IL320391A - Modulators and their uses - Google Patents

Modulators and their uses

Info

Publication number
IL320391A
IL320391A IL320391A IL32039125A IL320391A IL 320391 A IL320391 A IL 320391A IL 320391 A IL320391 A IL 320391A IL 32039125 A IL32039125 A IL 32039125A IL 320391 A IL320391 A IL 320391A
Authority
IL
Israel
Prior art keywords
smc
modulator
retinal
disease
ccr1
Prior art date
Application number
IL320391A
Other languages
Hebrew (he)
Original Assignee
Hadasit Med Res Service
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hadasit Med Res Service filed Critical Hadasit Med Res Service
Publication of IL320391A publication Critical patent/IL320391A/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/06Antiglaucoma agents or miotics

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

MODULATORS AND USES THEREOF TECHNOLOGICAL FIELD The present disclosure relates to modulators and uses thereof.
BACKGROUND ART References considered to be relevant as background to the presently disclosed subject matter are listed below: [1] Friedman DS, O’Colmain BJ, Muñoz B, Tomany SC, McCarty C, de Jong PTVM, Nemesure B, Mitchell P, Kempen J, Munoz B, et al (2004) Prevalence of age-related macular degeneration in the United States. Arch Ophthalmol 122: 564–572. [2]Resnikoff S, Pascolini D, Etya’ale D, Kocur I, Pararajasegaram R, Pokharel GP & Mariotti SP (2004) Global data on visual impairment in the year 2002. Bull World Heal Organ 82: 844–851. [3] Chinese patent No. CN103357017. [4]Hui-yang Zeng, Qing-jun Lu, Qian Liu, Ke-Gao Liu & Ning-li Wang (2011) The Role of CCR1 Expression in the Retinal Degeneration in rd Mice, Current Eye Research, 36:3, 264-269, DOI: 10.3109/02713683.2010.535133. [5] Rutar, M., Natoli, R., Chia, R. et al. Chemokine-mediated inflammation in the degenerating retina is coordinated by Müller cells, activated microglia, and retinal pigment epithelium. J Neuroinflammation 12, 8 (2015). https://doi.org/10.1186/s12974-014-0224-1.
Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter.
BACKGROUND Degenerative retinal and macular disease such as age-related macular degeneration (AMD) are the leading cause of irreversible blindness among the elderly in the Western world [1], [2] .
Several publications describe that chemokine receptors are involved in AMD. For example, beta chemokine receptor inhibitors for the protection of photoreceptor cells medicament for the treatment of hereditary retinal degeneration [3] . In addition, expression of CCR1 in the photoreceptor cells was identified to be increased with the progress of retinal degeneration in rd mice [4] . Further, it was shown that retinal degeneration induces upregulation of a broad chemokine response whose expression is coordinated by Müller cells, microglia, and RPE [5] .
GENERAL DESCRIPTION The present disclosure provides in accordance with some aspects, an effective amount of at least one small molecule compound (SMC) modulator for use in a method for modulating activity of CCR1 in a Müller cell of a subject in need thereof.
The present disclosure provides in accordance with some other aspects, an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator modulates activity of CCR1 in the Müller cell.
The present disclosure provides in accordance with some further aspects, an effective amount of at least one SMC for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC is represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
The present disclosure provides in accordance with some further aspects, an effective amount of at least one small molecule compound (SMC) for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the SMC is represented by Formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
The present disclosure provides in accordance with some other aspects, a pharmaceutical composition comprising the at least one SMC modulator and optionally at least one of pharmaceutically acceptable carrier/s, excipient/s, auxiliaries, and/or diluent/s.
The present disclosure provides with some other aspects a method of inhibiting activity of CCR1 in a Müller cell in a subject in need thereof, the method comprises contacting the cell with an effective amount of at least one SMC modulator.
The present disclosure provides with some other aspects a method of inhibiting Müller cell activation in a subject in need thereof, the method comprising contacting said cell with an effective amount of at least one SMC modulator, wherein the SMC modulator inhibits CCR1 activity in the Müller cell.
The present disclosure provides with some other aspects a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease or condition in a subject in need thereof, the method comprises administering to said subject a therapeutically effective amount of at least one SMC modulator, wherein said SMC modulator is represented by Formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof BRIEF DESCRIPTION OF THE DRAWINGS In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which: Figs. 1A-1E relate to photic retinal damage model, Fig. 1A is a schematic diagram depicting the experimental design, wherein the mice in the treated group underwent photic injury followed by an intravitreal injection of human monocyte-derived macrophages (hMdɸs) in the right eye (OD) and vehicle (PBS) in the left eye (OS); control mice were not exposed to photic injury, nor did they receive intravitreal injections; fellow eyes in the treated and control mice were tested by electroretinography (ERG) seven days after photic injury, and thickness of the outer nuclear layer (ONL) was measured using histology eight days after photic injury; Figs. 1B-1E are images showing TUNEL (red) and DAPI (blue) staining of BALB/c mouse retinas two days after photic injury shows apoptotic photoreceptor cells (asterisk) and RPE cells (arrow) in the posterior retina ( Fig. 1B and Fig. 1C ), and relatively few apoptotic cells (arrow) in the peripheral retina ( Fig . 1D and Fig. 1E ); Figs. 1F-1G are optical coherence tomography images obtained 7 days after photic injury in control ( Fig. 1F ) and in mice induced with photic injury ( Fig. 1G ), 1, 2, and 3 indicate the ganglion cell layer (GCL), inner nuclear layer (INL), and ONL, respectively; Fig. 1H is a graph showing relative ERG b-wave amplitude versus light flash intensity of mice injected with monocytes (n=7) and control mice that were not exposed to light (n=9); respectively, *p<0.05 (range 0.008-0.05); Fig. 1I is a graph showing relative photoreceptor number; *p<0.05. Scale bars: 50 µm ( Fig. 1B- Fig. 1E ) and 200 µm ( Fig. 1F and Fig. 1G ).
Figs. 2A-2Frelate to in vitro characterization of human monocytes derived macrophages (hMdɸs) and in vivo cytotoxicity of M2a hMdɸ cells, Fig. 2A are graphs representing the expression of the phenotype-specific markers CXCL10, CCL17, and CD163, measured by quantitative real-time PCR (n=5), determined by the relative quantification (RQ) of the expression of the gene of interest compared to a house keeping gene (or comparator gene), in human M0 macrophages (hMdɸs) that were polarized to form M1, M2a, or M2c hMdɸs; Fig. 2B are images from converted phase-contrast microscopy of M0, M1, M2a, and M2c hMdɸs; Fig. 2Cis a graph showing relative ERG b-wave amplitude versus light flash intensity of mice injected with M0, M1, M2a and M2c hMdɸs (n=8 mice for each group) and control mice (n=8) that were not exposed to light; relative ERG b-wave was calculated by dividing the b-wave amplitude recorded from the mouse eye injected with hMdɸs by the b-wave amplitude recorder from the vehicle-injected eye of the same mouse, similar b-wave amplitudes were recorded in fellow eyes of control mice; Fig. 2D are representative ERG recordings in control mice and in photic-injured mice in which the right eye (OD) was injected with M1 or M2a hMdɸs and the left eye (OS) was injected with PBS as vehicle, "a" and "b" in the graphs indicate the a-wave and the b-wave of the ERG, respectively; Fig. 2E is a graph showing summary of the relative number of photoreceptor nuclei in the ONL measured at the indicated distances from the optic nerve head (in µm), the relative number of photoreceptor nuclei was calculated by comparing the number of photoreceptor nuclei present in the ONL of the mouse eye injected with hMdɸ and the counterpart vehicle-injected eye; Fig. 2F are representative immunofluorescence images of retinal slices prepared from the indicated mice following an injection of DiO-stained hMdɸs (green); the nuclei were counterstained with DAPI (blue), and the ONL is indicated (red brackets). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. *p<0.05 and **p<0.01. Scale bars: µm (Yuan).
Figs. 3A-3I are images of adoptive transfer of M2a hMdɸ cells into mouse eyes, Figs. 3A and 3B are images of polarized M1 and M2a hMdɸs obtained from patients with AMD, respectively, showing distinct morphological differences and CD206 (red) expression in M2a hMdɸs; the cells were also stained with the lipophilic dye DiO (green), and the nuclei were counterstained with DAPI (blue); Figs. 3C-3E are inverted phase-contrast microscopy images of cryosections prepared from mouse eyes 7 days after photic retinal injury and intravitreal injection of DiO-labeled M2a hMdɸs, showing M2a hMdɸs in the vitreous ( Fig. 3 C) with a polarized profile and elongated cell morphology ( Fig. 3 D), as well as across the layers of the retina ( Fig. 3 E, asterisk), including the subretinal space ( Fig. 3 E, arrows); Figs. 3F-3I are images ofretinal flat-mount ( Fig. 3 F, Fig. 3 H) and fundus autofluorescence images ( Fig. 3 G, Fig. 3 I) of the retina 7 days after injecting M2a hMdɸs, the migration of M2a hMdɸs toward the ONH is shown in the red cross in Fig. 3 F and Fig. 3 G and in the vicinity of the large retinal vessels shown in arrows in Fig. 3 F and Fig. 3 G; the high density of M2a hMdɸs in the superior retinal area is indicated by the rectangles in Fig. 3 H and Fig. 3 I). S, superior; I, inferior; T temporal; N, nasal; GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; ONH, optic nerve head. Scale bars: µm ( Fig. 3 A, Fig. 3 B, Fig. 3 D, and Fig. 3 E), 100 µm ( Fig. 3 F and Fig. 3 H), and 2µm ( Fig. 3 C).
Figs. 4A-4I relate to M2a hMdɸs that have a neurotoxic effects on retinal explants, Figs. 4A-4C are images showing TUNEL staining (red) of 11 randomly selected retinal fields ( Fig. 4 A) of mouse retinal explants co-cultured with either MhMdɸs ( Fig. 4 B) or M2a hMdɸs ( Fig. 4 C) for 18 hours; the nuclei were counterstained with DAPI (blue), showing that M2a hMdɸ ( Fig. 4 C) are associated with photoreceptor cell apoptosis as compared to M1 hMdɸ; Fig. 4D shows representative FACS gating plots of cells obtained from the indicated retinal explants stained using TUNEL-PE; TUNEL+ cells are shown in the red rectangles based on an unstained retinal explant; Fig. 4E is a graph showing the percentage of apoptotic (TUNEL+) cells measured in control explants and in explants co-cultured with M1 or M2a hMdɸs (n=6 per group); Fig. 4F is aRhodopsin immunostaining (green) image of a retinal explant showing the association of macrophages with apoptotic photoreceptor cells, indicated by the co-localization of TUNEL and rhodopsin staining in a Z-stack (shown in arrow); Figs. 4G-4H are images of RPE-choroid explants co-cultured with M2a hMdɸs, and the co-localization of TUNEL staining (red) and the expression of the RPE marker RPE(green) ( Figs 4 G), the presence of TUNEL-positive hexagonal and pigmented cells (shown by arrows) is visualized in Fig. 4H; Fig. 4I is a graph showing the percentage of photoreceptor cell death (measured by the percentage of TUNEL-positive cells), further to the addition of supernatant collected from M2a hMdɸs to retinal explants increased photoreceptor death; n=6 per group. *p<0.05. Scale bars: 20 µm ( Fig. 4 G and Fig. 4 H), 50 µm ( Fig. 4 B, Fig. 4 C, and Fig. 4 F), and 200 µm ( Fig. 4 A).
Figs 5A-5Grelate to M2a hMdɸs cells that produce high levels of reactive oxygen species (ROS) and induce the infiltration of CD11b+ cells, Fig. 5A is a graph showing fluorescence intensity from cultured M0, M1 hMdɸs and M2a hMdɸs ; ROS production was measured using the DCFDA fluorogenic dye (n=5 per group); Fig. 5B is a HNE immunostaining (green) image showing similar levels of oxidative stress in mouse eyes following an intravitreal injection of either M1 hMdɸs (left) or M2a hMdɸs (right); Fig. 5C is a graph showing relative oxidative stress levels measured in control eyes and in eyes injected with M1 or M2a hMdɸs (n=7 per group) calculated by comparing the fluorescence level of HNE-stained sections of the hMdɸ-injected eye and the vehicle-injected eye of the same mouse. HNE staining intensity was quantified using ImageJ; Fig. 5D is a CD11b immunostaining image (red, arrows) showing increased presence of mononuclear phagocytes in the choroid tissue following photic injury (top right) and in eyes following an intravitreal injection of MhMdɸs (bottom left) or M2a hMdɸs (bottom right); Fig. 5E is a graph showing CD11b+ cells present in the choroid tissue in eyes following an intravitreal injection of M1 or M2a hMdɸs (n=7 per group); Fig. 5F are inverted phase-contrast microscopy images of the ONH showing migration of DiO-labeled M2a hMdɸ cells (green) and co-localization with recruited CD11b+ cells (red), shown in the rectangles; Fig. 5G is a graph showing an in vitro migration assay performed using a Boyden chamber, showing an increase in monocytes that migrated toward the M2a hMdɸs compared with the M1 hMdɸs (n=6 per group). *p<0.05, scale bars: 50 µm ( Fig. 5 B- Fig. 5 D) and 100 µm ( Fig. 5 F).
Figs. 6A-6C are graphs showing real-time quantitative PCR (qPCR) analysis of MPIF1, MCP4, and HCC1 mRNA, in M1 and M2a macrophages derived from human monocytes; n=6 each. *p<0.05; ns, not significant.
Figs 7A-7E relate to CCR1 expression, upregulated in a mouse model of photic injury, Figs 7A-7B are images of Albino BALB/c mice exposed to photic injury; hours and 7 days later, retinal sections were prepared and immunostained for Ccr( Fig. 7 A; red) or TUNEL stained ( Fig. 7 A B, red); the nuclei were counterstained with DAPI (blue); Fig. 7C is a graph showing real-time qPCR analysis of retinal CcrmRNA measured in control mice and in mice 7 days after photic injury (n=6 mice each); **p<0.005. Fig. 7D is a graph showing Ccr1 expression plotted against the b-wave amplitude measured using ERG in mice 7 days after photic injury, each dot represents an individual mouse, and the correlation coefficient and p-value are shown; Fig. 7E show images of retinal sections prepared 7 days after photic injury and co-immunostained for CCR1 (red) and the glial cell marker GFAP (green); nuclei were counterstained with DAPI (blue). GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; ONL, outer nuclear layer. Scale bars: 50 µm ( Fig. 7 A, Fig. 7 B, and Fig. 7 E).
