore, HepG2 cells treated with oxalate showed no significant alterations in genes regulating fatty7 acid and lipid biosynthesis (Fig. 13Panel D).In contrast, and consistent with the changes in hepatic oxalate and the transcriptional alterations in livers from mice treated with AAV8-GFP or AAV8-AGXT, key genes regulating FAO were significantly downregulated in both mouse primary hepatocytes (Fig. 4Panel C)and HepG2 cells (Fig. 4 Panel D)treated with oxalate, including PPARA, PPARGC1A, CPT1A, and ACADM. In line -69- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 with the qRT-PCR analyses, oxalate significantly reduced the protein abundance of CPTla, which is regulated by PPARa and catalyzes the rate-limiting step of FAO by converting acyl- CoAs into acylcarnitines allowing their subsequent mitochondrial P-oxidation30 (Fig. 4Panel E). [00262]We evaluated how oxalate suppresses the expression of PPARA and its target genes promoting FAO. To test whether the effect of oxalate on PPARA expression is at the transcriptional level, we treated HepG2 cells with oxalate in the absence or presence of the RNA Pol II inhibitor actinomycin D for 24 hours. While oxalate treatment significantly reduced the expression of PPARA compared to control in the absence of actinomycin D, RNA Pol II inhibition abolished this effect, indicating that oxalate inhibits PPARA transcription (Fig. 4 Panel F)consistent with the dow nregulation of PPARA and its target genes. To assess whether oxalate directly regulates PPARa transcriptional activity, we used a dual-luciferase reporter system. HepG2 cells were transfected with a PPAR response element (PPRE) reporter (PPREx3-TK-luciferase), human PPARa and Renilla constructs, and treated with or without oxalate or with the PPARa agonist Wy 14,64332 as a positive control. Treatment with oxalate significantly decreased PPARa transcriptional activity (Fig. 4Panel G).In line with these findings, oxalate treatment abolished the upregulation of the PPARa target genes CPT1A and A CLADM mediated by PPARa activation with Wy 14,643 (Fig. 4Panel H).As PPARa induces the expression of genes regulating mitochondrial FAO that were suppressed by oxalate treatment, we next assessed the effects of oxalate on mitochondrial bioenergetics using Seahorse analysis. HepG2 cells treated with oxalate showed significant reductions in basal respiration, maximal respiration and ATP production (Fig. 4Panel I and Fig. 13Panel E). Without wishing to be bound by theory, these effects were due to the loss of CPTla and the subsequent inability of fatty acids to translocate into the mitochondria for FAO. Thus, we treated HepG2 cells with or without oxalate and the CPTla inhibitor, etomoxir10,33, and measured mitochondrial respiration by Seahorse analysis. While HepG2 cells treated with oxalate were unaffected by etomoxir, inhibition of CPTla in control cells significantly reduced the oxygen consumption rates to a level comparable to cells treated with oxalate (Fig. 4Panel J),indicating that oxalate suppresses mitochondrial respiration in hepatocytes mainly through inhibition of FAO. Furthermore, aligned with suppressed mitochondrial function, oxalate significantly enhanced mitochondrial superoxide generation (Fig. 13Panels F and G). Together, these findings indicate that oxalate stimulates lipid accumulation in hepatocytes by-70- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 suppressing PPARa and attenuating the translocation and utilization of fatty acids in mitochondrial respiration. [00263]Considering that overexpression of AGXT ameliorates NASH in mice through induction of FAO pathways, we evaluated if these effects are mediated through the reduction of oxalate overproduction in hepatocytes. We found that a transient overexpression of AGXT (Fig. 4Panel K)was sufficient to significantly lower palmitic acid-induced intracellular oxalate in HepG2 cells compared with GFP control (Fig. 4Panel L), concomitant with a significant reduction in lipid accumulation assessed by Nile Red (Fig. 4Panel M and Fig. 14 Panel A).Moreover, HepG2 cells treated with palmitic acid and overexpressing AGXT showed enhanced expression of the PPARa-target genes, CPTIA and AC ADM (Fig. 4Panel N),as well as increased CPTla protein abundance (Fig. 4Panel O).Furthermore, Seahorse experiments demonstrated that overexpression of AGXT in HepG2 cells treated with palmitic acid significantly enhanced basal respiration, maximal respiration and ATP production compared with GFP control (Fig. 4Panel P and Fig. 14Panel B),with a corresponding suppression of mitochondrial superoxide formation (Fig. 14Panels C and D).Altogether, these data indicate that inhibiting the overproduction of oxalate reduces lipid accumulation in hepatocytes by inducing genes regulating FAO and mitochondrial respiration. [00264]Oxalate reduction via AGXT overexpression lowers leukocyte infiltration, hepatic inflammation and fibrosis in NASH [00265]Hepatic lipotoxicity promotes a proinflammatory response that facilitates leukocyte infiltration during the progression of NASH2’3■4. Mice fed the NASH diet and treated with AAV8-AGXT demonstrated a significant reduction in lobular inflammation compared with mice treated with AAV8-GFP (Fig. 2Panels I and J).Accordingly, KEGG pathway analysis of liver RNA-sequencing revealed a significant downregulation of multiple pathways involved in inflammation including chemokine signaling, cytokine-cytokine receptor interaction, as well as nuclear factor-kappaB (NF-kB) and tumor necrosis factor (TNF) signaling pathways (Fig. 5Panel A).RNA-sequencing analysis (Fig. 5Panel B),validated by qRT-PCR analyses (Fig. 5Panel C),indicated significant reductions in key genes of the NF-kB and TNF signaling pathways in livers from mice overexpressing AGXT, including Nfkb2, Rclb. and Tnf as well as chemokine ligand 2 (Cc72) and Cd5 that are known as drivers and therapeutic targets in NASH together with Ccr2 that regulates the recruitment of monocyte-derived cells in NASH34. Accordingly, immunofluorescence for F4/80 revealed a significant reduction in hepatic - 71 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 macrophages in livers from mice overexpressing AGXT (Fig. 5Panels D and E).Next to assess if oxalate accumulation in hepatocytes has a chemotactic effect, HepG2 cells were plated in the lower well of a transwell, and the transmigration of fluorescently-labeled human primary blood monocytes (hPBMs) was measured in cells treated with or without oxalate (Fig. 5Panel F).Consistent with our in vivo findings, there was a significant elevation of monocytes transmigrating toward the bottom well containing oxalate-treated HepG2 cells compared with control cells (Fig. 5Panels G and H).Together, these data indicate that lowering oxalate through AGXT overexpression suppresses oxalate-induced proinflammatory response and leukocyte chemotaxis during NASH. [00266]Hepatic fibrosis is the main determinant of liver-related events and mortality in NASH35. In addition to the suppression of proinflammatory pathways in mice overexpressing AGXT in hepatocytes during NASH, the KEGG pathway analysis revealed a significant downregulation of pathways associated with hepatic fibrosis including focal adhesion signaling, regulation of actin cytoskeleton and extracellular matrix (ECM)-receptor interactions (Fig. 5Panel A).RNA-sequencing analysis (Fig. 6Panel A),validated by qRT- PCR analyses (Fig. 6Panel B),indicated a significant downregulation of genes within the transforming growth factor-beta (TGF[3) signaling pathway, a main regulator of hepatic fibrosis36 ygfbl, Tgfb2, Tgfbrl, and Tgfbr2) as well as key genes related to ECM remodeling (collagen, type 1, alpha-1, Collal, Colla2, and Col4al) in mice overexpressing AGXT. As these transcriptional alterations indicate a reduction in hepatic fibrosis in response to lowering oxalate via AGXT overexpression, we next sought to evaluate hepatic fibrosis through histopathological and immunofluorescence analyses coupled with biochemical verification. Histopathological analysis based on Picrosirius Red staining revealed a significant reduction in collagen accumulation (Fig. 6Panels C and D)and decreased fibrosis scores (Fig. 6Panel E)in mice overexpressing AGXT compared with GFP control. These findings were confirmed biochemically through measurement of liver hydroxyproline content, which was significantly lower in mice overexpressing AGXT compared with GFP control (Fig. 6Panel F). Concomitant with these results, immunofluorescence for a-smooth muscle actin (SMA) indicated reduced presence of hepatic stellate cells, the main cells driving fibrogenesis 36, in livers from mice treated with AAV8-AGXT (Fig. 6Panels G and H).Taken together, these data demonstrate that lowering oxalate via AGXT overexpression protects against hepatic fibrosis during NASH.- 72- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-267" id="p-267" id="p-267" id="p-267"

[00267] Pharmacological targeting of hepatic oxalate overproduction ameliorates established NASH [00268]Oxalate is produced from glyoxylate in the liver by multiple enzymatic pathways (Fig.7A). Because AGXT overexpression lowers hepatic oxalate overproduction and prevents NASH, we evaluated 1) whether these protective effects are mediated by AGXT or through an oxalate-lowering effect and 2) to assess the therapeutic value of pharmacologically targeting hepatic oxalate overproduction in established NASH. We utilized MDMG-935P, a salicylic acid derivative we recently developed that potently decreases oxalate production by inhibiting GO and LDHA37 While GO generates glyoxylate, which is cleared by AGXT, LDHA catalyzes the oxidation of glyoxylate to form oxalate. 16 To assess the therapeutic potential of oxalate lowering, we devised an experimental approach to test MDMG-935P in mice with established NASH. Mice were fed the NASH diet for 3 months, then orally administered either vehicle, 5 mg/kg or 10 mg/kg MDMG-935P daily for an additional 3 months on the NASH diet (Fig.7 Panel B).As previous studies demonstrated that a daily dose of 20 mg/kg of MDMG- 935P for only 5 days effectively reduced oxalate in primary7 hyperoxaluric mice 37, we chose to administer up to 10 mg/kg/day to account for the long duration of the treatments. At endpoint, we found that 10 mg/kg/day of MDMG-935P significantly reduced hepatic oxalate compared with vehicle, while 5 mg/kg/day had no significant effect (Fig.7 Panel C).While the mice showed no significant alterations in body weight (Fig. 15Panel A),treatment with mg/kg/day of MDMG-935P significantly reduced the liver weight (Fig. 15Panel B)and liver- to-body weight ratio compared to mice treated with vehicle (Fig.7 Panel D).Furthermore, markers of liver injury in plasma, AST (Fig.7 Panel E)and ALT (Fig.7 Panel F),were significantly decreased in mice treated with 10 mg/kg/day of MDMG-935P. While gross morphology 7 of the abdominal body cavity 7 showed no obvious differences in adiposity7 in all groups (Fig.7 Panel G),histopathological analysis of the livers (Fig.7 Panel H)revealed significant reductions in steatosis, lobular inflammation, hepatocellular ballooning, and overall NAS in mice treated with 10 mg/kg/day of MDMG-935P (Fig.7 Panel T).Consistent with the reduction in steatosis scoring, biochemical analysis of liver lysates confirmed a significant reduction in hepatic triglycerides in mice treated with 10 mg/kg/day of MDMG-935P (Fig. Panel J).In line with the findings in mice and cells overexpressing AGXT and the inhibitory effects of oxalate on PPARa-mediated FAO, genes regulating FAO were significantly upregulated in livers from mice treated with 10 mg/kg/day of MDMG-935P including Cptla, - 73 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Acadl. Acadvl, Hadha. and Hadhb (Fig. 7Panel K). To confirm these effects were mediated through oxalate lowering in lipid-loaded hepatocytes, we treated HepG2 cells with palmitic acid in the absence or presence of increasing concentrations of MDMG-935P. In HepG2 cells treated with palmitic acid, oxalate was dose-dependently decreased by MDMG-935P (Fig. 15 Panel C),concomitant with a significant reduction in lipid accumulation assessed by Nile Red (Fig. 15Panels D-E).Altogether, these data indicate that targeting hepatic oxalate overproduction by inhibiting GO and LDHA can be therapeutically utilized to treat NASH through induction of FAO and reduction of hepatocyte lipid accumulation. [00269]Pharmacological targeting of hepatic oxalate overproduction reduces hepatic inflammation and fibrosis [00270]Considering that AGXT overexpression attenuated hepatic inflammation and fibrosis in NASH, we evaluated whether the pharmacological targeting of hepatic oxalate overproduction in mice with established NASH is sufficient to suppress proinflammatory and profibrotic responses. Consistent with the findings from mice overexpressing AGXT, mice administered 10 mg/kg/day of MDMG-935P exhibited significant reductions in the expression of key chemokines and cytokines driving the proinflammatory response in NASH including Ccl2. Ccl5. and Tnf (Fig. 8Panel A).Accordingly, immunofluorescence for F4/80 revealed a significant reduction in hepatic macrophages in livers from mice treated with 10 mg/kg/day of MDMG-935P compared with vehicle (Fig. 8Panels B and C).Furthermore, treatment with MDMG-935 at 10 mg/kg/day had potent anti-fibrotic effects and significantly downregulated key genes within the TGF0 signaling and ECM remodeling pathways including Tgfbl. Tgfb2, and Colla2 (Fig 8Panel D).These findings were aligned with histopathological analysis coupled with biochemical assessment of fibrosis, which revealed a significant reduction in Picrosirius Red staining following administration of 10 mg/kg/day MDMG-935P (Fig. 8 Panels E and F),as well as a significant reduction in hepatic hydroxyproline content (Fig. 8 Panel G).Assessment of fibrosis scores showed similar levels between vehicle and mg/kg/day and a downw ard trend with 10 mg/kg/day of MDMG-935P, although not reaching statistical significance (p=0.0798, Fig. 8Panel H).Lastly, immunofluorescence analysis for SMA revealed a significant reduction in livers from mice treated with 10 mg/kg/day of MDMG-935P compared with vehicle, indicating a reduction in hepatic stellate cell accumulation (Fig. 8Panels I and J).Altogether, these data indicate that pharmacologically Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 inhibiting oxalate overproduction in mice with established NASH suppresses oxalate-induced proinflammatory responses and hepatic fibrosis. [00271]Discussion [00272]The findings herein were obtained from studies in humans, multiple mouse models and in vitro hepatocyte systems combined with genetic and pharmacological approaches to manipulate oxalate metabolism tn vivo and tn vitro together with transcriptomics, molecular and functional analyses. We uncovered a molecular mechanism for oxalate accumulation in hepatocytes during NASH, elucidated the molecular and metabolic mechanisms by which hepatic oxalate accumulation promotes NASH, and identified a potential therapeutic approach for NASH across all aspects of the disease by lowering oxalate overproduction. Our findings reveal overproduction of oxalate in livers from both humans and mice with NASH as well as in lipid-loaded hepatocytes in vitro. In turn, accumulation of hepatic oxalate suppresses transcription of PPARa and the expression of its target genes controlling FAO (CPTla), leading to impaired mitochondrial fatty acid utilization, lipotoxicity. leukocyte chemotaxis, hepatic inflammation, and fibrosis. Importantly, lowering hepatic oxalate in NASH by genetic (hepatocyte-specific AGXT overexpression by AAV8-AGXT) and pharmacological (GO and LDHA inhibition by MDMG-935P) targeting of oxalate overproduction ameliorates hepatic steatosis, inflammation, and fibrosis through induction of PPARa-driven FAO, and suppression of NF-kB and TGF|3 targets (Fig. 8Panel K). [00273]Because dysregulated oxalate metabolism can cause renal and cardiovascular diseases 1721־, studies have focused on the deleterious effects of oxalate on the kidneys and renal cells as well as monocytes and macrophages 1720,38־. However, the effects of oxalate on the liver and hepatocytes, the primary cells responsible for its formation16, have not been systematically studied in the context of NASH. Expressed specifically in the liver, AGXT prevents oxalate formation by catalyzing the biosynthesis of glycine from glyoxylate 10’11■39. Suppression of AGXT transcript was previously reported in patients and mice with NASH or obesity 10,13,14,22. Here, we confirmed the downregulation of A GXT transcript in livers from patients with NASH and further report a significant decrease in AGXT protein abundance. Accordingly, we found a mild but significant increase in circulating oxalate in patients with NASH. Importantly, we found a marked accumulation of oxalate in livers from patients with NASH that was significantly correlated with reduced AGXT protein abundance. Of note, the enhanced circulating oxalate and hepatic accumulation of oxalate found in patients with NASH were - 75 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 independent of potential confounding factors including race, age, or sex. In line with those human findings, suppressed AGXT and accumulation of hepatic oxalate were also found to be associated with the severity of NASH in our mouse model that closely mimics the human disease, including hepatic fibrosis10,25,26,27. Using transcriptomics, histopathological, and Western blot analyses, the liver fibrosis markers previously found after 6 months on this diet include a significant upregulation of pathways/genes related to fibrogenesis and ECM remodeling (Co/7a7, Colla2, Col3al, Col4al, Col4a2, Timpl, and Serpinel), TGFP signaling (Tgfbl, Tgfb2, Tgfb3, Tgfbrl. and Tgfbr2 SMAD signaling (SMADger465/467 phosphorylation), as well as perisinusoidal and portal fibrosis10,25’26’27. Similar markers of liver fibrosis were found in the current study where genetic and pharmacological approaches to inhibit hepatic oxalate overproduction were tested in mice fed the NASH diet for 6 months. Furthermore, our studies in both primary mouse hepatocytes and human hepatic cell lines reveal that lipid loading is sufficient to downregulale AGXT and enhance intracellular oxalate accumulation. These findings are consistent with recent reports demonstrating that AGXT is downregulated in steatotic hepatocytes from humans and mice due to hypermethylation of its promoter 13. Together, these findings establish the suppression of AGXT in NASH, which in turn leads to hepatic oxalate accumulation. [00274]In addition to the accumulating evidence above establishing the suppression of AGXT in NASH, our recent studies uncovered a causative role for the loss of AGXT in NASH. As we reported 10, mice deficient in AGXT demonstrate accelerated diet-induced NASH. Nevertheless, whether these effects are mediated by hepatic oxalate accumulation and the therapeutic value of lowering hepatic oxalate overproduction in NASH were unknown. Here, we addressed those questions using a multidisciplinary approach combining genetic and pharmacological manipulation of oxalate metabolism in NASH with molecular and metabolic in vivo and in vitro studies. Our genetic approach was based on overexpressing AGXT specifically in hepatocytes using AAV8 driven by the TBG promoter 19,40, followed by 6 months on the NASH diet. These studies revealed that AGXT overexpression in hepatocytes significantly lowers hepatic oxalate accumulation and prevents diet-induced NASH and liver injury. independent of changes in body weight or adiposity. To address the therapeutic potential of targeting hepatic oxalate overproduction for the treatment of established NASH, we utilized our newly developed approach for inhibiting GO and LDHA using the salicylic acid derivative MDMG-935P37. Strikingly, we found that oral administration of MDMG-935P to mice with -76- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 established NASH significantly reduced hepatic oxalate overproduction, leading to a marked reduction in steatohepatitis, hepatic injury, and fibrosis. These findings not only indicate a causative role of hepatic oxalate accumulation in NASH, but also highlight the therapeutic potential of targeting AGXT to lower hepatic oxalate overproduction for the treatment of NASH. [00275]Previous proteomics studies on livers from mice deficient in AGXT revealed alterations in Patty acid metabolic pathways, independent of NASH41. Utilizing transcriptomics, we recently reported that the loss of AGXT suppresses FAO pathways and accelerates diet-induced NASH in mice 10. Considering the emerging reports of suppressed AGXT and impaired glyoxylate/oxalate metabolism in NAFLD1013,14,22, and to address the mechanisms by which oxalate promotes NASH, we studied the effects of oxalate on molecular and metabolic drivers of NASH in hepatocytes. While previous studies in renal cells, monocytes and macrophages used sodium oxalate at doses up to 2 mM1738■19׳, here, we selected the doses of exogenous sodium oxalate that resulted in levels comparable to endogenous oxalate concentrations found in response to lipid loading (250 pM in primary mouse hepatocytes and 500 pM in HepG2 cells). At these doses, oxalate significantly enhanced lipid accumulation in both primary mouse hepatocytes and a human hepatic cell line. In line with our transcriptomics results in livers from Agxtv״ mice, 10 oxalate potently inhibited PPARa- regulated FAO, an established driver of NASH342’10׳, with negligible effects on regulators of Patty acid uptake, transport, and biosynthesis. Mechanistically, using RNA Pol II inhibition, PPARa agonism and luciferase assays, we found that oxalate suppresses PPARa transcription and the expression of its target genes that promote FAO. In support, livers from mice overexpressing AGXT specifically in hepatocytes or treated with MDMG-935P demonstrated reduced oxalate and steatohepatitis aligned with an upregulation of PPARa target genes. [00276]Previous studies in renal cells, monocytes, and macrophages demonstrated that oxalate causes mitochondrial dysfunction leading to enhanced generation of reactive oxygen species and lipid peroxidation 17,19’38. Consistent with those previous reports, we found that oxalate suppresses mitochondrial respiration in HepG2 cells leading to enhanced mitochondrial superoxide formation. In addition, our studies in primary mouse hepatocytes and human hepatic cell lines uncovered suppressed CPTla through the inhibition of PPARa activity in response to oxalate. CPTla critically regulates fatty acid transport into the mitochondria 43 and FAO is a main pathway for energy production by the mitochondria. Indeed, our Seahorse - 77 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 experiments utilizing CPTla inhibition indicated that oxalate impairs mitochondrial respiration mainly through the suppression of FAO. Accordingly, transient overexpression of AGXT not only lowered intracellular oxalate and lipid accumulation, but also significantly upregulated CPTla and augmented mitochondrial respiration in lipid-loaded HepG2 cells. These findings are supported by our in vivo studies in which Cptla was significantly upregulated both in livers from mice overexpressing AGXT and in livers from mice treated with MDMG-935P, which not only demonstrated reduced hepatic oxalate, but also decreased steatohepatitis. Taken together, while previous reports indicated that oxalate causes mitochondrial dysfunction in various cell types 17,19,38, our current studies reveal that oxalate impairs mitochondrial respiration in hepatocytes by inhibiting PPARa-regulated FAO leading to intracellular lipid accumulation. These effects are rescued by genetic and pharmacological approaches to lower oxalate overproduction. [00277[During the progression of NASH, the accumulation of lipotoxic and reactive oxygen species induce hepatocellular injury, inflammasome activation, release of proinflammatory cytokines and chemokines with subsequent monocyte infiltration, and activation of macrophages and hepatic stellate cells that drive steatohepatitis and hepatic fibrosis2,3,4 While our recent studies in mice deficient in AGXT demonstrated enhanced steatohepatitis and hepatic fibrosis with significant enrichment of proinflammatory and profibrotic pathways 10,19, the current RNA-sequencing findings reveal that proinflammatory (chemokine signaling, cytokine-cytokine receptor interaction, NF-kB and TNF signaling) and profibrotic (focal adhesion signaling, regulation of actin cytoskeleton and ECM-receptor interactions) pathways are significantly suppressed in livers from mice overexpressing AGXT in hepatocytes during NASH. Similar anti-inflammatory and anti-fibrotic effects were found in livers from mice with established NASH that were treated with MDMG-935P. Importantly, through histopathological and immunofluorescence analyses coupled with biochemical verification, we confirmed that lowering oxalate via AGXT overexpression or pharmacological inhibition of LDHA and GO not only reduces steatohepatitis and hepatic macrophages, but also potently lowers hepatic stellate cells and fibrosis, the main determinant of liver-related events and mortality in NASH35. While these findings can be explained by reduced lipotoxicity secondary to activation of PPARa and improved FAO through lowering of hepatic oxalate, our studies in oxalate-treated HepG2 cells that enhance the transmigration of primary blood monocytes indicate that hepatocytes affected by oxalate accumulation exhibit a chemotactic effect on - 78 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 leukocytes that can enhance inflammation during NASH. These findings are supported by previous reports from our group and others demonstrating that oxalate directly enhances proinflammatory gene expression and stimulate the release of the chemoattractant proteins CCL2 and CCL5 in other cell types including macrophages and renal epithelial cells 19,44. [00278]Given that the predominant cause of mortality in patients with NASH is complications due to cardiovascular disease 45, identifying pathways that can be targeted for simultaneous treatment of NASH and cardiovascular disease is challenging and urgently needed. Importantly, emerging studies from our group and others uncovered oxalate metabolism commonly dysregulated in NAFLD and cardiovascular disease 10,13,1921,46־. Notably, increased circulating oxalate was recently identified as a new risk factor for cardiovascular events in patients on dialysis21,46. Exogenous oxalate not only induces chronic kidney disease, but also causes cardiac fibrosis in C57BL/6 mice 18, and accelerates atherosclerosis development in apolipoprotein E-deficient (Apoe ־) mice 19. Similarly, hepatic oxalate overproduction due to the loss of AGXT enhances atherosclerosis, while overexpression of AGXT in hepatocytes lowers oxalate and ameliorates atherosclerosis in Apoc־־ mice 19. Taken together, this can indicate that hepatic oxalate overproduction in the fatty liver concurrently accelerates the progression of NASH and atherosclerotic cardiovascular disease, highlighting the strategies drawn towards lowering oxalate overproduction for dual- targeting of these two prominent diseases. As MDMG-935P potently lowered hepatic oxalate, steatosis, inflammation, and fibrosis in mice with established NASH, further evaluation of GO and LDHA inhibition for concurrent treatment of NASH and associated cardiovascular disease is warranted. [00279]In summary, combining data from patents with NASH, multiple mouse models and hepatocellular tn vitro systems, the current study uncovers overproduction of hepatic oxalate due to suppression of AGXT that further accelerates NASH through inhibition of PPARa- regulated FAO and enhanced proinflammatory/fibrotic responses. Genetic and pharmacological targeting of hepatic oxalate overproduction lowers hepatic steatosis, inflammation and fibrosis and can have translational potential for the treatment of NASH, currently without approved treatment. Considering the recent development and approval of therapeutic agents that reduce hepatic oxalate production 47, the safety and efficacy of this strategy as a treatment for NASH warrant further clinical evaluation. [00280]Methods-79- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-281" id="p-281" id="p-281" id="p-281"

[00281]Human plasma and liver specimens [00282]Collection of deidentified NASH and Non-NASH human plasma and liver specimens was approved by the Institutional Review Board of Ochsner Clinic Foundation (protocols 2010.179, 2015.101.C. 2016.131.B, and 2020.039). The studies were conducted through the Ochsner Multi-Organ Transplant Institute (New Orleans, LA, USA) with specimens collected following informed consent. Peripheral blood specimens from patients with no history' of liver disease were obtained prior to a routine screening colonoscopy or mammogram (2015.101.C). Peripheral blood specimens from patients with NASH, as confirmed by biopsy, magnetic resonance elastography or ultrasonic transient elastography, were obtained during routine hepatology surveillance laboratory visits (2016.131.B). Plasma samples were obtained from peripheral blood specimens following centrifugation and separation and stored at -80°C until analysis. Disease-free liver tissue was obtained during laparoscopic, robotic-assisted liver resection (partial lobectomy) in patients with no existing or prior history of liver disease (2015.101.C). NASH tissue was obtained during orthotopic liver transplantation for end-stage liver disease (2010.179, 2020.039). Liver specimens were placed into fonnalin and further processed to formalin-fixed, paraffin-embedded tissue blocks or flash-frozen in liquid nitrogen and stored at -80°C until analysis. Patient demographics and laboratory values were exported from the electronic medical record and are described in Fig 9 Panels Aand B. [00283]Animal studies [00284]All animal procedures were approved by the Institutional Animal Care & Use Committees of Louisiana State University' Health Sciences Center-Shreveport (P-21-043 and P22-035) and the University of Michigan (PRO00008239). All studies were performed in accordance with the institutional guidelines. C57BL/6J (stock: 000664) were purchased from the Jackson Laboratories. Eight-week-old C57BL/6J male and female mice were fed ad libitum either a standard diet (LabDiet 5053.13% of calories from fat) or established 10’25’26’27’28 NASH- inducing diets (Research Diets DI 7010103, 40% of calories from fat or Envigo, TD. 160785, 52.6% of calories from fat) for 4 or 6 months prior to euthanasia and tissue harvest. Primary hepatocytes were isolated from 8-10-week-old male C57BL/6J mice fed a standard diet as described below. AAV8-AGXT expressing human AGXT and AAV8-GFP control driven by the hepatocyte-specific TBG promoter were administered by intraperitoneal injection into 7- week-old male C57BL/6J mice at 2x1011 viral genomes and a final volume of 200 pL per -80- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 mouse, as we previously described 19. Starting from 8 weeks of age, mice were fed the NASH diet (Research Diets D17010103) ad libitum for 6 months. MDMG-935P is a salicylic acid derivative we recently developed that potently decreases oxalate production by inhibiting GO and LDHA. The therapeutic potential of MDMG-935P was evaluated in mice with NASH using established protocols 10,25,27,37. Eight-week-old C57BL/6J male mice were fed the NASH diet (Research Diets D17010103) ad libitum for 3 months. Mice were then randomized to receive MDMG-935P solubilized in 0.5% methylcellulose by oral gavage at a concentration of mg/kg/day (vehicle), 5 mg/kg/day, or 10 mg/kg/day for an additional 3 months on the NASH diet until euthanasia and tissue harvest. [00285]Primary hepatocyte isolation and culture [00286]Primary hepatocytes were isolated from 8-10-week-old male C57BL/6J mice fed a standard diet. Following euthanasia by isoflurane, the portal vein was cannulated using a 24G IV catheter (Temmo #SR-OX2419CA). The catheter was held within the portal vein by applying a surgical knot. The inferior vena cava was cut and 50 mL of warm liver perfusion media (Gibco #17701038 supplemented with 1% penicillin/streptomycin [GenClone #25-512]) was perfused through the liver at 5 mL/min. Pressure was applied to the inferior vena cava using a sterile cotton swab every 10 mL for approximately 15 sec to allow backflow and thorough perfusion. Liver digest media (Gibco #17703034, warmed to 40°C) was perfused through the mouse at 5 mL/min. Pressure was applied to the inferior vena cava using a sterile cotton swab every 7 10 mL for approximately 15 sec to allow backflow and thorough digestion. The liver was removed from the body and the gallbladder was removed. Cells were dissociated from the liver by gentle mechanical separation using forceps in ice-cold plating and thawing media (William’s E Media [Gibco #A1217601] supplemented with thawing and plating supplements [Gibco #CM3000]) and passed through a 100 pm filter. Cells were rinsed twice by centrifugation at 50 g for 3 min and purified by percoll gradient (20% percoll [Cytiva #45- 001-748]), 80% thawing and plating media). Percoll was removed by centrifugation at 150 g for 3 minutes, and cells were rinsed twice by centrifugation at 50 g for 3 min. Cells were resuspended in w arm thawing and plating media and plated at approximately 80% confluence into collagen-coated plates (0.01% w/v. Advanced Biomatrix #NC0476635). Cells were allowed to adhere for approximately 3-4 h, and non-adhered cells and debris were rinsed with warm PBS. Hepatocyte maintenance media (William’s E Media [Gibco #A12176O1] with maintenance supplements [Gibco#CM4000]) w as added for experiments.- 81 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-287" id="p-287" id="p-287" id="p-287"