Figs. 8A-8E relate to expression of CCR2 and CCR5 in the mouse retina following photic injury, Figs. 8A-8B are images of retinal sections obtained from control and photic-injured mice immunostained for CCR2 ( Fig. 8 A) or CCR5 ( Fig. 8 B); nuclei were counterstained with DAPI (blue); Fig. 8C are images of flat-mount retinal sections prepared from photic-injured mice and show recruited cells expressing CCR1 (left panel, arrows), CCR2 (middle panel, arrows), and CCR5 (right panel, arrows); Figs. 8D-8E are graphs showing real-time qPCR analysis of retinal Ccr2 and Ccr5 mRNA, respectively, measured in control mice and photic-injured mice; n=mice each. *p<0.05. Scale bars: 50 µm ( Fig. 8 A and Fig. 8 B) and 20 µm ( Fig. 8 C).
Figs. 9A-9H relate to upregulation of Ccr1 in both rd10 mice and senescent mice, Fig. 9A are images showing retinal sections prepared from 1-week-old, 3-week- old, and 6-week-old rd10 mice and immunostained for CCR1; nuclei were counterstained with DAPI, increased expression of CCR1 (top row, shown by arrows) is observed at 3 and 6 weeks, corresponding to reduced ONL thickness (bottom row, shown by double-ended arrows); Fig. 9Bare images of retinal sections from a 3-week-old r10 mouse co-immunostained for CCR1 (red) and GFAP (green); nuclei were counterstained with DAPI, and the co-localization of CCR1 and GFAP in the Müller cells is shown; Fig. 9C is a graph showing real-time qPCR analysis of retinal CcrmRNA measured in 1-, 3-, and 6-week-old rd10 mice; n=7 mice each; Fig. 9D is a graph showing real-time qPCR analysis of retinal Ccr2 and Ccr5 mRNA measured in 1- and 3-week-old rd10 mice; n=7 mice each; Figs. 9E-9G are images of retinal sections prepared from 18-month-old (senescent) mice and co-immunostained for CCR1 (red) and GFAP (green); nuclei were counterstained with DAPI, co-localization of CCR1 and GFAP in the Müller cells is shown by arrows; Fig. 9H is a graph showing real-time qPCR analysis of retinal Ccr1, Ccr2, and Ccr5 mRNA measured in young (6-week-old) and senescent (18-month-old) mice; n=8 mice each. *p<0.05 and ns, not significant, scale bars: 50 µm ( Fig. 9 A, Fig. 9 B, and Fig. 9 E- Fig. 9 G).
Figs. 10A-10G show inhibition of CCR1 resulting in the reduction of the effects of photic injury, Albino BALB/c mice were subjected to photic injury followed by subcutaneous injections of the CCR1 inhibitor BX471 or vehicle for 5 days; Fig. 10A shows ERG recordings performed after 5 days, amplitude of the b-wave was measured and is plotted against flash intensity; Fig. 10Bis a graph showing the number of photoreceptor nuclei measured at the indicated distances from the optic nerve; Fig. 10C are images of retinal sections prepared from vehicle- and BX471-treated mice and immunostained for the microglial cell marker IBA-1; asterisks indicate amoeboid-shaped cells in the ONL and subretinal layer, and arrows indicate elongated cells in the GCL and IPL, with one cell shown in a magnified view (inset); Fig. 10D is a graph showing real-time qPCR analysis of retinal Adgre1 mRNA (which encodes the macrophage marker F4/80) in control mice, vehicle-treated photic-injured mice, and BX471-treated photic-injured mice; n=6 mice each; Fig. 10E are images showing retinal sections prepared from vehicle-treated photic-injured mice and BX471-treated photic-injured mice and immunostained for CCR1; Fig. 10Fis a graph showing real-time qPCR analysis of retinal Ccr1 mRNA measured in vehicle-treated photic-injured mice and BX471-treated photic-injured mice; n=5 mice each; Fig. 10G are graphs showing real-time qPCR analysis of retinal Ccl2, Cxcl1, and Cxcl10 mRNA measured in control mice, vehicle-treated photic-injured mice, and BX471-treated photic mice; n=6 mice each. *p<0.05, **p<0.01, #p<0.001, and ns, not significant, scale bars: µm ( Fig. 10 C and Fig. 10 E) and 20 µm (inset in Fig. 10 C).
Figs. 11A-11D relate to CCR1 inhibition that modulates the functional properties of M2a hMdɸs, Fig. 11A are images of M1 and M2a hMdɸs immunostained for CCR1 (green); with magnified views are shown below; Fig. 11B is a graph showing the percentage of CCR1-postive cells measured using cell sorting analysis of CCR1-stained M1 hMdɸ and M2a hMdɸs; n=5 experiments each; Fig. 11C is a graph showing ROS levels measured in untreated M2a hMdɸs and M2a hMdɸs treated with 0.5 or 5 µM BX471; Fig. 11D is a graph showing the migration of monocytes treated or not with 10 µM BX471 that migrated toward the M2a hMdɸs using a Boyden chamber; n=3 experiments each. *p<0.05 and **p<0.01, s cale bars: 50 µm ( Fig. 11 A) and 20 µm (insets in Fig. 11 A).
Figs. 12A-12Oare auto-fluorescence images of the eye fundus, Figs. 12A-12Eshow wild type mice (n=6), Figs. 12F-12Jimages of Ccr1 wild type, Crb1rd8 mice (n=6), Figs. 12K-12Oshow Ccr1 Knockout, Crb1rd8 mice (n=6), all 15 month-old, revealing that the deletion of Ccr1 is associated with a decrease of fundus lesions, indicated by the presence of multiple bright spots in the retina.
Figs. 13A-13Fare graphs showing the results of real-time quantitative PCR (qPCR) analysis of Cxcl10 ( Fig. 13A) , Gfap ( Fig. 13B) , Vimentin ( Fig. 13C) , Cxcl( Fig. 13D) , Ccl2 ( Fig. 13E)and F4/80 ( Fig. 13F)mRNA levels in Ccr1 wild type, Crb1rd8 mice (denoted as rd8), and in Ccr1 knockout, Crb1rd8 mice (denoted as ccrko), n=6 mice per group, Student’s t-test, data shown as mean ± SEM, p-Values indicated by ns, non-significant, *p<0.05.
Figs. 14A-14C show the effect of the CCR1-specific antagonist BX471 in rdmice; Fig. 14 A shows b-wave amplitude plotted against flash intensity, from full-field electroretinography (ERG) measurements recorded for both ( ) vehicle-treated and ( ) BX471-treated group, as well as a second ERG recording performed on day of the experiment for both groups ((---) vehicle-treated mice, and (---) BX471 treated mice. ; Fig. 14B shows the average b-wave amplitudes (in µV) for the control and treated mice; ; Fig.14C shows representative scotopic ERG signals of vehicle- and BX471-treated mice, at post-natal day 21 (P21) and at post-natal day 25 (P25); data shown as mean ± SEM. p-Values indicated by ns, not significant and Ψp<0.05, **p<0.00004, ***p<0.000004 (Student’s t-test).
Fig. 15 shows ERG measurements recorded at P21 for both, ( ̶ ) rd10 mice and ( ̶ ) rd10 mice with Ccr1 deletion, represented by the b-wave amplitude plotted against flash intensity; data shown as mean ± SEM. p-Values indicated by *p<0.03, **p<0.0(Student’s t-test).
DETAILED DESCRIPTION OF EMBODIMENTS Retinal disease is characterized by a complex physiology involving multiple interrelated diverse cellular and molecular processes. Such diseases are often multifactorial disease influenced by both genetic and environmental factors.
The human retina comprises several types of glial cells among them, astrocytes, microglia and Müller cells, with the latter being the most common and predominate type cell.
Specifically, Müller cells (also denoted as Müller glial cells) are known to participate in multiple and diverse retinal processes, including, for example, in retinal regeneration and in retinal neuroprotection, partially due to their unique morphology that enable their interaction with all neuronal cell types. In addition, their stem cell potential suggests that these cells may be a target for regenerative therapies by replacing injured retinal neurons. Further, during injury or disease, Müller cells may become reactive and might generate detrimental responses in the retina resulting in cell injury and loss. However, the exact impact of Müller glia cells on the retina depends on the particular circumstances and the underlying pathology.
The present disclosure is based on the surprising findings that human macrophages, specifically M2a macrophages, Müller cells and C-C chemokine receptor type 1 (CCR1), are interconnected and modulate retinal and macular degeneration.
As described herein, the inventors have identified a unique mechanism that involves M2 macrophages and photoreceptor cells death. Specifically, as shown in Example 1below, photoreceptor cell death was associated with the presence of hMdɸs following photic retinal injury. As suggested in Example 2below, M2a hMdɸs cells were shown to have a neurotoxic effect on retinal tissue.
As shown in Example 6 below, increased expression of genes encoding markers of activated Müller cells, Ccl2, Cxcl1, and Cxcl10 was observed after photic injury. These results suggest the importance of Müller cells as a therapeutic target and specifically the importance of inhibiting Müller cells activation.
Overall, these surprising findings are highly valuable as they may lead to development of new strategies in treating retinal disease by specifically targeting Müller cells. The ability of the inventors to identify Müller cells and specific targets in these cells as a therapeutic strategy is important due to the complexity of their dual function and important roles and involvement in promoting retinal regeneration and providing neuroprotection as well as the involvement of activated Muller cells to generate retinal injury.
Hence, the present disclosure provides in accordance with some aspects an effective amount of at least one small molecule compound (SMC) modulator for use in a method for modulating Müller cell activation in a subject in need thereof.
In the following text, when referring to the at least one SMC modulator it is to be understood as also referring to the compositions, methods, uses and kits disclosed herein. Thus, whenever providing a feature with reference to the SMC modulator, it is to be understood as defining the same feature with respect to the compositions, methods, uses and kits, mutatis mutandis.
It should be noted that "modulation", "modulator" or "modulate" as used herein encompasses either inhibition, or alternatively, enhancement. In some embodiments, the at least one SMC modulator inhibits Müller cell activation.
A small molecule compound (SMC) in the context of the present disclosure refers to a low molecular weight organic compound, having a molecular weight lower than 900 Daltons.
The term Müller cell activation as used herein refers to changes in these cells, for example, changes in morphology, protein expression and protein production, which may occur in response to pathological conditions such as a retinal disease.
As shown in Example 6 and in Example 8 , inhibition of Müller cells activation was associated with a reduction in the expression of genes encoding markers of activated Müller cells, Ccl2, Cxcl1, Cxcl10, Gfap and Vimentin.
In some embodiments, the at least one SMC modulator may reduce expression of at least one chemokine associated with Müller cell activation. In some embodiments, the reduce expression of at least one chemokine may inhibit activation of the Müller cell.
Chemokines are classified into four main subfamilies: C-X-C Chemokines (CXC Chemokines), C-C Chemokines (CC Chemokines), CX3C Chemokines and C Chemokines and exert their biological effects by interacting with G protein-linked transmembrane receptors called chemokine receptors.
In some embodiments, the SMC modulator may reduce expression of at least one CC chemokine. In some other embodiments, the SMC modulator may reduce the expression of at least one CXC chemokine. In some other embodiments, the SMC modulator may reduce the expression of at least one CX3C chemokine. In some other embodiments, the SMC modulator may reduce the expression of at least one C chemokine.
In some embodiments, the SMC modulator may reduce expression of C-C Motif Chemokine Ligand 2 (CCL2). CCL2 is a chemokine also referred to as monocyte chemoattractant protein 1 (MCP1) and small inducible cytokine A2.
In some embodiments, the SMC modulator may reduce expression of one or more of C-X-C Motif Chemokine Ligand 1 gene (CXCL1), Chemokine (C-X-C motif) ligand 9 (CXCL9) gene or C-X-C Motif Chemokine Ligand 10 gene (CXCL10).
In some embodiments, the SMC modulator may reduce expression of one or more of C-X-C Motif Chemokine Ligand 1 gene (CXCL1), or C-X-C Motif Chemokine Ligand 10 gene (CXCL10).
CXCL1 is a small peptide belonging to the CXC chemokine family. CXCLalso known as Interferon gamma-induced protein 10 (IP-10) or small-inducible cytokine B10 is a small cytokine belonging to the CXC chemokine family.
It should be understood that when referring to expression of CCL2, CXCL1, CXCL9 or CXCL10, the invention further encompasses genes and proteins as well as CCL2, CXCL1, CXCL9 or CXCL10 level and/or stability.
In some embodiments, the SMC modulator may reduce the level of at least one CC chemokine. In some embodiments, the SMC modulator may reduce the level of at least one CC chemokine and hence inhibit Müller cell activation. In some embodiments, the SMC modulator may reduce the level of CCL2. In some embodiments, the SMC modulator may reduce the level of CCL2 and hence inhibit Müller cell activation.
In some embodiments, the SMC modulator may reduce the level of at least one CXC chemokine. In some embodiments, the SMC modulator may reduce the level of at least one CXC chemokine and hence inhibit Müller cell activation.
In some embodiments, the SMC modulator may reduce levels of CXCL1. In some embodiments, the SMC modulator may reduce levels of CXCL1 and hence inhibit Müller cell activation.
In some embodiments, the SMC modulator may reduce levels of CXCL10. In some embodiments, the SMC modulator may reduce levels of CXCL10 and hence inhibit Müller cell activation.
In some embodiments, the at least one SMC modulator may reduce expression of at least one intermediate filament (IF) protein associated with Müller cell activation. In some embodiments, the reduce expression of at least one intermediate filament may inhibit activation of the Müller cell.
Intermediate filament as used herein refers to one or more proteins that form an elaborate network in the cytoplasm of most cells, extending from a ring surrounding the nucleus to the plasma membrane.
In some embodiments, the SMC modulator may reduce expression of at least one type III intermediate filament protein. In some embodiments, the SMC modulator may reduce expression of glial fibrillary acidic protein (GFAP). In some embodiments, the SMC modulator may reduce levels of GFAP and hence inhibit Müller cell activation. In some embodiments, the SMC modulator may reduce expression of vimentin. In some embodiments, the SMC modulator may reduce levels of vimentin and hence inhibit Müller cell activation.
As shown in Example 4 below, nine cytokines were identified to be significantly higher in the conditioned medium of M2a hMdɸ cells with three of these cytokines (HCC-1, MCP-4, and MPIF-1) being ligands of CCR1. As further shown in Example 4 , the inventors surprisingly found that CCR1 is expressed primarily in Müller cells. Interestingly, the expression of CCR2 or CCR5 was not detected in Müller cells. In addition, it was found that CCR1 expression was upregulated in Müller cells in models of retinal injury and aging, and that CCR1 expression was correlated with photoreceptor cell death and hence retinal damage. It was further found that inhibition of CCR1, significantly reduced the severity of retinal damage.
Hence, in accordance with some aspects, the present disclosure provides an effective amount of at least one small molecule compound (SMC) modulator for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof.
As described herein, modulating CCR1 activity in Müller cell inhibited Müller cell activation.
Hence, the present disclosure provides in accordance with some other aspects an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator modulates activity of CCR1 in the Müller cell.
In some examples of the present disclosure modulating the activity of CCR1 in Müller cell refers to reduction/inhibition of CCR1 expression, stability, level or any combination thereof.
As known in the art, CCR1 is a G protein-coupled receptor (GPCR) member of the CC chemokine subfamily of receptors. Human CCR1 is 355 amino acids in length and has a predicted molecular weight of 41 kDa and mouse and rat CCR1 share 80% amino acids sequence identity with the human protein. CCR1 similar to other GPCR is characterized by a structure including even-transmembrane domain.
In some embodiments, CCR1 may be a human CCR1. In some other embodiments, human CCR1 may comprise the amino acid sequence as denoted by Accession number P32246. In more specific embodiments, the amino acid sequence of CCR1 is as denoted by SEQ ID NO: 1. In some embodiments CCR1 is encoded by the cDNA of Accession number NC_000003.12. In more specific embodiments, said cDNA sequence of CCR1 is denoted by SEQ ID NO: 2.
In some embodiments, the SMC modulator may be an antagonist of CCR1. The term "antagonist" (inhibitor) relates to a compound, agent or a drug that binds to a protein or a receptor and partially or totally blocks stimulation, decreases, prevents, delays activation, inactivates, desensitizes, down regulates the activity or dampens a biological response. In the context of the present disclosure, the antagonist or inhibitor may partially or completely block the activity of CCR1.
According to some embodiments, the antagonist may be directed to a specific binding site of CCR1. The binding site may be determined by any known method in the field, for example by computational methods.
In some embodiments, the antagonist binds to a binding site located between transmembrane domain 3, 4, 5, 6, and 7 of CCR1.
In some embodiments, the antagonist binds to a binding site including amino acid residues from transmembrane domain 3 and 6 of CCR1.
In some embodiments, the antagonist binds to a binding site including amino acid residues Tyr-113 and Tyr-114 on transmembrane domain 3 and Ile-259 on transmembrane 6 of CCR1.
The selection of a CCR1 antagonist suitable for use can be determined based on their activity in at least one of the methods described in the Examples.
Specifically, a CCR1 antagonist in accordance with the present disclosure is selected such that it is capable of at least one of (i) increasing b-wave amplitude on electroretinogram (ERG) and increased outer nuclear layer (ONL) thickness, (ii) elongated microglial cells; (iii) reduced recruitment of macrophages to the retina (based on increased retinal expression of the macrophage marker F4/80), (iv) reduction of expression of Müller cell activation markers or (v) any combination thereof.
As appreciated, each one of the above-mentioned criteria can be determined by any method known in the art, for example, as descried in the examples below that form a part of the description of the application.
The antagonist may be in some embodiments, as a direct antagonist, or an allosteric inhibitor.
Antagonists mediate their effects by binding to the active (orthosteric = right place) site or to allosteric (= other place) sites on any cognate protein (or receptor, in case applicable), or they may interact at unique binding sites not normally involved in the biological regulation of the cognate protein.
In some embodiments, the antagonist is a competitive antagonist. As appreciated, a competitive antagonist directly and physically blocks access of the agonist to the receptor.
In some embodiments, the antagonist is a negative allosteric modulator of CCR1. As appreciated, a negative allosteric modulator indirectly changes agonist binding by interacting at a secondary site on the receptor to diminish the ability of the agonist to bind to the primary site.
In some embodiments, the at least one SMC modulator is at least one of the following: (a) (I) (designated herein as SMC 1), (b) (II) (designated herein as SMC 2), (c) (III) (designated herein as SMC 3), (d) (IV) (designated herein as SMC 4), (e) (V) (designated herein as SMC 5), (f) (VI) (designated herein as SMC 6), (g) (VII) (designated herein as SMC 7), (h) (VIII) (designated herein as SMC 8), (i) (IX) (designated herein as SMC 9), (j) (X) (designated herein as SMC 10) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
Each of these SMCs is briefly discussed below: SMC 1 represented by Formula (I) is known as BX-471 having CAS# 217645-70-0. BX-471 represented by the chemical name N-[5-chloro-2-[2-[(2R)-4-[(4-fluorophenyl)methyl]-2-methyl-1-piperazinyl]-2-oxoethoxy]phenyl]-urea.
In some embodiments, the at least one SMC modulator applicable for the present disclosure is a compound of Formula (I).
SMC 2 represented by Formula (II) is known as BI-638683 having a IUPAC name (2E,2'E)-dimethyl 4,4'-(benzylazanediyl)bis(but-2-enoate).
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (II).
SMC 3 represented by Formula (III) is known as BL-5923 having CAS# 868408-20-2. BL-5923 is represented by the chemical name (E)-N-(5-chloro-2-(3-(9-(4-fluorobenzyl)-3-oxa-7,9-diazabicyclo[3.3.1]nonan-7-yl)-3-oxoprop-1-en-1-yl)-4-methoxyphenyl)acetamidethe.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (III).
SMC 4 represented by Formula (IV) is known as BMS-817399 having CAS# 1202400-18-7. BMS-817399 is represented by the chemical name 1-[(2R)-1-[(4S)-4-(4-chlorophenyl)-4-hydroxy-3,3-dimethylpiperidin-1-yl]-3-methyl-1-oxobutan-2-yl]-3-(2-hydroxy-2-methylpropyl)urea.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (IV).
SMC 5 represented by Formula (V) is known as AZD-4818 having CAS# 1003566-93-5. AZD-4818 is represented by IUPAC name 2-{2-chloro-5-[(2S)-3-{5-chloro-3H-spiro[1-benzofuran-2,4'-piperidin]-1'-yl}-2-hydroxypropoxy]-4-(methylcarbamoyl)phenoxy}-2-methylpropanoic acid.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (V).
SMC 6 represented by Formula (VI) is known as CCX9588 having the chemical name 1-(4-(4-chloro-3-methoxyphenyl)piperazin-1-yl)-2-(4-chloro-5-methyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)ethenone.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (VI).
SMC 7 represented by Formula (VII) is known as CCX354 having CAS# 1010073-75-2. CCX354 has a chemical name 2-(3-(1H-Imidazol-2-yl)-1H-pyrazolo[3,4-b]pyridin-1-yl)-1-(4-(4-chloro-3-methoxyphenyl)piperazin-1-yl)ethan-1-one.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (VII).
SMC 8 represented by Formula (VIII) is known as CP-481715 having CAS# 212790-31-3. CP-481715 has a chemical name N-((2S,3S,5R)-5-carbamoyl-1-(3-fluorophenyl)-3,8-dihydroxy-8-methylnonan-2-yl)quinoxaline-2-carboxamide.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (VIII).
SMC 9 represented by Formula (IX) is known as MLN-3897 having CAS#1010731-97-1. MLN-3897 has a chemical name (S,E)-4-(4-chlorophenyl)-1-(3-(7-(2-hydroxypropan-2-yl)-2,11-dihydrobenzo[6,7]oxepino[3,4-b]pyridin-5(1H)-ylidene)propyl)-3,3-dimethylpiperidin-4-ol.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (IX).
SMC 10 represented by Formula (X) is known as CP-865569 having CAS#1010731-97-1. CP-865569 has a chemical name 5-chloro-2-(2-((2r,5s)-4-((4-fluorophenyl)methyl)-2,5-dimethyl-1-piperazinyl)-2-oxoethoxy)benzenemethanesulfonic acid.
In some embodiments, the at least one SMC modulator applicable for the invention is a compound of Formula (I).
In some embodiments, the at least one SMC modulator is at least one of AZD-4818, BI-638683, BL-5923, BMS-817399, BX-471, CCX9588, CCX354, CP-481715, MLN-3897, CP-865,569, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In some embodiments, the at least one SMC modulator applicable for the invention is a small molecule represented by Formula I.
In some embodiments, the at least one SMC modulator applicable for the invention is a small molecule represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or any combinations thereof.
It should be noted that in accordance with the present disclosure, when referring to a small molecule compound (e.g. any one of SMC1, SMC2, SMC3, SMC4, SMC5, SMC6, SMC 7, SMC 8, SMC 9, SMC 10), it may encompasses one or more of the following as well as any combinations thereof: a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
It should be further noted that a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof in the context of the present disclosure are considered to have similar biological or physiological activity as the small molecule to which they relate or any small molecule related thereof, for example, in inhibiting Müller cell activation and/or neurotoxic effect of M2a hMdɸs.
In accordance with some examples, the physiologically functional derivative of SMC 1 may be any SMC represented by Formula (XI): (XI) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein each one of R 1, R 2, R 3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, L 1 and L 2 is each independently from each other selected from -(CH2)p-, -(CH2)p-S, -,-(CH2)p-O-, NH, -NH-(CH2)p-, C(O)-(CH2)p-O-, each n, m, q, p is an integer being independently from each other selected from be 0 to 5.
Hence, in some aspects, the present disclosure provides an SMC modulator represented by Formula (XI).
In some examples, the SMC modulator is represented by Formula (XI), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido, L 1 is –(CH 2)-, L 2 is -C(O)-(CH 2)-O-, n and m are each 1 and q is 2. In some examples, the SMC modulator is represented by Formula (XI), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido, L1 is –(CH2)-, L2 is -C(O)-(CH2)-O-.
In some examples, the SMC modulator represented by Formula (XI) is represented by Formula (XIa): (XIa) wherein each one of R 1, R 2, R 3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, L2 is selected from -(CH 2) p-, -(CH 2) p-S, -,-(CH 2) p-O-, NH, -NH-(CH 2) p-, C(O)-(CH 2) p-O-, each n, m, q, p is an integer being independently from each other selected from be 0 to 5.
In some examples, the SMC modulator is represented by Formula (XIa), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is a halogen, R 2 is an alkyl, R 3 is a halogen and an ureido, L2 is -C(O)-(CH2)-O-, n and m are each 1 and q is 2.
In some examples, the SMC modulator is represented by Formula (XIa), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R1 is an F, R2 is an CH3, R3 is Cl and an ureido, and L 2 is -C(O)-(CH 2)-O-.
In some examples, the SMC modulator represented by Formula (XI) is represented by Formula (XIb): (XIb) wherein each one of R 1, R 2, R 3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, Lis selected from -(CH 2) p-, -(CH 2) p-S, -,-(CH 2) p-O-, NH, -NH-(CH 2) p-, C(O)-(CH 2) p-O, each n, m, q, p is an integer being independently from each other selected from be to 5.
In some examples, the SMC modulator is represented by Formula (XIb), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido, L 1 is –(CH 2)-, n and m are each 1 and q is 2.
In some examples, the SMC modulator is represented by Formula (XIb), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido, and L1 is –(CH2)-.
In some examples, the SMC modulator represented by Formula (XI) is represented by Formula (XII): (XII). or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein each one of R1, R2, R3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, each n, m, q is an integer being independently from each other selected from be 0 to 5.
In some examples, the SMC modulator is represented by Formula (XII), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is a halogen, R 2 is an alkyl, R 3 is a halogen and an ureido, n and m are each 1 and q is 2. In some examples, the SMC modulator is represented by Formula (XII), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido.
In some examples, the SMC modulator represented by Formula (XI) is represented by Formula (XIII): (XIII) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein each one of R 1, R 2, R 3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide.
In some examples, the SMC modulator is represented by Formula (XIII), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido. In some examples, the SMC modulator is represented by Formula (XIII), or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula XI, XIa, XIb, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. It should be noted that unless otherwise stated, reference to SMC represented by at least one of Formula XI refers to one or more of Formula XI, Formula XIa, or Formula XIb.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by a Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting the activity of CCR1 in a Müller cell of a subject in need thereof, wherein the SMC modulator is represented by a Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In accordance with some other aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator inhibits activity of CCR1 in the Müller cell and is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some other aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator inhibits activity of CCR1 in the Müller cell and is represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some other aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with In accordance with some other aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator is represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some further aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator inhibits activity of CCR1 in the Müller cell and is represented by a Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In accordance with some further aspects, it is provided an effective amount of at least one SMC modulator for use in a method for inhibiting Müller cell activation of a subject in need thereof, wherein the SMC modulator is represented by a Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
As described and shown herein, expression of CCR2 and/or CCR5 was not detected in Müller cells. Hence, in accordance with some embodiments, the SMC modulator does not modulate CCR2 and/or CCR5 activity and/or expression in the Müller cell. In accordance with some embodiments, the SMC modulator does not inhibit CCR2 activity and/or expression in the Müller cell. In accordance with some other embodiments, the SMC modulator does not inhibit CCR5 activity and/or expression in the Müller cell.
As described herein, it was found that CCR1 is expressed in Müller cells. In some examples, the at least one SMC modulator inhibit CCR1 activity in Müller cell. In some other examples, the at least one SMC modulator inhibit Müller cell activation.
The level of CCR1 expression can be measured by any method known in the art. For example, CCR1 expression can be measured by using flow cytometry or immunofluorescence assay by employing specific CCR1 antibody such as those described herein below.
As noted above, Müller cells form part of the glial cells in the retina and play an important role in retinal physiological activities.
As noted above, the term Müller cell activation as used herein refers to changes in these cells, for example, changes in morphology, protein expression and protein production, which may occur in response to pathological conditions such as a retinal disease.
As shown in Example 8 below, a reduction in the expression of genes encoding markers of activated Müller cells, Gfap, Vimentin, Ccl2, Cxcl1, and Cxcl10 was observed in Ccr1 knockout, Crb1rd8 mice compared to Ccr1 wild type, Crb1rd8 mice. This suggests that inhibiting CCR1 activity in Müller cells inhibits Müller cells activation.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator that reduces expression of the at least one chemokine is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments the at least one SMC modulator that reduces expression of the at least one chemokine is represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator that reduces expression of the at least one intermediate filament is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the at least one SMC modulator that reduces expression of the at least one intermediate filament is represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
As described herein, the inventors have identified unique mechanism that involves M2 macrophages and photoreceptor cells death and specifically a connection between photoreceptor cell death and the presence of hMdɸs following photic retinal injury.