[00287]Cell culture, treatments, and transfections [00288]Mouse primary hepatocytes were maintained in maintenance media and utilized for experiments no longer than 24 hours post-isolation. Hepatocytes were plated at approximately 80% confluence and allowed to adhere for approximately 6 hours prior to treatment. HepGcells were maintained in DMEM (Gibco #1059-010) supplemented with 10% FBS (Gibco #10438-026) and 1% penicillin/streptomycin (GenClone #25-512) and plated at approximately x 104 cells per cm 2. Cells were treated with sodium oxalate (0-500 pM, Sigma #223433), BSA-conjugated palmitic acid (200 pM, Cayman Chemical Company #29558), BSA control (200 pM, Cayman Chemical Company #29556) or Wy 14,643 (0-25 pM, Cayman Chemical Company #70730). For inhibition of transcription, HepG2 cells were treated with actinomycin D (5 pg/mL, Sigma-Aldrich, #A1410) for 24 hours, and lysed for qRT-PCR analysis as described below. For luciferase reporter assays. 1x104 HepG2 cells per well were plated in a 96-well plate and transfected with 80 ng/well of PPREx3-TK-luciferase (pGL3/PPREx3, Addgene), 10 ng/well recombinant human PPARa (pcDNA3.1/hPPARa, NM_001001930), and 10 ng/well Renilla (pRE-TK, Promega) constructs using Lipofectamine 3000 (Invitrogen #L3000-015). Approximately 18 hours following transfection, cells were treated with or without sodium oxalate (500 pM) or Wy 14,643 (25 pM) for 24 hours. Cells were lysed and luminescence was measured (Promega #E1980) as per manufacturer ’s instructions on a CLARIOstar Plus High-Performance Multimode Microplate Reader. For in vitro AGXT overexpression, HepG2 cells were plated at 2.5 x 105 cells/well in a 12-well plate with Lipofectamine 3000 according to manufacturer's instructions with pcDNA3.1-GFP control (pg DNA per 2 x 105 cells) or pcDNA3.1-AGXT-GFP (1 pg DNA per 2 x It)5 cells, OriGene, NM_000030). Human peripheral blood monocytes (hPBMs) were isolated according to Institutional Review Board and Health Insurance Portability and Accountability Act guidelines (approval number; H99-064) as described previously. 48 Briefly, blood was drawn by median cubital vein venipuncture from healthy volunteers and centrifuged through a Ficoll Histopaque 1077 gradient (Sigma) to isolate mononuclear cells. Cells were then washed with saline and monocytes were isolated by centrifugation through a Percoll (Pharmacia) gradient. Cells were washed once in serum-free RPM1 medium and re-suspended in serum-free RPMI medium. hPBMs were used within 24 hours. To label monocytes with green fluorescence, hPBMs were suspended in warm HBSS (Gibco #14025-076) at a concentration of approximately 1 x 1cells/mL and 5 pL/mL of Vy brant DiO cell-labeling solution (Invitrogen #V22886) was added-82- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 as per manufacturer ’s instructions. Cells were incubated at 37°C for 20 min, then rinsed twice with fresh HBSS before a final resuspension of 5 x 106 cells/mL prior to transwell experiments. [00289]Cloning and production of AAV8-GFP and AAV8-AGXT [00290]AAV8-AGXT expressing the human AGXT and AAV 8-GFP control were prepared as we previously described 19. Briefly, plasmids for AAV8 package (pAdDeltaF6, pAAV2/8, pAAV-TBG-GFP, pAAV-TBG-MCS) were kindly provided by Dr. Jiandie Lin (University of Michigan). The human AGXT was cloned from plasmid #RG212899 (Origene) into the backbone plasmid pAAV-TBG-MCS using the Gibson assembly kit (New England Biolabs). The AGXT sequence and proper insertion were confirmed by Sanger sequencing. pAAV-TBG- GFP with the same backbone but expressing GFP was used as a control. Seventy pg of AAV shuttle vector, 200 pg Delta F6 helper plasmid and 70 pg AAV2/8- Rep/Cap plasmid were prepared with EndoFree Plasmid Maxi Kit (QIAGEN) and transfected into 15-cm plates of HEK293T cells using PEI transfection reagent (Sigma-Aldrich). After 96 h, the cells were lysed (20 mM Tris, pH 8.0, 150 mM NaCl) and 1 M MgCl and 25 KU/ml benzonase were added after 3 freeze-thaw cycles between liquid nitrogen and 370C. Cell lysates were incubated at 37°C for 15 min and then centrifuged at 4,000 rpm and 4°C for 30 min. AAVs in the supernatant were purified by ultracentrifugation in a density gradient iodixanol solution with a T865 rotor for 160 min at 60,000 rpm and 14°C. AAVs were concentrated in PBS with 0.01% Poloxamer 188 (Sigma-Aldrich) using a lOOkDa filter tube (Millipore, Cat# 910096) and the titer was quantified by qPCR. [00291]RNA isolation and quantitative real time PCR [00292[For liver tissue samples. RNA was isolated from approximately 50 mg of liver tissue. Tissue was lysed using TRIzol (Invitrogen #15596018) and Precellys soft tissue homogenizing ceramic beads (Cayman Chemical Company #10011152) in a Precellys Evolution homogenizer (Bertin Technologies). Following isolation of the aqueous layer by chloroform extraction, RNA was isolated using the RNeasy Mini Kit (Qiagen #74106) as per manufacturer ’s instructions. Cells were lysed using the RNeasy Mini Kit (Qiagen #74106) as per manufacturer ’s instructions. cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen #18080-051) as per manufacturer's instructions. cDNA synthesis was performed in a Mastercycler nexus gradient thermocycler (Eppendorf). Primers were purchased from Integrated DNA Technologies (Tables 1 and 2)and qRT-PCR was performed using SSoAdvanced Uniersal SYBR Green Supermix (Bio-Rad #175271) with a CFX96 Touch -83 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Real-Time PCR Detection System (BioRad) according to manufacturer ’s instructions. Results were normalized to housekeeping genes (GAPDH, ACTB, HPRT1) and expressed as a fold change from control treatments using the AACt threshold cycle method of normalization. Gene name (Human) Forward primer Reverse primer Alanine-glyoxylateaminotransferase (AGXT1JAGAGACATCGTCAGCTACGTCA CAGGTCACAGCTTCTTCTTGG Hypoxanthine-guanine phosphoribosyltransferase (HPRT1)CCTGGCGTCGTGATTAGTGAT AGACGTTCAGTCCTGTCCATAA Glyceraldehyde-3- phosphate dehydrogenase (_GAPDH^ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC Peroxisome proliferator activated receptor alpha^PPARA)CGGTGACTTATCCTGTGGTCC CCGCAGATTCTACATTCGATGTT PPARG coactivator 1 alpha (PPARGCIA^GCTTTCTGGGTGGACTCAAGT GAGGGCAATCCGTCTTCATCC Carnitine palmitoyltransferase 1A^CPTIA)TCCAGTTGGCTTATCGTGGTG TCCAGAGTCCGATTGATTTTTGC Acyl-CoA Dehydrogenase Medium Chain (ACADM)ACAGGGGTTCAGACTGCTATT TCCTCCGTTGGTTATCCACAT Sterol regulatory element binding transcription factor)SREB F1)GGCTCCTGCCTACAGCTTCT CAGCCAGTGGATCACCACA Fatty acid synthase (FASN) TATGCTTCTTCGTGCAGCAGTT GCTGCCACACGCTCCTCTAGAcetyl-CoA carboxylase alpha (ACC1)CAGAAGTGACAGACTACAGG ATCCATGGCTTCCAGGAGTA Steroyl-Coenzyme A desaturase ^SCDl)CACCACATTCTTCATTGATTGCA ATGGCGGCCTTGGAGACT Cluster of differentiation 36, fatty acid translocase (CD36)AAGCCAGGTATTGCAGTTCTTT GCATTTGCTGATGTCTAGCACA Solute carrier family 27A1- 2, fatty acid transporter protein 2 ^SLC27A2)GGAGATACATTCCGGTGGAA TGATCTCAATGGTGTCCTGT Solute carrier family 27A1- 2, fatty acid transporter protein 4 (SLC27A4)GTGAAGGCAAAGGTGCGAC CGGAAGGTCCAGTGGGTATC Solute carrier family 27A1- 2, fatty acid transporter protein 5 (SLC27A5)TGGAGGAGATCCTTCCCAAGC TGGTCCCCGAGGTATAGATGAA id="p-293" id="p-293" id="p-293" id="p-293"

[00293] Table 1: Humanprimers used for qRT-PCR analyses.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Gene Name (Mouse) Forward Primer Reverse Primer Alanine-glyoxylate aminotransferase (Agxtl)AAGGCATCCAGTATGTGTTC CATTCCGGTTAGAAAGGAGTCCC Glyceraldehyde-3- phosphate dehydrogenase (Gapdh)CTGCGACTTCAACAGCAACT GAGTTGGGATAGGGCCTCTC Peroxisome proliferator activated receptor alpha (Ppara)AACATCGAGTGTCGAATATGTGGCCGAATAGTTCGCCGAAAGAA Peroxisome proliferator activated receptor alpha (Ppargcla)ATCACGTTCAAGGTCACCCT ACTTCTGCTTCTGCCTCTCTCTCT Carnitine palmitoyltransferase 1A (Cptla)AGATCAATCGGACCCTAGA CACCAGCGAGTAGCGCATAGTCA Acyl-CoA Dehydrogenase, Medium Chain (Adadm'^CTGTGATTCTTGCTGGAAAT GAGCCGTTGATAACATACTCGTCA Acyl-CoA Dehydrogenase, long Chain (Acadl)CTATATTGCGAATTACGGCA CAACACCTTGCTTCCATTGAGAAT Acyl-CoA Dehydrogenase very long Chain (Acadvl)GCAGATGAGTGCATCCAAA TAATGAGTTCCTTTCCTTTGTCCAT Acyl-Coenzyme A oxidase 1(Acoxl)CCGCCACCTTCAATCCAGAG CAAGTTCTCGATTTCTCGACGG Hydroxyacyl-Coenzyme A dehydrogenase a (Hadhd)ACCTCGGTGTAAAGCACAA AGTGAGGTTTTGTCAGTGGTGATGA Hydroxyacyl-Coenzyme A dehydrogenase p (Hadhb)AAACAAGCAATGTGGCTAG AGAGCAGACATTAACTCAACACCACCA Acetyl-Coenzyme A acyltransferase 2 (Acaa2)AGTCCCCCTACTGTGTCAGA AACCATCTCCTCATTGAAGTAGCC Enoyl-Coenzyme A A isomerase 1 kEci!)TGCTGTGACTACAGGGTTAT GGGATCCTCAGGTACCACCTCATC Enoyl-Coenzyme A A isomerase 2 (Ect2)ACTACTGCAGTGGGAATGA CCTATAGTCCCAGAAGGGTGACAGA Nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/pl00 (NJkb2)GAGGTTCGGTTCTATGAGGA TGCTCTGCACTTCCTCCTTGTCTT Avian reticuloendotheliosis viral (v-rel) oncogene related B (Re/h!ATCCTCTCTGAGCCTGTCTA CGCACATCAGCTTGAGAGAAGTCG Tumor necrosis factor (Tnf) CTGTGAAGGGAATGGGTGTT GGTCACTGTCCCAGCATCTTTransforming growth factorP-1 (Tgfbl)TGCGCTTGCAGAGATTAAAA CTGCCGTACAACTCCAGTGA Transforming growth factorP-2 (Tgfb2)CTAATGTTGTTGCCCTCCTA CAGGCACAGAAGTTAGCATTGTACCC Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-294" id="p-294" id="p-294" id="p-294"

[00294] Table 2. Mouseprimers used for qRT-PCR analyses. [00295]RNA sequencing and data analysis Transforming growth factor |receptor type 1 (Tgfbrl)GGACCATTGTGTTACAAGAA AGCCATGGCGTAACATTACAGTCTGA Transforming grow th factor P receptor type 2 (Tgfbr2)TCCTAGTGAAGAACGACTTG ACCTACCAGAGCCATGGAGTAGACAT Collagen 1A1 (Collar) TGAACGTGACCAAAAACCA AGCAGAAAAGGCAGCATTAGG Collagen 1A2 (Colla2~) AGGCAGGTCTGGGCTTTATT CGTATCCACAAAGCTGAGCACollagen 4A1 (CoUal) CAGGCATAGTCAGACAACA GATGTGGACAGCCAGTAAGAGTAGTCG id="p-296" id="p-296" id="p-296" id="p-296"

[00296]As described herein, RNA was isolated from liver samples of mice treated with AAV8-GFP or AAV8-AGXT (n=4 per group, randomly selected). Samples were quantitated with a Qubit RNA assay (ThermoFisher Scientific) and RNA quality was evaluated with the Agilent TapeStation RNA assay (Agilent Technologies). All samples had RNA integrity numbers (RINs) of at least 8.3. Libraries were prepared with the Stranded mRNA Prep, Ligation Kit (Illumina). One pg of RNA was processed for each sample and mRNA was purified and fragmented. cDNA was synthesized, and 3’ ends were adenylated. Anchor sequences were ligated to each sample and a limited-cycle PCR was performed to amplify and index the libraries. The average library size was evaluated using an Agilent TapeStation D10assay (Agilent Technologies) and libraries were quantitated with qPCR (Bio-rad CFX96 Touch Real-Time PCR. NEB Library Quant Kit for Illumina). Libraries were normalized to 0.5 nM and pooled. The library' pool was denatured and diluted to approximately lOOpM. A 1% library of 2.5pM PhiX was spiked in as an internal control. Paired-end 76 x 76 base pair sequencing was performed on an Illumina NovaSeq 6000. Primary' analysis, including base calling and quality scoring, was performed onboard the Illumina NovaSeq 6000 (NovaSeq Control Software vl.8.0; RTA v3). Samples were de-multiplexed, the adapter sequences were removed (the first 9 cycles of sequencing were trimmed), and FASTQ files were generated. Data analysis was performed as we previously described 10,19’25’27. The quality' of the raw FASTQ files was checked through FastQC v0.11.8(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ). Trimmomatic v.0.35 was used to trim the low-quality reads with the parameters: SLIDINGWINDOW:4:20 MINLEN:25. The resulted high-quality reads were then mapped to the mouse reference genome (GRCm38.90) using HISAT2 v.2.1.0.13. Gene level quantification was performed using HTSeq-counts v0.6.0 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 based on the GRCm38.90 genome annotations. The R package DESeq2 was then used to identify significant differentially expressed genes (DEGs). Genes with adjusted p value <0.were considered as significant DEGs The upregulated and do vm regulated DEGs were analyzed for significantly enriched KEGG pathways using the clusterProfiler package. The significance of the enrichment was evaluated by right-tailed Fisher ’s exact test followed by Benjamini-Hochberg multiple testing adjustment. RNA-sequencing data have been deposited inNCBEs Gene Expression Omnibus (GEO) database (accession number: GSE224097). [00297]Protein isolation and immunoblotting [00298]For liver tissues samples, protein was isolated from approximately 50 mg of liver tissue. Tissue was lysed in RIPA lysis and extraction buffer (G Biosciences #786-489) supplemented with 1% Halt protease inhibitor cocktail (Thermo Scientific #78429) and 1% phosphatase inhibitor cocktail A (Alfa Aesar #165354.LQ) and Precellys soft tissue homogenizing ceramic beads (Cayman Chemical Company #10011152) in a Precellys Evolution homogenizer (Bertin Technologies). Cells were lysed in either RIPA lysis and extraction buffer (G Biosciences #786-489) supplemented with 1% Halt protease inhibitor cocktail (Thermo Scientific #78429) and 1% phosphatase inhibitor cocktail A (Alfa Aesar #J65354.LQ) or 2x Laemmli Sample buffer (Bio-Rad #1610737). Protein concentrations were adjusted using Quick Start Bradford lx Dye Reagent (Bio-Rad #5000205). Membranes were labeled with rabbit anti-AGXT (1:1000, Sigma #HPA035370), mouse anti-AGXT (1:500, Santa Cruz Biotechnology 7 #SC-517388), rabbit anti-CPTla (1:1000, Abeam #ab234111), mouse anti־p־actin (1:1000, Cell Signaling Technology #37008), mouse anti-GAPDH (1 ;5000, Santa Cruz Biotechnology #sc365062). Primary antibodies were visualized by fluorescent secondary donkey anti-rabbit antibody (1:20,000, Li-Cor #926-68073) or donkey anti-mouse antibody (1:20,000 Li-Cor #926-32212) on a Li-Cor Odyssey XF Imager. Densitometry 7 was performed using Image Studio Lite v5.2 software and normalized to P־actin or GAPDH. [00299[Biochemical measurements of plasma, liver tissue and hepatocytes [00300]Immediately following mouse euthanasia, plasma was separated from whole blood by centrifugation in PST Tubes with lithium heparin (BD Microtainer #365985). AST and ALT were measured in mouse plasma using the EnzyChrom Aspartate Transaminase or Alanine Transaminase Assay Kits (BioAssay Systems #EASTR-100 and #EALT-100. respectively) per manufacturer ’s instructions. Human plasma samples were diluted 1:25 and assessed for oxalate concentration using the Oxalate Assay Kit (Abeam #ab 196990) per manufacturer ’s -87- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 instructions. For intracellular oxalate measurements, approximately 50 mg of liver tissue was lysed in ice-cold PBS by sonication. Primary mouse hepatocytes or HepG2 cells (approximately 5 x 105 cells) were trypsinized, pelleted by centrifugation, and lysed in 150 pL ice-cold PBS by sonication. Intracellular oxalate was measured using the Oxalate Assay Kit (Abeam #abl96990) and normalized to total protein using Quick Start Bradford lx Dye Reagent. For triglyceride analysis, approximately 50 mg of frozen liver samples was homogenized in PBS, and the soluble fraction was removed by centrifugation. Lipids were extracted as described previously 10■25•49 Briefly, lipids were extracted using 3:hexane:isopropanol. Aqueous components were separated out with the addition of PBS, and the remaining hexane fraction was permitted to evaporate for 48 hours. Triglycerides were evaluated using the LabAssay Triglyceride measurement kit (Fuji Film, #632-50991) as per manufacturer ’s instructions. Liver hydroxyproline was measured using a hydroxyproline assay kit (Abeam #ab222941) as per manufacturer's instructions. MDA was measured using the TEARS assay kit (Cayman Chemical Company# 10009055) according to manufacturer ’s instructions. [00301]Histological analysis, immunohistochemistry, and fluorescence microscopy [00302]Histological procedures were performed by technicians blinded to experimental groups at the University of Michigan IV AC Histology Laboratory or at Louisiana State University Health Sciences Center-Shreveport as previously described 10’25’27. Briefly, formalin-fixed tissues were sectioned on a M355S rotary' microtome (ThermoFisher Scientific) at 4 pm thickness and mounted on glass slides. Slides were stained for hematoxylin and eosin (H&E, ThermoFisher Scientific). H&E staining was used for NAFLD activity score (NAS50). Steatosis was scored from 0-3 (0: <5% steatosis; 1: 5-33%; 2: 34-66%; 3: >67%). Hepatocyte ballooning was scored from 0-2 (0: normal hepatocytes, 1: normal-sized with pale cytoplasm, 2: pale and enlarged hepatocytes, at least 2-fold). Lobular inflammation was scored from 0-based on foci of inflammation counted at 20X (0: none, 1: <2 foci; 2: 2-4 foci; 3: >4 foci). NAS was calculated as the sum of steatosis, hepatocyte ballooning and lobular inflammation scores. For Picrosirius Red staining, slides were treated with 0.2 N phosphomolybdic acid for 3 min and transferred to 0.1% Sirius Red saturated in picric acid (Rowley Biochemical Inc.) for min, then transferred to 0.01 N hydrochloric acid for 3 min. Picrosirius Red staining was used to score hepatic fibrosis from 0-4 (0: no fibrosis; I: perisinusoidal or portal fibrosis; 2: perisinusoidal and portal fibrosis; 3: bridging fibrosis; 4: cirrhosis). The NAS and fibrosis - 88 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 score 30 were evaluated by two independent investigators blinded to experimental groups, and the average scores are presented. Frozen section processing was used for Oil Red O staining. Formalin-fixed liver samples were cryoprotected in 20% sucrose at 4°C overnight, blotted, then liquid nitrogen-snap frozen in OCT compound (Tissue-Tek) and stored at -80°C. Prior to sectioning, frozen blocks were brought up to about -20°C, then sectioned at 5 pm on a Cryotome SME (Thermo-Shandon). Prior to staining, slides were thawed to room temperature for 30 min and then fixed in 10% neutral buffered formalin for 20 min, rinsed in DDW, followed by rinsing in 60% isopropanol before being placed in working ORO-isopropanol stain (Rowley Biochemical Inc., H-503-1B) for 5 min. Slides were then rinsed in 60% isopropanol followed by three changes of DDW and nuclear counterstained with Harris Hematoxylin. Immunofluorescence was performed using rat anti-F4/80 (Bio-Rad ABD Serotec #MCA497R, 1:400), mouse anti-smooth muscle actin-Cy3 (1:400, Sigma #C6198), or rabbit anti-arginasel (Argl, Sigma #HPA024006.1:200) and nuclei were visualized with DAPI. To visualize F4/80, goat-ant-rat secondary antibody conjugated to Cy5 fluorophore was used (1:200, Invitrogen #A-21247). For Nile Red in hepatocytes, cells were fixed with 3.7% neutral buffered formalin and stained with Nile Red (1:2,000 TCI Chemicals #N0659) and DAPI (1:50,000 MP Biometicals #0215757410) for 30 min. For mitochondrial superoxide analysis, cells were treated with MitoSOX superoxide fluorescent dye (4 pM, Invitrogen #M36008) and Hoechst nuclear stain (2 pM, ThermoScientific #62249) for 30 minutes. Liver sections and cells were imaged on a Keyence BZ-X810 all-in-one fluorescence microscope. Images were analyzed using the Keyence BZ-X800 analyzer software. [00303[Seahorse analysis [00304]Oxygen consumption rates and dependency on fatty acid -oxidation (FAO) were assessed using an Agilent Seahorse XFe24 Analyzer at the Cellular Metabolism Core, Louisiana State University Health Sciences Center-Shreveport. As we previously described 10, HepG2 cells were seeded at 2.5 x 104 per well in XF24 cell culture microplates (Agilent #103015-100). The next day, cells were treated with or without 500 pM NaOX for approximately 18 hours. XFe24 sensor cartridges were hydrated in accordance with the manufacturer ’s protocol. Oligomycin, FCCP, rotenone+antimycin A (R/A) (Agilent #103015- 100). and etomoxir (Cayman Chemical Company #11969) were used at final concentrations of 2.5 pM, 1 pM, 0.5 pM, and 20 pM, respectively. [00305]Transwell chemotaxis assay-89- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-306" id="p-306" id="p-306" id="p-306"

[00306]HepG2 cells were plated at approximately 1 x 105 cells per well of a 24-well plate and allowed to adhere overnight in 500 pL DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. HepG2 cells were then treated with or without 500 pM oxalate for approximately 18 hours. hPBMs were labeled with Vybrant DiO cell-labeling solution and suspended at approximately 5 x 106 cells per mL of warmed HBSS. Millicell cell culture hanging inserts with 8 pm pores (Millipore #PTEP24H48) were inserted into each well, and 100 pL of hPBMs were added to the top well of each insert. hPBMs were permitted to incubate for approximately 18 hours in the insert and pass through the pores into the bottom well. Following hPBM transmigration, inserts were carefully removed and the bottom well containing both HepG2 cells and hPBMs were fixed in 3.7% neutral buffered formalin for at least 20 min. Cells were visualized on a Keyence BZ-X810 all-in-one fluorescence microscope, and the total number of hPBMs that passed into the bottom well were quantified using Keyence BZ-X800 analyzer software. Representative images of the fluorescent hPBMs (shown in green) were taken with a brightfield overlay to visualize equal numbers of HepG2 cells for each treatment. [00307]Statistical analyses [00308]All statistical analyses were performed using GraphPad Prism v9 software. All data were expressed as mean ± SEM and repeated with at least 3 independent experiments. Biological replications were performed as indicated and averaged for each individual experiment. Prior to statistical comparisons, data were tested for normality' using Shapiro-Wilk and Kolmogorov-Smimov tests. If passed, unpaired t-test was used to compare two groups and one-way ANOVA followed by Tukey post-hoc test for compansons among >2 groups. Otherwise, nonparametric tests (Mann-Whitney U test or Kruskal-Wallis test followed by Dunn ’s post-hoc test) were used. Data comparing multiple groups utilized two-way ANOVA with Bonferroni multiple comparisons test. Differences between categorical variables (sex and race) were tested using Fisher ’s exact test and by Chi-squared analysis. A p-value <0.05 was considered statistically significant. [00309] References Cited in this Example [00310]1. Riazi, K. et al. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol 7, 851-861 (2022).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-311" id="p-311" id="p-311" id="p-311"

[00311]2. Chalasani, N. et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology 67,328-357 (2018). [00312]3. Friedman, S.L., Neuschwander-Tetri, B.A., Rinella. M. & Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat Med 24,908-922 (2018). [00313]4. Cusi, K. Role of obesity and lipotoxicity in the development of nonalcoholic steatohepatitis: pathophysiology and clinical implications. Gastroenterology 142,711-725 e(2012). [00314]5. Softie, S., Cohen, D.E. & Kahn, C.R. Role of Dietary Fructose and Hepatic De Novo Lipogenesis in Fatty7 Liver Disease. Dig Dis Sci 61,1282-93 (2016). [00315]6. Vuppalanchi, R., Noureddin, M., Alkhouri, N. & Sanyal, A.J. Therapeutic pipeline in nonalcoholic steatohepatitis. Nat Rev Gastroenterol Hepatol 18,373-392 (2021). [00316[7. Parekh. S. & Anania, F.A. Abnormal lipid and glucose metabolism in obesity: implications for nonalcoholic fatty liver disease. Gastroenterology 132,2191-207 (2007). [00317]8. Gaggini, M. et al. Altered amino acid concentrations in NAFLD: Impact of obesity and insulin resistance. Hepatology 67,145-158 (2018). [00318]9. Mardinoglu, A. et al. Personal model-assisted identification of NAD(+) and glutathione metabolism as intervention target in NAFLD. Mol Syst Biol 13,916 (2017). [00319]10. Rom, O. et al. Glycine-based treatment ameliorates NAFLD by modulating fatty7 acid oxidation, glutathione synthesis, and the gut microbiome. Sci Transl Med 12(2020). [00320]11. Li, X.M., Salido, E.C. & Shapiro, L.J. The mouse alanine: gly oxy late aminotransferase gene (Agxtl): cloning, expression, and mapping to chromosome 1. Somat Cell Mol Genet 25,67-77 (1999). [00321]12. Cellini, B., Bertoldi, M., Montioli, R., Paiardini, A. & Borri Voltattorni, C. Human wild-type alanine:glyoxylate aminotransferase and its naturally occurring G82E variant: functional properties and physiological implications. Biochem J 408.39-50 (2007). [00322]13. Gianmoena, K. et al. Epigenomic and transcriptional profiling identifies impaired glyoxylate detoxification in NAFLD as a risk factor for hyperoxaluria. Cell Rep 36, 109526 (2021). [00323]14. Asgharpour, A. et al. A diet-induced animal model of non-alcoholic fatty liver disease and hepatocellular cancer. J Hepatol 65,579-88 (2016).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-324" id="p-324" id="p-324" id="p-324"

[00324]15. Salido, E.C. etal. Alanine-glyoxylate aminotransferase-deficient mice, a model for primary7 hyperoxaluria that responds to adenoviral gene transfer. Proc Natl Acad Sci USA 103,18249-54(2006). [00325]16. Salido, E., Pey, A.L., Rodriguez, R. & Lorenzo, V. Primary7 hyperoxalurias: disorders of glyoxylate detoxification. Biochim Biophys Acta 1822,1453-64 (2012). [00326]17. Cao, L.C. et al. Mitochondrial dysfunction is a primary event in renal cell oxalate toxicity. Kidney Int 66,1890-900 (2004). [00327]18. Mulay, S.R. et al. Oxalate-induced chronic kidney disease with its uremic and cardiovascular complications in C57BL/6 mice. Am J Physiol Renal Physiol 310,F785-F7(2016). [00328]19. Liu, Y. et al. Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis. Cell Rep 36,109420 (2021). [00329[20. Ermer, T. et al. Oxalate homeostasis. Nat Rev Nephrol 19.123-138(2023). [00330]21. Pfau, A. et al. High Oxalate Concentrations Correlate with Increased Risk for Sudden Cardiac Death in Dialysis Patients. J Am Soc Nephrol 32,2375-2385 (2021). [00331]22. Stepanova, M. et al. Hepatic gene expression of Caucasian and African- American patients with obesity-related non-alcoholic fatty7 liver disease. Obes Surg 20,640-(2010). [00332]23. Petrarulo, M. et al. Ion chromatographic determination of plasma oxalate in healthy subjects, in patients with chronic renal failure and in cases of hyperoxaluric syndromes. J Chromatogr 511,223-31 (1990). [00333[24. Salido, E. et al. Phenotypic correction of a mouse model for primary hyperoxaluria with adeno-associated virus gene transfer. Mol Ther 19,870-5 (2011). [00334]25. Rom, O. et al. Nitro-fatty7 acids protect against steatosis and fibrosis during development of nonalcoholic fatty liver disease in mice. EBioMedicine 41,62-72 (2019). [00335[26. Gomez-Torres, O. et al. SLAMF1 is expressed and secreted by hepatocytes and the liver in nonalcoholic fatty7 liver disease. Am .!Physiol Gastrointest Liver Physiol 323, G1 77- G1 8 7 (2022). [00336]27. Qu, P. et al. DT-109 ameliorates nonalcoholic steatohepatitis in nonhuman primates. CellMetab 35,742-757 elO (2023). [00337]28. Wang, X. et al. Hepatocyte TAZ/WWTRI Promotes Inflammation and Fibrosis in Nonalcoholic Steatohepatitis. CellMetab 24,848-862 (2016).-92- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-338" id="p-338" id="p-338" id="p-338"

[00338]29. Baker, P R., Cramer, S.D., Kennedy, M., Assimos, D.G. & Holmes, R.P. Glycolate and glyoxylate metabolism in HepG2 cells. Am J Physiol Cell Physiol 287,C1359- (2004). [00339]30. Rakhshandehroo, M., Knoch, B., Muller. M. & Kersten. S. Peroxisome proliferator-activated receptor alpha target genes. PPAR Res 2010(2010). [00340]31. Horton, J.D., Goldstein, J.L. & Brown, M.S. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109,1125- (2002). [00341]32. Mogilenko, D.A. et al. Peroxisome proliferator-activated receptor alpha positively regulates complement C3 expression but inhibits tumor necrosis factor alpha- mediated activation of C3 gene in mammalian hepatic-derived cells. J Biol Chem 288,1726- (2013). [00342[33. Pike, L.S., Smift, A.L., Croteau, N.J.. Ferrick, D.A. & Wu, M. Inhibition of fatty acid oxidation by etomoxir impairs NADPH production and increases reactive oxygen species resulting in ATP depletion and cell death in human glioblastoma cells. Biochim Biophys Acta 1807, 726-34 (2011). [00343]34. Krenkel, O.etal. Therapeutic inhibition of inflammatory monocyte recruitment reduces steatohepatitis and liver fibrosis. Hepatology 67,1270-1283 (2018). [00344]35. Angulo, P. etal. Liver Fibrosis, butNo Other Histologic Features, Is Associated With Long-term Outcomes of Patients With Nonalcoholic Fatty Liver Disease. Gastroenterology 149,389-97 610 (2015). [00345[36. Seki, E. et al. TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat Med 13,1324-32 (2007). [00346]37. Moya-Garzon, M.D. et al. New salicylic acid derivatives, double inhibitors of glycolate oxidase and lactate dehydrogenase, as effective agents decreasing oxalate production. Eur J Med Chem 237,114396 (2022). [00347]38. Patel, M et al. Oxalate induces mitochondrial dysfunction and disrupts redox homeostasis in a human monocyte derived cell line. Redox Biol 15,207-215 (2018). [00348]39. Wang, W. et al. Glycine metabolism in animals and humans; implications for nutrition and health. Amino Acids 45,463-77 (2013). [00349]40. Kiourtis, C.et al. Specificity and off-target effects of AAV8-TBG viral vectors for the manipulation of hepatocellular gene expression in mice. Biol Open 10(2021). -93 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-350" id="p-350" id="p-350" id="p-350"

[00350]41. Hernandez-Fernaud, J.R. & Salido, E. Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type 1. FEES J 277,4766-(2010). [00351]42. Montagner. A. et al. Liver PPARalpha is crucial for whole-body fatty acid homeostasis and is protective against NAFLD. Gut 65,1202-14 (2016). [00352]43. Lee, K., Kemer, J. & Hoppel, C.L. Mitochondrial carnitine palmitoyltransferase la (CPTla) is part of an outer membrane fatty acid transfer complex. J Biol Chem 286,25655- (2011). [00353]44. Umekawa, T., Chegini, N. & Khan, S.R. Oxalate ions and calcium oxalate crystals stimulate MCP-1 expression by renal epithelial cells. Kidney Int 61,105-12 (2002). [00354]45. Finney, A.C. et al. The interplay between nonalcoholic fatty7 liver disease and atherosclerotic cardiovascular disease. Front Cardiovasc Med 10,1116861 (2023). [00355[46. Stepanova, N., Driianska, V., Korol. L.. Snisar, L. & Lebed, L. Plasma oxalic acid and cardiovascular risk in end-stage renal disease patients: a prospective, observational cohort pilot study. Korean J Intern Med 37,167-178 (2022). [00356]47. Garrelfs, S.F. et al. Lumasiran, an RNAi Therapeutic for Primary Hyperoxaluria Type 1. N Engl J Med3S4, 1216-1226 (2021). [00357]48. Chan, G., Nogalski, M.T., Stevenson, E.V. & Yurochko, A.D. Human cytomegalovirus induction of a unique signalsome during viral entry into monocytes mediates distinct functional changes: a strategy 7 for viral dissemination. JLeukoc Biol 92,743-52 (2012). [00358]49. Xiong, W. et al. Brown Adipocyte-Specific PPARgamma (Peroxisome Proliferator-Activated Receptor gamma) Deletion impairs Perivascular Adipose Tissue Development and Enhances Atherosclerosis in Mice. Arterioscler Thromb Vase Biol 38,1738- 1747 (2018). [00359]50. Kleiner, D E. et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41.1313-21 (2005).