Hence, in some embodiments which may be considered as aspects of the present disclosure, the SMC modulator reduces neurotoxic effects of M2a macrophages. In some embodiments, the SMC modulator reduces M2a hMdɸs neurotoxicity. The effects of M2a hMdɸs such as their neurotoxicity can be determined by any method known in the art, for example, those described herein below.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator that reduces neurotoxic effects of M2a macrophages is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator that reduces neurotoxic effects of M2a macrophages is represented by at least one of Formula XI, XII, XIII, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator that reduces neurotoxic effects of M2a macrophages is a compound represented by formula I (denoted herein SMC 1).
Macrophages are a type of white blood cell that engulfs and digests cellular debris, foreign substances, microbes, cancer cells, and anything else that does not have the types of proteins specific to healthy body cells on its surface in a process called phagocytosis.
In some embodiments, the SMC inhibit recruitment of neurotoxic macrophages to the retina. As used herein neurotoxic macrophages are considered cause a detrimental effect.
Inhibition of activity of the neurotoxic macrophages may in turn reduce activity of Müller cells thus may directly inhibit the death of photoreceptor cells.
In some embodiments, the SMC modulator reduces M2a hMdɸs neurotoxicity to thereby inhibit photoreceptor cell damage.
A photoreceptor cell as used herein refers to a type of neuroepithelial cell found in the retina that is capable of visual phototransduction. The photoreceptor cell damage as used herein refers to harm or injury in these cells that may result in vision symptoms such as blurred vision, loss of peripheral vision, etc. The photoreceptor cell damage as used herein encompasses photoreceptor cell death, e.g. photoreceptor cell apoptosis and/or photoreceptor cell degeneration.
In some embodiments, the SMC modulator inhibits photoreceptor cell death. In some embodiments, the SMC modulator inhibits photoreceptor cell apoptosis.
The term photoreceptor cell apoptosis refers to programmed cell death of photoreceptor cells that may be triggered by various factors, including genetic mutations, environmental stressors, or age-related processes. Photoreceptor cell apoptosis may be associated with development of various retinal degenerative diseases.
In some embodiments, the SMC modulator inhibits photoreceptor cell degeneration.
The term photoreceptor cell degeneration refers to a process of deterioration, damage, or loss of photoreceptor cells in the retina.
In some embodiments, the SMC modulator inhibits photoreceptor cell degeneration, photoreceptor cell death, or any combination thereof.
In some embodiments, the SMC modulator reduces macrophage-mediated photoreceptor cell death.
In accordance with some aspects, the present disclosure provides a SMC modulator for use in inhibiting one or more of Müller cell activation, photoreceptor cell damage or any combination thereof, wherein the SMC modulator inhibits the expression of CCR1 in Müller cell and is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some aspects, the present disclosure provides a SMC modulator for use in inhibiting one or more of Müller cell activation, photoreceptor cell damage or any combination thereof, wherein the SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some other aspects, the present disclosure provides a SMC modulator for use in inhibiting one or more of Müller cell activation, photoreceptor cell damage or any combination thereof, wherein the SMC modulator inhibits the expression of CCR1 in Müller cell and is a compound represented by formula I (denoted herein SMC 1).
In accordance with some other aspects, the present disclosure provides a SMC modulator for use in inhibiting one or more of Müller cell activation, photoreceptor cell damage or any combination thereof, wherein the SMC modulator is a compound represented by formula I (denoted herein SMC 1).
As described herein, Müller cell activation and photoreceptor cell damage are processes often associated with retinal damage, hence, as described herein, targeted inhibition of Müller cell activation is useful in disease associated with retinal damage.
Hence, applicability of the SMC modulator, composition, methods and uses all described herein, is highly important as by targeting Müller cell, damage to the retina may be inhibited. Accordingly, any subject suffering from one or more of a retinal damage, a retinal inflammation, a photoreceptor cell damage, retinal inflammation or any combination thereof may benefit from the at least one SMC modulator described herein.
In accordance with some embodiments, the Müller cell may be of a subject suffering from a retinal damage and/or a photoreceptor cell damage.
Retinal damage as defined herein encompasses any process/mechanism/pathway that cause damage to any part of the retina and may result in worsening of vision, vision loss and even blindness. Such process includes at least one of retinal cells death, retinal injury, retinal aging, retinal degeneration, retinal inflammation, photoreceptor cells apoptosis, macular degeneration, photic injury or any combination thereof. Retinal damage can occur in various cells in the retina including, inter alia, in photoreceptor cell and in retinal glial cells.
Retinal glial cell as known in the art is important for maintaining normal retinal function, having important roles in neurotransmitter uptake and recycling, potassium siphoning, shuttling of energy metabolites and maintenance of the blood retinal barrier.
As known in the art, retina refers to a layer of photoreceptors cells and glial cells that process light to perceive a visual picture.
In accordance with some embodiments, the Müller cell may be of a subject in need of restoring retinal function.
In accordance with some embodiments, the Müller cell may be of a subject in need of inhibiting Müller cell and/or decreasing M2a hMdɸs neurotoxicity.
In accordance with some embodiments, the Müller cell may be of a subject suffering from a retinal disease or any associated condition, such as retinal inflammation.
In accordance with some embodiments, the Müller cell may be of a subject suffering from a retinal disease.
In accordance with some embodiments, the Müller cell may be of a subject suffering from a retinal disease associated with activation of Müller cell. In accordance with some embodiments, the Müller cell may be of a subject suffering from a retinal disease associated with neurotoxicity of M2a hMdɸs.
In some embodiments, the retinal disease is associated with damage to photoreceptor cell. In some embodiments, the retinal disease is associated with photoreceptor cell death.
Hence, in accordance with some aspects it is provided an effective amount of at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the retinal disease is associated with activation of Müller cell and/or neurotoxicity of M2a hMdɸs.
In some embodiments, the at least one SMC modulator may be used for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition by inhibiting Müller cell and/or decreasing M2a hMdɸs neurotoxicity.
In accordance with some aspects it is provided an effective amount of at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the retinal disease is associated with activation of Müller cell and/or neurotoxicity of M2a hMdɸs and wherein the at least one SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In accordance with some aspects it is provided an effective amount of at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the retinal disease is associated with activation of Müller cell and/or neurotoxicity of M2a hMdɸs and wherein the at least one SMC modulator is represented by Formula I (denoted herein SMC 1) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In some embodiments which can be considered as aspects of the present disclosure, it is provided at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof by inhibiting Müller cell activation and/or decreasing M2a hMdɸs neurotoxicity, wherein the at least one SMC modulator is is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspects of the present disclosure, it is provided at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof by inhibiting Müller cell activation and/or decreasing M2a hMdɸs neurotoxicity, the at least one SMC modulator is a compound represented by formula I (denoted herein SMC 1) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In some embodiments which can be considered as aspects of the present disclosure, it is provided at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof by inhibiting damage of photoreceptor cell, wherein the at least one SMC modulator is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspects of the present disclosure, it is provided at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof by inhibiting damage of photoreceptor cell, the at least one SMC modulator is a compound represented by formula I (denoted herein SMC 1) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
In accordance with some aspects, it is provided an effective amount of at least one SMC modulator for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the at least one SMC modulator is described herein.
In the context of the present disclosure, when referring to a "retinal disease" or an "ocular disease" it is to be understood to encompass any abnormal condition primarily affecting the normal integrity and/or functionality of retina or choroid specifically interfering with the ability of the eye to function properly and/or that negatively affects the visual acuity. Such disease may be caused by any one of angiogenesis, inflammation, trauma, oxidative stress, hypoxia, undesired immune response, diabetes, vascular occlusion, structural, atrophy, prematurity, toxicity (including light toxicity), inherited degeneration, radiation, developmental retardation/defect, oncologic, hematologic, metabolic, vitamins deficiency, infectious, senile (aging) or different combination between them. The term retinal disease as used herein encompasses any conditions or complications associated therewith.
In some examples, the retinal disease is one or more of an inherited retinal degeneration (IRD) disease, a retinal vascular disease, choroidal vascular disease, inflammatory disease, posterior non-infectious uveitis disease, a retinal detachment disease, glaucoma or any associated disorders.
In some examples, the retinal disease is a retinal degenerative and dystrophies disease. In some examples, the retinal disease is a retinal degenerative disease. In some examples, the retinal disease is a retinal dystrophies disease. In some examples, the retinal disease is inherited retinal degeneration (IRD) disease.
A retinal degenerative disease or retinal dystrophies (RD) disease as used herein refers to a group of degenerative disorders of the retina caused by genetic mutations and/or environmental or pathologic damage to the retina. These disease cause photoreceptor and retinal pigment epithelium (RPE) cell loss that leads to vision loss.
In some examples, the retinal degenerative disease is one or more of macular dystrophies, retinitis pigmentosa (RP) and allied disorders, abnormalities of rod and cone function, hereditary vitreoretinal degeneration, hereditary choroidal dystrophies or any combination thereof.
In some examples, the retinal degenerative disease is macular dystrophies. The term macular dystrophies as used herein refers to a group of genetic disorders, primarily affecting the macula, being a central part of the retina in the eye.
In some examples, the retinal degenerative disease is retinitis pigmentosa and allied disorders. Retinitis pigmentosa and allied disorders as used herein refer to heterogeneous clinically and genetically disease. In some examples, the retinal degenerative disease is retinitis pigmentosa. The term retinitis pigmentosa as used herein refers to a group of retinal degeneration genetic eye conditions leading to chronic retinal degeneration, accompanied by abnormal deposits of pigment, causing a progressive decrease in peripheral or side vision. In some examples, the retinitis pigmentosa is a non-syndromic disease. In some examples, the retinitis pigmentosa is a syndromic disease.
In some examples, the retinal degenerative disease is an abnormality of rod and cone function. Abnormalities of rod and cone function as used herein refer to disorders that affect the functioning of the two main types of photoreceptor cells in the retina: rods and cones.
In some examples, the retinal degenerative disease is hereditary vitreoretinal degeneration. Hereditary vitreoretinal degeneration also known as hereditary vitreoretinopathy, as used herein refers to disease characterized by early-onset cataracts, vitreous anomalies, coarse fibrils and membranes, and retinal detachment.
In some examples, the retinal degenerative disease is hereditary choroidal dystrophies. The term hereditary choroidal dystrophies as used herein refers to a disease or disorder involving the choroid.
In some examples, the retinal degenerative disease or any associated condition thereof is one or more of retinitis pigmentosa (RP), cone or cone-rod dystrophy, Leber congenital amaurosis, Fundus flavimaculatus, stargardt disease (STGD), Congenital stationary night blindness, North Carolina macular dystrophy, Sorsby's macular dystrophy, Pattern macular dystrophy, Vitelliform macular dystrophy (Best's disease), Choroideremia, X-linked retinoschisis (XLRS), Gyrate atrophy.
In some examples, the retinal degenerative disease or any associated condition thereof is one or more of Usher syndrome, Bardet-Biedl syndrome, Senior-Locken syndrome, Alport syndrome, Älmstron syndrome, Joubert Syndrome, Nephronophthisis, Cockayne syndrome, Refsum disease, Autosomal dominant cerebellar ataxia type 7, Norrie disease.
In some examples, the retinal degenerative disease is one or more of stargardt disease (STGD), best disease (BD), X-linked retinoschisis (XLRS), autosomal dominant drusen (ADD), Sorsby fundus dystrophy (SFD), pattern dystrophy (PD).
In some examples, the retinal disease is a retinal vascular disease. In some examples, the retinal vascular disease is one or more of diabetic retinopathy, retinal artery and capillary occlusions, acquired retinal macroaneurysm (RAM), branch retinal vein occlusion, central retinal vein occlusion, macular telangiectasia type 2, radiation retinopathy or any combination thereof.
In some examples, the retinal vascular disease is diabetic retinopathy. Diabetic retinopathy as used herein refers to a condition in which damage occurs to the retina due to diabetes mellitus and may cause vision loss and blindness. Diabetic retinopathy may affect blood vessels in the retina. The term Diabetic retinopathy as used herein may encompasses non-proliferative diabetic retinopathy, proliferative diabetic retinopathy and diabetic macular edema (DME). DME refers to retinal thickening caused by the accumulation of intraretinal fluid, primarily in the inner and outer plexiform layers.
In some examples, the retinal vascular disease is non-proliferative diabetic retinopathy. In some examples, the retinal vascular disease is proliferative diabetic retinopathy. In some examples, the retinal vascular disease is DME.
In some examples, the retinal vascular disease is Retinal artery occlusion and capillary occlusions. Retinal artery occlusions (RAO) and capillary occlusions as used herein refers to a condition associated with visual loss. Retinal artery occlusions is associated with vascular transient monocular vision loss (TMVL), branch retinal arterial occlusion (BRAO), central retinal arterial occlusion (CRAO) and ophthalmic arterial occlusion (OAO).
In some examples, the retinal vascular disease is acquired retinal macroaneurysm. Acquired Retinal Macroaneurysm as used herein refers to a condition formed when arteriosclerosis leads to weakening of the arteriolar wall and consequently, the arterial wall develops an outpouching that results in a macroaneurysm.
In some examples, the retinal vascular disease is branch retinal vein occlusion (BRVO). Branch retinal vein occlusion as used herein refers to a situation when branches of the retinal vein become blocked. The most common symptom of branch retinal vein occlusion is vision loss or blurry vision in part or all of one eye.
In some examples, the retinal vascular disease is retinal vein occlusion (RVO). Retinal vein occlusion as used herein refers to a condition associated with vision loss, typically in older individuals.
In some examples, the retinal vascular disease is central retinal vein occlusion. Central retinal vein occlusion as used herein refers to a condition associated with occlusion at or proximal to the lamina cribrosa of the optic nerve, where the central retinal vein exits the eye.
In some examples, the retinal vascular disease is macular telangiectasia type 2. Macular telangiectasia type 2 as used herein refers to a bilateral disease with characteristic alterations of the macular capillary network and neurosensory atrophy.
In some examples, the retinal vascular disease is radiation retinopathy. Radiation retinopathy as used herein refers to a chronic progressive vasculopathy developing secondary to ionizing radiation to the retina.
In some examples, the retinal disease is a choroidal vascular disease.
In some examples, the retinal disease is a Bruch’s membrane disease.
Choroidal vascular disease or Macular neovascularization (MNV) disease as used herein refers to a condition associated with growth of new, abnormal blood vessels originating in the choroid or retina, that is a vessel-containing layer under the retina.
In some examples, the choroidal vascular disease is one or more of age-related macular degeneration (AMD), pathologic myopia, pachychoroid disease and polypoidal choroidal vasculopathy.
Age-related macular degeneration (AMD or ARMD) is a medical condition which may result in blurred or no vision in the center of the visual field. The severity of the disease can be divided into early, intermediate, and late types, with the late type also divided into "atrophic" and "neovascular" forms.
The age-related macular degeneration as used herein encompasses non-neovascular early AMD, intermediate AMD, and geographic atrophy and neovascular AMD.
Dry form AMD also known as Atrophic AMD (aAMD) is usually associated with drusen, cellular debris in the macula and is characterized by the progressive loss of retinal pigment epithelial (RPE) cells and photoreceptor cells, which can coalesce and cause geographic atrophy in the macular region.
Wet form AMD also known as neovascular AMD (nvAMD), is associated with CNV, namely blood vessels growth under the macula, causing blood and fluid to leak into the retina.
Pathologic myopia as used herein refers to is highly myopic eyes with degenerative macular changes.
Polypoidal choroidal vasculopathy (PVC) as used herein refers to an eye disease primarily affecting the choroid that may cause sudden blurring of vision or a scotoma in the central field of vision.
In some examples, the retinal disease is an inflammatory disease.
The term retinal inflammatory disease also is an eye condition that causes dysfunction of the retina and, in advance case, substantial vision loss. The retinal inflammatory disease in some examples is uveitis. In some examples, the retinal inflammatory disease is Anterior Uveitis (Iritis). – Anterior Uveitis (Iritis). affects the front portion of the eye. In some examples, the retinal inflammatory disease is Intermediate Uveitis (Cyclitis). Intermediate Uveitis (Cyclitis) affects the ciliary body, which is responsible for releasing aqueous humor into the eye. In some examples, the retinal inflammatory disease is Posterior Uveitis (Choroiditis and Retinitis). Posterior Uveitis (Choroiditis and Retinitis) affects the back portion of the eye. In some examples, the retinal inflammatory disease is Diffuse Uveitis (Panuveitis). Diffuse Uveitis (Panuveitis) affects the middle portions of the eye located under the sclera (the white of the eye).
In some examples, the retinal disease is a posterior non-infectious uveitis. Posterior non-infectious uveitis as used herein are often the cause of vision loss.
In some examples, the inflammatory disease/uveitis posterior non-infectious uveitis is or photic retinal injury.
In some examples, the retinal disease is a retinal detachment.
Retinal detachment as used herein refers to a condition in which a thin layer of tissue (the retina) at the back of the eye pulls away from its normal position. Retinal detachment separates the retinal cells from the layer of blood vessels that provides oxygen and nourishment to the eye.
In some examples, the retinal detachment is non-rhegmatogenous retinal detachment, rhegmatogeneous retinal detachment (RRD) or degenerative retinoschisis.
Rhegmatogenous Retinal Detachment (RRD) is a disease associated with accumulation of subretinal fluid in the potential space between the neurosensory retina and the underlying retinal pigment epithelium (RPE).
Retinal traction detachment (RTD) also known as tractional retinal detachment (TRD) is associated with separation of the neurosensory retina from the retinal pigment epithelium (RPE) due to the traction caused by proliferative membranes present over the retinal surface or vitreous.
Exudative (or serous) retinal detachment (ERD) is associated with fluid accumulation in the subretinal space between the sensory retina and the retinal pigmented epithelium (RPE) resulting in retinal detachment.
In some examples, the retinal disease is glaucoma.
Glaucoma is a group of eye diseases which result in damage to the optic nerve and cause vision loss. The most common type is open-angle (wide angle, chronic simple) glaucoma, in which the drainage angle for fluid within the eye remains open, with less common types including closed-angle (narrow angle, acute congestive) glaucoma and normal-tension glaucoma.
The present disclosure also provides in accordance with some aspects a pharmaceutical composition comprising at least one SMC modulator and optionally at least one of pharmaceutically acceptable carrier/s, excipient/s, auxiliaries, and/or diluent/s. The compositions of the invention may comprise an effective amount of the at least one SMC modular.
In some embodiments which can be considered as aspect of the present disclosure, the pharmaceutical composition comprises the at least one SMC modulator as described herein or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the pharmaceutical composition comprises the at least one SMC modulator represented by one or more of Formula I, II, III, IV, V, VI, VII, VIII, IX, X. In some embodiments, the pharmaceutical composition comprises the at least one SMC modulator represented by one or more of Formula XI, XII, XIII or any combinations thereof. In some embodiments, the pharmaceutical composition comprises the at least one SMC modulator represented by Formula I.
The pharmaceutical compositions of the invention can be administered and dosed by the methods of the invention, in accordance with good medical practice, systemically, for example intravenous. It should be noted however that the invention may further encompass additional administration modes. In other examples, the pharmaceutical composition can be introduced to a site by any suitable route including oral, intranasal, or intraocular administration, intraperitoneal, subcutaneous, transcutaneous, topical, intramuscular, intraarticular, subconjunctival, or mucosal.
The at least one SMC disclosed herein being for example a SMC denoted herein as SMC 1, may be formulated into a delivery system, preferably with a pharmaceutically acceptable carrier.
Such delivery systems typically control the rate at which a drug is released and the location in the body where it is released.
The composition disclosed herein can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the subject in need by employing procedures known in the art.
In some examples, the pharmaceutical composition is formulated using intravitreal biodegradable polymeric implant, or implanted device for sustained, slow release.
In some examples, the composition is formulated for controlled delivery thereof.
In the context of the present disclosure, it is to be understood that "controlled delivery" denotes any one of slow release, delayed release, immediate/burst release, triggered release, and any other controlled delivery form as known to those versed in the pharmaceutical art.
In some embodiments, the delivery system is one or more of liposome, niosome, microsponge, microemulsion, microsphere, solid lipid nanoparticles (SLN), aerosol or combination thereof. In the context of the present disclosure, it is to be understood that a "pharmaceutically acceptable carrier" means a carrier that is useful in preparing a composition or formulation that is generally safe, non-toxic and neither biologically nor otherwise undesirable. The carrier is one that is acceptable for use on a living body, preferably mammals (humans and non-humans).
Some examples of suitable carriers or excipients for delivery of the combination disclosed herein include, without being limited thereto, polylactic acid (PLA), poly-lactic-co-glycolic acid (PLGA), polyvinyl alcohol (PVA), polyethyleneimine (PEI), lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose.
The composition can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl-and propylhydroxy-benzoates; sweetening agents; and flavoring agents.
In some examples, the composition is formulated for injection. In some examples, the composition is formulated for intravenous (IV) injection, intramuscular (IM) injection.
In some examples, the pharmaceutical composition is formulated for topical (local) application/ administration e.g., for topical delivery, to the eye, e.g., as eye drops, or eye ointment and by local/intravitreal or suprachoroidal injection. As used herein the term "topical administration", or "topical application", means directly laying on or spreading on an eye tissue, especially a cornea, or on tissues surrounding the eye. The topically administrable compositions may be formulated into a suitable formulation or composition with at least one carrier.
The at least one carrier may be selected from powders, oils, creams, foams, ointments, lotions, gels, pastes, mousiness, hydrogels or combination thereof. In some other embodiment, the composition is in the form of a solution, a suspension, a paste, a cream, a foam, gel or an ointment. In some embodiment, the composition is an ocular solution or an ocular suspension. In some embodiment, the composition is an aqueous solution or an aqueous suspension. In some embodiment, the composition is in the form of eye drops, eye spray or eye cream.
In some embodiments, the composition is in the form of eye drops of a suspension or solution. In some embodiments, the composition is applied to the eye in a form of topical drop. The eye drops may be in isotonic, pH-adjusted, sterile saline. Administration of the eye drops into the eye may be using a dropper, or a container with a dropper nozzle or a tube with a nozzle.
In some embodiments, the composition is an ocular solution. The term solution as used herein encompasses a range of viscosities, ranging from low viscosity solution to high viscosity solutions (forming a gel-like solution).
The pH of ocular composition is an important feature for controlling for example the ocular acceptability of the composition and the absorption of the compound across the cornea. Ideally the pH of the composition should be adjusted to maximize the chemical stability and/or absorption of the compounds (the first compound and the second compound). In some embodiments, the pH of the ocular composition is about 7.4 as this is the pH of tear fluid.
The pharmaceutical compositions may be used to treat subjects in need thereof according to the invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general formulations are prepared by uniformly and intimately bringing into association the active ingredients, specifically, the SMC modulator with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. The pharmaceutical compositions of the present invention also include, but are not limited to, emulsions and liposome-containing formulations.
It should be understood that in addition to the ingredients particularly mentioned above, the formulations may also include other agents conventional in the art having regard to the type of formulation in question.
In addition, the composition/s of the invention and any components thereof may be applied as a single daily dose or multiple daily doses.
As suggested, the SMC modulator of the present disclosure and/or pharmaceutical compositions comprising the same, may be used in various methods as described herein.
According with some aspects of the present disclosure, it is provided a method of inhibiting Müller cell activation in a subject in need thereof. The method comprises the step of contacting the cell with an effective amount of at least one SMC modulator as described herein.
According with According with some aspects of the present disclosure, it is provided a method of modulating activity of CCR1 in a Müller cell in a subject in need thereof. The method comprises the step of contacting the cell with an effective amount of at least one SMC modulator as described herein.
According with some other aspects of the present disclosure, it is provided a method of inhibiting Müller cell activation in a subject in need thereof. The method comprises the step of contacting the with an effective amount of at least one SMC modulator, wherein said SMC modulator inhibits CCR1 activity in the Müller cell.
According with some further aspects of the present disclosure, it is provided a method of inhibiting retinal damage. Specifically, the present disclosure provides a method for reducing loss of photoreceptor cell and/or inhibiting Müller cell activation. The method may comprise in some embodiments the step of contacting a cell the with an effective amount of at least one SMC modulator as described herein. In some embodiments, the SMC modulator inhibits CCR1 activity in the Müller cell.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure is is represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments which can be considered as aspect of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure is a compound represented by formula I (denoted herein SMC 1) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
The term "contacting" means to bring, put, incubates or mix together. As such, a first item is contacted with a second item when the two items are brought or put together, e.g., by touching them to each other or combining them. In the context of the present invention, the term "contacting" includes all measures or steps which allow interaction between the at least one SMC modulator and a cell, being in accordance with some embodiments a Müller cell.
The methods of the invention may be in vitro methods, ex vivo methods and/or in vivo methods.
In some embodiments, the method is an in vitro method.
In some other embodiments, the method is an in in vivo method.
In some embodiments, the method is an ex vivo method.
As shown herein, the at least one SMC modulator (being in some examples a compound denoted as SMC 1) was found to be effective at different animal (mice) models in which retina damage was induced or present and hence is considered to be useful for various retinal diseases.
In some examples, the method is for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of one or more retinal disease.
According to some aspects of the present disclosure it is provided a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease in a subject in need thereof, the method comprises administering to the subject a therapeutically effective amount of at least one SMC modulator or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
As shown in the Examples below, it was suggested that inhibiting activation of Müller cells as well as the recruitment of neurotoxic macrophages to the retina and the functional modulation of M2a hMdɸs by suitable SMCs may be used for treating a variety of retinal disease.
In some embodiments, which can be considered as aspects of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease in a subject in need thereof, is represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, which can be considered as aspects of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease in a subject in need thereof, is represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, which can be considered as aspects of the present disclosure, the at least one SMC modulator applicable by the methods of the present disclosure for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease in a subject in need thereof, is a compound represented by formula I (denoted herein SMC 1).
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying an inherited retinal degeneration (IRD) disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula XI, XII, XIII or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying an inherited retinal degeneration (IRD) disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying an inherited retinal degeneration (IRD) disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying IRD disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying one or more of macular dystrophies, retinitis pigmentosa (RP) and allied disorders, abnormalities of rod and cone function, hereditary vitreoretinal degeneration, hereditary choroidal dystrophies. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying one or more of macular dystrophies, retinitis pigmentosa (RP) and allied disorders, abnormalities of rod and cone function, hereditary vitreoretinal degeneration, hereditary choroidal dystrophies comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying one or more of macular dystrophies, retinitis pigmentosa (RP) and allied disorders, abnormalities of rod and cone function, hereditary vitreoretinal degeneration, hereditary choroidal dystrophies comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying retinitis pigmentosa (RP). In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RP comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RP comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying a retinal vascular disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a retinal vascular disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a retinal vascular disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying a retinal vascular disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a retinal vascular disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a retinal vascular disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying diabetic retinopathy. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying diabetic retinopathy comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a diabetic retinopathy disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying a choroidal vascular disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a choroidal vascular disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a choroidal vascular disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying a choroidal vascular disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a choroidal vascular disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying a choroidal vascular disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying dry AMD. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying dry AMD comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying dry AMD comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying an inflammatory disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying an inflammatory disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying an inflammatory disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying an inflammatory disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying an inflammatory disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying an inflammatory disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying retinal detachment disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying retinal detachment disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying retinal detachment disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by at least one of Formula I, II, III, IV, V, VI, VII, VIII, IX, X or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying retinal detachment disease. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying retinal detachment disease comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying retinal detachment disease comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the methods of the invention may be applicable for treating, inhibiting, arresting or delaying RRD. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RRD comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RRD comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the method of the invention may be applicable for treating, inhibiting, arresting or delaying exudative retinal detachment. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying exudative retinal detachment comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RRD comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying exudative retinal detachment comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the method of the invention may be applicable for treating, inhibiting, arresting or delaying RTD. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RTD comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying RTD comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
In some embodiments, the method of the invention may be applicable for treating, inhibiting, arresting or delaying glaucoma. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying glaucoma comprises administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by formula I or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof. In some embodiments, the methods of the invention for treating, inhibiting, arresting or delaying glaucoma comprises topically administering to the subject in need thereof a therapeutically effective amount of at least one SMC modulator represented by Formula I, or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof or any combinations thereof.
When used in the context of a chemical group: "hydroxy" means −OH; halogen means independently −F, −Cl, −Br or −I. In the context of chemical formulas, the symbol "−" means a single bond, "=" means a double bond. When a variable is depicted as a "floating group" on a ring system, for example, the group "R" in the formula: R , then the variable may replace any hydrogen atom attached to any of the ring atoms, including a depicted, implied, or expressly defined hydrogen, so long as a stable structure is formed.
The term "alkyl" refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups −CH 3 (Me), −CH 2CH3 (Et), −CH 2CH 2CH 3 (n-Pr or propyl), −CH(CH 3) 2 (i-Pr, iPr or isopropyl), −CH 2CH 2CH 2CH (n-Bu), −CH(CH 3)CH2CH3 (sec-butyl), −CH 2CH(CH3)2 (isobutyl), −C(CH 3)3 (tert-butyl, t-butyl, t-Bu or tBu), and −CH 2C(CH3)3 are non-limiting examples of alkyl groups.