EXAMPLE 2 [00360]Example 2: Hepatic oxalate overproduction as a driver and therapeutic target in NASH and atherosclerosis [00361]Affecting one third of the global population, with no pharmacotherapy available, nonalcoholic fatty liver disease (NAFLD) has become the leading cause of chronic liver Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 disease. Surprisingly, the major cause of death in patients with NAFLD, particularly in those with the more severe nonalcoholic steatohepatitis (NASH), is atherosclerotic cardiovascular disease (CVD). Thus, there is a critical need to identify targetable pathways for concurrent treatment of NASH and atherosclerotic CVD, which has been hampered by limited understanding of the pathophysiology and metabolic pathways linking these two diseases. Recently, we and others uncovered oxalate metabolism commonly dysregulated in NAFLD and CVD. Using unbiased transcriptomics, we identified suppression of genes that limit oxalate production in livers from humans and mice with NASH. Alanine-glyoxylate aminotransferase (AGXT), a liver-specific enzyme that detoxifies glyoxylate, the oxalate precursor, was reduced and oxalate was markedly increased in correlation with NASH severity. Remarkably, oxalate was also increased both in patients and mice with atherosclerosis. In our mouse models of hepatic oxalate overproduction (Agxl^־ and Agxl־־iApoc). both NASH and atherosclerosis were increased with suppressed hepatic fatty acid 3-oxidation (FAO) and induction of proinflammatory pathways. In hepatocytes, oxalate induced mitochondrial dysfunction and lipid accumulation while downregulating peroxisome proliferator-activated receptor a (PPARa), inhibiting FAO and upregulating C-C motif chemokine ligand 5 (CCL5). Importantly, limiting hepatic oxalate production via hepatocyte-specific overexpression of AGXT (AAV8-TBG-AGXT) reduced NASH and atherosclerosis in mice by stimulating FAO and attenuating proinflammatory responses. Together, our findings uncover hepatic oxalate overproduction as a dysregulated metabolic pathway linking NASH and atherosclerotic CVD, highlighting the potential of oxalate reduction for concurrent treatment of these two prominent diseases.

EXAMPLE 3 [00362]Example 3: Salicylic Acid Derivatives [00363[MDMG-935P [00364]The compound MDMG-935P has been and evaluated in lipid loaded hepatocytes (in vitro) and NASH mouse models (in vivo). MDMG-935P is included in the family of compounds with general structure aminomethylfurylsalicylic acids.HOOC MDMG-935P -95 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-365" id="p-365" id="p-365" id="p-365"

[00365]Structure of the salicylic acid derivative MDMG-935P (Moya-Garzon et al., NewSalicylic Acid Derivatives, Double Inhibitors of Glycolate Oxidase and LactateDehydrogenase, as Effective Agents Decreasing Oxalate Production. European Journal of Medicinal Chemistry 2022, 237. 114396 and EP 3593803) [00366]Biological effect of MDMG-935P: Lowering of hepatic oxalate formation. [00367] COMPOUNDS FAB [00368]The following compounds (Scheme 3) have been tested in primary hyperoxaluria (in vitro). The compounds can be tested in lipid loaded hepatocytes (in vitro) and NASH mouse models (in vivo). id="p-369" id="p-369" id="p-369" id="p-369"

[00369] Scheme 3. Structures of the salicylic acid derivatives FAB. [00370] COMPOUNDS FAB [00371]The following compounds (Scheme 3) have texted in primary hyperoxaluria (in vitro). The compounds can be tested in lipid loaded hepatocytes (in vitro) and NASH mouse models (in vivo).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-372" id="p-372" id="p-372" id="p-372"

[00372]The general structure of the compounds in Scheme I can be summarized by Formula (II): id="p-373" id="p-373" id="p-373" id="p-373"

[00373] Formula 11.General structure of the salicylic acid derivatives FAB. [00374[The compound FAB-541has been texted testing primary hyperoxaluria (in vitro). Without wishing to be bound by theory, it can be tested in lipid loaded hepatocytes (in vitro) and NASH mouse models (in vivo). [00375]The structural difference with the general structure in Formula 11 is the substitution of the carboxylic acid group on Cl with a nitro group. After that change, compound FAB-541 is not a salicylic acid derivative. id="p-376" id="p-376" id="p-376" id="p-376"

[00376]The general structure that gathers the compounds in Scheme 1 and FAB-541is the one shown in Formula 1.

A AA-B = C=O or ^CH-OH R3 = -COOH or -NO2 [00377] Formula 1.General structure of the FAB compounds (salicylic and non-salicylic acid derivatives).

FAB-541 X-Y = CH2-CH2 or CH=CH Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-378" id="p-378" id="p-378" id="p-378"

[00378] Table 3summarizes the compounds FAB according to the general structureindicated in Figure 5 (i.e. summary of the compounds included in FAB-541and Scheme 3). id="p-379" id="p-379" id="p-379" id="p-379"

[00379]Table 3. Summary 7 of compounds FAB that have been synthesized and evaluated Compound Ri R2 R3 X-Y A-B FAB-541 -Br -H -NO2 -CH=CH- -CO- FAB-544 -N(CH3)2 -H -COOH -CH=CH- -CO- FAB-548 -1 -H -COOH -CH=CH- -CO- FAB-549 -CF3 -H -COOH-CH2-CH2- -CO- FAB-563 ־(CH2)3CH3 -H -COOH -CH=CH- CO- FAB-566 -SCH3 -H -COOH -CH=CH- -CO­ FAB-570 -CH=CH-COOH -H -COOH -CH=CH- co- FAB-57 la -CH2CH3 -H -COOH -CH=CH- -co ­ FAB-573 -CH3 -H -COOH -CH=CH- -CO- FAB-576 -CH(CH3)2 -H -COOH -CH=CH- -CO- FAB-578a -CH20H -Et -COOH -CH=CH- -CO- FAB-58 laa -(CH2)2-COOH -H -COOH -CH=CH- -CO- FAB- 581atBu -(CH2)2-COOC(CH3)3-H -COOH -CH=CH- co- FAB-583a -CeC-(CH2)4C1 -H -COOH -CH=CH- -co ­ FAB-585 -(CH2)3CH3 -H -COOH-CH2-CH2- -CO- FAB-587 -(CH2)3CH3 -H -COOH -CH2-CH2- -(CHOH)- FAB-590A -(CH2)5CH3 -H -COOH -CH=CH- CO- FAB-594A -(CH2)7CH3 -H -COOH -CH=CH- -CO­ (according to the general structure in Formula 1). [00380[The following general structure (Formula 1) summarizes non-limiting. exemplary compounds: id="p-381" id="p-381" id="p-381" id="p-381"

[00381]R1 = Hydrogen. -Ph, furan, tiophene, pyridine, halogen, -CF3, -CN, -N(R4)(R5). - OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, ־Pr, ‘Bu, -(CH2)nCH3, -(CH2)n/Pr, -(CH2)n،Bu, -(CH2)nOR4, -(CH2)״N(R4)(R5), -(CH2)nCOOR4, -(CH2)nCON(R4)(R5), - (CH2)nSR4. -(CH2)nCN, -(CH2)n־Cl, -CH=CH-(CH2)n-CH3, -CH=CH-(CH2)n'Pr, -CH=CH- (CH2)nrBu. -CH=C-(CH2)nOR4, -CH=CH-(CH2)nN(R4)(R5). -CH=CH-(CH2)nCOOR4. - CH=CH-(CH2)״CON(R4)(R5), -CH=CH-(CH2)nSR4, -CH=CH-(CH2)nCN, -CH=CH-(CH2)n- Cl, -C=C-(CH2)n-CH3, -C=C-(CH2)nTr, -C=C-(CH2)n׳Bu. -C=C-(CH2)״OR4. -C=C- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 (CH2)nN(R4)(R5), -C=C-(CH2)nCOOR4, -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)nSR4, -C=C- (CH2)nCN, or -C=C-(CH2)n-Cl; [00382]R2 = Hydrogen, -Ph, furan, tiophene, pyridine, halogen, -CF3, -CN, -N(R4)(R5), - OR4, -SR4. -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, 'Pr, ‘Bu, -(CH2)״CH3, -(CH2)n'Pr, -(CH2)/Bu, ־(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4, -(CH2)nCON(R4)(R5), - (CH2)nSR4, -(CH2)nCN, -(CH2)n־Cl, -CH=CH-(CH2)n־CH3, -CH=CH-(CH2)n zPr, -CH=CH- (CH2)n׳Bu, -CH=C-(CH2)nOR4, -CH=CH-(CH2)״N(R4)(R5), -CH=CH-(CH2)nCOOR4, - CH=CH-(CH2)nCON(R4)(R5), -CH=CH-(CH2)״SR4, -CH=CH-(CH2)nCN. -CH=CH-(CH2)״- Cl, -C=C-(CH2)n-CH3, -C=C-(CH2)״'Pr, -C=C-(CH2)״fBu, -C=C-(CH2)nOR4, -C=C- (CH2)nN(R4)(R5), -C=C-(CH2)nCOOR4, -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)nSR4, -C=C- (CH2)nCN, or -C=C-(CH2)n-CI: [00383]n = 0-10 [00384[R3 = -COOH, -COOR6, -NO2 [00385]R4 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; [00386]R5 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; [00387]R6 = -CH3, -CH2CH3 [00388]A-B = -CO-, -(CHOH)- [00389]X-Y = -CH2-CH2-, -CH=CH- [00390]Without wishing to be bound by theory, non-limiting, general structure of the FAB compounds (salicylic and non-salicylic acid derivatives). [00391]Pharmacological mechanism of compounds FAB [00392[All the compounds FAB are designed to be dual inhibitors of the enzymes GO and LDHA. The biological data against recombinant enzy mes GO and LDHA are summarized in Table 4. [00393] Table 4Values of IC50 (uM) against recombinant enzymes obtained for the FAB compounds (i.e. those included in Table 1). Compound AGO* ILDHA* FAB-541 3.7 ±0.54 2.4 ± 0.44FAB-544 3.3 ±0.06 1.1 ±0.37FAB-548 1.9±0.16 3.2 ±0.96FAB-549 11.4 ±0.70 0.4 ±0.15FAB-563 1.8 ±0.990.07 ± 0.02FAB-566 1.8 ±0.22 3.7 ±0.36 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-570 0.97 ± 0.05 3.4 ± 1.2FAB-57 la 3.6 ±0.21 1.4 ±0.58FAB-573 2.3 ±0.33 1.5 ±0.57FAB-576 2.5 ±0.11 0.3 ± 0.06FAB-578a 3.4±0.19 > 10FAB-581 aa 5.8 ±0.40 > 10FAB- 581atBu2.3 ±0.25 0.7 ±0.11 FAB-583a 0.8 ±0.060.09 ± 0.02FAB-585 6.2 ±0.20 4.0±0.13FAB-587 3.1 ±0.07 0.8 ±0.19FAB-590A 1.9±0.10 0.4 ±0.21FAB-594A 1.1 ±0.02 0.1 ±0.02 [00394]*Mean of four replicates with ten concentrations of inhibitor each ± SD [00395] Flavonoids [00396]The Flavonoid compounds have been tested against recombinant enzymes GOandLDHA. They have undergone biological testing in hyperoxaluric hepatocytes (in vitro) and, without wishing to be bound by theory, in lipid loaded hepatocytes (in vitro) or in NASH mouse models (in vivo). These compounds are natural products and are not structurally related to MDMG-935P or FAB compounds. They are not salicylic acid derivatives. id="p-397" id="p-397" id="p-397" id="p-397"

[00397] Scheme 2.Structures of the FL compounds [00398]Pharmacological mechanism of compounds FL; Inhibition of enzyme GO. [00399]Biological effect of compounds FL: Lowering of hepatic oxalate production. [00400]SYNTHETIC METHODOLOGY [00401]1. SYNTHESIS OF SALICYLIC ACID DERIVATIVES [00402]1.1. General synthetic route.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Scheme 1.General synthetic pathway for the preparation of salicylic acid derivatives included in Figure 6 (R3 = -COOH, -COOR6). [00403]1.2. Synthetic procedures. [00404]1.2.1. Synthesis of MDMG-409e by Suzuki-Miyaura reaction. [00405]Methyl 5-(5-formyl-2-furanyl)-2-hydroxybenzoate (MDMG-409E) (step a, Scheme1). id="p-406" id="p-406" id="p-406" id="p-406"

[00406]To a stirred solution of methyl 5-iodosalicylate (1)(1 eq) and 5-formyl-2- furanylboronic acid (2) (1.5 eq) in DMF (2.5 mL/mmol), triethylamine (3 eq) and Pd(OAc)(0.05 eq) were added. The reaction mixture was stirred at room temperature overnight. After consumption of the starting material, evaluated by TLC (petrol etherethyl acetate) (70:30), the reaction mixture was concentrated in a high vacuum rotavapor. The solid residue was dissolved in ethyl acetate and washed with water and brine. The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography (FCC) (gradient elution using petrol etherethyl acetate) (80:20 50:50) toyield MDMG-409Eas a yellowish-orange solid (87% yield). 1H NMR (400 MHz, chloroform- 5 10.99 (s, 1H, OH), 9.61 (s, 1H), 8.31 (d, J =2.3 Hz, 1H), 7.87 (dd, J= 8.7, 2.3 Hz, 1H), 7.31 (d,J=3.7Hz, 1H), 7.05 (d, J =8.7 Hz, 1H), 6.74 (d, J = 3.7 Hz, 1H), 4.00 (s, 3H). 13C NMR (101 MHz, chloroform-60 5 177.0,170.2, 162.7,158.7,151.9,132.6, 127.2,120.8, 118.6, Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 112.9 , 106.8, 52.7. HRMS: m id="p-409" id="p-409" id="p-409" id="p-409"

[00409]Working on a sealed tube in an inert argon atmosphere, 4-bromoacetophenone (1 eq), palladium (II) acetate (0.02 eq), l,4-diazabicylo[2,2,2]octane (DABCO) (0.04 eq) and potassium carbonate (1 eq) were dissolved in anhydrous Al ?/-dimethyl formamide. After addition of tert-butyl acrylate (1.5 eq), the reaction mixture was heated to 120 °C during 15h. Once cooled down, the reaction was fdtered through zeolite and concentrated under reduced pressure. FCC purification was performed by gradient elution using petrol ether:ethyl acetate (100:0 80:20). Yellowish oil (81% yield). [00410]1H NMR (500 MHz, chloroform-d) 5 7.95 (d, J = 8.4 Hz, 2H), 7.63 - 7.55 (m, 3H), 6.45 (d, J = 16.0 Hz, 1H), 2.61 (s, 3H), 1.54 (s, 9H). 13C NMR (126 MHz, chloroform-d) 197.49, 165.91, 142.10, 139.21, 137.93, 128.95, 128.15, 122.92, 81.08, 28.30, 26.81. [00411]/c77-Butyl 3-(4-acetylphenyl)propanoate (FAB-574). id="p-412" id="p-412" id="p-412" id="p-412"

[00412] FAB-564(1 eq) was dissolved in THF and 1 mF of Raney Nickel® activated catalyst (50% slurry in water) was then added. Hydrogen (g) was bubbled through the solution during Ih. Once completed, the reaction mixture was fdtered through zeolite and concentrated under reduced pressure. FCC purification was performed by elution using mixtures of petrol ether and ethyl acetate. The final product was obtained as a yellowish oil (96% yield). [00413]1H NMR (400 MHz, chloroform-d) 5 7.88 (d. J = 8.2 Hz, 2H). 7.29 (d, J = 8.2 Hz, 2H), 2.96 (t, J = Il Hz, 2H), 2.57 (d, J = 7.1 Hz, 5H), 1.40 (s, 9H). [00414]1 -(4-(6-Chlorohex-l -yn-1 -yl)phenyl)ethan- 1 -one (FAB-586).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-415" id="p-415" id="p-415" id="p-415"

[00415]A solution of 4-iodoacetophenone (1 eq), bis(triphenylphosphine)palladium (II) dichloride (0.05 eq) and copper (I) iodide in anhydrous THF, was prepared under argon atmosphere. Then a IM solution of tetrabutylammonium fluoride (1.5 eq) in hexane and 6- chi oro-l-hexyne (1.1 eq) were added to start the reaction. After 2h stirring at rt the reaction was completed. It was filtered through zeolite and concentrated under reduced pressure. FCC purification was performed by elution using mixtures of petrol ether and ethyl acetate. The final product was obtained as a white solid (88% yield). [00416]1H NMR (400 MHz, chloroform-d) 5 7.87 (d. J = 8.4 Hz, 2H). 7.46 (d, J = 8.5 Hz, 2H), 3.60 (t, J= 6.5 Hz, 2H). 2.58 (d, J= 0.6 Hz, 3H). 2.49 (t. J= 6.9 Hz. 2H), 2.00 - 1.92 (m. 2H), 1.83 - 1.74 (m, 2H). 13C NMR (101 MHz, chloroform-ri) 5 197.48, 135.96, 131.79, 128.92, 128.32, 93.27, 80.83, 44.60, 31.75, 26.71, 25.85, 18.99. [00417]1.2.3. General conditions for aldol condensation (step b. Scheme 1). [00418[To a stirred solution of the corresponding methylketone (3)(1.5 eq) in a THF:MeOH (1:1) mixture (2.5 mL/mmol), lONNaOH aqueous solution (10 eq) was added dropwise. After min, a solution of MDMG-409E(1 eq) in a THF:MeOH (1:1) mixture (2.5 mL/mmol) was added. After 24 h stirring at rt, the reaction was quenched by addition of HC1 3N until pH 3. The organic solvents were evaporated under reduced pressure and 20 mL of ethyl acetate were added. The organic layer was washed with water and brine, dried over MgSO4, filtered and concentrated under reduced pressure. The final products (salicylate esters or salicylic acids) were purified by FCC. [00419]Methyl (E)-2-hydroxy-5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)prop-l-en-l- yl)furan-2-yl)benzoate (FAB-542).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-420" id="p-420" id="p-420" id="p-420"

[00420]General conditions for aldol condensation using the methylketone p- trifluoromethylacetophenone. FCC purification; Gradient elution using petrol ether:ethyl acetate (100:0 80:20). Reddish-orange solid (93% yield). [00421]1H NMR (400 MHz, chloroform-d) 5 10.93 (s, 1H), 8.22 (d, J = 2.3 Hz, 1H), 8.12 (d, J = 8.1 Hz, 2H), 7.87 (dd, J = 8.7, 2.3 Hz, 1H), 7.60 (d, J = 15.3 Hz, 1H), 7.41 (d, J = 15.3 Hz, 1H), 7.07 (d, J = 8.7 Hz, 1H), 6.85 (d, J = 3.6 Hz, 1H), 6.71 (d. J = 3.6 Hz, 1H), 4.03 (s, 3H). 13CNMR(101 MHz, chloroform-d) 5 189.09, 170.16. 162.02, 156.09, 150.66, 141.30, 141.133.90 (q, J = 32.6 Hz), 131.92, 131.48, 128.70. 126.18, 125.66 (q, .7= 3.7 Hz), 123.74 (q, J = 272.7 Hz), 121.52, 119.91, 118.51, 118.00, 112.79, 107.54, 52.66. HRMS: m/z calcd. for [M+H] C22H16O5F3 417.0950; found, 417.0971 (deviation 5.0 ppm). [00422](E)-5-(5-(3-(4-(dimethylamino)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2- hydroxybenzoic acid (FAB-544).HO^O FAB-544 N / [00423]General conditions for aldol condensation using the methylketone p-(N,N- dimethylamino)acetophenone. FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2 >45:45:10) acidified with 1% acetic acid. Reddish- orange solid (83% yield). [00424]1H NMR (500 MHz, methanol-6/4) 5 8.39 (d, J = 2.2 Hz, 1H). 8.01 (d, J= 9.0 Hz, 2H), 7.79 (dd, .7=8.6, 2.2 Hz, 1H), 7.59 (d,.7 = 15.2 Hz, 1H), 7.51 (d,.7 = 15.2 Hz, 1H), 6.91 (d,.

FAB-542 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 = 8.6 Hz, 1H), 6.89 (d, J= 3.5 Hz, 1H), 6.80 - 6.76 (m, 3H), 3.09 (s, 6H). 13C NMR (126 MHz, methanol-d4) 5189.53, 163.46, 158.06, 155.43, 152.15, 132.02, 130.69, 130.20, 128.06, 126.76. 121.93, 119.88, 118.88, 118.31, 112.08, 107.58, 40.13. HRMS: m/z caled for [M+H] C22H20NO5 378.1341; found, 378.1339 (deviation -0.5 ppm). [00425]Methyl (£)-2-hydroxy-5-(5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)benzoate (FAB-545).

I [00426]General conditions for aldol condensation using the methylketone p- iodoacetophenone. FCC purification: Gradient elution using petrol etherethyl acetate 95:70:30). Reddish-orange solid (94% yield). [00427]1H NMR (400 MHz, chloroform-d) 5 10.93 (s, 1H), 8.22 (d, J = 2.3 Hz, 1H), 7.(dq, J= 8.7, 2.2 Hz, 3H), 7.78 - 7.73 (m, 2H), 7.59 (d, J= 15.3 Hz, 1H), 7.39 (d, J = 15.3 Hz, 1H), 7.07 (d, J =8.7 Hz. 1H), 6.82 (d. J =3.6 Hz. 1H), 6.70 (d, J = 3.6 Hz, 1H), 4.03 (s. 3H). 13C NMR (101 MHz. chloroform-d) 8 189.27, 170.30. 162.06. 155.97, 150.93, 138.04, 137.81. 132.03,131.09,130.00,126.25, 121.73, 119.59, 118.61,118.07,112.90,107.58, 100.53,52.78. HRMS: m/z calcd. for [M-H] C21H14O5I 472.9886; found, 472.9848 (deviation: 6.5 ppm). [00428]Methyl (£)-2-hydroxy-5-(5-(3-(4-(methylthio)phenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)benzoate (FAB-554).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-429" id="p-429" id="p-429" id="p-429"

[00429]General conditions for aldol condensation using the methylketone p- (methylthio)acetophenone. FCCpurification: Gradient elution using petrol ether:ethyl acetate (100:0 —► 80:20). Reddish-brown solid (89% yield). [00430]1H NMR (500 MHz, chloroform-d) 5 10.92 (s. 1H), 8.20 (d. J= 2.3 Hz. 1H), 7.98 (d, J= 8.6 Hz, 2H), 7.86 (dd, J= 8.7, 2.3 Hz, 1H), 7.58 (d, J= 15.2 Hz, 1H), 7.45 (d, J= 15.3 Hz, 1H), 7.35 - 7.29 (m, 2H), 7.06 (d, J = 8.7 Hz, 1H), 6.79 (d, J = 3.6 Hz, 1H), 6.68 (d, J= 3.Hz, 1H), 4.02 (s, 3H), 2.54 (s, 3H). 13C NMR (126 MHz, chloroform-d) 5 188.80, 170.31, 161.92. 155.60, 151.11. 145.59, 134.74. 131.96, 130.38, 129.01, 126.14, 125.23, 121.83, 118.98, 118.53,118.46,112.84,107.45,52.76, 14.98. HRMS: m/zcalcd. for [M+H] C22H17O5S 393.0767; found, 393.0797 (deviation -7.6 ppm). [00431]Methyl (£')-5-(5-(3-(4-cyanophenyl)-3-oxoprop- l-en- 1 -yl)furan-2-yl)-2-hydroxybenzoate (FAB-555). id="p-432" id="p-432" id="p-432" id="p-432"

[00432]General conditions for aldol condensation using the methylketone p- cyanoacetophenone. FCC purification: Gradient elution using petrol etherethyl acetate (100:70:30). Reddish-orange solid (90% yield). [00433]1H NMR (500 MHz, chloroform-d) 5 10.94 (s. 1H), 8.23 (d, J= 2.4 Hz, 1H), 8.11 (d, J= 8.4 Hz, 2H), 7.88 (dd, J= 8.8, 2.3 Hz, 1H), 7.84 - 7.79 (m, 2H), 7.62 (d, J = 15.2 Hz, 1H), 7.39 (d, J = 15.3 Hz, 1H), 7.08 (d, J = 8.8 Hz, 1H), 6.88 (d, J = 3.6 Hz, 1H), 6.73 (d, J= 3.Hz, 1H), 4.03 (s, 3H). 13C NMR (126 MHz, chloroform-d) 5 188.66, 170.25, 162.20, 156.45, 150.69. 141.85, 141.85. 132.63, 132.08, 131.95, 128.93, 126.37, 121.55, 120.52, 118.67, 117.60. 115.92, 112.93, 107.79. 52.82. HRMS: m/z calcd. for [M+H] C22H14NO5 393.0767; found, 393.0797 (deviation -7.6 ppm). [00434]Methyl (E)-5-(5-(3-(4-butylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-559).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-435" id="p-435" id="p-435" id="p-435"

[00435]General conditions for aldol condensation using the methylketone p- butyl acetophenone. FCC purification: Gradient elution using petrol etherethyl acetate (100:80:20). Reddish-orange solid (87% yield). [00436]1H NMR (400 MHz, chloroform-d) 5 10.92 (s. 1H), 8.22 (d. J= 2.3 Hz. 1H), 7.98 (d, J= 8.2 Hz, 2H), 7.87 (dd, J= 8.8, 2.3 Hz, 1H), 7.59 (d, J= 15.3 Hz, 1H), 7.48 (d, J= 15.3 Hz, 1H), 7.32 (d, J = 8.2 Hz, 2H), 7.07 (d, J = 8.7 Hz, 1H), 6.79 (d, J = 3.6 Hz, 1H), 6.69 (d, J= 3.6 Hz, 1H), 4.03 (s, 3H), 2.70 (t, J = 7.7 Hz, 2H), 1.65 (p, J= 7.5 Hz, 2H), 1.38(dq,J= 14.6, 7.3 Hz. 2H), 0.95 (t. J = 13 Hz, 3H). 13C NMR (101 MHz, chloroform-d) 5 189.77, 170.36, 161.93, 155.55, 151.18, 148.57, 136.16, 131.99, 130.33, 128.82, 128.74, 126.15, 121.91, 118.98, 118.80, 118.55, 112.87, 107.41, 77.48, 52.76, 35.89, 33.45, 22.49, 14.06. HRMS: m'z calcd. for [M+H] C25H25O5= 405.1702; found, 405.1689 (deviation -3.2 ppm). [00437](E)-2-Hydroxy-5-(5-(3-(4-hydroxyphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-561).

FAB-561 id="p-438" id="p-438" id="p-438" id="p-438"

[00438]General conditions for aldol condensation using the methylketone p- hydroxy acetophenone. FCCpurification: Gradient elution using petrolether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish- orange solid (75% yield).

FAB-559 HO^^O Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-439" id="p-439" id="p-439" id="p-439"

[00439]1H NMR (500 MHz, methanol-d) 5 8.31 (d, J = 2.2 Hz, 1H), 8.03 - 8.00 (m, 2H), 7.94 (dd, J= 8.7, 2.3 Hz, 1H), 7.57 (d, J = 1.8 Hz, 2H), 7.02 (d, J = 8.7 Hz, 1H), 6.95 (d, J= 3.6 Hz, 1H), 6.93 - 6.89 (m, 2H), 6.86 - 6.84 (m, 1H). 13C NMR (126 MHz, methanol-674) 190.25. 173.48, 163.89. 163.50, 157.33. 152.31, 132.44. 132.22, 131.06. 127.58, 122.68, 120.17, 119.08, 119.00, 116.46, 108.31. HRMS: m/z calcd. for [M+H] C20H15O6 351.0869; found, 351.0881 (deviation +3.4 ppm). [00440]5-(5-((£)-3-(4-((£)-3-(tert-butoxy)-3-oxoprop-l-en-l-yl)phenyl)-3-oxoprop-l-en-l- yl)furan-2-yl)-2-hydroxy benzoic acid (FAB-565). [00441[General conditions for aldol condensation using the methylketone FAB-564.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol(49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (73%yield). [00442]1H NMR (400 MHz, methanol-674) 5 8.26 (s, 1H), 8.05 (d, J= 7.8 Hz, 2H), 7.92 (d, J = 8.4 Hz, 1H). 7.72 (d, J = 7.8 Hz, 2H), 7.64 - 7.54 (m, 2H), 7.49 (d, J= 15.2 Hz, 1H), 7.(d, 8.6 Hz, 1H), 6.98 (d, J= 2.6 Hz, 1H), 6.84 (d, J = 2.6 Hz, 1H), 6.55 (d, J= 16.0 Hz,1H), 1.54 (s, 9H). 13C NMR (101 MHz, methanol -674) 5 190.75, 167.56, 157.64,152.16, 143.63, 140.41. 140.17, 132.74, 132.11, 130.06, 129.40, 127.65, 123.45, 122.65, 121.15, 119.13, 118.76. 108.63, 82.06,28.42. [00443]Methyl (£)-2-hydroxy-5-(5-(3-oxo-3-(/Molyl)prop-l-en-l-yl)furan-2-yl)benzoate (FAB-567).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 [00444[General conditions for aldol condensation using the methylketone p- methylacetophenone. FCCpurification: Gradient elution using petrol etherethyl acetate (100:50:50). Reddish-orange solid (96% yield). [00445]1H NMR (500 MHz, chloroform-d) 5 10.92 (s, 1H), 8.22 (d, J= 2.3 Hz, 1H), 7.96 (d, J= 8.2 Hz, 2H), 7.87 (dd, J= 8.7, 2.3 Hz, 1H), 7.58 (d, J= 15.4 Hz, 1H), 7.47 (d, J= 15.3 Hz, 1H), 7.32 (d, J = 7.8 Hz, 2H), 7.07 (d, J = 8.7 Hz, 1H), 6.79 (d, J = 3.5 Hz, 1H), 6.69 (d, J = 3.5 Hz, 1H), 4.03 (s, 3H), 2.45 (s, 3H). 13C NMR (126 MHz, chloroform-d) 5 189.70, 170.35, 161.92, 155.55, 151.14, 143.64, 135.93, 131.98, 130.36, 129.45, 128.72, 126.14, 121.88, 118.87. 118.84, 118.54, 112.85, 107.41, 52.76, 21.83. HRMS: wz calcd. for [M+H] C22H19363.1232; found, 363.1242 (deviation 2.8 ppm). [00446]Methyl (E)-2-hydroxy-5-(5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l -en-1 -yl)furan-2-yl)benzoate (FAB-568). id="p-447" id="p-447" id="p-447" id="p-447"

[00447]General conditions for aldol condensation using the methylketone /?-(hydroxymethyl) acetophenone. FCC purification: Gradient elution using petrol etherethyl acetate (80:20 —> 20:80). Reddish-orange solid (83% yield). [00448]1H NMR (500 MHz, chloroform-d) 5 10.92 (s, 1H), 8.22 (d, J= 2.3 Hz, 1H), 8.04 (d, J=8.2Hz, 2H), 7.87 (dd, J= 8.7, 2.3 Hz, 1H), 7.59 (d, J= 15.3 Hz, 1H), 7.51 (d,J=8.1 Hz, 2H), 7.46 (d,J=15.3Hz, 1H), 7.07 (d,J=8.7Hz, 1H), 6.81 (d,J=3.5Hz. 1H), 6.69 (d.J = FAB-567 FAB-568 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 3.5 Hz, 1H), 4.81 (s, 2H), 4.03 (s, 3H). 13C NMR (126 MHz, chloroform-d) 5 189.77, 170.33, 161.97, 155.74, 151.04, 145.87, 137.74, 132.00, 130.72, 128.91, 126.87, 126.19, 121.82, 119.19. 118.72, 118.57, 112.87, 107.49, 64.90, 52.78. HRMS: m/z calcd. for [M+H] C22H19379.1182; found. 379.1194 (deviation 3.2 ppm). [00449]Methyl (E)-5-(5-(3-(4-ethylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-571e). id="p-450" id="p-450" id="p-450" id="p-450"

[00450]General conditions for aldol condensation using the methylketone p- ethylacetophenone. FCC purification: Gradient elution using petrol ether:ethyl acetate (100:—> 70:30). Reddish-orange solid (43% yield). [00451]1H NMR (400 MHz, chloroform-d) 5 10.91 (s, 1H), 8.23 (d, J= 2.3 Hz, 1H), 7.99 (d, J= 8.2 Hz. 2H), 7.87 (dd, J = 8.7, 2.3 Hz, 1H), 7.59 (d, J = 15.3 Hz, 1H). 7.48 (d, J = 15.4 Hz. 1H), 7.34 (d, J = 8.3 Hz, 2H), 7.08 (d, J = 8.7 Hz, 1H), 6.79 (d, J = 3.6 Hz, 1H), 6.69 (d, J = 3.5 Hz, 1H), 4.03 (s, 3H), 2.74 (q, J = 7.6 Hz, 2H), 1.29 (t, J = 7.6 Hz, 3H). 13C NMR (1MHz, chloroform-c0 5 189.79,170.37,161.96,155.58, 151.20, 149.83, 136.22,132.01,130.36, 128.84. 128.28, 126.18, 121.93, 119.02. 118.80, 118.57, 112.90, 107.42. 52.76, 29.15, 15.40. HRMS: m/z calcd. for [M+H] C23H21O5 377.1389: found, 377.1385 (deviation -1.1 ppm). [00452](E)-5-(5-(3-(4-Ethylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate(FAB-5 7 la).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-453" id="p-453" id="p-453" id="p-453"