Hydroxy alkyl as used herein refers to a linear monovalent hydrocarbon radical of one or more carbon atoms or a branched monovalent hydrocarbon radical of three to six carbons substituted with one or two hydroxy groups, provided that if two hydroxy groups are present, they are not both on the same carbon atom.
As described herein, the SMC modulator, compositions comprising the SMC, methods, may be applicable using an effective amount such that the methods of the invention involve the administration of a therapeutically effective amount of at least one SMC modulator. The term "effective amount" or "therapeutically effective" for purposes disclosed herein indicates that the amount of formulation is effective to treat, inhibit or delay one or more symptoms of a disease as described herein. Specifically, such terms relate to the amount of an active agent present in a composition, that is needed to provide a desired level of active agent in the bloodstream or at the site of action in an individual to be treated to give an anticipated physiological response when such composition is administered. The precise amount will depend upon numerous factors, e.g., the active agent, the activity of the composition, the delivery device employed, the physical characteristics of the composition, intended patient use (i.e., the number of doses administered per day), patient considerations, and the like, and can readily be determined by one skilled in the art, based upon the information provided herein. As used herein, an "effective amount" of the at least one SMC modulator in the composition of the present invention is meant any amount effective for the inhibitory effect on Muller cell activation, and/or photoreceptor cell death and/or therapeutic effect on any of the disclosed retinal disease as disclosed herein.
"Expression", as used herein generally refers to the process by which gene-encoded information is converted into the structures present and operating in the cell. Therefore, according to the invention "expression" of a gene, specifically, may refer to transcription into a polynucleotide, translation into a protein, or even posttranslational modification of the protein. Protein stability, as used herein, refers to the physical (thermodynamic) stability, and chemical stability of the protein and relates to the net balance of forces, which determine whether a protein will be in its native folded conformation or a denatured state. More specifically, the levels of proteins within cells are determined not only by rates of synthesis as discussed above, but also by rates of degradation and the half-lives of proteins within cells that vary widely, from minutes to several days. In eukaryotic cells, two major pathways mediate protein degradation, the ubiquitin-proteasome pathway, mentioned herein before, and lysosomal proteolysis. "Expression", as used herein generally refers to the process by which gene-encoded information is converted into the structures present and operating in the cell. Therefore, according to the invention "expression" of a gene, specifically, may refer to transcription into a polynucleotide, translation into a protein, or even posttranslational modification of the protein. Protein stability, as used herein, refers to the physical (thermodynamic) stability, and chemical stability of the protein and relates to the net balance of forces, which determine whether a protein will be in its native folded conformation or a denatured state. More specifically, the levels of proteins within cells are determined not only by rates of synthesis as discussed above, but also by rates of degradation and the half-lives of proteins within cells that vary widely, from minutes to several days. In eukaryotic cells, two major pathways mediate protein degradation, the ubiquitin-proteasome pathway, mentioned herein before, and lysosomal proteolysis.
As noted herein, the present disclosure relates to at least one small molecule compound. A small molecule as used herein may encompass at least one of solvate, a hydrate, a stereoisomer, a pharmaceutically acceptable prodrug, a pharmaceutically active metabolite, a pharmaceutically acceptable salt, a crystalline form, an amorphous form, a physiologically functional derivative. Specifically, a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
The term "pharmaceutically acceptable salt" refers to salts derived from organic and inorganic acids of a compound described herein. Exemplary salts include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride, hydrochloride, bromide, hydrobromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, napthalenesulfonate, propionate, succinate, fumarate, maleate, malonate, mandelate, malate, phthalate, and pamoate. The term "pharmaceutically acceptable salt" as used herein also refers to a salt of a compound described herein having an acidic functional group, such as a carboxylic acid functional group, and a base. Exemplary bases include, but are not limited to, hydroxide of alkali metals including sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxyl-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-(C 1-C 6)-alkylamine), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like. The term "pharmaceutically acceptable salt" also includes hydrates of a salt of a compound described herein.
The term "solvate" refers to an aggregate of a molecule with one or more solvent molecules, such as hydrate, alcoholate (aggregate or adduct with alcohol), and the like.
The term "hydrate" refers to a compound formed by the addition of water. The hydrates may be obtained by any known method in the art by dissolving the compounds in water and recrystallizing them to incorporate water into the crystalline structure.
The term "stereoisomer" as used herein encompasses an "enantiomer", the enantiomer refers to a compound that is superposable with respect to its counterpart only by a complete inversion/reflection (mirror image) of each other. The small molecule in accordance with the present disclosure encompass any enantiomers (i.e. R or S).
The term "physiologically functional derivative" used herein relates to any physiologically acceptable derivative of a compound as described herein. The physiologically functional derivatives also include prodrugs of the compounds of the invention. As noted herein, such prodrugs may be metabolized in vivo to a compound of the invention. These pro-drugs may or may not be active themselves and are also an object of the present invention. It should be noted that in accordance with some embodiments, the compounds defined by Formulas XI, XIa, XIb, XII, XIII may be considered as physiologically functional derivative of the SMC modulator of Formula I denoted herein as SMC 1.
The term "derivative" in accordance with the small molecule of the present invention also encompasses chemically modified small molecule derived from a parent compound of the invention that differs from the parent compound by one or more elements, substituents and/or functional groups such that the derivative has the same or similar biological properties/activities as the parent compound.
The term "prodrug" or "pharmaceutically acceptable prodrug" as used herein refers to a compound that may be converted under physiological conditions to the specified compound or to a pharmaceutically acceptable salt of such compound. Prodrugs may be useful for facilitating the administration of a parent drug.
The term "metabolite" or "pharmaceutically acceptable metabolite" as used herein refers to a compound that is formed under physiological conditions to of degrading and eliminating the compounds. Oxidative metabolite may be an example.
A crystalline and/or amorphous forms of the small compounds described herein include, for example, polymorphs, pseudopolymorphs, solvates, hydrates, unsolvated polymorphs (including anhydrates), conformational polymorphs, and amorphous forms of the compounds, as well as mixtures thereof.
As used herein, "disease", "disorder", "condition" and the like, as they relate to a subject's health, are used interchangeably and have meanings ascribed to each and all of such terms. It is understood that the interchangeably used terms "associated" and "related", when referring to pathologies herein, mean diseases, disorders, conditions, or any pathologies which at least one of: share causalities, co-exist at a higher than coincidental frequency, or where at least one disease, disorder, condition or pathology causes a second disease, disorder, condition or pathology.
As noted above, the invention provides methods for treating disorders specified above. The term "treatment" as used herein refers to the administering of a therapeutic amount of the formulation of the present invention which is effective to improve one or more undesired symptoms associated with a disease or condition as described herein.
As used herein, the term "subject" refers to a living organism that is treated with the formulation as described herein, including, but not limited to, any mammal, such as a human.
The terms "inhibition", "moderation", "reduction" or "attenuation" as referred to herein, relate to the reduction for example in expression/level/stability of CCR1 activity or CCR1 expression in Müller cell or Müller cell activation or at least one CC chemokine by any one of about 1% to 99.9%, specifically, about 1% to about 5%, about 5% to 10%, about 10% to 15%, about 15% to 20%, about 20% to 25%, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 75% to 80%, about 80% to 85% about 85% to 90%, about 90% to 95%, about 95% to 99%, or about 99% to 99.9% as compared to a suitable control.
As used herein, the forms "a", "an" and "the" include singular as well as plural references unless the context clearly dictates otherwise. For example, the term "an antagoist" includes one or more antagoionst.
Further, as used herein, the term "comprising" is intended to mean that the composition include the recited components, e.g. at least one SMC modulator.
"Consisting of" shall thus mean excluding more than trace amounts of other components. Embodiments defined by each of these transition terms are within the scope of this invention.
Further, all numerical values, e.g. when referring the amounts or ranges of the components constituting the film or food product, are approximations which are varied (+) or (-) by up to 20%, at times by up to 10% of from the stated values. It is to be understood, even if not always explicitly stated that all numerical designations are preceded by the term "about".
It should be noted that various embodiments of this invention may be presented in a range format. The description of a range should be considered to have specifically disclosed all the possible sub ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 or between 1 and should be considered to have specifically disclosed sub ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6.
It should be further noted that the various embodiments and examples detailed herein in connection with various aspects of the invention may be applicable to one or more aspects disclosed herein. It should be further noted that any embodiment described herein, for example, related to components of the food ingredient, may be applied separately or in various combinations. Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. The phrases "in another embodiment" or any refence made to embodiment as used herein do not necessarily refer to different embodiment, although it may. Thus, various embodiments of the invention can be combined (from the same or from different aspects) without departing from the scope of the invention.
The invention will now be exemplified in the following description of experiments that were carried out in accordance with the invention. It is to be understood that these examples are intended to be in the nature of illustration rather than of limitation. Obviously, many modifications and variations of these examples are possible in light of the above teaching. It is therefore, to be understood that within the scope of the appended claims, the invention may be practiced otherwise, in a myriad of possible ways, than as specifically described hereinbelow.
NON-LIMITING EXAMPLES Materials and Methods Mice Mice used in these studies were purchased from Jackson laboratory, (Bar Harbor, ME, US).
Patients A total of 33 patients with AMD (14 women and 19 men) 77.1 ± 3 years of age (range: 63-95 years) were recruited at the Retina Clinic in the Department of Ophthalmology at the Hadassah-Hebrew University Medical Center in Jerusalem, Israel. The criteria for establishing a diagnosis of AMD included >55 years of age and clinical findings of intermediate or advanced AMD in accordance with the 19AREDS (Age-Related Eye Disease Study) criteria (Age-Related Eye Disease Study Research 1999). Moreover, eyes with high myopia (>6 diopters), trauma, other retinal disease, and/or uveitis were excluded. Further, patients who presented with a major systemic illness such as cancer, autoimmune disease, congestive heart failure, and/or uncontrolled diabetes were excluded. All participating patients provided written informed consent, and the study was approved by our institutional ethics committee.
Preparation of monocytes and macrophages Whole blood samples (30 ml) were collected from patients with AMD in EDTA tubes (BD Biosciences, Franklin Lakes, NJ). Monocytes were then isolated from these whole blood samples using negative selection as described previously (Grunin et al, 2012). In brief, PBMCs were separated from the whole blood using a Histopaque-Ficoll gradient (Sigma-Aldrich, Munich, Germany) and washed twice by centrifugation at 1500 rpm for 10 minutes to remove the platelets; live cells were counted using a hemocytometer with the trypan blue exclusion method. Total blood monocytes, including CD14++CD16- and CD14+CD16+ monocytes, were then isolated using the EasySep negative selection kit (Stemcell Technologies, Vancouver, Canada) in accordance with the manufacturer’s instructions.
To prepare macrophages, PBMCs were isolated from the whole blood samples as described above, stimulated with M-CSF (macrophage colony-stimulating factor; PeproTech, Rocky Hill, NJ) to produce non-activated (M0) macrophages, and then activated with either IFN-γ and LPS (to produce M1 hMdɸs), IL-4 and IL-13 (to produce M2a hMdɸs), or IL-10 (to produce M2c macrophages) as previously described (Mantovani et al. 2002; Fernando O Martinez 2009). In brief, PBMCs were suspended in RPMI 1640 medium (Biological Industries, Kibbutz Beit-Haemek, Israel) and seeded at 3x10 cells/cm in 6-well plates. The monocytes were then incubated at 37°C in 5% CO 2 for 2 hours, washed with phosphate-buffered saline (PBS), and then cultured for 7 days in RPMI 1640 supplemented with 10% (v/v) fetal calf serum (FCS), 1% non-essential amino acids, 2 mmol/L L-glutamine, 1 mM sodium pyruvate, 1units/ml penicillin, 100 µg/ml streptomycin, and 50 ng/ml M-CSF; M-CSF was included in the growth medium to drive maturation of the monocytes into macrophages. M1 hMdɸs were obtained by the addition of 20 ng/ml IFN-γ (PeproTech) and 100 ng/ml LPS (Sigma-Aldrich) on day 6, M2a hMdɸs were obtained by the addition of 50 ng/ml IL-13 (PeproTech) and 20 ng/ml IL-4 (PeproTech) on day 5, and M2c hMdɸs were obtained by the addition of 50 ng/ml IL-10 (PeproTech) on day 5. hMdɸ cells that were not activated were classified as unpolarized HMdɸs (M0). M1 macrophages require 24 hours for polarization, whereas M2a and M2c cells require hours; therefore, the hMdɸs were polarized on different days so that the in vitro and in vivo experiments could be performed on the same day.
Macrophage co-cultures with mouse retinal explants The various groups of polarized hMdɸs were harvested and seeded for a minimum of 2 hours on a polycarbonate filter in serum-free DMEM (Biological Industries) supplemented with glutamine and penicillin-streptomycin. In parallel, C57BL/6 mice (n=9) were anesthetized and euthanized via cervical dislocation. Both eyes (n=18) were then enucleated and placed in cold serum-free DMEM supplemented with glutamine and penicillin-streptomycin. The retinas were gently detached from the choroid tissue and immediately placed on the polycarbonate filter so that the hMdɸs were in contact with the photoreceptor layer. For retinal explants cultivated without direct contact with hMdɸs (n=18), 10 hMdɸs were seeded in the bottom well of a Boyden chamber, and the explant was placed in the upper chamber. After incubation for 18 hours, the mouse retinas were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature (RT) and then permeabilized for 30 min on ice in methanol, followed by 30 min on ice in a 2:1 mixture of methanol/acetone. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was then performed using an In Situ Cell Death Detection Kit, TMR red (La Roche, Basel, Switzerland) in accordance with the manufacturer’s instructions. For rhodopsin and RPE65 immunostaining, retinal explants were incubated with either mouse anti-rhodopsin (10 µg/ml; ab3267, Abcam, Cambridge, UK) or mouse anti-RPE65 (µg/ml; ab13826, Abcam) overnight at 4°C, washed, and then incubated with donkey anti-mouse IgG-Alexa Fluor 488 (Abcam) for 1 hour at RT. A Zeiss LSM 710 confocal microscope was used to visualize the TUNEL-stained cells in 11 randomly selected retinal fields.