[00453]General conditions for aldol condensation using the methylketone p- ethylacetophenone. FCCpurification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish- orange solid (52% yield). [00454]1H NMR (400 MHz, methanol-6/4) 5 8.30 (d, J= 2.3 Hz, 1H), 7.99 (d, J= 8.3 Hz, 2H), 7.95 (dd, J= 8.7, 2.3 Hz, 1H), 7.57 (d, J=3.8 Hz, 2H), 7.39 (d, J = 8.3 Hz, 2H), 7.03 (d, J= 8.7 Hz, 1H), 6.98 (d,J=3.6Hz, 1H), 6.86 (d,J=3.6Hz, 1H), 2.75 (q, J = 7.6 Hz, 2H), 1.(t, J= 7.6 Hz. 4H). 13C NMR (101 MHz, methanol-6/4) 5 191.52, 163.56. 157.47, 152.23, 151.49, 137.15, 132.63, 131.69, 129.80, 129.33, 127.60, 122.71, 120.63, 119.17, 119.09, 108.47, 29.91, 15.70. HRMS: m/z calcd. for C22H1905 363.1232; found, 363.1242 (deviation +2.8 ppm). [00455]Methyl (70-2-hydroxy-5-(5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)benzoate (FAB-572). id="p-456" id="p-456" id="p-456" id="p-456"

[00456]General conditions for aldol condensation using the methylketone p- isopropylacetophenone. FCC purification: Gradient elution using petrol etherethyl acetate (100:0 —► 70:30). Reddish-orange solid (91% yield). [00457]1H NMR (500 MHz, chloroform-d) 5 10.92 (s, 1H), 8.22 (d, J= 2.3 Hz, 1H), 8.00 (d, J= 8.2 Hz. 2H), 7.87 (dd, J= S/K 2.3 Hz, 1H), 7.59 (d, J= 15.3 Hz, 1H). 7.48 (d, J= 15.3 Hz. 1H), 7.37 (d,.7 = 8.3 Hz, 2H), 7.08 (d,.7 = 8.7 Hz, 1H), 6.80 (d, .7 = 3.6 Hz, 1H), 6.69 (d,.7 = 3.5Hz, 1H), 4.03 (s, 3H), 3.00 (p,J=6.9Hz, 1H), 1.31 (s, 3H), 1.29 (s, 3H). 13C NMR (1MHz, chloroform-60 5 189.81, 170.37,161.93,155.56, 154.38, 151.16, 136.34, 132.00, 130.36, 128.86. 126.87, 126.15, 121.91, 118.99. 118.85, 118.56, 112.87, 107.42. 52.77, 34.44, 23.88. HRMS: m/z calcd. for [M+H] C24H2305 391.1545; found, 391.1557 (deviation +3.1). [00458](70-5-(5-(3-(3-Ethyl-4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2- hydroxybenzoic acid (FAB-578a).- Ill - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-459" id="p-459" id="p-459" id="p-459"

[00459]General conditions for aldol condensation using the methylketone l-[3-ethyl-4- (hydroxymethyl)phenyl]ethanone. FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish- orange solid (71% yield). [00460]1H NMR (400 MHz, methanol-^) 5 8.37 (d, J= 2.2 Hz, 1H), 7.92 (dd, J= 7.9, 1.Hz, 1H), 7.89 (s, 1H), 7.84 (dd, J= 8.7, 2.2 Hz, 1H), 7.60 (d, J= 7.8 Hz, 1H), 7.56 (d, J= 4.Hz, 2H), 6.98 - 6.94 (m, 2H), 6.81 (d, J= 3.6 Hz, 1H), 4.75 (s, 2H), 2.78 (q, J = 7.5 Hz, 2H), 1.29 (t,J=7.6Hz, 3H). 13C NMR (101 MHz, methanol-J4) 5 191.78, 163.55, 158.29, 151.91, 145.51. 143.51, 138.60. 131.86, 131.29. 129.30, 128.73. 128.05, 127.30. 122.00, 120.99, 118.76, 118.52, 108.02, 62.36, 26.07, 15.42. HRMS: m/z calcd. for C23H1905 391.1 190: found, 391.1208 (deviation 1.7 ppm). [00461](E)-5-(5-(3-(4-(3-(tert-Butoxy)-3-oxopropyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)-2-hydroxybenzoic acid (FAB-581atBu). [00462[General conditions for aldol condensation using the methylketone FAB-574.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol(49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (55% yield). [00463]1H NMR (400 MHz, methanol-6/4) 5 8.32 (d, J= 2.2 Hz, 1H). 8.01 (d, J= 8.3 Hz, 2H), 7.95 (dd. J= 8.7, 2.2 Hz, 1H). 7.62 - 7.53 (m, 2H), 7.41 (d, J= 8.3 Hz, 2H), 7.02 (d, J= 8.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Hz, 1H), 6.99 (d,J=3.6Hz, 1H), 6.87 (d,J=3.6Hz, 1H), 2.99 (t, J = 7.5 Hz, 2H), 2.61 (t, J = 7.5 Hz, 2H), 1.41 (s, 9H). 13C NMR (101 MHz, methanol-d) 5 191.42, 173.77, 163.60, 157.65. 152.18, 147.99, 137.61, 132.46, 131.82, 129.95, 129.77, 127.67, 122.59, 120.78, 119.02. 108.43, 81.80. 37.44, 32.07. 28.30. HRMS: m/z calcd. for C23H1707 461.1679: found, 461.1621 (deviation -2.5 ppm). [00464](E)-5-(5-(3-(4-(6-Chlorohex-l-yn-l-yl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2- hydroxybenzoic acid (FAB-583a). id="p-465" id="p-465" id="p-465" id="p-465"

[00465]General conditions for aldol condensation using the methylketone FAB-586.FCC purification: Gradient elution using petrol ether: dicloromethane: methanol(49:49:2—45:45׳ J 0) acidified with 1% acetic acid. Reddish-orange solid (93% yield). [00466]1H NMR (500 MHz. methanol-J4) 5 8.34 - 8.31 (m, 1H), 8.03 (d, J = 8.3 Hz. 2H), 7.95 (dd, J= 8.7, 1.8 Hz, 1H), 7.60 (t, J= 14.8 Hz, 2H), 7.53 (d, J = 8.2 Hz, 2H), 7.03 (d, J= 8.7 Hz, 1H), 7.01 (d, J = 3.6 Hz, 1H), 6.88 (d, J = 3.6 Hz, 1H), 3.66 (t, J = 6.5 Hz, 2H), 2.(t, J= 7.0 Hz, 2H), 1.97 (dt. J = 14.6, 6.6 Hz, 2H). 1.79 (p, J = 7.1 Hz, 2H). 13C NMR (1MHz, methanol-،/4) 5 190.78, 163.65, 157.75, 152.16, 138.30. 132.80, 132.52, 132.02, 130.11, 129.51, 127.72, 122.56, 121.08, 119.05, 118.72, 108.51, 94.23, 81.58, 45.25, 32.94, 26.98, 19.45. HRMS: m/z calcd. for C26H22C1O5 449.1143; found, 449.1150 (deviation +1.6 ppm). [00467]Methyl (£)-5-(5-(3-(4-hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoate (FAB-5906).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-468" id="p-468" id="p-468" id="p-468"

[00468]General conditions for aldol condensation using the methylketone p- hexylacetophenoe. FCC purification: Gradient elution using petrol etherethyl acetate) (100:—> 70:30). Reddish-orange solid (36% yield). [00469]1H NMR (500 MHz, chloroform-d) 5 10.92 (s, 1H), 8.21 (d, J= 2.3 Hz, 1H), 7.98 (d, J=8.2Hz, 2H), 7.86 (dd, J= 8.7, 2.3 Hz, 1H), 7.58 (d, J= 15.3 Hz, 1H), 7.47 (d, J= 15.3 Hz, 1H), 7.32 (d, J= 8.0 Hz, 2H), 7.07 (d, J= 8.7 Hz, 1H), 6.78 (d, J= 3.5 Hz, 1H), 6.68 (d, J = 3.5 Hz. 1H), 4.02 (s. 3H), 2.69 (t, J = 7.7 Hz, 2H), 1.65 (p, J = 7.5 Hz, 2H), 1.37 - 1.29 (m, 6H), 0.91 - 0.87 (m, 3H). 13C NMR (126 MHz, chloroform-d) 5 189.73. 170.33, 161.91. 155.52, 151.14, 148.61, 136.12, 131.96, 130.31, 128.80, 128.72, 126.12, 121.87, 118.92, 118.81, 118.52, 112.84, 107.40, 52.74, 36.18, 31.81, 31.27, 29.09, 22.72, 14.22. HRMS: m/z calcd. for [M+H] C27H2905 433.2010; found 433.1987 (deviation +5.1 ppm). [00470[(E)-5-(5-(3-(4-Hexylphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-590a). id="p-471" id="p-471" id="p-471" id="p-471"

[00471]General conditions for aldol condensation using the methylketone p- hexylacetophenone. FCC purification: Gradient elution using petrol Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 ether: dicloromethane: methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish- orange solid (55% yield). [00472]1H NMR (500 MHz, methanol-sk) 5 8.29 (d, J= 2.1 Hz, 1H). 7.98 (d, J= 8.1 Hz, 2H), 7.95 (dd. J= 8.7, 2.2 Hz, 1H). 7.60 - 7.52 (m, 2H), 7.35 (d, J = 8.1 Hz, 2H), 7.03 (d, J = Si Hz, 1H), 6.97 (d,J=3.6Hz, 1H), 6.86 (d,J=3.6Hz, 1H), 2.70 (t, J = 7.7 Hz, 2H), 1.66 (p,J = 7.5 Hz, 2H), 1.38 - 1.30 (m, 6H), 0.93 - 0.88 (m, 3H). 13C NMR (126 MHz, methanol-d4) 191.45. 173.16, 163.56, 157.41, 152.24, 150.16, 137.11, 132.69, 131.67, 129.89, 129.71, 127.57. 122.72, 120.64, 119.13, 119.11, 114.64, 108.50, 36.96, 32.85, 32.32, 30.07. 23.66, 14.40. HRMS: m zcalcd. for [M+H] C26H2705 419.1839; found, 419.1853 (deviation 3.4 ppm). [00473](£)-2-Hydroxy-5-(5-(3-(4-octylphenyl)-3-oxoprop- 1-en- l-yl)furan-2-yl)benzoic acid (FAB-594a). id="p-474" id="p-474" id="p-474" id="p-474"

[00474]General conditions for aldol condensation using the methylketone p- octylacetophenone. FCCpurification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2 >45:45:10) acidified with 1% acetic acid. Reddish- orange solid (91% yield). [00475[1H NMR (500 MHz, chloroform-d) 5 10.71 (s. 1H), 8.31 (s. 1H), 7.99 (d. J = 7.4 Hz. 2H), 7.91 (d,J=7.5Hz, 1H), 7.62 (d,J= 15.0 Hz, 1H), 7.50(d,J= 15.1 Hz, 1H), 7.32 (d,J = 7.6 Hz, 2H), 7.09 (d, J= 8.0 Hz, 1H), 6.75 (d, J= 49.6 Hz, 2H), 2.68 (t, J= 7.6 Hz, 2H), 1.(q, J = 7.0 Hz, 2H), 1.36 - 1.24 (m, 10H), 0.88 (t, J = 6.8 Hz, 3H). 13C NMR (126 MHz, chloroform-d) 5 190.08, 173.32, 162.46. 155.39, 151.23. 148.84, 135.98. 132.88, 130.58, 128.86, 126.97, 122.15, 119.07, 118.87, 118.72, 111.98, 107.63, 36.22, 32.01, 31.32, 29.59, 29.46, 29.39, 22.81, 14.25. HRMS: m/z caled. for [M+H] C28H3105 447.2152; found, 447.21(deviation +3.2 ppm). [00476]1.2.4. General conditions for double bond selective reduction (step c, Scheme 1).- 115 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 R R Chaicones Keto derivatives [00477]The corresponding chaicone was dissolved in THF at rt. Then, Raney Nickel* activated catalyst (50% slurry in water) (1 mL) was added. For the reaction to take place, hydrogen (g) was bubbled through the solution for l h. Once completed, the reaction mixture was filtered through zeolite and concentrated under reduced pressure. FCC purification was performed by elution using mixtures of petrol ether and ethyl acetate. [00478]Methyl 2-hydroxy-5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)propyl)furan-2- yl)benzoate (FAB-546). id="p-479" id="p-479" id="p-479" id="p-479"

[00479]General conditions for double bond selective reduction, using FAB-542.FCC purification (petrol ether : ethyl acetate) (100:0 —> 90:10). Clear oil (95% yield). [00480]1H NMR (400 MHz, chloroform-d) 5 10.75 (s, 1H), 8.08 (d, J= 8.1 Hz, 2H), 8.05 (d, 7=2.3 Hz. 1H), 7.73 (d. J = 8.2 Hz, 2H), 7.68 (dd, J = 8.7, 2.3 Hz, 1H), 6.98 (d, J= 8.8 Hz, 1H), 6.44 (d. J= 3.3 Hz. 1H), 6.13 (d. J = 3.3 Hz, 1H). 3.98 (s, 3H). 3.41 (t. J = 7.4 Hz. 2H), 3.17 (t,7= 7.4 Hz, 2H). 13C NMR (101 MHz, chloroform-d) 8 197.78, 170.53, 160.81, 153.88, 151.91, 139.50, 134.64 (q,7= 32.7 Hz), 131.20, 128.52, 125.87 (q, J= 3.7 Hz), 124.73, 123.(q, 7= 272.7 Hz), 123.06, 118.16, 112.56, 107.89, 104.86, 52.55,37.60, 22.75. [00481]Methyl 5-(5-(3-(4-butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoate (FAB- 582).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-482" id="p-482" id="p-482" id="p-482"

[00482]General conditions for double bond selective reduction, using FAB-559.FCC purification (petroleum ether : ethyl acetate) (100:0 —> 70:30). Clear oil (94% yield). [00483]1H NMR (500 MHz, chloroform-d) 5 10.76 (s, 1H), 8.07 (d, J= 23 Hz, 1H), 7.91 (d, J= 8.0 Hz, 2H), 7.69 (dd, J= 8.7. 2.3 Hz, 1H), 7.27 (d, J= 7.9 Hz, 2H), 6.98 (d, J= 8.7 Hz, 1H), 6.44 (d, J = 3.2 Hz, 1H), 6.12 (d, J = 3.2 Hz, 1H), 3.99 (s, 3H), 3.40 - 3.33 (m, 2H), 3.(t, J= 7.5 Hz, 2H), 2.66 (t, J= 7.7 Hz, 2H), 1.61 (p, J= 7.6 Hz, 2H), 1.35 (h, J= 1A Hz, 2H), 0.93 (t, 7.3 Hz, 3H). 13C NMR (126 MHz, chloroform-d) 8 198.43, 170.60, 160.71, 154.53,151.70. 149.06, 134.61, 131.20, 128.82, 128.34, 124.70, 123.18, 118.11, 112.53, 107.63, 104.83. 52.54, 37.12, 35.83, 33.38, 22.96, 22.45, 14.03. [00484]1.2.5. General conditions for double bond and keto reduction (step d, Scheme 1).

Hydroxy derivatives Chaicone derivatives id="p-485" id="p-485" id="p-485" id="p-485"

[00485]The corresponding chaicone (1 eq) was dissolved in THF. To the solution, palladium on activated charcoal 10% (0.05 eq) was added. For the reaction to take place, H2 was bubbled in the solution for 3h. Once completed, the reaction mixture was filtered through zeolite and concentrated under reduced pressure. [00486]Methyl 5-(5-(3-(4-butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoate (FAB-584).

FAB-582 Double bond and keto reduction Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-487" id="p-487" id="p-487" id="p-487"

[00487]General conditions for double bond selective reduction, using FAB-559.FCC purification: Gradient elution using petrol etherethyl acetate) (100:0 —>■ 70:30). Clear oil (71% yield). [00488]1H NMR (500 MHz, chloroform-d) 5 10.75 (s, 1H), 8.07 (d, J= 2.2 Hz, 1H), 7.(dd, J = 8.8, 2.3 Hz, 1H), 7.29 (d, J = 7.8 Hz, 2H), 7.18 (d, J = 7.8 Hz, 2H), 6.99 (d, J = 8.Hz, 1H), 6.44 (d, J= 3.2 Hz, 1H), 6.07 (d, J= 3.2 Hz, 1H), 4.74 (dd, J= 7.8, 5.5 Hz, 1H), 3.(s, 3H). 2.85-2.71 (m, 2H), 2.61 (t, J = 7.8 Hz, 2H), 2.25-2.07 (m, 2H). 1.63 - 1.56 (m, 2H), 1.36 (h, J= 1A Hz. 2H), 0.93 (t, J= 13 Hz, 3H). 13C NMR (126 MHz, chloroform-d) 5 131.06. 128.62, 125.89, 124.51, 117.99, 107.19, 104.63, 73.71, 52.42, 37.06, 35.34, 33.66, 24.69, 22.39, 13.97. [00489]1.2.6. General conditions for acid deprotection (step e, Scheme 1). id="p-490" id="p-490" id="p-490" id="p-490"

[00490]The corresponding methyl salicylate (1 eq) derivative was dissolved in pyridine (mL/mmol) and heated up to reflux during 15h. After this time, pyridine was removed using a high vacuum rotavapor. The residue was dissolved in ethyl acetate and the remaining trace of pyridine was extracted with aqueous HC1 IN. The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. FCC purification was performed using petrol ether:dicloromethane:methanol mixtures acidified with 1% acetic acid. [00491](E)-2-Hydroxy-5-(5-(3-(4-iodophenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-548).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-492" id="p-492" id="p-492" id="p-492"

[00492]General conditions for acid deprotection, using FAB-545.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2—>45:45:10) acidified with 1% acetic acid. Reddish-orange solid (94% yield). [00493]1H NMR (400 MHz, methanol-6/4) 5 8.22 (d, J = 2.3 Hz, 1H), 7.87 (dq, J = 8.7, 2.Hz. 3H), 7.78-7.73 (m, 2H), 7.59 (d,J = 15.3 Hz, 1H), 7.39 (d,J= 15.3 Hz, 1H), 7.07 (d,J = 8.7 Hz, 1H), 6.82 (d, J=3.6Hz, 1H), 6.70 (d, J = 3.6 Hz, 1H). 13C NMR (101 MHz, methanol- 6/4) 5 189.27, 170.30, 162.06, 155.97, 150.93, 138.04, 137.81, 132.03, 131.09, 130.00, 126.25, 121.73. 119.59, 118.61, 118.07, 112.90, 107.58, 100.53. HRMS: m/z calcd. for [M-H] C20H12O5I 458.9730; found, 458.9760 (deviation -8.0 ppm). [00494]2-Hydroxy-5-(5-(3-oxo-3-(4-(trifluoromethyl)phenyl)propyl)furan-2-yl)benzoic acid (FAB-549). id="p-495" id="p-495" id="p-495" id="p-495"

[00495]General conditions for acid deprotection, using FAB-546.FCC purification. Gradient elution using petrol ether:dicloromethane:methanol (49:49:2—>45:45:10) acidified with 1% acetic acid. Yellow solid (93% yield). [00496]1H NMR (400 MHz, acetone-6/6) 5 8.24 (d, J= 8.1 Hz, 2H). 8.15 (d, J= 2.2 Hz, 1H). 7.86 (d, J= 8.2 Hz, 2H), 7.74 (dd, J= 8.6, 2.1 Hz, 1H), 6.92 (d, J = 8.7 Hz, 1H), 6.60 (d, J= 3.2 Hz, 1H), 6.20 (d, J= 3.1 Hz, 1H), 3.53 (t, J- 13 Hz, 2H), 3.12 (t, J= 7.3 Hz, 2H). HRMS: m/z calcd. for [M+H] C21H14O5F3 403.0793: found, 403.0798 (deviation 1.2 ppm). [00497](E)-5-(5-(3-(4-Cyanophenyl)-3-oxoprop- l-en- l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-558).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-498" id="p-498" id="p-498" id="p-498"

[00498]General conditions for acid deprotection, using FAB-555.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2—>■40:40:20) acidified with 1% acetic acid. Reddish-orange solid (87% yield). [00499]1H NMR (400 MHz, DMSO-d) 5 8.27 - 8.23 (m, 3H), 8.08 (dd. J= 8.7, 2.3 Hz, 1H), 8.07 - 8.03 (m. 2H). 7.62 (s. 2H), 7.26 (d. J= 3.6 Hz. 1H), 7.15 (d. J= 3.6 Hz. 1H), 7.08 (d. J = 8.7 Hz, 1H). 13C NMR (101 MHz, DMSO-d) 5 187.84, 171.33, 161.65, 155.75, 150.29, 141.09, 132.83, 131.58, 131.18, 128.92, 126.26, 121.15, 120.62, 118.28, 118.06, 117.47, 114.81. 114.19, 108.31, 40.15. HRMS: m'z calcd. for [M-H] C18H15O6 327.0869; found, 327.0870 (deviation; 0.3 ppm). [00500](E)-5-(5-(3-(4-Butj'lphenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2-hydroxybenzoic acid (FAB-563). [00501[General conditions for acid deprotection, using FAB-559. FCCpurification gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (95% yield). [00502]1H NMR (500 MHz, methanol-d4) 5 8.29 (d, J= 2.2 Hz, 1H). 7.96 (d, J= 8.3 Hz, 2H), 7.90 (dd. J= 8.7, 2.3 Hz, 1H). 7.54 (d, J = 9.5 Hz, 1H), 7.34 (d, J = 8.3 Hz, 2H), 6.99 (d, J = 8.7 Hz, 1H), 6.95 (d, J= 3.6 Hz, 1H), 6.82 (d, J= 3.6 Hz, 1H), 2.72 - 2.66 (m, 2H), 1.68 - 1.(m, 2H), 1.38 (h, J= 7.4 Hz, 3H), 0.95 (t, J= 7.4 Hz, 3H). 13C NMR (126 MHz, methanol-d) 191.43, 163.51, 152.14, 150.10, 137.09, 132.38, 131.69, 130.53, 129.87, 129.72, 129.70, 127.66. 120.69, 119.02, 118.97, 108.37, 36.65, 34.53. 23.38, 14.24. HRMS; m/z calcd. for C24H2305 391.1545; found; 391.1557 (deviation +3.1 ppm).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-503" id="p-503" id="p-503" id="p-503"

[00503](/.’)-2-Hydroxy-5-(5-(3-(4-(methylth1o)phenyl)-3-ooprop-l -en-1 -yl)f11ran-2- yl)benzoic acid (FAB-566). s• [00504]General conditions for acid deprotection, using FAB-554.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (85% yield). [00505]1H NMR (500 MHz, methanol-d) 5 8.39 (d, J= 2.3 Hz, 1H), 8.01 (d, J= 8.5 Hz, 2H), 7.79 (dd, J= 8.6, 2.3 Hz, 1H), 7.56 (d, J = 3.7 Hz, 2H), 7.36 (d, J = 8.5 Hz, 2H), 6.95 (d, J = 3.6 Hz, 1H), 6.91 (d../ 8.6 Hz, 1H), 6.79 (d, J- 3.6 Hz, 1H), 2.55 (s, 3H). 13C NMR (1MHz, methanol-a 129.99 ,130.82 ,131.70 ,135.60 .147.76 ,151.85 ,158.56 ,163.62 ,190.57 5 (4׳, 128.17, 126.14, 121.76, 121.06. 119.37, 118.34, 118.24, 107.82, 14.62. HRMS: m/z caled. for [M-H] C21H15O5S 379.0640; found, 379.0662 (deviation 5.8 ppm). [00506](£)-2-Hydroxy-5-(5-(3-oxo-3-(p-tolyl)prop-l-en-l-yl)furan-2-yl)benzoic acid (FAB-573). id="p-507" id="p-507" id="p-507" id="p-507"

[00507]General conditions for acid deprotection, using FAB-567.FCC purification; Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (86% yield). [00508]1H NMR (500 MHz, DMSO-de) 5 8.17 (d, J = 2.4 Hz, 1H), 8.01 (d, J= 8.2 Hz, 2H), 7.85 (dd, J=8.5, 2.2 Hz, 1H), 7.56 (s, 2H), 7.39 (d, J=8.1 Hz, 2H), 7.17 (d, J = 3.6 Hz, 1H), 6.96 (d, J= 3.6 Hz, 1H), 6.84 (d, J= 8.6 Hz, 1H). 2.41 (s, 3H). 13C NMR (126 MHz, DMSO- d6) 5 187.88, 171.01, 159.13, 149.82, 143.28, 135.29, 129.98, 129.40, 129.38, 128.40, 126.32, 120.40, 117.32, 116.97, 106.77, 21.21. HRMS: m/z calcd. for C21H1505 347.0919; found, 347.0887 (deviation -9.2 ppm).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-509" id="p-509" id="p-509" id="p-509"

[00509](£)-2-Hydroxy-5-(5-(3-(4-(hydroxymethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)benzoic acid (FAB-575). id="p-510" id="p-510" id="p-510" id="p-510"

[00510]General conditions for acid deprotection, using FAB-568. FCCpurification; Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (91 % yield). [00511]1HNMR (400 MHz, DMSO-de) 8 8.19 (d, J = 2.4 Hz, 1H), 8.07 (d, J= 8.3 Hz, 2H), 7.86 (dd, J= 8.6, 2.4 Hz, 1H), 7.57 (s, 2H), 7.51 (d, J= 8.3 Hz, 2H), 7.18 (d, J= 3.6 Hz, 1H), 6.97 (d, J = 3.6 Hz, 1H), 6.85 (d, J = 8.6 Hz, 1H), 5.37 (s, 1H), 4.61 (s, 2H). 13C NMR (1MHz, DMSO) 6 188.01, 171.10. 163.79, 156.72, 149.82. 147.88, 136.30. 130.03, 129.35, 128.21, 126.40, 126.34, 120.38, 118.46, 117.29, 117.07, 106.80, 62.47. HRMS: m/z cal cd. for [M+H] C21H15O6 363.0869; found, 363.0858 (deviation -3.0 ppm). [00512](E)-2-Hydroxy-5-(5-(3-(4-isopropylphenyl)-3-oxoprop-l-en-l-yl)furan-2- yl)benzoic acid (FAB-576). id="p-513" id="p-513" id="p-513" id="p-513"

[00513]General conditions for acid deprotection, using FAB-572. FCCpurification; Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (89% yield). [00514]1H NMR (400 MHz, methanol-d4) 6 8.30 (d, .1= 2.2 Hz, 1H), 8.00 (d, .7= 8.4 Hz, 2H), 7.93 (dd, J = 8.7, 2.3 Hz, 1H), 7.56 (d, J = 3.8 Hz, 2H), 7.41 (d, J = 8.2 Hz, 2H), 7.02 (d, J = 8.7 Hz, 1H), 6.97 (d,J=3.6Hz, 1H), 6.85 (d,J=3.6Hz, 1H), 3.00 (p, J =6.9 Hz, 1H), 1.(d, J = 6.9 Hz, 6H). 13C NMR (101 MHz. methanol-da) 8 191.49, 163.56. 157.52, 155.97, 152.20, 137.28, 132.54, 131.69, 129.83, 127.90, 127.62, 122.64, 120.66, 119.13, 119.05, 108.44, 35.54, 24.07. HRMS: m/z caled. for C23H19O5 375.1232; found, 375.1219 (deviation - 3.5 ppm).- 122- FAB-575 FAB-576 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-515" id="p-515" id="p-515" id="p-515"

[00515]5-(5-(3-(4-Butylphenyl)-3-oxopropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 585). id="p-516" id="p-516" id="p-516" id="p-516"

[00516]General conditions for acid deprotection, using FAB-582.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2—>■45:45:10) acidified with 1% acetic acid. Clear oil (97% yield). [00517]1H NMR (400 MHz, methanol-J4) 5 8.15 (d, J = 2.4 Hz, 1H), 7.97 - 7.90 (m. 2H), 7.63 (dd. J = 8.6, 2.4 Hz, 1H). 7.31 (d, J = 8.2 Hz, 2H), 6.88 (d, J = 8.6 Hz. 1H), 6.47 (d. J = 3.2 Hz, 1H), 6.13 (d, J= 3.2 Hz, 1H), 3.40 (t, J = 7.3 Hz, 2H), 3.10 (t, J= 13 Hz, 2H), 2.68 (t, J=7.7Hz, 2H), 1.66- 1.57 (m, 2H), 1.40- 1.33 (m, 2H), 0.95 (t, J = 13 Hz, 3H). 13CNMR (101 MHz, methanol-J4) 5 200.93, 161.98, 155.25, 153.49, 150.30, 135.89, 130.61, 129.80, 129.40. 126.51, 123.78. 118.16, 108.44, 105.15, 37.83. 36.59, 34.49, 23.94, 23.32. 14.21. HRMS: m/z calcd. for [M+Na] C24H24NaO5 415.1505; found, 415.1516 (deviation +2.6 ppm). [00518]5-(5-(3-(4-Butylphenyl)-3-hydroxypropyl)furan-2-yl)-2-hydroxybenzoic acid (FAB- 587). id="p-519" id="p-519" id="p-519" id="p-519"

[00519]General conditions for acid deprotection, using FAB-584.FCC purification: Gradient elution using petrol ether:dicloromethane:methanol (49:49:2-45:45:10) acidified with 1% acetic acid. Clear oil (96% yield). [00520]1H NMR (400 MHz. methanol-J4) 5 8.10 (d, J = 2.3 Hz, 1H), 7.72 (dd, J = 8.7. 2.Hz, 1H), 7.27 (d, J= 8.1 Hz, 2H), 7.15 (d, J= 8.0 Hz, 2H), 6.94 (d, J= 8.7 Hz, 1H), 6.50 (d, J = 3.2 Hz, 1H), 6.08 (d, J= 3.2 Hz, 1H), 4.68 - 4.63 (m, 1H), 2.75 - 2.68 (m, 2H), 2.61 - 2.(m, 2H), 2.16 - 2.03 (m, 2H), 1.57 (ddt, J = 9.0, 7.6, 3.5 Hz, 2H), 1.38 - 1.30 (m. 2H), 0.93 (t, J = 7.4 Hz. 3H). 13CNMR (101 MHz, methanol-J4) 5 173.36. 162.11, 156.43, 152.78, 143.20, 143.14, 131.71, 129.39, 127.09, 125.96, 124.36, 118.64, 114.08, 108.22, 105.59, 74.21, 38.54,- 123 - FAB-585 FAB-587 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 36.30, 34.97, 25.50, 23.33, 14.27. HRMS: m/z calcd. for [M-H] C24H25O5 393.1706; found, 393.1707 (deviation +0.5 ppm). [00521]1.2.7. General conditions for Boc deprotection. id="p-522" id="p-522" id="p-522" id="p-522"

[00522]The corresponding tert-butyl ester (1 eq) was dissolved in dicloromethane. Trifluoroacetic acid was then added (4 eq). The reaction was stirred at rt during 2h. After this time, the organic solvents were evaporated under reduced pressure. FCC purification was performed using petrol ether: dicloromethane:methanol mixtures acidified with 1% acetic acid. [00523[5-(5-((£’)-3-(4-((£’)-2-Carboxyvinyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2- hydroxybenzoic acid (FAB-570). id="p-524" id="p-524" id="p-524" id="p-524"

[00524]General conditions for Boc deprotection, using FAB-565.FCC purification; Gradient elution using petrol ether:dicloromethane:methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (93% yield). [00525]1H NMR (400 MHz, DMSO-d6) 5 8.25 (d, J = 2.3 Hz, 1H), 8.14 (d, J = 8.5 Hz, 2H), 8.10 (dd, J = 8.7, 2.3 Hz, 1H). 7.89 (d, J= 8.4 Hz, 2H), 7.71 -7.56 (m, 3H), 7.23 (d, J = 3.Hz. 1H), 7.14 (d. J= 3.6 Hz, 1H), 7.09 (d. J= 8.7 Hz, 1H), 6.70 (d, J= 16.1 Hz, 1H). 13CNMR (101 MHz, DMSO-d6)5 187.86, 171.35, 167.27, 161.38, 155.27, 150.45, 142.63, 138.56, 138.38, 131.64, 130.32, 128.81, 128.51, 126.13, 121.68, 120.85, 120.30, 118.06, 117.92, 113.90. 108.20. HRMS; m/z calcd. for C23H17O7 405.0974; found, 405.0976 (deviation +0.PPm). [00526](C)-5-(5-(3-(4-(2-Carboxyethyl)phenyl)-3-oxoprop-l-en-l-yl)furan-2-yl)-2- hydroxybenzoic acid (FAB-581 aa).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-581 aa id="p-527" id="p-527" id="p-527" id="p-527"

[00527]General conditions for Boo deprotection, using FAB-574. FCCpurification; Gradient elution using petrol ether:dicloromethane;methanol (49:49:2^45:45:10) acidified with 1% acetic acid. Reddish-orange solid (90% yield). [00528]1H NMR (500 MHz, DMSO-de) 8 8.24 (d, J= 2.3 Hz, 1H), 8.09 (dd, J = 8.7, 2.3 Hz, 1H), 8.04 (d, J = 8.3 Hz, 2H), 7.65 - 7.54 (m, 2H), 7.44 (d, J = 8.3 Hz, 2H), 7.20 (d, J = 3.Hz. 1H), 7.13 (d, J= 3.6 Hz, 1H), 7.09 (d,J=8.7Hz, 1H), 2.93 (t, J = 7.5 Hz, 2H), 2.61 (t, J = 7.6Hz,2H). 13C NMR (126 MHz, DMSO) 6 188.06. 173.59, 171.40, 161.33, 155.06, 150.49, 146.54, 135.74, 131.63, 129.90, 128.73, 128.49, 126.10, 120.94, 119.91, 118.07, 113.87, 108.13, 34.67, 30.30. HRMS: m/z calcd. for C2H17O7 407.1053; found, 407.1090 (deviation +2.1 ppm). [00529]2. SYNTHESIS OF o-NITROPHENOL DERIVATIVES [00530]2.1. General synthetic route. Aldol condensation (b) FAB-536 Nitro derivatives Scheme 2.General synthetic pathway for the preparation of nitro derivatives included in Figure (R3 = -NO2). [00531]2.2. Synthetic procedures. [00532]2.2.1. Preparation of 5-(4-hydroxy-3-nitrophenyl)-2-furaldehyde (FAB-536) by Suzuki-Miyaura reaction (step a. Scheme 2). [00533]A solution of 4-bromo-2-nitrophenol (4)(1 eq), 5-formyl-2-furanylboronic acid (2) (1.1 eq), potassium carbonate (2.5 eq), Pd(OAc)2 (0.05 eq) and tetrabutylammonium bromide (1 eq) in distilled water (5 mL/mmol of 4),was prepared in a two-necked flask. Oxygen was removed by bubbling argon. The mixture was w armed up to 70 °C and vigorous stirring was maintained for 6 h. After this time, the heat source was removed and the solution was let to HO. ,,0 Suzuki-Miyaura reaction Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 cool dow n before 20 mL of ethyl acetate w ere added. The mixture was filtered through zeolite. The filtrate was washed with water and brine. The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. FCC purification was performed by gradient elution using petrol ether:ethyl acetate (95:5 —> 30:70). FAB-536 was obtained as a reddish-orange solid (76% yield). [00534]1H NMR (500 MHz, chloroform-d) 5 10.71 (s, 1H), 9.67 (s, 1H), 8.54 (d, J= 2.3 Hz, 1H), 8.03 (dd, J=8.8, 2.3 Hz, 1H), 7.33 (d, J= 3.7 Hz, 1H), 7.26 (d,J=8.8Hz, 1H), 6.85 (d, J=3.7Hz, 1H). 13C NMR (126 MHz, chloroform-!/) 5 177.3, 156.6,155.8, 152.4,134.0, 133.9, 123.5, 122.2, 121.8, 121.2, 108.2. HRMS: m/z calcd. for [M+H] C11H6NO5 232.0246; found, 232.0252 (deviation +1.5 ppm). [00535]2.2.2. General procedure for the preparation of nitro derivatives by aldol condensation (step b. Scheme 2). [00536[The corresponding methylketone (3)(1.5 eq) was solved in a THF:MeOH (1:1) mixture (2.5 mL/mmol). On this solution, a 10 N solution of sodium hydroxide (10 eq) was dripped and the mixture let to stir for 10 min. After this time, a solution of FAB-536(1 eq) in THF;MeOH (1:1) (2.5 mL/mmol) was added. The reaction was let to stir for 24 h before quenching by addition of HC1 3N until pH 5. The organic solvents were evaporated under reduced pressure and 20 mL of ethyl acetate were added. After washes with water and brine, the organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. FCCpurification was performed using petrol ether:ethyl acetate mixtures. [00537](E)-l -(4-Bromophenyl)-3-(5-(4-hydroxy-3-nitrophenyl)furan-2-yl)prop-2-en-l-one (FAB-541). id="p-538" id="p-538" id="p-538" id="p-538"

[00538]General conditions for aldol condensation, using the methylketone p- bromoacetophenone. FCCpurification: Gradient elution using petrol ether;ethyl acetate (90:10^30:70). Reddish-orange solid (92% yield).

FAB-541 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-539" id="p-539" id="p-539" id="p-539"

[00539]1H NMR (500 MHz, chloroform-d) 5 10.69 (s, 1H), 8.48 (d, J = 2.2 Hz, 1H), 7.(dd, J= 8.8, 2.2 Hz, 1H), 7.95 - 7.92 (m, 2H), 7.69 - 7.65 (m, 2H), 7.61 (d, J= 15.3 Hz, 1H), 7.46 (d, J = 15.4 Hz. 1H), 7.26 (d, J = 8.8 Hz, 2H). 6.84 (d, J = 3.6 Hz, 1H), 6.79 (d, J = 3.Hz. 1H). 13C NMR (126 MHz, chloroform-d) 5 188.68,155.16,153.88, 151.70, 137.01, 133.97, 133.59, 132.13, 130.68, 130.13, 128.13, 123.02, 121.04, 120.61, 119.27, 118.84, 108.97. HRMS: m/z calcd. for [M-H] C19H11NO5Br 411.9814; found, 411.9821 (deviation -1.7 ppm).

EXAMPLE 4 id="p-540" id="p-540" id="p-540" id="p-540"

[00540]Example 4 Salicylate derivatives: Double GO/LDHA inhibitors lowering oxalate production [00541]Salicylate derivatives: Double GO/LDHA inhibitors lowering oxalate production [00542[Structure [00543]The compounds are derivatives of salicylic acid bearing lateral chains that contain aromatic and aliphatic moieties. [00544]Synthesis [00545[The compounds can be synthesized in 3-5 steps. [00546]Activity on recombinant enzymes [00547]The compounds are dual hGO/hLDHA inhibitors. The activities of a selection of compounds are depicted in the table. [00548] Fig. 123shows activities of selected salicylate derivatives against recombinant human glycolate oxidase and lactate dehydrogenase A.

EXAMPLE 5 [00549]Example 5: New results using salicylic acid derivatives as glycolate oxidase and lactate dehydrogenase inhibitors. [00550]Diversely substituted furylsalicylic acids are efficient scaffolds inhibiting glycolate oxidase and lactate dehydrogenase enzymes. 1 Their dual inhibitory activity raises their potential to become therapeutic agents against primary hyperoxaluria type 1 (PHI). Their efficiency to reduce oxalate production has been proved in vitro (AGXT-KO mouse hepatocytes) as well as in vivo (AGXT-KO mice). These compounds are bioavailable and effective after oral administration. Besides, they have proved to have no cytotoxic effect and Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 no toxicity after five days oral administration to mice, at oxalate-lowering doses. Longer-term effect is being currently studied. On the search of an optimal molecule that can be used as a prototype, new salicylic derivatives have been prepared and tested on recombinant enzy mes. We discuss a summary of the improved inhibitory activities that have been found. [00551] References [00552](1) Moya-Garzon, M. D.; Rodriguez-Rodriguez, B.; Martin-Higueras, C.; Franco- Montalban, F.; Fernandes, M. X.; Gomez-Vidal, J. A.; Pey, A. L.; Salido, E.; Diaz-Gavilan, M. New Salicylic Acid Derivatives, Double Inhibitors of Glycolate Oxidase and Lactate Dehydrogenase, as Effective Agents Decreasing Oxalate Production. European Journal of Medicinal Chemistry 2022,237114396 י.

EXAMPLE 6 [00553[Example 6: New compounds for evaluation of intracellular oxalate in hepatocytes of Primary Hyperoxaluria mice (AGXT-/-) [00554] Fig. 124shows a non-limiting, exemplary list of compounds for evaluation of intracellular oxalate in hepatocytes of Primary Hyperoxaluria mice (AGXT-/-). Compounds named FAB can be salicylate derivatives, compounds named FL are flavonoids.

EXAMPLE 7 [00555]Example 7 [00556]Non-alcoholic fatty liver disease (NAFLD) has become the most common cause of chronic liver disease worldwide, affecting nearly a third of the global population. 1 Non- alcoholic steatohepatitis (NASH), the more severe form of NAFLD, is characterized by hepatocyte injury 7 and lobular inflammation associated with liver fibrosis.2,3 Despite considerable efforts in drug development, no therapy currently exists to treat NASH.4 NASH is associated with an increased risk of liver-related mortality; however, the major cause of death in patients with NASH is cardiovascular disease (CVD) driven by accelerated atherosclerosis, independent of traditional risk factors. 511־ Thus, there is an urgent need to identify new pathways that can be targeted for concurrent treatment of NASH and associated atherosclerosis . Such efforts have been hampered by limited understanding of the pathophysiology and metabolic pathways linking NASH with atherosclerosis.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-557" id="p-557" id="p-557" id="p-557"