Reverse transcription and real-time quantitative PCR (qPCR) RNA was extracted from isolated hMdɸs and retina samples using TRIzol Reagent (Sigma-Aldrich) in accordance with the manufacturer’s instructions. The RNA quality and quantity were measured using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA) and a bioanalyzer (Agilent Technologies, Santa Clara, CA), and RNA was reverse transcribed to create cDNA using the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA) in accordance with the manufacturer’s instructions. qPCR was then performed using the PerfeCTa SYBR Green FastMix kit (Quantabio); the gene-specific primers (Sigma-Aldrich) used in this study are listed in Table 1 . Each gene was amplified in triplicate, and the expression level of each gene was normalized to human GAPDH or mouse Gapdh as an endogenous control using the standard 2(ΔΔCT) method. Table 1List of gene-specific primers Gene Forward (5’-3’) Reverse (5’-3’)human GAPDH AACAGCCTCAAGATCATCAGC (SEQ ID NO:3) GGATGATGTTCTGGAGAGCC (SEQ ID NO:4) human CXCL GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO:5) GTCCATCCTTGGAAGCACTGCA (SEQ ID NO:6) Gene Forward (5’-3’) Reverse (5’-3’)human CCL17 AGGGATGCCATCGTTTTTGTAA (SEQ ID NO:7) GCTTCAAGACCTCTCAAGGCT (SEQ ID NO:8) human CD163 CAGTGCAGAAAACCCCACAA (SEQ ID NO:9) AAAGGATGACTGACGGGATGA (SEQ ID NO:10) human MCP4 ATCTCCTTGCAGAGGCTGAA (SEQ ID NO:11) CTTCTCCTTTGGGTCAGCAC (SEQ ID NO:12) human MPIF1 TTTGAAACGAACAGCGAGTG (SEQ ID NO:13) CAGCATTCTCACGCAAACC (SEQ ID NO:14) human HCC1 ATACAGCTAAAGTTGGTGGGGG (SEQ ID NO:15) TGGTGATGAAGACAATTCCGGG (SEQ ID NO:16) human CCR1 AAGTCCCTTGGAACCAGAGAGAAG (SEQ ID NO:17) CCAACCAGGCCAATGACAAA (SEQ ID NO:18) mouse Gapdh AACTTTGGCATTGTGGAAGG (SEQ ID NO:19) ACACATTGGGGGTAGGAACA (SEQ ID NO:20) mouse Ccr1 GTTGGGACCTTGAACCTTGA (SEQ ID NO:21) CCCAAAGGCTCTTACAGCAG (SEQ ID NO:22) mouse Ccr2 GAAGAGGGCATTGGATTCAC (SEQ ID NO:23) TATGCCGTGGATGAACTGAG (SEQ ID NO:24) mouse Ccr5 TCTCCTAGCCAGAGGAGGTG (SEQ ID NO:25) TGTCATAGCTATAGGTCGGAACTG (SEQ ID NO:26) mouse Adgre1* GCATCATGGCATACCTGTTC (SEQ ID NO:27) AGTCTGGGAATGGGAGCTAA (SEQ ID NO:28) mouse Ccl2 AGGTCCCTGTCATGCTTCTG (SEQ ID NO:29) TCTGGACCCATTCCTTCTTG (SEQ ID NO:30) mouse Cxcl1 GACCATGGCTGGGATTCACC (SEQ ID NO:31) CCAAGGGAGCTTCAGGGTCA (SEQ ID NO:32) mouse Cxcl10 CATCCCTGCGAGCCTATCC (SEQ ID NO:33) CATCTCTGCTCATCATTCTTTTTCA (SEQ ID NO:34) mouse Vimentin TGCGAGAGAAATTGCAGGA (SEQ ID NO:35) GTGCCAGAGAAGCATTGTCA (SEQ ID NO:36) *Encodes the F4/80 protein, also known as EMR1 (EGF-like module-containing mucin-like hormone receptor-like 1).
Photo-oxidative retinal injury and intravitreal injections Albino BALB/c mice that were homozygous for the wild-type Crb1, Gnat2, and Rpe65 genes were used for this study. Photic injury was induced essentially as described previously (Grimm et al. 2013), with optimization to ensure an approximately 50% reduction in outer nuclear layer (ONL) thickness as previously described (Elbaz-hayoun et al, 2019). In brief, after 1 hour of dark adaptation, 6-week-old BALB/c mice raised under a standard light/dark cycle were exposed to 8000 lux of white light for 3 hours. Photic injury was then induced as follows, according to the appropriate circadian rhythm: the pupils were dilated with Cyclogyl (one drop per eye, Sandoz Farmaceutica S.A., Madrid, Spain) and 5% phenylephrine (Fisher Scientific, Tel Aviv, Israel) at 9:30 am under a red light; the light level was adjusted at 9:45 am, and photic injury was induced for 3 hours (from 10:00 am to 1:00 pm), during which the mice were placed in a cage (maximum two mice per cage) lined with aluminum foil, and the temperature was maintained below 30°C.
Immediately after photic injury, the mice received an intravitreal injection of either human monocytes or hMdɸs that were labeled with the Vybrant DiO tracer (Invitrogen-Molecular Probes, Carlsbad, CA), and then returned to the standard light/dark cycle. For these experiments, the intravitreal route was chosen over the subretinal route in order to avoid triggering an immune response due to RPE immunogenicity and the potentially higher risk of RPE and/or Bruch’s membrane breakthrough; moreover, intravitreal injection allows the injected cells to distribute across the entire retina, creating a wider and less-biased effect on ONL thickness. For each mouse, 10 human monocytes or hMdɸs suspended in PBS were injected into the right eye, while the left eye received an injection of PBS as a control. As an additional control, some mice were not exposed to light and did not receive an intravitreal injection of monocytes or hMdɸs. An antibiotic ointment (5% chloramphenicol) was applied after each intravitreal injection.
CCR1 blocking treatment Immediately after photic injury was induced, the mice received subcutaneous injections of either the CCR1-specific antagonist BX471 (50 mg/kg body weight; Tocris, Bristol, UK) or vehicle (40% cyclodextrin in saline) every 12 hours for 7 days. For injection, BX471 was dissolved at a final concentration of 10 mg/ml in saline containing 40% (w/v) cyclodextrin (Sigma-Aldrich); the solution was mixed thoroughly and dissolved overnight at 4°C, after which the pH was adjusted to 4.5 with NaOH, and the solution was filtered through a 0.45-µm filter.
Electroretinography recording and in vivo retinal imaging Seven days after photic injury, the pupils were dilated with tropicamide (Fisher Scientific) and phenylephrine (Fisher Scientific), and the corneas were kept moist by application of carboxymethylcellulose (Fisher Scientific). Retinal images were obtained using a Spectralis Optical Coherence Tomography device and a Micron III retinal microscope (Phoenix Research Labs, San Francisco, CA). Blue autofluorescence images were obtained using an excitation wavelength of 488 nm, and full-field electroretinography (ERG) was performed in dark-adapted mice. During ERG recording, the eyes were anesthetized with oxybuprocaine hydrochloride drops (Fisher Scientific). All procedures were performed in dim red lighting or in total darkness, and the mice were kept warm throughout the recording. During the recording, the mouse was positioned facing the center of a Ganzfeld bowl, ensuring equal, simultaneous illumination of both eyes. ERG data were recorded inside a Faraday cage using an Espion computerized system (Diagnosys LLC, Littleton, MA). Dark-adapted ERG responses to a series of white flashes at increasing intensity (from 0.000006 to 9.6 cd·sec/m) were recorded at inter-stimulus intervals increasing from sec (for the lowest-intensity flashes) to 90 sec (for the highest-intensity flashes). Light adaptation was performed using a background illumination of 30 cd/m. For analysis, the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave.
Immunohistochemistry Seven days after photic injury, the mice were euthanized, the eyes were enucleated and sectioned at 10 µm using a cryostat, and the sections were immunostained as previously described (Hagbi-Levi et al. 2016). In brief, the eyes were fixed in 4% PFA for 2 hours and then placed in 30% sucrose overnight at 4°C. The eyes were then placed in optimal cutting temperature (OCT) compound (Scigen Scientific, Gardena CA), and 10 µm sections were cut and placed in blocking solution (PBS containing 10% serum and 0.1% Triton X-100) for 1 hour at RT. The sections were then incubated in primary antibody overnight at 4°C; the following day, the sections were incubated in secondary antibody for 1 hour at RT. The nuclei were counterstained with DAPI, and the sections were visualized using a fluorescence microscope. For hMdɸ labeling, after polarization the cells were washed once with PBS and then fixed with 4% PFA for 30 min at RT; after three washes with PBS, the cells were incubated in blocking solution and immunostained with primary and secondary antibodies as described above.
The following primary antibodies were used for these experiments: rabbit anti-hydroxynonenal (HNE) antibody (10 µg/ml; ab46545, Abcam), rat anti-cd11b antibody (0.5 µg/ml; ab64347, Abcam), mouse anti-human CCR1 (25 µg/ml; mab145, R&D Systems, Minneapolis, MN), rat anti-mouse CCR1 (25 µg/ml; mab5986, R&D Systems), rat anti-mouse-CCR5 (10 µg/ml; ab11466, Abcam), rabbit anti-mouse CCR2 (5 µg/ml; NBP2-67700, Novus Biologicals, Littleton, CO), rabbit anti-mouse GFAP (0.5 µg/ml; ab64347, Abcam), and rabbit anti-mouse Iba1 (5 µg/ml; ab153696, Abcam). The following secondary antibodies were used: donkey anti-mouse IgG-Alexa Fluor 488 (ab150109; Abcam), donkey anti-rat IgG-Alexa Fluor 555 (ab150154; Abcam), and goat anti-rabbit IgG-Alexa Fluor 488 (ab150085; Abcam). TUNEL staining was performed using the In Situ Cell Death Detection Kit, TMR red (La Roche, Basel, Switzerland) in accordance with the manufacturer’s instructions.
To measure the thickness of the ONL, the sections were stained with DAPI and the number of photoreceptor nuclei was counted at fixed distances from the optic nerve head (ONH).
Measurement of reactive oxygen species (ROS) Human hMdɸs were cultured in 6-well plates for 6 days and polarized as described above. To block CCR1, 0.5 µM or 5 µM BX471 was added to M2a hMdɸ cultures for 1 hour at 37°C. ROS production was measured using the DCFDA Cellular ROS Detection Assay (ab113851; Abcam) and a fluorescence microplate reader (Tecan Group, Männedorf, Switzerland) in accordance with the manufacturers’ instructions.
Multiplex ELISA assay After the macrophages were polarized (see above), the culture medium was collected and stored at −80°C. A panel of 120 cytokines was then measured in the culture medium using the Human Cytokine Array GS2000 (RayBiotech Life, Inc., Norcross, GA) in accordance with the manufacturer’s instructions.
In vitro migration assay CD14++CD16- and CD14+CD16+ monocytes were isolated as described above, and their migration was measured using a 24-well Boyden chamber assay (Corning, 5-µm pore size). In brief, conditioned medium obtained from 10 M1 hMdɸs or 10 M2a hMdɸs was harvested, centrifuged to remove cell debris, and placed in the bottom chamber of the plate. Next, 1.2x10 previously isolated monocytes suspended in 1µl RPMI with 1% FCS were placed in the upper chamber.
To determine the effect of blocking CCR1 on monocyte migration, 10 M2a hMdɸs were first grown in the bottom chamber for 48 hours. The day of the experiment, fresh RPMI containing 1% FCS was used to fill the bottom chamber, and 1.2x10 previously isolated monocytes that were pretreated for 1 hour with either µM BX471 or vehicle were placed in the upper chamber containing 100 µl RPMI with 1% FCS. After incubation for 2 hours at 37°C, the monocytes that migrated to the bottom chamber were measured using FACS analysis.
Flow cytometry To evaluate the effect of polarized hMdɸs on photoreceptor apoptosis in vitro, retinal explants that were either in contact with or not in contact with polarized hMdɸs were fixed, TUNEL stained as described above, and digested using a homogenizer in 500 ml PBS containing 100 mg/ml collagenase/dispase (10-269-638; La Roche). Samples (100 ml each) were then placed in tubes, washed twice with 2 ml FACS washing buffer containing 0.5% (w/v) BSA in PBS, and centrifuged at 1500 g for min to collect the cells. The cells were then filtered through a 60-micron mesh, and fluorescence intensity was immediately read using an LSR-II flow cytometer (BD Biosciences, Franklin Lakes, NJ) in accordance with the manufacturer’s instructions.
To measure the level of CCR1 expression in M1 and M2a hMdɸs, the cells were fixed in 4% PFA for 20 min at RT and washed twice with PBS. The cells were then stained with mouse anti-human CCR1 antibody (2.5 µg/10 cells; mab145, R&D Systems) for 20 min at RT, followed by donkey anti-mouse IgG-Alexa Fluor 4antibody (1 µg/ml; ab150109, Abcam) for 20 min in the dark at RT. Each sample was then washed twice with PBS containing 0.5% (w/v) BSA and centrifuged at 1500 rpm for 5 minutes to collect the cells. The cells were then filtered through a 60-micron mesh, and fluorescence intensity was immediately read using an LSR-II flow cytometer (BD Biosciences) in accordance with the manufacturer’s instructions.
In vivo retinal imaging At 15 months, the retinal structure of C57BL/6 wild type mice, Ccr1 wild type, Crb1rd8 mice and in Ccr1 knockout, Crb1rd8 mice was examined using FAF imaging. To the end mice were anesthetized, the pupils were dilated with Cyclogyl (one drop per eye, Sandoz Farmaceutica S.A., Madrid, Spain) and the corneas were kept moist by application of carboxymethylcellulose (Fisher Scientific). Retinal images were obtained using a Spectralis Optical Coherence Tomography device and a Micron III retinal microscope (Phoenix Research Labs, San Francisco, CA).
CCR1 blocking treatment in rd10 mice At postnatal day 21 (P21), rd10 mice received subcutaneous injections of either the CCR1-specific antagonist BX471 (50 mg/kg body weight; Tocris, Bristol, UK) or vehicle (40% cyclodextrin in saline) every 8 hours for 4 days. For injection, BX471 was dissolved at a final concentration of 10 mg/ml in saline containing 40% (w/v) cyclodextrin (Sigma-Aldrich); the solution was mixed thoroughly and dissolved overnight at 4°C, after which the pH was adjusted to 4.5 with NaOH, and the solution was filtered through a 0.45-µm filter. Full-field electroretinography (ERG) measurements were recorded before the first administration of the treatment and five days after it. To that end, the mice were placed in dark adaptation overnight. During ERG recording, the mice were anesthetized, their pupils were dilated with tropicamide (Fisher Scientific) and phenylephrine (Fisher Scientific), and the corneas were kept moist by application of carboxymethylcellulose (Fisher Scientific). All procedures were performed in dim red lighting or in total darkness, and the mice were kept warm throughout the recording. During the recording, the mouse was positioned facing the center of a Ganzfeld bowl, ensuring equal, simultaneous illumination of both eyes. ERG data were recorded inside a Faraday cage using an Espion computerized system (Diagnosys LLC, Littleton, MA). Dark-adapted ERG responses to a series of white flashes at increasing intensity (from 0.000006 to 9.6 cd·sec/m) were recorded at inter-stimulus intervals increasing from 10 sec (for the lowest-intensity flashes) to 90 sec (for the highest-intensity flashes). For analysis, the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave.