[00557]Emerging studies from our group and others uncovered oxalate metabolism commonly dvsregulated in NAFLD and CVD.1216־ Oxalate is an end product of glyoxylate metabolism in the liver, accounting for 85-90% of total circulating oxalate. 1218 ־ 17 ־ While the deleterious effects of oxalate in the kidneys are well known, 1728־ the effects of oxalate in hepatocytes, the primary cells responsible for its formation,17 have not been systematically studied yet. Moreover, in NASH and associated atherosclerosis, a causative role of oxalate, its mechanisms of action and the therapeutic value of targeting oxalate overproduction can be explored . Humans have no enzymes capable of degrading oxalate, but specific liver enzymes can prevent oxalate overproduction via glyoxylate detoxification. 17 Here, using unbiased transcriptomics, we identified suppression of glyoxylate detoxifying genes ^AGXT, GRHPR, and HOGA1), in livers from humans and mice with NASH. Alanine-gly oxy late aminotransferase (AGXT), a liver-specific enzyme that detoxify glyoxylate, was reduced in livers from both humans and mice with NASH while oxalate was increased in correlation with disease severity. Remarkably, oxalate was also increased both in patients and mice with atherosclerosis. In our mouse models of oxalate overload, 13,14 hepatic oxalate overproduction (Agxt'f increased both NASH and atherosclerosis with suppressed hepatic fatty acid P־ oxidation (FAO) and induced proinflammatory pathways. Exogenous oxalate also enhanced atherosclerosis development. In hepatocytes, oxalate induced mitochondrial dysfunction and lipid accumulation while downregulating peroxisome proliferator-activated receptor a (PPARa) targets and upregulating C-C motif chemokine ligand 5 (CCL5). Importantly, limiting oxalate production via liver-specific AGXT overexpression, as proof-of-concept, attenuated NASH and atherosclerosis. Thus, our findings underscore a potential of oxalate- reducing agents for the concurrent treatment of NASH and atherosclerosis. N project described herein (Fig. 133) will address, without wishing to be bound by theory, that hepatic oxalate overproduction drives NASH and atherosclerosis via mitochondrial dysfunction, impaired PPARo/FAQ. and CCL5 induction, while suppression of oxalate formation reduces established NASH and atherosclerosis. [00558]Evaluate the mechanisms by which oxalate drives NASH and associated atherosclerosis . Without wishing to be bound by theory, oxalate promotes NASH and atherosclerosis through hepatic mitochondrial dysfunction, suppression of PPARa/FAO and induction of CCL5. Using newly generated mice with hepatic oxalate overproduction and PPARa deficiency (Agxt ־ / ־ / PparaLKO / LdlF1־), new dietary models, genetic (Ccl5־f־') and- 129- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 pharmacological (MitoTEMPO, Wy-14643) approaches, combined with in vitro models, we evaluated the mechanisms by which oxalate 1) causes mitochondrial dysfunction, and 2) suppresses PPARa/FAO to induce CCL5 in hepatocytes. We will evaluate in vivo whether endogenous and exogenous oxalate drive 3) NASH, and 4) concurrent NASH and atherosclerosis via suppression of hepatic PPARa and induction of CCL5. [00559]Oxalate reduction can be therapy for NASH and associated atherosclerosis. Without wishing to be bound by theory, oxalate-reducing treatments ameliorate established NASH and atherosclerosis by inducing PPARa/FAO and suppressing CCL5. We will evaluate the efficacy of genetic and dietary approaches to lower oxalate by enhancing glyoxylate detoxification (AAV8-AGXT, pyridoxine) or limiting oxalate formation (AAV8- shHaol, AAV8-shZJ/7rz) to 1) improve mitochondrial function/FAO and inhibit CCL5 in hepatocytes, 2) lower established NASH, and 3) concurrent NASH and atherosclerosis via a hepatic PPARa/FAO/CCL5 axis. [00560[Oxalate overproduction and its genetic regulation in human NASH and atherosclerosis . Without wishing to be bound by theory, oxalate production is enhanced in human NASH and atherosclerosis due to dysregulation of glyoxylate/oxalate metabolic genes. We will 1) evaluate oxalate overproduction in human livers (n>600) and characterize dysregulation of glyoxylate/oxalate enzymes due to 2) epigenetic modifications, and 3) genetic variation using large-scale genome-wide association studies (GWAS, n>1.7 million) and human liver samples. [00561]Non-limiting aspects described herein comprise 1) identify ׳ metabolic pathway linking NASH and atherosclerosis and 2) advance translation of oxalate reduction as a concurrent treatment for these diseases, a significant unmet clinical need . [00562]NAFLD has reached epidemic proportions with no pharmacological therapy available. NAFLD, a spectrum of liver pathologies, ranges from simple steatosis, NASH, to cirrhosis that can lead to hepatocellular carcinoma and liver failure. 2,3 Affecting nearly one third of the global population . NAFLD has become the most common cause of chronic liver disease worldwide, 1 with a substantial economic burden exceeding $100 billion in annual direct costs in the U.S. alone. 29 Lipid overload is central to the pathogenesis of NAFLD and NASH.3’0,31־ Fatty acids are supplied in excess to the liver via 1) enhanced flow from adipose tissue, and 2) increased synthesis from carbohydrates, primarily fructose, via de novo lipogenesis. 3,3032־ High fructose intake also suppresses hepatic fatty acid 3-oxidation (FAO).Fatty acid overload coupled with mitochondrial dysfunction and incomplete FAO lead to the - 130- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 generation of reactive oxygen species (ROS) and lipotoxic species. 3339־ These reactive species induce hepatocellular injury, inflammasome activation, release of proinflammaton■ cytokines and chemokines with subsequent monocyte infiltration, and activation of macrophages and hepatic stellate cells that drive NASH and hepatic fibrosis.3,4043־ Despite major advances in our understanding of the mechanisms that lead to NASH and considerable efforts in drug development, no pharmacological therapy currently exists for this disease .4 Hence, identification of new pathways that can be targeted for NASH treatment are urgently needed . Here, we discovered impaired oxalate metabolism in NASH, and identified oxalate reduction as a new approach that simultaneously enhances hepatic FAO while lowering steatohepatitis and fibrosis. [00563]CVD is the leading cause of death in patients with NAFLD. NAFLD is associated with increased risk of liver-related mortality: however, the most common cause of death in patients with NAFLD. for example those with NASH, is CVD.511־ The main driver of most CVDs is atherosclerosis arising from imbalanced lipid metabolism and a maladaptive immune response. 4445׳ Underlying risk factors of atherosclerosis, including obesity, dyslipidemia and ty pe 2 diabetes, 46 are common in patients with NAFLD/NASH.2 However, NASH is associated with increased atherosclerosis, independent of those risk factors .550 ־ 11,47 ־ The pathophysiology linking NASH with atherosclerosis is incompletely understood, but current evidence indicates that this process is mediated not only via aggravated dyslipidemia, but also through systemic release of proinflammatory mediators from the steatotic and inflamed liver. 5053־ Despite their known benefits in atherosclerosis, statins are not effective for NASH.2,54,55 Moreover, advanced drug candidates for NASH (e.g., FXR agonists and ACC inhibitors), exacerbate atherogenic dyslipidemia, 5659־ raising concerns regarding their adverse cardiovascular consequence in this group of patients already at increased CVD risk. Thus, there is an urgent clinical need to identify new therapeutics for NASH without increasing, and preferably simultaneously decreasing. To address this unmet need, we have identified new metabolicpathways that can be targeted for NASH and atherosclerosis. 13,14,6067־ Yet, no therapeutic approach has shown simultaneous protection against NASH and atherosclerosis thus far. Here, we found impaired oxalate metabolism in both NASH and atherosclerosis, in humans and mice, and identified an oxalate-reducing approach that protects against both diseases. [00564]Hepatic oxalate metabolism: a potential link between NAFLD and CVD. Oxalate is an end product of glyoxylate metabolism in the liver (Fig. 134), accounting for 85-90% of total - 131 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 circulating oxalate .12,17,18 4-hydroxy-L-proline (HLP), glycine and glycolate are the precursors for glyoxylate, which is readily oxidized to oxalate by lactate dehydrogenase A (LDHA).Secreted oxalate can complex with calcium in the kidneys to form calcium oxalate stones, the most common nephrolithiasis, which is associated with NAFLD and CVD.6873־ Notably, humans have no enzymes capable of degrading oxalate. 74 However, specific hepatic enzymes can prevent oxalate overproduction via glyoxylate detoxification. 17 Alanine-glyoxylate aminotransferase (AGXT) is expressed only in the liver and plays a central role by converting glyoxylate to glycine. 17,75 Glyoxylate can also be converted to glycolate via glycolate reductase/hydroxypyruvate reductase (GRHPR). In an opposite reaction, glycolate can be oxidized to glyoxylate by glycolate oxidase (GO, encoded by HAO1). In addition, hydroxyproline dehydrogenase (HYPDH, encoded by PRODH2) converts HLP to 4-hydroxy- 2-oxoglutarate. which is further catalyzed into glyoxylate by 4-hydroxy-2-oxoglutarate aldolase 1 (H0GA1).17 Loss-of-function mutations in AGXT. GRHPR, and HOGA1 cause primary hyperoxaluria (PH) due to impaired glyoxylate detoxification. The vast majority of PH cases are caused by mutations in AGXT(PH type 1=80%), and the remainder are caused by mutations in GRHPR (PH type 2=10%) anA HOGA1 (PH type 3=10%).17 Impaired glvoxvlate detoxification was reported in NAFLD12 Also, increased circulating oxalate was identified as a new risk factor for cardiovascular events in patients on dialysis.15 in non-limiting, exemplary data, transcriptomics of livers revealed suppression of glyoxylate detoxifying genes, with AGXT downregulated both in humans and mice with NASH. Accordingly, oxalate was increased in correlation with NASH severity. We further found Increased circulating oxalate both in patients with significant coronary artery disease (sCAD) and atherosclerotic mice. Herein, the role of oxalate in NASH and associated atherosclerosis, its mechanisms of action and ability for targeting oxalate overproduction as a therapeutic approach is evaluated. Herein, we will evaluate this gap in knowledge using new genetic, pharmacological and dietary strategies to modulate oxalate metabolism in NASH and atherosclerosis. [00565]Dysregulated oxalate metabolism in human NASH and atherosclerosis is understudied. Dysregulation of glyoxylate/oxalate metabolic genes in NAFLD/NASH has emerged in recent transcriptomics studies by our group and others. 12■13■76 AGXT was reported to be downregulated due to promoter methylation in steatotic human hepatocytes. 12 However, that study focused only on AGXT in hepatocytes isolated from a small cohort of patients with NAFLD (n=17). Thus, glyoxylate/oxalate metabolic enzymes and their regulation have vet to - 132- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 be systematically studied in large human cohorts of NAFLD/NASH. Over 200 variants in AGXT, GRHPR, and HOGA1 have been associated with PH.77 Recently, a missense variant in AGXT was found to be associated with arrhythmia, 78 indicating a link with CVD. Nevertheless, that study was based on a small cohort (n=120). did not apply accepted thresholds of genome- wide significance and did not assess oxalate. Thus, the effects of genetic variation in glyoxylate/oxalate metabolic genes on the cardiometabolic risk have not been systematically studied . Here, to address weaknesses in the research and to accelerate translation of this work, we can evaluate oxalate overproduction in our large cohorts of human liver samples (n>600). Combining epigenetics and GWAS on our large datasets (n>1.7 million) .7982־ we will def ne dysregulation of glyoxylate/oxalate enzymes underlying oxalate overproduction in NASH and atherosclerosis. [00566]The mechanisms by which oxalate drives NASH and associated atherosclerosis are unknown. Due to the known role of oxalate in nephropathy, studies have mainly focused on its deleterious effects in the kidneys. While previous studies reported that oxalate causes renal injury through mitochondrial dysfunction, NF-kB or inflammasome activation, and induction of proinflammatory mediators, 2028־ the effects of oxalate in hepatocytes, the primary cells responsible for its formation, have not been systematically studied yet . In our preliminary data, oxalate exacerbated lipid accumulation in hepatocytes, reduced mitochondrial respiration, enhanced superoxide and induced CCL5, a known driver and target in both NASH and atherosclerosis.8386־ In our newly generated mice, loss of Agxt increased both NASH and atherosclerosis with suppressed FAO driven by downregulated PPARa targets and induction of CCL5. Here, we will thoroughly elucidate the mechanisms by which oxalate drives NASH and associated atherosclerosis by genetically and pharmacologically targeting mitochondrial dysfunction, PPARa'FAO and CCL5 during endogenous and exogenous oxalate overload in vitro and in vivo. [00567[The therapeutic potential of oxalate reduction in NASH and associated atherosclerosis is unknown. Research on primary hyperoxaluria (PH) established that reducing hepatic oxalate overproduction is the primary' strategy for treatment of PH.87 Until recently, this was possible only by two approaches: 1) liver transplantation, and 2) vitamin B(pyridoxine) to enhance the activity of AGXT, a pyridoxal phosphate (PLP)-dependent enzyme. 87 In 2020, the FDA approved an RNAi approach targeting HAO1 that inhibits hepatic glyoxylate formation and oxalate overproduction in PH.88 Other approaches in preclinical and - 133 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 clinical evaluation include LDHA inhibition and AGXT restoration. 87,8991־ While oxalate overproduction has been implicated with NAFLD and CVD,12-16 the ability of oxalate reduction as a therapeutic approach for these diseases can be investigated. We reported that liver-specific overexpression of AGXT in Apoe־'־ mice fed a Western diet (WD) attenuated atherosclerosis. In non-limiting exemplary data, AGXT overexpression in mice fed a NASH-inducing diet for months reduced oxalate and attenuated NASH. Without wishing to be bound by theory, oxalate-reducing treatments can lower established NASH and associated atherosclerosis and by which mechanisms . Herein, we will systematically evaluate genetic and dietary approaches to limit oxalate overproduction that will set the basis for a treatment of established NASH and associated atherosclerosis and define its mechanisms of action that involves a hepatic PPAR0JFA0/CCL5 axis. [00568]In non-limiting summation, and without wishing to be bound by theory, hepatic oxalate overproduction drives NASH and atherosclerosis via mitochondrial dysfunction, impaired PPARa/FAO, and CCL5 induction, while suppression of oxalate formation reduces established NASH and atherosclerosis. Non-limiting objectives are 1) to evaluate the mechanisms by which oxalate drives NASH and associated atherosclerosis, 2) to evaluate oxalate reduction as a potential therapy for NASH and associated atherosclerosis, and 3) to evaluate oxalate overproduction and its genetic regulation in human NASH and atherosclerosis. Without wishing to be bound by theory, we can accelerate translation of our findings and provide new strategies to simultaneously treat NAFLD and CVD in the clinical setting. [00569]NAFLD affects nearly one third of the global population: 1 yet, despite considerable efforts in drug development, no pharmacological therapy currently exists to treat this disease .The major cause of death in patients with NAFLD/NASH is CVD driven by accelerated atherosclerosis, independent of traditional risk factors. 5-11,47-50 This creates an urgent need to identity new therapeutics for NAFLD/NASH that simultaneously decrease atherosclerosis . Such efforts have been hampered by limited understanding of the pathophysiology linking NAFLD/NASH with atherosclerosis. Here, we uncovered dysregulated oxalate metabolism as a link between these two diseases, in humans and mice . Oxalate is increased in both NASH and atherosclerosis, while modulating its production via loss or gain of AGXT, as proof-of- concept, increases or decreases NASH and atherosclerosis, respectively. We will provide new mechanistic insight on the role of oxalate in NASH and associated atherosclerosis, address the feasibility of oxalate-reducing approaches as a therapy, and evaluate the genetic and epigenetic - 134- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 etiology of oxalate overproduction in human NASH and atherosclerosis. Without wishing to be bound by theory, we can accelerate the translation of oxalate reduction as a simultaneous treatment for NAFLD/NASH and CVD, to address a significant unmet clinical need. [00570]Conceptual innovation; We offer a new paradigm highlighting dysregulated oxalate metabolism in NAFLD/NASH linked to atherosclerotic CVD and propose underlying mechanisms that have not been explored yet. Non-limiting discoveries; We will provide new mechanistic insight of the role of oxalate in NASH and atherosclerosis, define the therapeutic effects of oxalate reduction, and address genetic links between oxalate metabolism and cardiometabolic diseases. Our access to human liver samples and large-scale GW AS places us in a unique position to examine defects in oxalate metabolism in cardiometabolic diseases in humans. Considering the central role of AGXT, PPARa and CCL5 in this project, we generated mice with liver- specific deficiency of PPARa (PparaLKO~). This, together with our recently reported fig.w ־ mice, 13,14 allowed us to generate new mouse strains for this project that will be made available to the scientific community: Agxt־'־ / Ppara^0! Ldlr־־; Agxt ־ 1 ־ / ('c!5־־ / Ldlr ־ 1 ־ ; and Agxt־/" / Pparc^° / Ccl5־!" / Ldlr1־ mice. They will be used together with pertinent dietary and pharmacological interventions to define the mechanisms by which oxalate overload promotes NASH and associated atherosclerosis. Non-limiting therapeutic innovation; Supported by data showing that liver-specific AGXT overexpression reduces oxalate, NASH and atherosclerosis in mice, we will explore genetic and dietary approaches to lower oxalate as treatments for established NASH and associated atherosclerosis and define their underlying mechanisms of action, which can change current clinical paradigms. [00571[Species, sex and age as biological variables : Sex- and age-specific prevalence of NAFLD, NASH and atherosclerosis in humans have been clearly defined, 9393־ which is considered in the human data in Fig. 149-152, and in our proposed human studies including liver/plasma samples and GWAS. We and others have shown that sex is also a variable in mouse models of oxalate overload, 14,9699־ atherosclerosis. 93 and NAFLD. in the latter PPARa was found to be a sexually dimorphic drug target. 100 Therefore, male and female mice will be studied throughout the experiments, and for the isolation of primary mouse hepatocytes. Power analysis: The number of mice was evaluated by power analysis based on our previous work, 13,14,60,63 and the preliminary studies here (Fig. 135-136, 139, 141, 146-148).mice/sex/genotype/treatment can be used to reach statistical significance (p<0.05, power 0.80, 25% difference). Based on the experimental design below, and considering 5% attrition rate, a - 135 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 total of about 3.339 mice can be required . For in vitro studies, we will perform at least independent experiments for each assay with at least 3 experimental replicates. We will use multiple cell sources to ensure reproducibility of the data. As we reported, 1392’81’63 ־ 14 ־ we will use primary mouse hepatocytes as well as HepG2 and AML-12 cell lines purchased from the ATCC (please, see Authentication of Key Biological and/or Chemical Resources). Specialty diets : We will use our established dietary NASH model (NASH diet: Research Diets D17010103, 40% fat, 22% fructose, 2% cholesterol) 1363־ supplemented with sodium oxalate (NaOx. 50 umoles/g)101.102 or 0.1% Wy-14643.103 Statistical analyses : Data are tested for normality־ (Shapiro-Wilk test). Normally distributed data are analyzed using Student ’s t-test or one-way ANOVA followed by Tukey ’s post hoc test. Data failing the normality־ test are analyzed using non- parametric Mann-Whitney U test and Kruskal Wallis test followed by Dunn ’s post hoc lest. Differences are considered significant al p<0.05. For GWAS, genelic variants associated with traits of interest are considered significant using genome-wide threshold of p<5x 108־ and p<3.5x 10’נ for phenome-wide association studies (PheWAS), as we reported. 7982־ Technical variables : We found that GAPDH, 18S and P־Actin are stable internal controls for liver and hepatocyte mRNA and protein.1381 ־ 63 ־ 14 ־ mRNA levels are analyzed by the 2־AACt method normalized to GAPDH and 18S. Histological procedures are performed by technicians, blinded to the experimental groups. Analyses are performed in a blinded manner by experienced investigators. Atherosclerosis studies are performed in accordance with the AHA recommendations, and standardization of reporting. 104 [00572]Evaluate the mechanisms by which oxalate drives NASH and associated atherosclerosis. [00573]Rationale : Unbiased transcriptomics revealed impaired glyoxylate metabolism in livers from mice with NASH. Hepatic AGXT was reduced in mice with NASH, mice with atherosclerosis and in lipid- loaded hepatocytes, leading to oxalate overproduction. Oxalate overload exacerbated lipid accumulation and mitochondrial dysfunction, inhibited PPARa target genes and induced CCL5. In our Agxff" and AgxI־־ / Apoc־־ mice, oxalate was increased with accelerated NASH and atherosclerosis, respectively. RNA-seq indicated suppressed hepatic PPARa/FAO, activation of proinflammatory pathways, and increased CCL5 Without wishing to be bound by theory ־, oxalate drives NASH and associated atherosclerosis through hepatic mitochondrial dysfunction, suppression of PPARa-mediated FAO and induction of CCL5. We can evaluate these mechanisms driving NASH and indicated atherosclerosis using- 136- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 new models of endogenous and exogenous oxalate overload combined with genetic and pharmacological manipulation of mitochondrial function, PPARa and CCL5 in NASH and atherosclerosis. [00574]Non-limiting, exemplary data: [00575]Suppressed AGXT and increased oxalate in NASH and atherosclerosis. We first identified impaired oxalate metabolism through RNA-seq of livers from our two independent cohorts of mice with NASH.13•63 KEGG pathway analysis revealed that glyoxylate and dicarboxylate metabolism was among the top downregulated pathways in NASH in both cohorts (PRJNA55653713: p=1.05xl07־; GSE12620463: p=9.4xl07־). Here, liver AGXT was significantly reduced in mice fed our NASH diet for 24 weeks compared to standard diet (SD, 10% fat). Liver oxalate, assessed by an enzymatic-based assay commonly used by our group and others. 13•14•105107־ was significantly increased by 4.4-fold in mice with NASH (Fig. 3). Plasma oxalate was also increased (1.8-fold) and positively correlated with aspartate aminotransferase (AST, r=0.8, p=0.0007, not shown). As we reported, 14 liver AGXT was reduced also in Apoe ־ 1 ־ mice fed a Western diet (WD) (Fig. 136), with increased plasma oxalate (1.9-fold) correlated with atherosclerotic lesion area (r=0.6, p=0.0009, not shown). Oxalate was also increased in primary mouse hepatocytes (Fig. 137 panels A-B) and human HepGcells loaded with palmitic acid (PA), aligned with reduced AGXT (Fig. 137 panels C-D). Thus, our data from various mouse and in vitro models indicate overproduction of oxalate in NASH and atherosclerosis. [00576]Oxalate exacerbates lipid accumulation and mitochondrial dysfunction. To begin addressing a causative role for oxalate in NASH and atherosclerosis, we studied its effects in hepatocytes. Previous studies assessed the effects of oxalate (using sodium oxalate, NaOX) in other cell types at various concentrations, up to 2 mM.20,108 Here, we evaluated a dose suitable forHepG2 cells by 1) toxicity• assays (CCK8), and 2) intracellular uptake. We found that NaOX significantly reduces cell viability in HepG2 cells at concentrations >600 pM (not shown). Treatment of HepG2 cells with 500 pM NaOX (which yields free oxalate at 175 pM)20 caused a similar increase in cellular oxalate as we found in PA-loaded cells (not shown), thus, we chose this concentration for further studies. While PA increased oxalate in hepatocytes. NaOX exacerbated PA-induced lipid accumulation (Fig. 6A). Seahorse and MitoSOX assays revealed that oxalate suppresses mitochondrial respiration and increases superoxide formation, exacerbating the effects of PA (Fig. 138 panels B-C). These data indicate that oxalate - 137 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 exacerbates lipid accumulation and mitochondrial dysfunction in lipid-loaded hepatocytes in vitro. [00577]AGXT loss enhances NASH through increased oxalate, repressed FAO and increased inflammation. To address oxalate overproduction in NASH, we generated Agxt־'־ mice using CRISPR/Cas9,13 and fed them the NASH diet for 12 weeks (Fig. 139 panels A-B). Agxt־'־ mice showed a significant increase in liver oxalate and NASH (Fig. 139 panels C-E), with comparable body weight to Agxi mice (not shown). Consistent with the in vitro data, RNA- seq and pathway analysis (validated by qPCR, not shown) revealed suppression of oxidative phosphorylation (OXPHOS) and fatty acid degradation with downregulated PPARa targets in livers fromXgxA" mice. In contrast, proinflammatory pathways were upregulated (Fig. 1panels F-G) with induction of NF-kB and its targets encoding proatherogenic chemokines (Ccl5 and Ccl2, p<0.05. not shown). In HepG2 cells, oxalate dose-dependently suppressed PPARa targets and upregulated CCL5 (Fig. 140). These data indicate a causative role of oxalate in NASH, with impaired FAO and increased inflammation as underlying mechanisms. [00578]Oxalate overload increases CCL5 and atherosclerosis. The enhanced inflammatory response in Agxt־'־ mice on the NASH diet and recent reports linking oxalate to increased CVD risk, 15’16 indicate that oxalate can also promote athero-sclerosis. As recently reported. 14 we crossed Agxf" mice with Apoe־־ mice and fed Agxf/+ / Apoe־־ and Agxt־'־ / Apoe־־ mice a WD for 12 weeks (Fig. 141 panel A). Liver oxalate (p=0.0127, not shown), and atherosclerosis w ere increased in Agxt־'־ / Apoe־'־ mice (Fig. 141 panels B-C). RNA-seq indicated a significant enrichment of proinflammatory pathways in livers from Agxt־'־! Apoe ־ 1 ־ mice with upregulated Ccl5 observed by qPCR (Fig. 141 panels D-E). Among different proatherogenic chemokines examined, plasma CCL5 was most significantly increased in Agxf־ / Apoe ־ 1 ־ mice (Fig. 1panel F). To evaluate if atherosclerosis was increased due to AGXT loss or oxalate overload, we used, our reported WD enriched with the glyoxylate precursor, HLP.14 WD supplemented with 3% HLP significantly increased liver oxalate and atherosclerosis mApoe־־ mice (Fig. 10). Thus, endogenous and exogenous oxalate overload increase atherosclerosis, with CCL5 as a possible link between enhanced NASH and atherosclerosis. [00579]Non-limiting exemplary experimental strategy [00580]Evaluate the mechanisms by which oxalate induces mitochondrial dysfunction in hepatocytes . We will utilize our established in vitro models using mouse primary and AML- hepatocytes and human HepG2 ce 11s13’14,63,81.92 Exogenous oxalate will be studied using - 138 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 NaOX, while endogenous oxalate will be studied using hepatocytes from Agxt־'־ mice. Cells at 70-80% confluence will be switched from 10%- to 1%-FBS medium and treated with BSA- conjugated PA (200 uM)13 or BSA (Cayman Chemicals) with or without NaOX (500 pM, Sigma-Aldrich) 20 for 18 h. In cells or isolated mitochondria, we will assess 1) electron transport chain (ETC) supercomplexes expression, assembly, stability, and abundance using blue native polyacrylamide gel electrophoresis (BN-PAGE),1092 112־) mitochondrial ETC complex activity using spectrophotometric analysis of NADH oxidation (340 nm, Complex I), DCIP reduction (600 nm, Complex II), and Cytochrome c reduction (550 nm, (Complex III),113 3) mitochondrial transmembrane potential (ATm) using JC-1 assay (Sigma-Aldrich), 114 4) high- resolution respirometry and oxygen fluxes using Oroboros Oxygraph-2k (available at LSUHS)115 with various substrates to assess electron flow at complex I (pyruvate, 4 mM, glutamate, 10 mM, and malate, 4 mM), complex I linked OXPHOS (ADP, 2 mM), mitochondrial membrane integrity (Cytochrome C, 10 pM). complex I and II linked OXPHOS (succinate, 20 mM), complex I and II linked maximal respiration (FCCP, 4 pM), and non- mitochondrial oxygen fluxes (rotenone, 1 pM, and antimycin A, 2 pM), , 5) mitochondrial superoxide using MitoSOX14,60 and HPLC (LSUHS, Analytical Redox Core), and 6) FAO using seahorse and etomoxir (6 pM), a CPT1A inhibitor that blocks FAO, as we reported. 13 7) To define the dependence of mitochondrial dysfunction on oxalate- induced FAO suppression and CCL5 induction, we will use MitoTEMPO (10 pM, Sigma-Aldrich), a mitochondria- specific superoxide scavenger that preserves membrane potential, 116 and assess FAO, CCLmRNA and protein by qPCR and ELISA (R&D Systems), as we reported. 13,14 [00581[Evaluate the mechanisms by which oxalate suppresses FAO and induces CCL5 in hepatocytes. Described herein, oxalate and Agxt loss enhanced hepatic steatosis with downregulated PPARa target genes and upregulated CCL5. Yet, it remains unknown whether oxalate directly suppresses PPARa to inhibit FAO and induce CCL5. 1) To address inhibition of PPARa transcriptional activity by oxalate, we will use luciferase assays (all reagents are available at the Rom lab). HepG2 and AML-12 cells will be co- transfected with PPREx3-TK- luciferase, PPARa and Renilla plasmids (80, 10 and 10 ng, respectively). After 24 h, the cells will be treated with vehicle (EtOH), PPARa agonist or antagonist (Wy-14643 or GW6471, pM,117,118 Cayman Chemicals), or NaOX (500 pM). Experiments will be done in the presence and absence of MitoTEMPO to address the dependence on mitochondrial dysfunction. Luciferase activity normalized by Renilla will be measured after 18 b. 2) We will treat primary- 139- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 hepatocytes, AML-12 and HepG2 cells with NaOX with or without Wy-14643, GW6471 or MitoTEMPO. After 18 h, we will use qPCR to assess the expression of PPARa target genes (Hadha,Acaa2,Acsll,Acadl,Acadvl, and AcotS) that were downregulated in livers fromAgxL mice or HepG2 cells treated with oxalate. We will evaluate the interaction of PPARa/coactivators (PGCla, CBP1, TRAPL NCOR2, SRC 1/2/3, and SHP1/2)119 by Co-IP, and assess occupancy of the promoters in the target genes using ChIP for PPARa/coactivator pairs. To evaluate the involvement of PPARa inhibition for oxalate- induced FAO suppression and CCL5 upregulation, we generated PparaLKO mice and confirmed their increased susceptibly to diet-induced NASH (Fig. 143). We will assess FAO and CCL5 induction in primary hepatocytes isolated from 3) Pparaf1™ and PparaLK0 mice and treated with NaOX, Wy- 14643, GW6471 or MitoTEMPO and from 4) Agxt־'־ mice crossed with PparaLK0 mice (Agxt־ ־' /PparcP"x vs. Agxt ־ 1 ־ / PparaLKO mice). While CCL5 was reported to be upregulated by oxalate in the kidneys. 102 and Wy- 14643 was shown to lower CCL5 in mice and humans. 120,121 the role of PPARa as a regulator of oxalate-mediated CCL5 induction is unknown. Our CCLpromoter analysis showed no PPRE for direct repression via PPARa, indicating involvement of a downstream effector. Our RNA-seq and qPCR data indicated activation of NF-kB in livers from Agxt" mice, and PPARa is known to suppress the inflammatory response via a negative crosstalk with NF-xB.122 5) To test if CCL5 induction by oxalate is dependent on PPARa inhibition, we will clone -2,500 bp of the CCL5 promoter containing p65 binding sites (conserved in human and mouse) 123125־ in front of luciferase in pGL4.10[luc2] (Promega, wild- type and p65 sites mutated). HepG2 and AML-12 cells will be transfected with the reporter constructs (24 h). and then treated with oxalate. Wy-14643, GW6471 or MitoTEMPO). Normalized CCL5 luciferase activity will be measured after 18 h. p65 dependence will be assessed using siRNA against p65 (vs. scrambled siRNA). Functionality of p65 binding sites will be addressed by altered occupancy using ChIP in pri man hepatocytes from Ppara^ and PparaLK0 mice treated with NaOX. Wy-14643, GW6471 or MitoTEMPO or from Agxt־'־ / Pparaflox and Agxt־'־ / PparaLK0 mice to assess the effects of endogenous oxalate overload. [00582]Evaluate oxalate as a driver of NASH via mitochondrial dysfunction, FAO suppression and CCL5 induction. We will evaluate the mechanisms by which oxalate drives NASH in vivo using a combination of dietary, genetic and pharmacological approaches. Male and female mice will be studied herein (n=10/sex/genotype/treatment). 1) To study endogenous oxalate overproduction, w e will feed Agxt+/+ and Agxt ־ 1 ־ mice our NASH diet for 12 weeks. - 140- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 To study exogenous oxalate, we will feed C57BL6/J mice the NASH diet with or without NaOX (50 pmoles/g 101,102). To test if oxalate accelerates NASH via mitochondrial dysfunction, the mice will be treated with MitoTEMPO (0.7 mg/kg/d) 126 or vehicle (EtOH/saline) via osmotic minipumps (ALZET) while on the NASH diets. Minipumps will be replaced every weeks, as we reported. 63 At endpoint, we will assess liver and plasma oxalate (Abeam), liver (steatosis, inflammation and fibrosis using lipid extraction, H&E, ORO, F4/80, and Sirius Red staining), biochemical (plasma AST, alanine aminotransferase [ALT], alkaline phosphatase [ALP], and lipid profile) and inflammatory׳ (plasma CCL5) indices as well as hepatic expression of PPARa target genes and Ccl5. as described. 13,14,63 Mitochondrial function will be assessed in livers and isolated hepatocytes as described herein. 2) To evaluate if oxalate accelerates NASH via suppression of PPARa, the experiments described herein canbe performed in Pparc^ox vs. PparaLK0 fed the NASH diet +NaOX and in Agxt־'־ / Ppara^1™ vs. Agxt ־ ‘ ־ / PparaLK0 mice fed the NASH diet, with or without 0.1% Wy-14643.103 3) To define the dependency on CCL5, the experiments herein will be performed in Cclo*'* vs. Ccl5־'־ mice (obtained from The Jackson Laboratory#005090 ׳) and in Agxt־*־! Ccl5+I+ vs. Agxt־'־ / Ccl5־'־ that will be fed the NASH diets described in 1.3.2. 4) To define the crosstalk between PPARa and CCL5 in oxalate-induced NASH, we will perform the above experiments in Ppard1™ / Cclvs. PparaLkO / Ccl5־־ and in Agxt־'־ / Pparaf1^ / ('cl5 vs. Agxt־'־ / PparaLLO / Ccl5־־ mice on the NASH diets. [00583]Evaluate oxalate as a driver of NASH-associated atherosclerosis and its dependence on the mitochondrial dysfunction/PPARa-FAO/CCL5 axis. Our preliminary ׳ studies uncovered oxalate overproduction in both NASH and atherosclerosis, while oxalate overload accelerated both diseases. To study a causative role of oxalate in NASH-associated atherosclerosis and define the underlying mechanisms, we established a model featuring both diseases simultaneously by feeding our NASH diet to Ldlr־'־ mice (Fig. 144). 1) To address endogenous oxalate, we will feed Agxt' h / Ldlr ־ 1 ־ and Agxt־'־ / Ldlr ־ 1 ־ mice the NASH diet for 16 weeks. To study ׳ exogenous oxalate, we will feed Ldlr־f־ mice the NASH diet or NASH diet +NaOX for weeks. Treatment with MitoTEMPO and endpoint analyses of NASH, mitochondrial function, PPARa/FAO and CCL5 will be performed as described here.. In addition, we will thoroughly characterize atherosclerosis in the whole aortic tree (en face, ORO) and the aortic sinus (plaque size, lipid and macrophage contents using H&E, ORO and Mac2 staining), as we previously reported. 14,60,127 2) To evaluate if oxalate drives NASH-associated atherosclerosis - 141 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 via suppressed PPARa, the above experiments will be performed in Ppara11™ / Ldlr'־ vs. PparaLK0 / Ldlr ־ 1 ־ fed the NASH diet +NaOX and in Agxt ־ 1 ־ / Ppared™ / Ldlr־־ vs. Agxt ־ 1 ־ / PparaLK0 / Ldlr־־ mice fed the NASH diet, with or without Wy-14643. 3) To define the dependency on CCL5, the above experiments will be performed in Ccl5 / Ldlr ־ 1 ־ vs. Ccl5־־ / Ldlr־־ and in Agxt ־ 1 ־ / Ccl5 / Ldlr ־ 1 ־ vs. Agxt ־ 1 ־ / Ccl5־־ / Ldlr־־ fed the NASH diets. 4) To define the crosstalk between PPARa and CCL5 in NASH-associated atherosclerosis due to oxalate overload, the above experiments will be done in Pparcd™ / Ccl5 /Ldlr ־ 1 ־ vs. PparaLKO / CclS ־ 1 ־ /Ldlr1־ and in Agxt ־ 1 ־ I Pparcd™ I Ccl5 i Ldlr־־ vs. Agxt־'־ /PparaLK0 / Cel 5־־ /Ldlr ־ 1 ־ . [00584]Without wishing to be bound by theory, oxalate overload in hepatocytes will suppress the ETC complexes (protein and activity), mitochondrial respiration and membrane potential, leading to superoxide overproduction and incomplete FAO. Mitochondrial superoxide formation, impaired FAO and CCL5 induction will be reversed by MitoTEMPO treatment. Although we focus on impaired ETC as a cause of ROS generation, potential activation of p22phox , p47phox and NADPH oxidase (NOX) by oxalate overload can be addressed as an alternative using NOX inhibition (Apocynin, VAS2870) and Western blot.128 129 Without wishing to be bound by theory, exogenous (NaOX) and endogenous (HgiT־’) oxalate will repress PPARa transcriptional activity ׳ in hepatocytes, leading to suppressed FAO and CCLinduction in a similar manner to GW6471 or hepatocytes from PparaLKO mice. Oxalate overload will increase CCL5 luciferase activity in a PPARa- dependent manner viaNF-xB and will enhance recruitment of p65 to the endogenous promoter. These effects will be attenuated by MitoTEMPO. Oxalate-induced PPARa suppression can change nuclear localization of pwhich can be addressed by subcellular fractionation and Western blot. Without wishing to be bound by theory 7, transcription factors other than NF-kB mediate CCL5 induction can be addressed by systematic serial deletions of the CCL5 promoter region in luciferase assays followed by CHP. Without wishing to be bound by theory, exogenous and endogenous oxalate will accelerate NASH in mice via mitochondrial dysfunction, suppressed PPARa/FAO and CCL5 induction, which will be attenuated by MitoTEMPO administration. In },pared"־' mice, but not in PparaLK0 mice, oxalate overload will increase NASH, which will be attenuated by treatment with Wy-14643. In Ccl5 ־ ! ־ mice, oxalate overload will increase hepatic steatosis by suppressing PPARa-mediated FAO. but hepatic inflammation and fibrosis will be attenuated compared to Ccl5 mice. In PparaLK0 / CclS ־ 1 ־ mice, oxalate overload will result in comparable hepatic steatosis, but inflammation and fibrosis will be reduced compared to- 142- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Pparan"x / Ccl5+K mice. Without wishing to be bound by theory, oxalate overload will increase NASH-associated atherosclerosis, which will be attenuated by MitoTEMPO treatment. In Ppara)1" / Ldlr־'־ mice, but not in PparaLK0 / Ldlr ־ 1 ־ mice, oxalate overload will increase concurrent NASH and atherosclerosis, which will be attenuated by Wy-14643. In Ccl5 ־ ! ־ / Ldlr־ ־' mice, oxalate will increase hepatic steatosis, but hepatic inflammation and atherosclerosis will be attenuated compared to Ccl5 / Ldlr־*־ mice. In PparaLK0 / CclS־*־ / Ldlr־*־ mice, hepatic steatosis will be comparable, but hepatic inflammation and atherosclerosis will be reduced compared to PparcP1™ / Cc!5 / Ldlr ־ 1 ־ mice. While our data indicate that oxalate overload induces CCL5 in hepatocytes, it is possible that increased systemic oxalate induces CCL5 in atherosclerotic lesional macrophages, which can be addressed by silencing CclS specifically in these cells using siRNA nanoparticles 130’131. [00585]Without wishing to be bound by theory, oxalate reduction as a potential therapy for NASH and associated atherosclerosis. [00586]Non-limiting exemplary results: AGXT overexpressed in vitro reduced PA-induced oxalate, mitochondrial dysfunction and lipid accumulation. Using our established approach to overexpress genes in hepatocytes in vivo)4 we found that a single injection of AAV8-TBG- AGXT to mice fed the NASH diet for 24 weeks significantly reduced liver oxalate and NASH, with RNA-seq indicating PPARa/FAO activation and CCL5 suppression. AGXT overexpression also lowered liver oxalate, CCL5 and atherosclerosis in Apoe־'־ mice, as we recently reported. 14 Without wishing to be bound by theory, oxalate-reducing treatments ameliorate established NASH and atherosclerosis by inducing PPARa/FAO and suppressing CCLS. We will evaluate the therapeutic potential and underlying mechanisms of genetic (AAV8-AGXT, AAN%-shHaolי AANS-shLdha) and dietary (vitamin B6, pyridoxine) approaches to lower oxalate. The dependence on PPARa/FAO and CCL5 suppression will be assessed using Ppara'44". CclS ־ 1 ־ and Ldlr ־ 1 ־ mice with NASH and concurrent NASH and atherosclerosis. [00587]AGXT overexpression in vitro reduces oxalate, mitochondrial dysfunction and lipid accumulation. As the first step in exploring the therapeutic potential of oxalate reduction, we transfected HepG2 cells with GFP-tagged AGXT or GFP plasmid (control) in the presence of PA (200 uM). Cellular oxalate was significantly decreased in cells overexpressing AGXT (Fig. 145 panels A-B). Seahorse, MitoSOX, and Nile Red showed increased mitochondrial respiration, and decreased superoxide and lipid accumulation (Fig. 145 panels C-E). Thus, - 143 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 oxalate reduction via AGXT overexpression attenuates mitochondrial dysfunction and lipid accumulation in vitro. [00588]Oxalate reduction via AGXT overexpression attenuates NASH. To test the therapeutic potential of oxalate reduction in vivo, we injected C57BL/6J mice with AAV8- TBG-AGXT or AAV8-TBG-GFP and fed them the NASH diet. After 24 weeks, we confirmed sustained AGXT overexpression and reduced liver oxalate (Fig. 146 panels A-C), resulting in a significant decrease in plasma AST and NASH (Fig. 146 panels D-G), and a significant reduction in hepatic fibrosis (p=0.0301, not shown). To begin exploring underlying mechanisms, we utilized RNA-seq. Principal component analysis (PCA) indicated a clear separation between the groups. Pathway analysis revealed an upregulation of FAO-related pathways (e.g., Peroxisome, Fatty7 acid degradation and PPAR signaling) in livers from mice overexpressing AGXT, while pathways related to a proinflammatory response were downregulated (e.g., Chemokine signaling, Cytokine-cytokine receptor interaction, andNF-KB signaling) (Fig. 147 panels A-C). We validated the RNA-seq data by7 qPCR and found that Ppara target genes (Hadha [shown], Acaa2, Acsll, dead 1. Acadvl, and Acot3 [not shown |) were upregulated, while Ccl5 was down- regulated (Fig. 147 panel D). These data highlight the need to study the therapeutic potential of oxalate reduction in established NASH. [00589]Oxalate reduction via AGXT overexpression attenuates atherosclerosis. AGXT over- expression in Apoe־'־ mice fed a WD for 12 weeks lowered liver oxalate (Fig. 148 panels A-C), liver (not shown) and plasma CCL5, and atherosclerosis (Fig. 148 panels D-E), independent of plasma lipids, as we reported. 14 Thus, oxalate reduction via AGXT over- expression attenuates atherosclerosis and NASH, implying the potential of this strategy! for simultaneous treatment. [00590]We will evaluate oxalate reduction as an approach to low er mitochondrial dysfunction and lipid accumulation in steatotic hepatocytes. We will target different steps of the glyoxylate/oxalate metabolic pathway in vitro and define their ability7 to improve mitochondrial dysfunction and lower lipid accumulation in steatotic hepatocytes. Oxalate-reducing agents will be tested in mouse AML-12 hepatocytes, human HepG2 cells, and primary7 hepatocytes from wild-type and Ppara ־ 1 ־ mice loaded with PA (200 pM, 18 h). 1) After PA loading, the cells will be transfected with GFP-tagged AGXT or GFP plasmid. After 24 h, cellular oxalate (Abeam) and lipids will be assessed by Nile Red and lipid extraction (Hexan:Isopropanol). 13,62,63 ETC super-complexes (BN-PAGE) and activity(spectrophotometric analyses), ATm (JC-1), oxygen fluxes (Oroboros Oxygraph-2k), - 144- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 superoxide (MitoSOX and HPLC), FAO (Seahorse) and CCL5 (mRNA and protein) will be assessed as described herein) Pyridoxine metabolized to PLP, an essential cofactor of AGXT, can increase AGXT expression and activity to limit oxalate formation.132’133 After PA loading, the cells will be treated with increasing pyridoxine concentrations (Sigma- Aldrich. 0-250 pM, h), 133 followed by assessment of cellular oxalate, lipids, mitochondrial function, FAO, and CCL5. 3) GO (HAOP) or 4) LDHA inhibition lower oxalate by preventing oxidation of glycolate to gly oxy late or glyoxylate to oxalate, respectively. 88134•90־ To address GO and LDHA inhibition, cells loaded with PA will be transfected for 24 h with two siRNA targeting (independently) Haol (siHaol) oxLdha (siLdha) compared to scrambled siRNA (20 nM) using Lipofectamine RNAiMAX (Invitrogen). 13,81 After 24 h, we will assess cellular oxalate, lipids, mitochondrial function, FAO, and CCL5, as described herein. [00591]We evaluate oxalate reduction as treatment for NASH through a hepatic PPAR/FAO/CCL5 axis. We will apply genetic and dietary approaches to target different steps of the glyoxylate/oxalate metabolic pathway in vivo, define their ability to lower established NASH and characterize their mechanisms of action. Male and female mice will be studied as described herein (n=10/sex/genotype/treatment). 1) To test the ability of AGXT overexpression to lower established NASH. C57BL/6J mice will be fed the NASH diet for 16 weeks, and then injected with AAV8-TBG-AGXT or AAV8-TBG-GFP (I.P., 2xl0״ vg/mouse), as we reported. 14 To test AGXT activation, mice will be given orally (gavage) pyridoxine (mg/kg/d) 135 or water (control). To address suppression of oxalate formation via GO or LDHA inhibition, mice will be injected with AAV8-Hl-shS9o/ or AAVS-Hl-shGZ/ia vs. AAV8-H1- shGfp (I.P., 2xl0״ vg/mouse). 136 The above oxalate-reducing agents will be given for 8 weeks followed by endpoint analyses of liver/plasma oxalate, steatohepatitis, fibrosis, PPARa/FAO and CCL5 as described herein. 132 63־) To evaluate if oxalate-reducing treatments for NASH are dependent on hepatic PPARa/FAO activation, Pparaa°* and Ppara^0 mice will be fed the NASH diet for 16 weeks followed by treatments for 8 weeks and endpoint analyses as above. 3) To evaluate the dependence on CCL5 suppression, the above experiments will be performed in Ccl5 and Ccl5־־ mice fed the NASH diet. 4) To define the crosstalk between hepatic PPARa and CCL5 during oxalate-reducing treatment for NASH, the above experiments will be performed in Ppard1" / Cci5+,+ and PparcP^0 / Ccl5־׳־ mice on the NASH diet. [00592]We will evaluate oxalate reduction as treatment for NASH-associated atherosclerosis through a hepatic PPARa/FAO/CCL5 axis. We can evaluate the abi 11 ty of oxalate-reducing - 145 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 treatments to lower established NASH and atherosclerosis simultaneously. 1) Ldlr ־ ’ ־ mice will be fed the NASH diet to establish concurrent NASH and atherosclerosis. After 16 weeks, the mice will be treated with oxalate-reducing agents for 8 weeks, as described herein. The ability of oxalate-reducing treatments to lower established NASH and atherosclerosis will be studied as described herein.13,14,60,63,127 2) To evaluate if oxalate-reducing treatments for NASH- associated atherosclerosis are dependent on hepatic PPARa/FAO activation, Ppara^’" / Ldlr ־ 1 ־ anAPpara^0/ Ldlr ־ 1 ־ mice will be fed the NASH diet (16 weeks), treated with oxalate-reducing agents (8 weeks) and assessed for NASH and atherosclerosis. 3) To evaluate the dependence on CCL5 suppression, the above experiments will be done in ( 'cl5 ' / Ldlr ־ 1 ־ and Ccl5 ־ ! ־ / Ldlr" 1־ mice. 4) To define the crosstalk between hepatic PPARa and CCL5, the above experiments will be done in Ppara60^ / Ccl5 / Ldlr־*־ and Pparc^0 / Ccl5־'־ / Ldlr ־ ! ־ mice. [00593]Without wishing to bound by theory, in PA-loaded cells, oxalate-reducing treatments will lower mitochondrial dysfunction, induce PPARa/FAO and suppress CCL5. These effects will be abolished in hepatocytes from Ppara ־ 1 ־ mice. Without wishing to be bound by theory, if pyridoxine supplementation does not increase AGXT activity and lower cellular oxalate, we will test its effects in pyridoxine-restricted media, which can cause accumulation of cellular oxalate and lipids.133,137 We have performed AAV8 and dietary interventions in long-term mouse models of NASH and atherosclerosis (Figs. 146-148),13,14,60,63 and without wishing to be bound by theory there will not be any technical difficulties. In C57BL/6J and Ppara®0* mice, but not in Ppara®*•0 mice, oxalate-reducing treatments will lower established NASH by preventing PPARa suppression, enhancing hepatic FAO and reducing CCL5. In Ccl5־־ mice, oxalate-reducing treatments will lower hepatic steatosis by preserving PPARa/FAO while hepatic inflammation and fibrosis will be comparable to the treated Ccl5 mice. In PparaLKO / Ccl5־־ mice treated with oxalate-reducing agents, hepatic steatosis will be higher while inflammation and fibrosis will be comparable to the treated Ppara^ox / Ccl5 mice. In Ldlr ־ 1 ־ and Ppara?1™ / Ldlr ־ 1 ־ mice, but not in PparaLKO / Ldlr ־ 1 ־ mice, oxalate-reducing treatments will lower established NASH and atherosclerosis. In CclS ־ 1 ־ / Ldlr ־ 1 ־ mice, oxalate-reducing treatments will lower hepatic steatosis while atherosclerosis will be comparable to the treated Ccl5 / Ldlr־*־ mice. In PparaLKO / Ccl5־'־ / Ldlr" mice treated with oxalate-reducing agents, hepatic steatosis will be higher while atherosclerosis will be comparable to the treated Ppara11™ / CclS0* / Ldlr ־ 1 ־ mice. Beyond CCL5, our preliminary and recent studies, 14 revealed that AGXT overexpression lowered hepatic and circulating CCL2, another known driver and target - 146- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 in both NASH and atherosclerosis. 138,139 If mice lacking Ccl5 show partially reduced hepatic inflammation and atherosclerosis after oxalate-reducing treatments, we will study Ccl5־!" mice crossed with Ccl2" mice (available from The Jackson Laboratory #004434). [00594]Define oxalate overproduction and its genetic regulation in human NASH and atherosclerosis. [00595]To set the stage for rapid translation, we compared RNA-seq from humans and mice with NASH and found that glyoxylate/oxalate metabolic pathways are suppressed in both species, with downregulation of the three genes implicated in PH, AGXT, GRHPR avA HOGAI. Using our cohort of samples from liver transplantation donors, we recently reported that AGXT expression is inversely correlated with hepatic steatosis. 13 In our studies, hepatic oxalate was increased and AGXT w as decreased in individuals with NASH. Moreover, circulating oxalate was significantly increased in our cohort of patients with sCAD.14,60 Therefore, without wishing to be bound by theory, oxalate production is enhanced in human NASH and atherosclerosis due to dysregulation of glyoxyl ate'oxalate metabolic genes. We will evaluate oxalate overproduction and define the underlying dysregulation of glyoxylate/oxalate enzy mes in our large and unique human cohorts by epigenetics and GWAS [00596]Glyoxylate/oxalate metabolic genes are dysregulated in human NASH. First, we analyzed RNA-seq of livers from humans with NASH,140 and our mice with diet-induced NASH.13 Pathway analysis revealed clear similarities between human NASH and our mouse model. Particularly, the glyoxylate and dicarboxylate pathway as well as the glycine, serine and threonine metabolic pathway were suppressed in NASH in both species, while proinflammatory/fibrotic pathways (e.g.. Chemokine signaling and Extracellular matrix- receptor interaction) were upregulated (Fig 149). AGXT, GRHPR and HOGA1, as well as PPARA, were downregulated in human NASH, while the proinflammatory/ fibrotic genes, CCL5 and TGFBI, were upregulated (Fig. 150 panel A). In our liver transplantation donor cohort (n=206, GSE26106).13,141,142 AGXT expression showed the most significant inverse correlation with steatosis, while CCL5 and TGFBI showed a significant positive correlation (Fig. 150 panel B). These data indicate transcriptional dysregulation of glyoxylate/oxalate metabolic genes in human NASH. [00597]Hepatic oxalate is increased and AGXT is decreased in human NASH. To begin addressing if the above transcriptional alterations increase oxalate in human NASH, we performed a study on liver samples 143,144 and found a significant increase in oxalate and - 147 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 reduced AGXT in samples from patients with NASH compared to disease-free tissues (Fig. 151). Our findings highlight the need to characterize oxalate overproduction in NASH using large human cohorts. [00598]Circulating oxalate is increased in human atherosclerosis. In samples from our recent studies, 14,60 oxalate was significantly increased in patients with sCAD (Fig. 152). This increase remained significant after controlling for confounding factors including sex, age, circulating lipids and hypertension (p=0.0120). These findings indicate dysregulated oxalate metabolism as a potential link between NASH and atherosclerosis in humans. [00599]Evaluate oxalate overproduction in human NAFLD/NASH. We will utilize large and unique collections of human liver and plasma samples obtained through our established collaborations 13,14,6392 ־ 82 ־ with two independent centers. Cohorts can comprise 560 human liver samples collected from organ donors and postmortem autopsy donors,141,142,14515%) 148־ African American. 40% females, and median age 38y). Demographics including age, sex. race, smoking, alcohol use, and liver function data are available. The samples are being systematically characterized for genomic, transcriptomic, lipidomic, proteomic, and histological indices (H&E, ORO, Sirius red, and NAS). Current histological characterization indicates 35% NAFLD and 12% NASH. Drs. Cohen ’s and Thevenot ‘ s cohorts include human liver samples collected through biorepository protocols of routine orthotopic transplantations for patients with NASH. 143,144 Non-malignant, disease-free liver tissues procured during partial hepatic resection sen e as no-NASH controls (n=52, 8% African American, 40% females, and median age 60y). Plasma samples were collected from patients undergoing routine screening for NAFLD/NASH. Patients with NASH were confirmed by FibroScan and elevated transaminases. Patients without NASH had normal AST, ALT, ALP, bilimbin, albumin, creatinine, INR, and sodium levels, and have no history of liver complications upon entry (n=82, 18% African American, 74% females, and median age 62y). Samples were collected through previously approved IRB protocols and are devoid of any patient identifier. 92,141148־ Here, we will evaluate oxalate overproduction in the above cohorts by measuring oxalate in liver (25 mg) and plasma (25 pL) samples (Abeam) relative to the diagnosis of NAFLD/NASH and cardiometabolic comorbidities, the above biochemical/histological indices, expression of PPARa targets and CCL5. with or without adjusting for confounding factors (age, sex. race, comorbidities, and dmg use).

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-600" id="p-600" id="p-600" id="p-600"

[00600]Evaluate dysregulation of glyoxylate/oxalate metabolic enzymes in human NAFLD/NASH. In support of our data, a study reported a downregulation of AGXT, GRHPR and HOGA1 in steatotic human hepatocytes isolated from a small cohort of patients (n=17). That study focused only on AGXT downregulation and reported hypermethylation of its promoter. 12 Yet, the transcript and protein levels of glyoxylate/oxalate metabolic enzymes and their epigenic regulation have not been systematically assessed in large human cohorts of NAFLD/NASH. In the human liver samples described herein, we will 1) assess the expression of AGXT, GRHPR, HOGA1, GO 1.7 million participants at the time of this submission), we will thoroughly investigate the relationship between variants in glyoxylate/oxalate metabolic genes, oxalate levels, traits related to NAFLD/NASH, and atherosclerotic CVD. 1) As in our reports, 7982־ we will perform a look-up on GWAS data from several large consortia and perform a GWAS using the large biobank data available (UK - 149- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Biobank, GLGC, Michigan Genomics Initiative [MGI]) on genetic variants in AGAT, GRHPR, HOGA1, HAO1, PRODH2, and LDHA or variants that affect their expression (expression quantitative trait loci, eQTL). We will focus on liver-related blood traits of relevance to NAFLD/NASH and CVD including transaminases (ALT, AST. ALP, and gamma- glutamyltransferase (GGT), lipid profile (total cholesterol, triglycerides, LDL-C, and HDL-C), and inflammatory markers (C-reactive protein). As we recently reported, 81,82 we will use the UK Biobank and MGI for PheWAS to evaluate associations between the genetic variants, NAFLD/NASH and atherosclerotic CVD. 2) Using our human liver samples described herein, we will assess the effects of variants in glyoxylate/oxalate metabolic genes on hepatic oxalate relative to the diagnosis of NAFLD/NASH, cardiometabolic comorbidities, biochemical/histological indices, and expression of PPARa targets and CCL5. [00602]Without wishing to be bound by theory, hepatic and plasma oxalate will be increased in samples from donors with NAFLD and further increase in those with NASH. Based on our data and reports, 12 without wishing to be bound by theory, the transcript and protein levels of AGXT, GRHPR, and HOGA1 will be reduced in samples from donors with NAFLD due to promoter hypermethylation, which will be enhanced in those with NASH. In our mouse RNA- seq data. Ldha was significantly upregulated in NASH, which can also increase oxalate formation. Our analyses of human liver samples from large cohorts can reveal enhanced LDHA in NASH that can be pursued mechanistically by promoter methylation, 153 or alternatively, by HIF1 regulation. 154 Although our GWAS is not limited to known PH mutations in AGXT, GRHPR, and HOGA1 and will include much larger cohorts than previously studied, 77 it is possible that the number of carriers in our human liver samples (over 600 in total) will be too small to establish associations with hepatic oxalate, NAFLD/NASH or cardiometabolic comorbidities. To overcome this hurdle, variants in glyoxylate/oxalate metabolic genes that will be identified in our large-scale GWAS but will not be found in the human liver samples, will be modeled in vitro using CRISPR/Cas9,155158־ followed by analyses of cellular oxalate, lipid metabolism, mitochondrial function and proinflammatory responses as described herein. [00603] References Cited in this Example 1. Riazi K, Azhari H, Charette JH, Underwood FE, King J A, Afshar EE, Swain MG, Congly SE. Kaplan GG, Shaheen AA. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2022 Sep;7(9):851- 861.- 150- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 2. Chalasani N, Younossi Z, Lavine JE, Charlton M, Cusi K, Rinella M, Harrison SA, Brunt EM, Sanyal AJ. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 2018 Jan;67(l);328-357.3. Friedman SL, Neuschwander-Tetri BA, Rinella M, Sanyal AJ. Mechanisms of NAFLD development and therapeutic strategies. Nat Med. 2018 Jul;24(7):908-922.4. Vuppalanchi R, Noureddin M, Alkhouri N, Sanyal AJ. Therapeutic pipeline in nonalcoholic steatohepatitis. Nat Rev Gastroenterol Hepatol. 2021 Jun;18(6);373-392.5. Targher G, Byme CD, Lonardo A, Zoppini G, Barhui C. Non-alcoholic fatty liver disease and risk of incident cardiovascular disease: A meta-analysis. J Hepatol. 20Sep;65(3):589-600.6. Duell PB, Welty FK, Miller M, Chait A, Hammond G, Ahmad Z, Cohen DE, Horton JD, Pressman GS, Toth PP; American Heart Association Council on Arteriosclerosis, Thrombosis and Vascular Biology; Council on Hypertension; Council on the Kidney in Cardiovascular Disease; Council on Lifestyle and Cardiometabolic Health; and Council on Peripheral Vascular Disease. Nonalcoholic Fatty7 Liver Disease and Cardiovascular Risk: A Scientific Statement From the American Heart Association. Arterioscler Thromb Vase Biol. 2022 Jun;42(6):el68-el85.7. Stepanova M, Younossi ZM. Independent association between nonalcoholic fatty7 liver disease and cardiovascular disease in the US population. Clin Gastroenterol Hepatol. 2012 Jun; 10(6):646-50.8. Younossi ZM. Non-alcoholic fatty liver disease - A global public health perspective. J Hepatol. 2019 Mar;70(3):531-544.9. Lonardo A, Nascimbeni F, Mantovani A, Targher G. Hypertension, diabetes, atherosclerosis and NASH: Cause or consequence? J Hepatol. 2018 Feb;68(2);335-352.10. Ekstedt M. Hagstrom H, Nasr P, Fredrikson M, Stal P, Kechagias S. Hultcrantz R. Fibrosis stage is the strongest predictor for disease-specific mortality in NAFLD after up to 33 years of follow-up. Hepatology. 2015 May;61(5): 1547-54.11. Younossi ZM, Stepanova M, Rafiq N, Henry L, Loomba R, Makhlouf H, Goodman Z. Nonalcoholic steatofibrosis independently predicts mortality in nonalcoholic fatty liver disease. Hepatol Commun. 2017 Jun 6;I(5):42I-428.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 12. Gianmoena K, Gasparoni N, Jashari A, Gabrys P, Grgas K, Ghallab A, Nordstrom K, Gasparoni G, Reinders J, Edlund K, Godoy P, Schriewer A, Hayen H, Hudert CA, Damm G, Seehofer D, Weiss TS, Boor P, Anders HJ, Motrapu M, Jansen P, Schiergens TS, Falk- Paulsen M, Rosenstiel P, Lisowski C, Salido E, Marchan R, Walter J, Hengstler JG, Cadenas C. Epigenomic and transcriptional profiling identifies impaired glyoxylate detoxification in NAFLD as a risk factor for hyperoxaluria. Cell Rep. 2021 Aug 24;36(8); 109526.13. Rom 0, Liu Y, Liu Z, Zhao Y, Wu J, Ghrayeb A, Villacorta L, Fan Y. Chang L, Wang L, Liu C, Yang D, Song J, Rech JC, Guo Y, Wang H, Zhao G, Liang W, Koike Y, Lu H, Koike T, Hayek T, Pennathur S, Xi C, Wen B, Sun D, Garcia-Barrio MT, Aviram M, Gottlieb E, Mor 1, Liu W, Zhang J, Chen YE. Glycine-based treatment ameliorates NAFLD by modulating fatty acid oxidation, glutathione synthesis, and the gut microbiome. Sci Transl Med. 2020 Dec 2;12(572):eaaz2841.14. Liu Y, Zhao Y, Shukha Y, Lu H, Wang L, Liu Z, Liu C, Zhao Y, Wang H, Zhao G, Liang W, Fan Y, Chang L, Yurdagul A Jr, Pattillo CB, Orr AW, Aviram M, Wen B, Garcia- Barrio MT, Zhang J, Liu W, Sun D, Hayek T, Chen YE, Rom O. Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis. Cell Rep. 2021 Jul 27:36(4): 109420.15. Pfau A, Ermer T, Coca SG, Tio MC, Genser B, Reichel M, Finkelstein FO, Marz W, Wanner C, Waikar SS, Eckardt KU, Aronson PS, Drechsler C, Knauf F. High Oxalate Concentrations Correlate with Increased Risk for Sudden Cardiac Death in Dialysis Patients. J Am Soc Nephrol. 2021 Sep;32(9):2375-2385.16. Stepanova N, Driianska V, Korol L, Snisar L, Lebed L. Plasma oxalic acid and cardiovascular risk in end-stage renal disease patients: a prospective, observational cohort pilot study. Korean J Intern Med. 2022 Jan;37(l):167-178.17. Salido E, Pey AL, Rodriguez R, Lorenzo V. Primary hyperoxalurias: disorders of glyoxylate detoxification. Biochim Biophys Acta. 2012 Sep; 1822(9): 1453-64.18. Brzica H, Breljak D, Burckhardt BC, Burckhardt G, Sabolic 1. Oxalate: from the environment to kidney stones. Arh Hig Rada Toksikol. 2013 Dec;64(4):609-30.19. Waikar SS, Srivastava A, Palsson R, Shafi T, Hsu CY, Sharma K, Lash JP, Chen J, He J, Lieske J, Xie D, Zhang X, Feldman HI, Curhan GC; Chronic Renal Insufficiency Cohort Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 study investigators. Association of Urinary Oxalate Excretion With the Risk of Chronic Kidney Disease Progression. JAMA Intern Med. 2019 Apr 1;179(4):542-551.20. Cao LC, Honeyman TW, Cooney R, Kennington L, Scheid CR, Jonassen JA. Mitochondrial dysfunction is a primary event in renal cell oxalate toxicity. Kidney Int. 2004 Nov;66(5): 1890-900.21. Farooq SM, BoppanaNB, Devarajan A, Sekaran SD, Shankar EM, Li C, Gopal K, Bakar SA, Karthik HS, Ebrahim AS. C-phycocyanin confers protection against oxalate- mediated oxidative stress and mitochondrial dysfunctions in MDCK cells. PLoS One. 2014 Apr 1 ;9(4): 693056.22. SharmaM, Naura AS, Singla SK. A deleterious interplay betw een endoplasmic reticulum stress and its functional linkage to mitochondria in nephrolithiasis. Free Radic Biol Med. 2021 May 20:168:70-80.23. Qian X, Wu W. Hu H, Yu X. Wang S, Zhu J. Zhang J. The role of reactive oxygen species derived from different NADPH oxidase isoforms and mitochondria in oxalate-induced oxidative stress and cell injury 7. Urolithiasis. 2022 Apr;50(2): 149-158.24. Umekawa T, Iguchi M, Uemura H, Khan SR. Oxalate ions and calcium oxalate crystal- induced up-regulation of osteopontin and monocyte chemoattractant protein-1 in renal fibroblasts. BJU Int. 2006 Sep:98(3): 656-60.25. Tozawa K, Yasui T, Okada A, Hirose M, Hamamoto S, Itoh Y, Kohri K. NF-kappaB activation in renal tubular epithelial cells by oxalate stimulation. Int J Urol. 20Oct;15(10):924-8.26. Joshi S, Wang W. Peck AB. Khan SR. Activation of the NLRP3 inflammasome in association with calcium oxalate crystal induced reactive oxygen species in kidneys. J Urol. 2015 May;193(5): 1684-91.27. Mulay SR, Kulkarni OP, Rupanagudi KV, Migliorini A, Darisipudi MN, Vilaysane A, Muruve D. Shi Y, Munro F, Liapis H. Anders HJ. Calcium oxalate crystals induce renal inflammation by NLRP3-mediated IL-1p secretion. J Clin Invest. 2013 Jan;123(l):236- 46.28. Liu H, Ye T, Yang X, Liu J, Jiang K, Lu H, Xia D, Peng E, Chen Z, Sun F, Tang K, Ye Z. H19 promote calcium oxalate nephrocalcinosis-induced renal tubular epithelial cell injury via aceRNA pathway. EBioMedicine. 2019 Dec:50:366-378.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 29. Younossi ZM, Blissett D, Blissett R, Henry L, Stepanova M, Younossi Y, Racila A, Hunt S, Beckerman R. The economic and clinical burden of nonalcoholic fatty liver disease in the United States and Europe. Hepatology. 2016 Nov;64(5): 1577-1586.30. Neuschwander-Tetri BA. Hepatic lipotoxicity and the pathogenesis of nonalcoholic steatohepatitis: the central role of nontriglyceride fatty acid metabolites. Hepatology. 2010 Aug;52(2):774-88.31. Cusi K. Role of obesity 7 and lipotoxicity 7 in the development of nonalcoholic steatohepatitis; pathophysiology 7 and clinical implications. Gastroenterology. 20Apr;142(4):711-725.e6.32. Softie S, Meyer JG, Wang GX, Gupta MK, Batista TM, Lauritzen HPMM, Fujisaka S, Serra D, Herrero L, Willoughby J, Fitzgerald K, Ukayeva O, Newgard CB, Gibson BW, Schilling B, Cohen DE, Kahn CR. Dietary Sugars Alter Hepatic Fatty Acid Oxidation via Transcriptional and Post-translational Modifications of Mitochondrial Proteins. Cell Metab. 2019 Oct 1 ;30(4):735-753.64.33. Perry 7 RJ, Samuel VT, Petersen KF, Shulman GI. The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature. 2014 Jun 5:510(7503):84-91.34. Chaurasia B. Summers SA. Ceramides - Lipotoxic Inducers of Metabolic Disorders. Trends Endocrinol Metab. 2015 Oct;26(10):538-550.35. Begriche K, Igoudjil A, Pessayre D, Fromenty B. Mitochondrial dysfunction in NASH: causes, consequences and possible means to prevent it. Mitochondrion. 2006 Feb;6(l): 1- 28.36. Koliaki C. Szendroedi J. Kaul K. Jelenik T. Nowotny P. Jankowiak F. Herder C. Carstensen M, Krausch M, Knoefel WT, Schlensak M, Roden M. Adaptation of hepatic mitochondrial function in humans with non-alcoholic fatty7 liver is lost in steatohepatitis. Cell Metab. 2015 May 5:21(5):739-46.37. Masarone M, Rosato V. Dallio M, Gravina AG. Aglitti A, Loguercio C. Federico A, Persico M. Role of Oxidative Stress in Pathophysiology' of Nonalcoholic Fatty Liver Disease. Oxid Med Cell Longev. 2018 Jun 11 ;2018:9547613.38. Chaurasia B, Tippetts TS, Mayoral Monibas R, Liu J, Li Y, Wang L, Wilkerson JL, Sweeney CR, Pereira RF, Sumida DH, Maschek J A, Cox JE, Kaddai V, Lancaster GI, Siddique MM, Poss A, Pearson M, Satapati S, Zhou H. McLaren DG, Previs SF, Chen Y, Qian Y, Petrov A, Wu M, Shen X, Yao J, Nunes CN, Howard AD, Wang L, Eri on - 154- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 MD, Rutter J, Holland WL, Kelley DE, Summers SA. Targeting a ceramide double bond improves insulin resistance and hepatic steatosis. Science. 2019 Jul 26;365(6451):386- 392.39. Han MS, Park SY. Shinzawa K. Kim S. Chung KW, Lee JH, Kwon CH, Lee KW, Lee JH, Park CK, Chung WJ, Hwang JS, Van JJ, Song DK, Tsujimoto Y, Lee MS. Lysophosphatidylcholine as a death effector in the lipoapoptosis of hepatocytes. J Lipid Res. 2008 Jan;49(l):84-97.40. Han J, Kaufman RJ. The role of ER stress in lipid metabolism and lipotoxicity. J Lipid Res. 2016 Aug;57(8): 1329-38.41. Csak T, Ganz M, Pespisa J, Kodys K, Dolganiuc A, Szabo G. Fatty acid and endotoxin activate inflammasomes in mouse hepatocytes that release danger signals to stimulate immune cells. Hepatology. 2011 Jul;54(l): 133-44.42. Mridha AR, Wree A. Robertson AAB, Yeh MM, Johnson CD, Van Rooyen DM, Haczeyni F, Teoh NC, Savard C, Ioannou GN, Masters SL, Schroder K, Cooper MA, Feldstein AE, Farrell GC. NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice. J Hepatol. 2017 May;66(5): 1037-1046.43. Jiang M, Li C, Liu Q. Wang A. Lei M. Inhibiting Ceramide Synthesis Attenuates Hepatic Steatosis and Fibrosis in Rats With Non-alcoholic Fatty Liver Disease. Front Endocrinol (Lausanne). 2019 Sep 26; 10:665.44. Moore KJ, Sheedy FJ, Fisher EA. Macrophages in atherosclerosis: a dynamic balance. Nat Rev Immunol. 2013 Oct;13(10):709-21.45. Libby P, Buring JE, Badimon L. Hansson GK. Deanfield J, Bittencourt MS, Tokgozoglu L, Lewis EF. Atherosclerosis. Nat Rev Dis Primers. 2019 Aug 16;5(1):56.46. Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP. Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF, Gupta DK. Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J. Loop MS, Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD, Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A, VanWagner LB, Wang NY, Tsao CW; American Heart Association Council on Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee. Heart Disease and Stroke Statistics-2021 Update: A Report From the American Heart Association. Circulation. 2021 Feb 23;143(8):e254-e743.- 155 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 47. Oni ET, Agatston AS, Blaha MJ, Fialkow J, Cury R, Sposito A, Erbel R, Blankstein R, Feldman T, Al-Mallah MH, Santos RD, Budoff MJ, Nasir K. A systematic review: burden and severity of subclinical cardiovascular disease among those with nonalcoholic fatty liver; should we care? Atherosclerosis. 2013 Oct;230(2):258-67.48. Pais R, Giral P, Khan JF, Rosenbaum D, Housset C, Poynard T, Ratziu V; LIDO Study Group. Fatty liver is an independent predictor of early carotid atherosclerosis. J Hepatol. 2016Jul;65(l);95-102.49. Adams LA, Anstee QM, Tilg H, Targher G. Non-alcoholic fatty liver disease and its relationship with cardiovascular disease and other extrahepatic diseases. Gut. 20Jun;66(6): 1138-1153.50. Targher G, Byrne CD, Tilg H. NAFLD and increased risk of cardiovascular disease: clinical associations, pathophysiological mechanisms and pharmacological implications. Gut. 2020 Sep;69(9):1691-1705.51. Katsiki N, Mikhailidis DP, Mantzoros CS. Non-alcoholic fatty liver disease and dyslipidemia: An update. Metabolism. 2016 Aug;65(8):l 109-23.52. Jiang F, Chen Q, Wang W, Ling Y, Van Y, Xia P. Hepatocyte-derived extracellular vesicles promote endothelial inflammation and atherogenesis via microRNA-L J Hepatol. 2020 Jan;72(l): 156-166.53. Fricker ZP, Pedley A, Massaro JM, Vasan RS, Hoffmann U, Benjamin EJ, Long MT. Liver Fat Is Associated With Markers of Inflammation and Oxidative Stress in Analysis of Data From the Framingham Heart Study. Clin Gastroenterol Hepatol. 20May:17(6):1157-1164.e4.54. Nelson A, Torres DM, Morgan AE, Fincke C, Harrison SA. A pilot study using simvastatin in the treatment of nonalcoholic steatohepatitis: A randomized placebo- controlled trial. J Clin Gastroenterol. 2009 Nov-Dec;43(10):990-4.55. Bril F, Portillo Sanchez P. Lomonaco R, Orsak B, Hecht J. Tio F, Cusi K. Liver Safety of Statins in Prediabetes or T2DM and Nonalcoholic Steatohepatitis: Post Hoc Analysis of a Randomized Trial. J Clin Endocrinol Metab. 2017 Aug l;102(8):2950-2961.56. Younossi ZM, Ratziu V, Loomba R, Rinella M, Anstee QM, Goodman Z, Bedossa P, Geier A, Beckebaum S, Newsome PN, Sheridan D. Sheikh MY, Trotter J. Knapple W, Lawitz E, Abdelmalek MF, Kowdley KV, Montano-Loza AJ, Boursier J, Mathurin P, Bugianesi E, Mazzella G, Olveira A, Cortez-Pinto H, Graupera I, Orr D, Gluud LL, - 156- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Dufour JF, Shapiro D, Campagna J, Zaru L, MacConell L, Shringarpure R, Harrison S, Sanyal AJ; REGENERATE Study Investigators. Obeticholic acid for the treatment of non-alcoholic steatohepatitis: interim analysis from a multicentre, randomised, placebo- controlled phase 3 trial. Lancet. 2019 Dec 14;394(10215):2184-2196.57. Siddiqui MS, Van Natta ML, Connelly MA, Vuppalanchi R, Neus ch wander-Tetri BA, Tonascia J, Guy C, Loomba R, Dasarathy S, Wattacheril J, Chalasani N, Sanyal AJ; NASH CRN. Impact of obeticholic acid on the lipoprotein profile in patients with non- alcoholic steatohepatitis. J Hepatol. 2020 Jan;72(l);25-33.58. Eslam M, Alvani R, Shiha G. Obeticholic acid: towards first approval for NASH. Lancet. 2019 Dec 14;394(10215):2131-2133.59. Loomba R, Noureddin M, Kowdley KV, Kohli A, Sheikh A, Neff G, Bhandari BR, Gunn N, Caldwell SH, Goodman Z, Wapinski 1, Resnick M, Beck AH, Ding D, Jia C, Chuang JC, Huss RS, Chung C, Subramanian GM, Myers RP, Patel K, Borg BB, Ghalib R, Kabler H, Poulos J, Younes Z, Elkhashab M, Hassanein T, Iyer R, Ruane P, Shiffman ML, Strasser S, Wong VW, Alkhouri N; ATLAS Investigators. Combination Therapies Including Cilofexor and Firsocostat for Bridging Fibrosis and Cirrhosis Attributable to NASH. Hepatology. 2021 Feb;73(2):625-643.60. Rom O, Liu Y, Finney AC, Ghrayeb A, Zhao Y, Shukha Y, Wang L, Rajanayake KK, Das S, Rashdan NA, Weissman N, Delgadillo L, Wen B, Garcia-Barrio MT, Aviram M, Kevil CG, Yurdagul A Jr, Pattillo CB, Zhang J, Sun D, Hayek T, Gottlieb E, Mor I, Chen YE. Induction of glutathione biosynthesis by glycine-based treatment mitigates atherosclerosis. Redox Biol. 2022 Jun;52:1023I3.61. Rom 0, Villacorta L, Zhang J, Chen YE, Aviram M. Emerging therapeutic potential of glycine in cardiometabolic diseases: dual benefits in lipid and glucose metabolism. Cun Opin Lipidol. 2018 Oct;29(5):428-432.62. Rom O, Grajeda-Iglesias C, Najjar M, Abu-Saleh N, Volkova N, Dar DE, Hayek T, Aviram M. Atherogenicity of amino acids in the lipid-laden macrophage model system in vitro and in atherosclerotic mice: a key role for triglyceride metabolism. J Nutr Biochem. 2017 Jul;45;24-38.63. Rom O, Xu G, Guo Y, Zhu Y, Wang H, Zhang J, Fan Y, Liang W, Lu H, Liu Y, Aviram M, Liu Z, Kim S, Liu W, Wang X, Chen YE, Villacorta L. Nitro-fatty acids protect Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 against steatosis and fibrosis during development of nonalcoholic fatty liver disease in mice. EBioMedicine. 2019 Mar:41:62-72.64. Yang RX, Fan JG. Nitro-oleic acid as a new drug candidate for non-alcoholic steatohepatitis. EBioMedicine. 2019 Apr;42:32-33.65. Rom 0, Liu Y, Chang L, Chen YE, Aviram M. Nitro-fatty acids: novel drug candidates for the co-treatment of atherosclerosis and nonalcoholic fatty liver disease. Curr Opin Lipidol. 2020 Apr;31(2): 104-107.66. Rudolph TK. Rudolph V, Edreira MM, Cole MP, Bonacci G, Schopfer FJ, Woodcock SR, Franek A, Pekarova M, Khoo NK, Hasty AH, Baldus S, Freeman BA. Nitro-fatty acids reduce atherosclerosis in apolipoprotein E-deficient mice. Arterioscler Thromb Vase Biol. 2010 May;30(5):938-45.67. Schopfer FJ, Vitturi DA, Jorkasky DK, Freeman BA. Nitro-fatty acids: New drug candidates for chronic inflammatory and fibrotic diseases. Nitric Oxide. 2018 Sep 1:79:31-37.68. Qin S, Wang S, Wang X, Wang J. Non-alcoholic fatty liver disease and the risk of urolithiasis: A systematic review and meta-analysis. Medicine (Baltimore). 20Aug;97(35):el2092.69. Nam IC. Association of non-alcoholic fatty liver disease with renal stone disease detected on computed tomography. Eur J Radiol Open. 2016 Aug 2:3:195-9.70. Reiner AP, Kahn A, Eisner BH, Pletcher MJ, Sadetsky N, Williams OD, Polak JF, Jacobs DR Jr, Stoller ML. Kidney stones and subclinical atherosclerosis in young adults: the CARDIA study. J Urol. 2011 Mar:185(3):920-5.71. Aydin H, Yencilek F, Erihan IB, Okan B, Sarica K. Increased 10-year cardiovascular disease and mortality risk scores in asymptomatic patients with calcium oxalate urolithiasis. Urol Res. 2011 Dec:39(6):451-8.72. Ferraro PM, Taylor EN, Eisner BH. Gambaro G, Rimm EB, Mukamal KJ. Curhan GC. History of kidney stones and the risk of coronary heart disease. JAMA. 2013 Jul 24;310(4):408-15.73. Alexander RT, Hemmelgam BR, Wiebe N, Bello A, Samuel S, Klarenbach SW, Curhan GC, Tonelli M; Alberta Kidney Disease Network. Kidney stones and cardiovascular events: a cohort study. Clin J Am Soc Nephrol. 2014 Mar:9(3):506-12.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 74. Crivelli JJ, Mitchell T, Knight J, Wood KD, Assimos DG, Holmes RP, Fargue S. Contribution of Dietary Oxalate and Oxalate Precursors to Urinary Oxalate Excretion. Nutrients. 2020 Dec 28;13(l):62.75. Li XM, Salido EC, Shapiro LJ. The mouse alanine:glyoxylate aminotransferase gene (Agxtl): cloning, expression, and mapping to chromosome 1. Somat Cell Mol Genet. 1999 Mar;25(2):67-77.76. Asgharpour A, Cazanave SC, Pacana T, Seneshaw M, Vincent R, Banini BA, Kumar DP, Daita K, Min HK, Mirshahi F. Bedossa P, Sun X, Hoshida Y, Koduru SV, Contaifer D Jr, Wamcke UO, Wijesinghe DS, Sanyal AJ. A diet-induced animal model of non- alcoholic fatty liver disease and hepatocellular cancer. J Hepatol. 2016 Sep;65(3):579- 88.77. Hopp K, Cogal AG, Bergstralh EJ, Seide BM, Olson JB, Meek AM, Lieske JC, Milliner DS. Harris PC; Rare Kidney Stone Consortium. Phenotype-Genotype Correlations and Estimated Carrier Frequencies of Primary Hyperoxaluria. J Am Soc Nephrol. 20Oct;26(10):2559-70.78. Huang J, Luo R, Zheng C, Cao X, Zhu Y, He T, Liu M, Yang Z, Wu X, Li X. Integrative Analyses Identify Potential Key Genes and Calcium-Signaling Pathway in Familial Atrioventricular Nodal Reentrant Tachycardia Using Whole-Exome Sequencing. Front Cardiovasc Med. 2022 Jul 18;9:910826.79. Graham SE, et al. The power of genetic diversity 7 in genome-wide association studies of lipids. Nature. 2021 Dec:600(7890);675-679.80. Ramdas S. et al., A multi-layer functional genomic analysis to understand noncoding genetic variation in lipids. Am J Hum Genet. 2022 Aug 4; 109(8): 1366-1387.81. Nielsen JB, et al., Loss-of-function genomic variants highlight potential therapeutic targets for cardiovascular disease. Nat Commun. 2020 Dec 18;11(1):6417.82. Fan Y, Wolford BN. Lu H, Liang W. Sun J, Zhou W, Rom O, Mahajan A. Surakka 1, Graham SE, Liu Z, Kim H, Ramdas S, Fritsche LG, Nielsen JB, Gabrielsen ME, Hveem K, Yang D. Song J, Garcia-Barrio MT, Zhang J, Liu W, Zhang K, Wilier CJ, Chen YE. Type 2 diabetes sex-specific effects associated with E167K coding variant in TM6SF2. iScience. 2021 Oct 2;24(11): 103196.83. Berres ML, Koenen RR, Rueland A, Zaldivar MM, Heinrichs D, Sahin H, Schmitz P, Streetz KL. Berg T, Gassier N, Weiskirchen R, Proudfoot A, Weber C, Trautwein C, - 159- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 Wasmuth HE. Antagonism of the chemokine Ccl5 ameliorates experimental liver fibrosis in mice. J Clin Invest. 2010 Nov;120(ll):4129-40.84. Krenkel 0,Puengel T, Govaere 0,Abdallah AT, Mossanen JC,Kohlhepp M, Liepelt A, Lefebvre E, Luedde T, Hellerbrand C, Weiskirchen R. Longerich T, Costa IG, Anstee QM,Trautwein C,Tacke F. Therapeutic inhibition of inflammatory monocyte recruitment reduces steatohepatitis and liver fibrosis. Hepatology. 2018 Apr;67(4):1270- 1283.85. Braunersreuther V, Steffens S, Arnaud C, Pelli G, Burger F, Proudfoot A, Mach F. A novel RANTES antagonist prevents progression of established atherosclerotic lesions in mice. Arterioscler Thromb Vase Biol. 2008 Jun;28(6): 1090-6.86. Braunersreuther V, Zemecke A, Arnaud C, Liehn EA, Steffens S, Shagdarsuren E, Bidzhekov K, Burger F, Pelli G, Luckow B, Mach F, Weber C. Ccr5 but not Ccrl deficiency reduces development of diet-induced atherosclerosis in mice. Arterioscler Thromb Vase Biol. 2007 Feb;27(2):373-9.87. Milliner DS, Harris PC, Sas DJ, Cogal AG, Lieske JC. Primary Hyperoxaluria Type 1. 2002 Jun 19 [updated 2022 Feb 10], In: Adam MP, Everman DB, Mirzaa GM. Pagon RA, Wallace SE. Bean LJH, Gripp KW, Amemiya A, editors. GeneReviews® [Internet], Seattle (WA): University of Washington, Seattle; 1993-2022.88. Garrelfs SF, Frishberg Y, Hulton SA, Koren MJ, O'Riordan WD, Cochat P, Deschenes G, Shasha-Lavsky H, Saland JM, Van't Hoff WG, Fuster DG, Magen D, Moochhala SH, Schalk G, Simkova E, Groothoff JW, Sas DJ, Meliambro KA, Lu J, Sweetser MT, Garg PP. Vaishnaw AK. Gansner JM, McGregor TL, Lieske JC; ILLUMINATE-A Collaborators. Lumasiran, an RNAi Therapeutic for Primary Hyperoxaluria Type 1. N Engl J Med. 2021 Apr 1;384(13):1216-1226.89. Lai C, Pursell N. Gierut J, Saxena U, Zhou W, Dills M, Diwanji R, Dutta C, Koser M, Nazef N. Storr R, Kim B, Martin-Higueras C. Salido E. Wang W, Abrams M, Dudek H, Brown BD. Specific Inhibition of Hepatic Lactate Dehydrogenase Reduces Oxalate Production in Mouse Models of Primary Hyperoxaluria. Mol Ther. 2018 Aug ;26(8): 1983-1995.90. Ariceta G, Barrios K, Brown BD, Hoppe B, Rosskamp R, Langman CB. Hepatic Lactate Dehydrogenase A: An RNA Interference Target for the Treatment of All Known Types of Primary Hyperoxaluria. Kidney IntRep. 2021 Feb 3;6(4): 1088-1098.- 160- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 91. Salido E, Rodriguez-Pena M, Santana A, Beattie SG, Petry H, Torres A. Phenotypic correction of a mouse model for primary hyperoxaluria with adeno-associated virus gene transfer. Mol Ther. 2011 May;19(5);870-5.92. Gomez-Torres 0, Amatya S. Kamberov L, Dhaibar HA, Khanna P. Rom 0, Yurdagul A Jr, Orr AW, Nunez K, Thevenot P, Cohen A, Samant H, Alexander JS, Burgos-Ramos E, Chapa-Rodriguez A, Cruz-Topete D. SLAMF1 is expressed and secreted by hepatocytes and the liver in nonalcoholic fatty liver disease. Am J Physiol Gastrointest Liver Physiol. 2022 Sep 1;323(3):G177-G187.93. Robinet P, Milewicz DM, Cassis LA, Leeper NJ, Lu HS, Smith JD. Consideration of Sex Differences in Design and Reporting of Experimental Arterial Pathology Studies- Statement From ATVB Council. Arterioscler Thromb Vase Biol. 2018 Feb;38(2):292- 303.94. Lonardo A. Nascimbeni F. Ballestri S, Fairweather D, Win S, Than TA, Abdelmalek MF, Suzuki A. Sex Differences in Nonalcoholic Fatty Liver Disease: State of the Art and Identification of Research Gaps. Hepatology 7. 2019 Oct;70(4): 1457-1469.95. Vandel J, Dubois-Chevalier J, Gheeraert C, Derudas B, Raverdy V. Thuillier D, Gaal L, Francque S, Pattou F, Staels B, Eeckhoute J, Lefebvre P. Hepatic Molecular Signatures Highlight the Sexual Dimorphism of Nonalcoholic Steatohepatitis (NASH). Hepatology. 2021 Mar;73(3):920-936.96. Fan J, Chandhoke PS, Grampsas SA. Role of sex hormones in experimental calcium oxalate nephrolithiasis. J Am Soc Nephrol. 1999 Nov: 10 Suppl 14:8376-80.97. Yoshihara H. Yamaguchi S, Yachiku S. Effect of sex hormones on oxalate-synthesizing enzymes in male and female rat livers. J Urol. 1999 Feb;161(2):668-73.98. Salido EC, Li XM, Lu Y, Wang X, Santana A, Roy-Chowdhury N, Torres A, Shapiro LJ, Roy-Chowdhury J. Alanine-glyoxylate aminotransferase-deficient mice, a model for primary7 hyperoxaluria that responds to adenoviral gene transfer. Proc Natl Acad Sci U S A. 2006 Nov 28; 103(48): 18249-54.99. Zhu W, Zhao Z, Chou FJ, Zuo L, Liu T, Bushinsky D, Chang C, Zeng G, Yeh S. The Protective Roles of Estrogen Receptor p in Renal Calcium Oxalate Crystal Formation via Reducing the Liver Oxalate Biosynthesis and Renal Oxidative Stress-Mediated Cell Injury 7. Oxid Med Cell Longev. 2019 Apr 17:2019:5305014.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 100. Smati S, Polizzi A, Fougerat A, Ellero-Simatos S, Blum Y, Lippi Y, Regnier M, Laroyenne A, Huillet M, Arif M, Zhang C. Lasserre F, Marrot A, Al Saati T, Wan J, Sommer C, Naylies C, Batut A, Lukowicz C, Fougeray T, Tramunt B, Dubot P, Smith L, Bertrand-Michel J. Hennuyer N. Pradere JP, Staels B, Burcelin R, Lenfant F, Amal JF, Levade T, Gamet-Pavrastre L, Lagarrigue S, LoiseauN, Lotersztajn S, Postic C, Wahli W, Bureau C, Guillaume M, Mardinoglu A, Montagner A, Gourdy P, Guillou H. Integrative study of diet-induced mouse models of NAFLD identifies PPARa as a sexually dimorphic drug target. Gut. 2021 Apr 26:gutjnl-2020-323323.101. Knauf F, Asplin JR, Granjal, Schmidt IM, Moeckel GW, David RJ, Flavell RA, Aronson PS. NALP3-mediated inflammation is a principal cause of progressive renal failure in oxalate nephropathy. Kidney Int. 2013 Nov;84(5):895-901.102. Mulay SR, Eberhard JN. Pfann V. Marschner J A. Darisipudi MN, Daniel C. Romoli S, Desai J, Grigorescu M. Kumar SV, Rathkolb B, Wolf E. Hrabe de Angelis M. Bauerle T, Dietel B, Wagner CA, Amann K, Eckardt KU, Aronson PS, Anders HJ, Knauf F. Oxalate- induced chronic kidney disease with its uremic and cardiovascular complications in C57BL/6 mice. Am J Physiol Renal Physiol. 2016 Apr 15;310(8):F785-F795.103. Ip E, Farrell GC, Robertson G. Hall P. Kirsch R, Leclercq I. Central role of PPARalpha- dependent hepatic lipid turnover in dietary steatohepatitis in mice. Hepatology. 20Jul;38(l):123-32.104. Daugherty 7 A, Tall AR, Daemen MJAP, Falk E, Fisher EA, Garcia-Cardena G, Lusis AJ, Owens AP 3rd, Rosenfeld ME. Virmani R; American Heart Association Council on Arteriosclerosis, Thrombosis and Vascular Biology; and Council on Basic Cardiovascular Sciences. Recommendation on Design, Execution, and Reporting of Animal Atherosclerosis Studies: A Scientific Statement From the American Heart Association. Circ Res. 2017 Sep I;121(6):e53-e79.105. Liu M, Devlin JC, Hu J. Volkova A, Battaglia TW, Ho M. Asplin JR, Byrd A, Loke P, Li H, Ruggles KV, Tsirigos A, Blaser MJ, Nazzal L. Microbial genetic and transcriptional contributions to oxalate degradation by the gut microbiota in health and disease. Elife. 2021 Mar 26;10:e63642.106. Zhu J, Wang Q, Li C. Lu Y, Hu H, Qin B, Xun Y, Zhu Y, Wu Y, Zhang J, Wang S. Inhibiting inflammation and modulating oxidative stress in oxalate-induced Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 nephrolithiasis with the Nrf2 activator dimethyl fumarate. Free Radic Biol Med. 20Apr; 134:9-22.107. Pfau A. Wytopil M, Chauhan K, Reichel M. Coca SG, Aronson PS, Eckardt KU, Knauf F. Assessment of Plasma Oxalate Concentration in Patients With CKD. Kidney Int Rep. 2020 Sep 2:5(1 !):2013-2020.108. Patel M, Yarlagadda V, Adedoyin O, Saini V, Assimos DG, Holmes RP, Mitchell T. Oxalate induces mitochondrial dysfunction and disrupts redox homeostasis in a human monocyte derived cell line. Redox Biol. 2018 May;15:207-215.109. Alam S, Abdullah CS, Aishwarya R, Morshed M, Nitu SS, Miriyala S, Panchatcharam M, Kevil CG, Orr AW, Bhuiyan MS. Dysfunctional Mitochondrial Dynamic and Oxidative Phosphorylation Precedes Cardiac Dysfunction in RI 20G-aB-Cry stallin- Induced Desmin-Related Cardiomyopathy. J Am Heart Assoc. 2020 Dec;9(23);e01 7195.110. JhaP, Wang X. Auwerx J. Analysis of Mitochondrial Respiratory Chain Supercomplexes Using Blue Native Polyacrylamide Gel Electrophoresis (BN-PAGE) Curr Protoc Mouse Biol. 2016 Mar 1;6(1):1-14.111. Yan LJ, Forster MJ. Resolving mitochondrial protein complexes using nongradient blue native polyacrylamide gel electrophoresis. Anal Biochem. 2009 Jun 15;389(2):143-9.112. Luo X. Wu J, Jin Z, Yan LJ. Non-Gradient Blue Native Polyacrylamide Gel Electrophoresis. Curr Protoc Protein Sci. 2017 Feb 2:87:19.29.1-19.29.12.113. Spinazzi M, Casarin A, Pertegato V, Salviati L, Angelini C. Assessment of mitochondrial respiratory chain enzymatic activities on tissues and cultured cells. Nat Protoc. 2012 May 31;7(6):1235-46.114. Sivandzade F, Bhalerao A, Cucullo L. Analysis of the Mitochondrial Membrane Potential Using the Cationic JC-1 Dye as a Sensitive Fluorescent Probe. Bio Protoc. 2019 Jan 5;9(l):e3128.115. Abdullah CS, Aishwarya R, Alam S, Remex NS, Morshed M, Nitu S. Miriyala S, Panchatcharam M, Hartman B, King J, Alfrad Nobel Bhuiyan M, Traylor J, Kevil CG, Orr AW, Bhuiyan MS. The molecular role of Sigmarl in regulating mitochondrial function through mitochondrial localization in cardiomyocytes. Mitochondrion. 20Jan;62;159-175.116. Liang HL, Sedlic F, Bosnjak Z, Nilakantan V. SODI and MitoTEMPO partially prevent mitochondrial permeability transition pore opening, necrosis, and mitochondrial - 163 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 apoptosis after ATP depletion recovery. Free Radic Biol Med. 2O1ON0V 30;49(10):1550- 60.117. Mogilenko DA, Kudriavtsev IV. Shavva VS, Dizhe EB, Vilenskaya EG. Efremov AM, Perevozchikov AP, Orlov SV. Peroxisome proliferator-activated receptor a positively regulates complement C3 expression but inhibits tumor necrosis factor a-mediated activation of C3 gene in mammalian hepatic-derived cells. J Biol Chem. 2013 Jan 18;288(3): 1726-38.118. Orozco Morales ML, Rinaldi CA, de Jong E. Lansley SM, Gummer JPA, Olasz B, Nambiar S, Hope DE, Casey TH, Lee YCG, Leslie C, Neal on G, Shackleford DM, Powell AK, Grimaldi M, Balaguer P, Zemek RM, Bosco A, Piggott MJ, Vrielink A, Lake RA, Lesterhuis WJ. PPARa and PPARy activation is associated with pleural mesothelioma invasion but therapeutic inhibition is ineffective. iScience. 2021 Dec 4;25(l);103571.119. Chakravarthy MV. Lodhi IJ, Yin L, Malapaka RR, Xu HE, Turk J. Semenkovich CF. Identification of a physiologically relevant endogenous ligand for PPARalpha in liver. Cell. 2009 Aug 7;138(3):476-88.120. Li S, Gokden N. Okusa MD, Bhatt R, Portilla D. Anti-inflammatory effect of fibrate protects from cisplatin-induced ARE. Am J Physiol Renal Physiol. 20Aug;289(2):F469-80.121. FengX, GaoX, Jia Y, Zhang H, Xu Y, Wang G. PPAR-a Agonist Fenofibrate Decreased RANTES Levels in Type 2 Diabetes Patients with Hypertriglyceridemia. Med Sci Monit. 2016 Mar 5;22:743-51.122. Delerive P, De Bosscher K, Besnard S, Vanden Berghe W, Peters JM, Gonzalez FJ, Fruchart JC, Tedgui A, Haegeman G, Staels B. Peroxisome proliferator-activated receptor alpha negatively regulates the vascular inflammatory7 gene response by negative cross-talk with transcription factors NF-kappaB and AP-1. J Biol Chem. 1999 Nov 5;274(45):32048-54.123. Lennard Richard ML, Sato S, Suzuki E, Williams S, Nowling TK, Zhang XK. The Fli-transcription factor regulates the expression of CCL5/RANTES. J Immunol. 2014 Sep 15;193(6):2661-8.124. Moriuchi H, Moriuchi M, Fauci AS. Nuclear factor-kappa B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J Immunol. 19Apr 1;158(7):3483-91- 164- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 125. Lee AH, Hong JH, Seo YS. Tumour necrosis factor-alpha and interferon-gamma synergistically activate the RANTES promoter through nuclear factor kappaB and interferon regulatory factor 1 (IRF-1) transcription factors. Biochem J. 2000 Aug 15;3Pt l(Pt l):131-8.126. Ma C, Kesarwala AH, Eggert T, Medina-Echeverz J, Kleiner DE, Jin P, Stroncek DF, Terabe M, Kapoor V, ElGindi M, Han M, Thornton AM, Zhang H, Egger M, Luo J, Felsher DW, McVicar DW, Weber A, Heikenwalder M, Greten TF. NAFLD causes selective CD4(+) T lymphocyte loss and promotes hepatocarcinogenesis. Nature. 20Mar 10;531(7593):253-7.127. Xiong W. Zhao X, Villacorta L, Rom O, Garcia-Barrio MT, Guo Y, Fan Y, Zhu T, Zhang J, Zeng R, Chen YE, Jiang Z, Chang L. Brown Adipocyte-Specific PPARy (Peroxisome Proliferator-Activated Receptor y) Deletion Impairs Perivascular Adipose Tissue Development and Enhances Atherosclerosis in Mice. Arterioscler Thromb Vase Biol. 2018 Aug;38(8):1738-1747.128. Joshi S, Peck AB, Khan SR. NADPH oxidase as a therapeutic target for oxalate induced injury in kidneys. Oxid Med Cell Longev. 2013:2013:462361.129. Zuo J, Khan A, Glenton PA, Khan SR. Effect of NADPH oxidase inhibition on the expression of kidney injury molecule and calcium oxalate crystal deposition in hydroxy- L-proline-induced hyperoxaluria in the male Sprague-Dawley rats. Nephrol Dial Transplant. 2011 Jun;26(6): 1785-96.130. Huang X, Liu C, Kong N, Xiao Y, Yurdagul A Jr, Tabas I, Tao W. Synthesis of siRNA nanoparticles to silence plaque-destabilizing gene in atherosclerotic lesional macrophages. Nat Protoc. 2022 Mar;17(3):748-780.131. Tao W, Yurdagul A Jr, KongN, Li W, Wang X, Doran AC, Feng C, Wang J, Islam MA, Farokhzad OC, Tabas I, Shi J. siRNA nanoparticles targeting CaMKIIy in lesional macrophages improve atherosclerotic plaque stability in mice. Sci Transi Med. 2020 Jul 22;12(553):eaayl063.132. Fargue S, Rumsby G, Danpure CJ. Multiple mechanisms of action of pyridoxine in primary' hyperoxaluria type 1. Biochim Biophys Acta. 2013 Oct;1832(10):1776-83.133. Fargue S, Knight J, Holmes RP. Rumsby G, Danpure CJ. Effects of alanine:glyoxylate aminotransferase variants and pyridoxine sensitivity on oxalate metabolism in a cell- based cytotoxicity assay. Biochim Biophys Acta. 2016 Jun; 1862(6): 1055-62.- 165 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 134. Zabaleta N, Barberia M, Martin-Higueras C, Zapata-Linares N, Betancor 1, Rodriguez S, Martinez-Turrillas R, Torella L, Vales A, Olague C, Vilas-Zornoza A, Castro-Labrador L, Lara-Astiaso D, Prosper F, Salido E. Gonzalez-Aseguinolaza G, Rodriguez-Madoz JR. CRISPR/Cas9-mediated glycolate oxidase disruption is an efficacious and safe treatment for primary hyperoxaluria type I. Nat Commun. 2018 Dec 21 ;9( 1):5454.135. Liu Z, Li P, Zhao ZH, Zhang Y, Ma ZM, Wang SX. Vitamin B6 Prevents Endothelial Dysfunction, Insulin Resistance, and Hepatic Lipid Accumulation in Apoe (-/-) Mice Fed with High-Fat Diet. J Diabetes Res. 2016;2016:1748065.136. Zhu C, Kim K, Wang X, Bartolome A, Salomao M, Dongiovanni P, Meroni M, Graham MJ, Yates KP, Diehl AM, Schwabe RF, Tabas I, Valenti L, Lavine JE, Pajvani UB. Hepatocyte Notch activation induces liver fibrosis in nonalcoholic steatohepatitis. Sci Transl Med. 2018 Nov 21;10(468):eaat0344.137. Zhao M, Ralat MA, da Silva V, Garrett TJ. Melnyk S, James SJ. Gregory JF 3rd. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells. Am J Physiol Endocrinol Metab. 2013 Feb 15;304(4):E342-51.138. Baeck C, Wehr A, Karlmark KR, Heymann F, Vucur M, Gassier N, Huss S, Klussmann S, Eulberg D, Luedde T. Trautwein C, Tacke F. Pharmacological inhibition of the chemokine CCL2 (MCP-1) diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. Gut. 2012 Mar;61(3):416-26.139. Winter C, Silvestre-Roig C, Ortega-Gomez A, Lemnitzer P, Poelman H, Schumski A, Winter J, Drechsler M, de Jong R, Immler R. Sperandio M, Hristov M, Zeller T. Nicolaes GAF, Weber C, Viola JR, Hidalgo A, Scheiermann C, Soehnlein O. Chrono- pharmacological Targeting of the CCL2-CCR2 Axis Ameliorates Atherosclerosis. Cell Metab. 2018 Jul 3;28(l):175-182.e5.140. Hoang SA. Oseini A, Feaver RE, Cole BK, Asgharpour A, Vincent R, Siddiqui M, Lawson MJ, Day NC. Taylor JM, Wamhoff BR, Mirshahi F, Contos MJ. Idowu M, Sanyal AJ. Gene Expression Predicts Histological Severity and Reveals Distinct Molecular Profiles of Nonalcoholic Fatty Liver Disease. Sci Rep. 2019 Aug 29;9(1):12541.141. Innocenti F, Cooper GM, Stanaway IB, Gamazon ER, Smith JD. Mirkov S, Ramirez J, Liu W, Lin YS, Moloney C, Aldred SF, Trinklein ND, Schuetz E, Nickerson DA, Thummel KE, Rieder MJ, Rettie AE, Ratain MJ, Cox NJ, Brown CD. Identification, - 166- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 replication, and functional fine-mapping of expression quantitative trait loci in primary human liver tissue. PLoS Genet. 2011 May;7(5):el002078.142. Wang L, Athinarayanan S, Jiang G, Chalasani N, Zhang M, Liu W. Fatty acid desaturase gene polymorphisms control human hepatic lipid composition. Hepatology 2015 .׳ Jan;61(l): 119-28.143. Nunez KG, Frank A, Gonzalez-Rosario J, Galliano G, Bridle K, Crawford D, Seal J, Abbruscato F, Vashistha H, Thevenot PT, Cohen AJ. Interleukin-33 / Cyclin Dimbalance in severe liver steatosis predicts susceptibility to ischemia reperfusion injury. PLoS One. 2019 Apr 29; 14(4) :60216242.144. Nunez K, Hamed M, Fort D, Bruce D. Thevenot P, Cohen A. Links between donor macrosteatosis, interleukin-33 and complement after liver transplantation. World J Transplant. 2020 May 29;10(5): 117-128.145. Li M, Song J, Mirkov S, Xiao SY, Hart J, Liu W. Comparing morphometric, biochemical, and visual measurements of macrovesicular steatosis of liver. Hum Pathol. 20Mar;42(3):356-60146. Gamazon ER, Innocenti F, Wei R, Wang L, Zhang M, Mirkov S, Ramirez J, Huang RS, Cox NJ, Ratain MJ, Liu W. A genome-wide integrative study of microRNAs in human liver. BMC Genomics. 2013 Jun 13; 14:395.147. Liu W, Ramirez J, Gamazon ER, Mirkov S, Chen P, Wu K, Sun C, Cox NJ, Cook E Jr, Das S, Ratain MJ. Genetic factors affecting gene transcription and catalytic activity ׳ of UDP-glucuronosy !transferases in human liver. Hum Mol Genet. 2014 Oct 15;23(20):5558-69.148. Liu Z, Chalasani N, Lin J, Gawrieh S, He Y, Tseng YJ, Liu W. Integrative omics analysis identifies macrophage migration inhibitory ׳ factor signaling pathways underlying human hepatic fibrogenesis and fibrosis. J BioX Res. 2019 Mar;2(l): 16-24.149. Stockwell PA, Chatterjee A. Rodger EJ, Morison IM. DMAP: differential methylation analysis package for RRBS and WGBS data. Bioinformatics. 2014 Jul l;30(13):1814-22.150. Heinz S, Benner C, Spann N, Bertolino E. Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell. 20May 28;38(4):576-89.

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 151. Baba R, Matsuda S, Arakawa Y, Yamada R, Suzuki N, Ando T, Oki H, Igaki S, Daini M, Hattori Y, Matsumoto S, Ito M, Nakatani A, Kimura H. LSDI enzy me inhibitor TAK- 418 unlocks aberrant epigenetic machinery and improves autism symptoms in neurodevelopmental disorder models. Sci Adv. 2021 Mar 12;7(1 l):eabal 187.152. Recalde M, Garate-Rascon M, Elizalde M, Azkona M, Latasa MU, Barcena-Varela M, Sangro B, Fernndez-Barrena MG, Avila MA, Arechederra M, Berasain C. The splicing regulator SLU7 is required to preserve DNMT1 protein stability7 and DNA methylation. Nucleic Acids Res. 2021 Sep 7;49(15):8592-8609.153. Valvona CJ, Fillmore HL, Nunn PB, Pilkington GJ. The Regulation and Function of Lactate Dehydrogenase A: Therapeutic Potential in Brain Tumor. Brain Pathol. 20Jan;26(l):3-17.154. Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, Maire P, Giallongo A. Hypoxia response elements in the aldolase A, enolase 1. and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chern. 1996 Dec 20;271(51):32529-37.155. Liu DJ, et al., Exome-wide association study of plasma lipids in >300,000 individuals. Nat Genet. 2017 Dec;49(12): 1758-1766.156. Magdy T, Jouni M, Kuo HH, Weddle CJ, Lyra-Leite D, Fonoudi H, Romero-Tejeda M, Gharib M, Javed H, Fajardo G, Ross CJD, Carleton BC, Bernstein D, Burridge PW. Identification of Dmg Transporter Genomic Variants and Inhibitors That Protect Against Doxorubicin-Induced Cardiotoxicity. Circulation. 2022 Jan 25;145(4):279-294.157. Magdy T, Jiang Z. Jouni M. Fonoudi H. Lyra-Leite D, Jung G. Romero-Tejeda M, Kuo HH, Fetterman KA, Gharib M, Burmeister BT, Zhao M, Sapkota Y, Ross CJ, Carleton BC, Bernstein D, Burridge PW. RARG variant predictive of doxorubicin-induced cardiotoxicity 7 identifies a cardioprotective therapy. Cell Stem Cell. 2021 Dec 2;28(12):2076-2089.e7.158. Magdy T, Kuo HH, Burridge PW. Precise and Cost-Effective Nanopore Sequencing for Post-GWAS Fine-Mapping and Causal Variant Identification. iScience. 2020 Apr 24;23(4); 100971.

EXAMPLE 8 Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 id="p-604" id="p-604" id="p-604" id="p-604"

[00604]Example 8: Genetic and pharmacological targeting of hepatic oxalate overproduction ameliorates metabolic dysfunction-associated steatohepatitis (MASH) [00605]The prevalence of metabolic dysfunction-associated steatohepatitis (MASH) is rapidly increasing, and with no pharmacological therapy available, identification of new metabolic targets is urgently needed. The liver-specific alanine-glyoxylate aminotransferase (AGXT) detoxifies glyoxylate, preventing the accumulation of the metabolic end-product oxalate. In livers from patients and mice with MASH and in multiple in vitro systems of lipid-loaded hepatocytes, we found that AGXT is suppressed, leading to oxalate overproduction. In turn, oxalate promotes lipid accumulation in hepatocytes by impairing the transcription of peroxisome proliferator activated receptor-alpha (PPARa) and inhibiting fatty acid P־oxidation (FAO). In mice with diet-induced MASH, blocking oxalate overproduction through hepatocyte-specific overexpression of AGXT or pharmacological inhibition of glycolate oxidase (GO) and lactate dehydrogenase A (LDHA) potently lowers hepatic oxalate, steatosis, inflammation, and fibrosis by inducing PPARa-driven FAO, and suppressing leukocyte chemotaxis, and nuclear factor-kappa B and transforming growth factor-beta targets. These findings highlight hepatic oxalate overproduction as a new target for the treatment of MASH. [00606]References Cited in this Example [00607]Das S, Finney AC ... Rom O. Nature Metabolism (in revision) [00608]Liu Y... Rom O. Cell Reports 2021 ;36(4): 109420 [00609]Rom et al. Science Translational Medicine. 2020;12(572):eaaz2841 EQUIVALENTS id="p-610" id="p-610" id="p-610" id="p-610"

[00610]Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.

Claims (20)

Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 CLAIMS What is claimed is:

1. A compound of Formula (I): Formula (1) or a pharmaceutically acceptable salt, prodrug, hydrate, or solvate thereof, wherein: Ri is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, - N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr. ‘Bu, - (CH2)nCH3, -(CH2)n Tr, -(CH2)n fBu, -(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4, - (CH2)nCON(R4)(R5), ־(CH2)nSR4, -(CH2)nCN, -(CH2)n-Cl, -CH=CH-(CH2)n ־CH3, - CH=CH-(CH2)nTr. -CH=CH-(CH2)n fBu, -CH=C-(CH2)nOR4, -CH=CH- (CH2)nN(R4)(R5), -CH=CH-(CH2)nCOOR4, -CH=CH-(CH2)nCON(R4)(R5), -CH=CH- (CH2)nSR4, -CH=CH-(CH2)nCN, -CH=CH-(CH2)n-Cl, -C=C-(CH2)n ־CH3, -C=C- (CH2)n Tr, -C=C-(CH2)n fBu, -C=C-(CH2)nOR4, -C=C-(CH2)nN(R4)(R5). -C=C- (CH2)nCOOR4, -C=C-(CH2)nCON(R4)(R5). -C=C-(CH2)nSR4. -C=C-(CH2)nCN. or - C=C-(CH2)n-Cl; R2 is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, - N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr. Bu, - (CH2)nCH3, -(CH2)nTr, -(CH2)n ,Bu, ־(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4. - (CH2)nCON(R4)(R5). ־(CH2)nSR4. ־(CH2)nCN, -(CH2)n ־Cl, -CH=CH-(CH2)n ־CH3, - CH=CH-(CH2)nTr, -CH=CH-(CH2)n ؛Bu, -CH=C-(CH2)nOR4, -CH=CH- (CH2)nN(R4)(R5), -CH=CH-(CH2)nCOOR4, -CH=CH-(CH2)nCON(R4)(R5), -CH=CH- - 170- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 (CH2)״SR4, -CH=CH-(CH2)״CN, -CH=CH-(CH2)״-C1, -C=C-(CH2)״-CH3, -C=C- (CH2)״،Pr, -C=C-(CH2)״،Bu, -C=C-(CH2)״OR4, -C=C-(CH2)״N(R4)(R5), -C=C- (CH2)״COOR4, -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)״SR4, -C=C-(CH2)״CN, or - C=C-(CH2)״-C1; n is 0-10; R3 is -COOH, -COOR6, or -NO2; R4 is hydrogen, acyclic alkyl, C1-C9 alkyl, or and; R5 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; R6 is -CH3 or -CH2CH3; A-B is -CO- or -(CHOH)-; and X-Y is -CH2-CH2- or -CH=CH-.

2. The compound of claim 1, wherein the halogen is fluorine, chlorine, bromine, or iodine.

3. The compound of claim 1, wherein: X-Y is CH2-CH2 or CH=CH; ch-oh ؛ 0 = c ؛A-B is “11י׳- or ; R3 is -COOH or -NO2.

4. The compound of claim 1, wherein the compound is a salicylic acid derivative of Formula (II): wherein X-Y is CH2-CH2 or CH^CH; and - 171 - Formula (II) Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 C=O A2H-OH ؛A-B isu or

5. The compound of claim 3, wherein the compound is: - 172- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-570 FAB-581 aa - 173 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 - 174- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024

6. The compound of claim 1, wherein the compound is:

7. A pharmaceutical composition comprising a compound of any one of claims 1-6, or a combination thereof, and a pharmaceutically acceptable carrier, excipient, or diluent.

8. A method of treating a subject afflicted with an oxalate production-related disease the method comprising: measuring the circulating oxalate levels of a subject: and administering to the subject a therapeutically effective amount of a compound selected from the group consisting of: - 175 - FAB-594A FAB-541 Formula (I), Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 MDMG-935P OH O FL-6 OH OH O FL-22

9. The method of claim 8, wherein: Ri is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, - N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, ،Bu, - (CH2)nCH3, -(CH2)nTr, -(CH2)n،Bu, -(CH2)nOR4, -(CH2)nN(R4)(R5), -(CH2)nCOOR4, - (CH2)״CON(R4)(R5), -(CH2)״SR4, -(CH2)״CN, -(CH2)n-Cl, -CH=CH-(CH2)״-CH3, - CH=CH-(CH2)n zPr, -CH=CH-(CH2) ־ ״ Bu, -CH=C-(CH2)nOR4, -CH=CH- (CH2)״N(R4)(R5), -CH=CH-(CH2)nCOOR4, -CH=CH-(CH2)״CON(R4)(R5), -CH=CH- (CH2)״SR4. -CH=CH-(CH2)״CN. -CH=CH-(CH2)״-C1, -C=C-(CH2)״-CH3, -C=C- (CH2)n 7Pr, -C=C-(CH2)״،Bu, -C=C-(CH2)״OR4, -C=C-(CH2)״N(R4)(R5). -C=C- - 176- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 (CH2)״COOR4, -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)״SR4, -C=C-(CH2)״CN, or - C=C-(CH2)״-C1; R2 is a hydrogen, -Ph, a furan, a thiophene, a pyridine, a halogen, -CF3, -CN, - N(R4)(R5), -OR4, -SR4, -CH2-NH-(CH2)n-N(R4)(R5), -COOH, -COOR4, Tr, Bu, - (CH2)nCH3, -(CH2)nTr, -(CH2) ־ ״ Bu, -(CH2)״OR4, -(CH2)״N(R4)(R5), -(CH2)״COOR4, - (CH2)״CON(R4)(R5), -(CH2)״SR4, -(CH2)״CN, -(CH2)n-Cl, -CH=CH-(CH2)״-CH3, - CH=CH-(CH2)nTr, -CH=CH-(CH2)״،Bu, -CH=C-(CH2)״OR4, -CH=CH- (CH2)״N(R4)(R5), -CH=CH-(CH2)״COOR4, -CH=CH-(CH2)״CON(R4)(R5), -ch=ch- (CH2)״SR4. -CH=CH-(CH2)״CN. -CH=CH-(CH2)״-C1, -C=C-(CH2)״-CH3, -c=c- (CH2)n?r, -C=C-(CH2)״،Bu, -C=C-(CH2)״OR4, -C=C-(CH2)״N(R4)(R5). -C=C- (CH2)״COOR4. -C=C-(CH2)nCON(R4)(R5), -C=C-(CH2)״SR4, -C=C-(CH2)״CN. or - C=C-(CH2)״-C1; n is 0-10; R3 is -COOH, -COOR6, or -NO2; R4 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; R5 is hydrogen, acyclic alkyl, C1-C9 alkyl, or aryl; R6 is -CH3 or -CH2CH3; A-B is -CO- or -(CHOH)-; and X-Y is -CH2-CH2- or -CH=CH-.

10. The method of claim 9, wherein the halogen is fluorine, chlorine, bromine, or iodine.

11. The method of claim 8, wherein; X-Y is CH2-CH2 or CH=CH; ch-oh ؛ A-B is or ׳ - 177 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 R3 is -COOH or -NO2.

12. The method of claim 8, wherein the compound is a salicylic acid derivative of Formula (H): B X.״,A R2 R1 Formula (II) wherein X-Y is CH2-CH2 or CH=CH; and C=O CH-OHA-B is or "n

13. The method of claim 8, wherein the compound is: - 178 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-570 - 179- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 - 180- Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 FAB-594A

14. The method of claim 8. wherein the oxalate production-related disease comprises a cardiometabolic disease, a cardiovascular disease, a metabolic disease, a liver disease, a renal disease, or a combination thereof.

15. The method of claim 8, wherein the oxalate production-related disease comprises a GO-associated disease and/or an LDHA-associated disease.

16. The method of claim 14. wherein the cardiometabolic disease, cardiovascular disease, metabolic disease, liver disease, renal disease, or combination thereof, comprises heart failure, myocardial infarction, stroke, diabetes, dyslipidemia, hyperoxaluria, primary hyperoxaluria (PH), hypertension, obesity, hepatitis, cirrhosis, hepatocellular carcinoma, chronic kidney disease, nonalcoholic stealohepatitis (NASH), nonalcoholic - 181 - Docket No.: 2932719-000218-WO1 Date of Filing: February 28, 2024 fatty liver disease (NAFLD), atherosclerotic cardiovascular disease (ASCVD), or a combination thereof.

17. The method of claim 8, wherein the therapeutically effective amount of the composition inhibits GO activity, LDHA activity, or a combination thereof.

18. The method of claim 8, wherein the therapeutically effective amount comprises less than about 0.1 mg/kg, about 0.1 mg/kg, about 0.5 mg/kg, about 1.0 mg/kg, about 2.5 mg/kg, about 5 mg/kg, about 7.5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 70 mg/kg, about 80 mg/kg, about 90 mg/kg, about 100 mg/kg, about 120 mg/kg. about 135 mg/kg, about 150 mg/kg. about 175 mg/kg, about 200 mg/kg. and greater than about 200 mg/kg.

19. The method of claim 8, wherein measuring the circulating oxalate levels of a subject comprises an enzymatic assay, mass spectrometry, or a combination thereof.

20. The method of claim 19, wherein the subject ‘s circulating oxalate level is at least about 1 uM, about 1 uM, about 1.5 uM. about 2 uM, about 2.5 uM, about 3 uM. about 4 uM, about 5 uM, about 6 uM, about 7 uM. about 8 uM, about 9 uM, about 10 uM, or greater than about 10 uM. - 182-