Electroretinography recording in rd10 mice and rd10 mice with Ccr1 deletion ERG recording was performed at P21 in rd10 mice and in rd10 mice with Ccrdeletion. ERG procedure was the described above.
Statistical analysis The appropriate statistical tests were used based on the results of a test for normalcy and the sample distribution and parameters. The biostatistical software package InStat (GraphPad Software, San Diego, CA) was used for data analysis. Data were analyzed using a one-way ANOVA followed by the Turkey-Kramer post-hoc test or an unpaired Student’s t-test, where appropriate. The results are presented as the mean fold change ± the standard error of the mean (SEM).
Results Example 1: M2a hMdɸs increase photic-induced photoreceptor degeneration Initially, it was examined whether monocytes obtained from AMD patients are either neuroprotective or detrimental to photoreceptor cells subjected to neurodegenerative conditions. To induce neurodegeneration, mice were exposed to bright light as a model of photic retinal injury (Fig. 1A).
Light exposure caused apoptotic photoreceptor cells (asterisk) and RPE cells (arrow) in the posterior retina around the optic nerve head (Fig. 1B and Fig. 1C), while cells in the peripheral retina were largely spared with relatively few apoptotic cells (arrow) in the (Fig. 1D and Fig. 1E).
Optical coherence tomography images obtained 7 days after photic injury in control (Fig. 1G) and in mice induced with photic injury (Fig. 1G). revealed a marked reduction in ONL thickness (red asterisks) in a mice induced with photic injury mouse compared to a control mouse.
Immediately after photic injury, the mice received an intravitreal injection in one eye of human monocytes derived from patients with AMD; the other eye was injected with vehicle (PBS) as a control (Fig. 1A).
Compared to the control eyes, the eyes that received an intravitreal injection of monocytes had significantly reduced/suppressed ERG b-wave amplitudes at various light intensities (Fig. 1H) and significantly increased photoreceptor cell loss per ONL thickness in the dorso-central retina ranging from -300 to -1200 microns from the ONH (Fig. 1I) as evident from the reduced number of photoreceptor nuclei +found in eyes injected with monocytes from AMD patients at different distances from the ONH.
After reaching the site of inflammation, monocytes can differentiate into a variety of macrophage subtypes; the inventors therefore attempted to identify which subtype is associated with the neurotoxicity observed in the photic-injured retina. To that end, monocytes obtained from patients with AMD were polarized into M0, M1, M2a, and M2c macrophages by stimulation with M-CSF, LPS + IFNγ, IL-4 + IL-13, or IL-10, respectively. Polarization of M0 macrophages into the appropriate activated hMdɸs was confirmed using qPCR to measure CXCL10 (a marker of M1 hMdɸs) (Yuan et al, 2015), CCL17 (a marker of M2a hMdɸs) (Hagbi-Levi et al. 2016; Mantovani et al. 2002), and CD163 (a marker of M2c hMdɸs) (Yuan et al, 2015) (Fig. 2A). In addition, each hMdɸ (M0, M1, M2a, and M2c hMdɸs) subtype displayed a distinct morphology (Fig. 2B).
When the effects of polarized hMdɸs were tested in the inventors’ photic retinal injury model, it was found that M2a hMdɸs suppressed ERG b-wave amplitude at various light intensities (Fig. 2C and Fig. 2D) and accelerated photoreceptor cell loss from -300 µm to -1200 µm from the ONH (Fig. 2E and Fig. 2F) compared to control eyes. A decrease in the number of photoreceptors nuclei was observed after adoptive transfer of M2a hMdɸ (n=8), but not of other macrophage subtypes.
In contrast, M1 hMdɸs, which have been reported as pro-inflammatory cells in other organs had no effect on ERG b-wave amplitude or ONL thinning compared to control eyes (Figs. 2C-2F). Similarly, neither M2c hMdɸs nor M0 hMdɸs affected photoreceptor cell death (Fig. 2C and Fig. 2E). As shown, the presence of DiO-positive M2a hMdɸs was observed in the ganglion cell layer (GCL).
In an attempt to explain the increased death of photoreceptors in the dorso-central retina following injection of M2a hMdɸs, after inducing photic injury, the inventors monitored the spatial distribution of the injected cells for 7 days using histology. The inventors identified the injected M2a hMdɸs by their typical elongated cell shape (Hagbi-Levi et al. 2016;) (Fig. 3B and Fig. 3D). Although most of the injected M2a hMdɸs were scattered throughout the vitreous (Fig. 3C), several of these cells migrated across the retina layers, reaching the subretinal space (Fig. 3E), with many cells present around the ONH and along the retinal vessels (Fig. 3F, Fig. 3G). Histological analysis revealed that the deleterious effects of M2a hMdɸs occurred primarily in the dorso-central region ranging from -300 µm to -1200 µm from the ONH (Fig. 2E).
A retinal flat-mount analysis and in vivo fundus autofluorescence (FAF) confirmed that the injected M2a hMdɸs were concentrated primarily in the superior part of the eye, suggesting that photoreceptor cell death was associated with the presence of M2a cells in the same part of the retina (Fig. 3H and Fig. 3I).
Example 2: M2a hMdɸs have a neurotoxic effect on retinal tissue ex vivo The in vivo experiments showed that M1 hMdɸs did not induce neurotoxicity, whereas M2a hMdɸs had a robust neurotoxic effect. To support these in vivo findings, the effect of M1 and M2a hMdɸs was compared ex vivo by co-culturing retinal explants with 10 cells for 18 hours, followed by TUNEL staining. The inventors measured the number of apoptotic photoreceptor cells in the retinal explants using confocal microscopy (Figs. 4A-4C), and performed cell sorting (Fig. 4D and Fig. 4E).
The inventors found that explants co-cultured with M2a hMdɸs had significantly more apoptotic photoreceptor cells compared to both control retinal explants (without co-cultured macrophages) and explants co-cultured with M1 hMdɸs (Fig. 4E). The inventors then determined the cell types that were affected by the M2a macrophages in the retinal explants and in choroid-RPE explants that were co-cultured with M2a hMdɸs, revealing photoreceptor cell death (Fig. 4F) and RPE cell death (Fig. 4G and Fig. 4H), respectively.
Although the injected M2a hMdɸs were observed in different retinal layers in the in vivo experiments, it is also possible that mediators released from these hMdɸs—and not necessarily direct contact with the macrophages themselves—contributed to the increase in photoreceptor cell death. To determine whether direct contact between M2a hMdɸs and photoreceptor cells is required for inducing apoptosis, the inventors examined retinal explants that were treated with cell-free hMdɸ-conditioned medium. It was found that retinal explants cultured with supernatant from M2a hMdɸs had significantly increased cell death; in contrast, culturing explants with supernatant from M1 hMdɸs had no effect (Fig. 4I). Interestingly, retinal explants co-incubated with M2a hMdɸ cells had a higher percentage of apoptosis (10%; Fig. 4E) compared to explants incubated with M2a hMdɸ‒conditioned medium (3%; p=0.028; Fig. 4I). These ex vivo results suggest that M2a hMdɸ cells have the capacity to directly affect neuronal tissues independent of the systemic inflammatory context and without the need to recruit additional cell types.
Example 3: Characterization of the neurotoxic properties of M2a hMdɸs Next, the inventors attempted to characterize the putative neurotoxic effects of M2a hMdɸs on photoreceptor cells. Macrophages are a potential source of ROS, and oxidative stress has been implicated in the progression of various retinal diseases, including AMD. To explore the role of ROS production in M2a hMdɸ‒mediated neurotoxicity, the inventors measured in vitro ROS production in M0, M1, and M2a hMdɸs and found that M2a hMdɸs release significantly more ROS compared to both M0 and M1 hMdɸs (Fig. 5A). The inventors also used HNE staining to evaluate the oxidative damage in a retinal section following photic injury and found that injection of either M1 or M2a hMdɸs was not associated with increased oxidative damage compared to control conditions (Fig. 5B and Fig. 5C). Together, these results suggest that M2a hMdɸ‒mediated neurotoxicity is driven only partially by increased ROS release from these cells.
Although the ex vivo results obtained from the inventors’ retinal explant experiments suggest that M2a hMdɸs exert a direct neurotoxic effect, additional indirect processes may also contribute to this effect in vivo. For example, the presence of M2a hMdɸs may drive the recruitment of mononuclear cells to the retina, and these cells may exert an additional neurotoxic effect. To examine this possibility, the inventors measured cells expressing CD11b-a broadly expressed integrin that serves as a marker of mononuclear phagocytes-in the choroid of photic-injured mice following an injection of either M1 or M2a hMdɸs. The inventors found that injecting M2a hMdɸs led to significantly more recruitment of CD11b+ cells to the choroid compared to injecting M1 hMdɸs (Fig. 5D and Fig. 5E). In addition, the inventors found that M2a hMdɸs and CD11b+ cells were co-localized across the ONH, suggesting the existence of crosstalk between these two cell types (Fig. 5F).
In principle, an inflammatory response may have resulted from the xenograft; however, the eye is an immune-privileged site, and the inventors previously excluded the possibility that adoptive transfer of hMdɸs causes a cross-species reaction (Hagbi-Levi et al. 2016). In addition, the inventors tested all four hMdɸ subtypes in the inventors’ xenograft model but found that only M2a hMdɸs were associated with an increased recruitment of endogenous cells. To confirm that CD11b+ cells are indeed recruited specifically by M2a hMdɸs, the inventors measured the in vitro chemotactic capacity of M1 and M2a hMdɸs on freshly isolated human monocytes. Using FACS analysis, the inventors found that chemokines released from M2a hMdɸs attracted more monocytes compared to chemokines released from M1 hMdɸs (Fig. 5G). Taken together, these results indicate that M2a hMdɸs differ from the other macrophage phenotypes with respect to their capacity to recruit additional immune cells to the site of injury and their ability to increase oxidative stress, thereby exacerbating photoreceptor cell death in the context of inflammation.
Example 4: CCR1 expression and apoptosis are increased in the retina following photic-induced damage Next, it was examined whether a cytokine-mediated interaction between M2a hMdɸs and the retinal environment underlies photoreceptor cell death. Using a multiplex cytokine array, the inventors compared the levels of 120 cytokines ( Table 2 ) between M1 hMdɸ‒conditioned medium and M2a hMdɸ‒conditioned medium.
Table 2: Levels of various cytokines in M1 hMdɸ‒ and M2a hMdɸ‒conditioned medium Protein name M1:M2a ratio P-valueCXCL13 (O43927) 75.14 0.003 CCL11 (P51671) 0.89 0.55 CCL24 (O00175) 0.54 0.02 CSF3 (P09919) 25.06 0.06 CSF2 (P04141) 0.90 0.35 CCL1 (P22362) 1.86 0.02 ICAM-1 ( P05362) 1.34 0.48 IFNg ( P01579) 1.87 0.12 IL-1a ( P01583) 0.91 0.36 IL-1b (P01584) 2.53 0.12 IL-1ra ( P18510) 0.93 0.44 IL-2 ( P60568) 0.99 0.91 IL-4 ( P05112) 0.01 3.219E-05 IL-5 (P05113) 1.21 0.25 IL-6 (P05231) 14.40 1.836E-05 IL-6sR (P08887) 0.68 0.24 IL-7 (P13232) 0.76 0.03 IL-8 (P10145) 0.84 0.26 IL-10 (P22301) 2.79 0.02 IL-11 (P20809) 1.21 0.05 IL-12p40 (P29460) 58.31 0.06 IL-12p70 ( P29459) 1.39 0.13 IL-13 ( P35225) 0.01 2.408E-05 IL-15 (P40933) 0.92 0.40 IL-16 ( Q14005) 1.18 0.36 IL-17 (Q16552) 1.05 0.35 CCL2 ( P13500) 1.09 0.27 CSF1 ( P09603) 1.95 0.05 CXCL9 (Q07325) 1.38 0.35 Protein name M1:M2a ratio P-valueCCL3 (P10147) 1.10 0.10 CCL4 (P13236) 1.03 0.80 CCL15 ( Q16663) 0.82 0.23 PDGFB (P01127) 0.65 0.04 CCL5 (P13501) 3.32 0.003 TIMP-1 (P01033) 1.05 0.39 TIMP-2 ( P16035) 0.82 0.33 TNFa (P01375) 2.74 0.27 TNFb (P01374) 0.79 0.03 TNF RI ( P19438) 0.88 0.73 TNF RII (P20333) 1.45 0.08 AREG (P15514) not detected BDNF ( P23560) 0.45 0.bFGF ( P09038) not detected BMP-4 ( P12644) 0.41 0.
BMP-5 (P22003) not detected BMP-7 ( P18075) 0.44 0.b-NGF (P01138) not detected EGF (P01133) 0.32 0.EGF R ( P00533) not detected EG-VEGF (P58294) not detected FGF-4 (P08620) 0.03 0.FGF-7 ( P21781) not detected GDF-15 (Q99988) 0.56 0.GDNF ( P39905) not detected GH ( P01241) not detected HB-EGF ( Q99075) not detected HGF ( P14210) 0.28 0.IGFBP-1 ( P08833) not detected IGFBP-2 (P18065) 0.16 0.IGFBP-3 ( P17936) not detected Protein name M1:M2a ratio P-valueIGFBP-4 ( P22692) not detected IGFBP-6 ( P24592) not detected IGF-I ( P05019) 0.97 0.Insulin (P01308) 0.17 0.MCSF R (P07333) 1.20 0.NGF R ( P08138) not detected NT-3 (P20783) not detected NT-4 ( P34130) 0.00 0.OPG (O00300) not detected PDGF-AA (P04085) 0.81 0.PLGF (P49763) 0.42 0.SCF (P21583) not detected SCF R ( P10721) not detected TGFa (P01135) 0 0.TGFb (P01137) 1.62 0.TGFb3 (P10600) not detected VEGF-a (P15692) 4.74 0.VEGF R2 (P35968) not detected VEGF R3 ( P35916) not detected VEGF-D (O43915) not detected CCL21 ( O00585) 0.81 0.Axl (P30530) 2.33 0.BTC ( P35070) 0.91 0.CCL28 ( Q9NRJ3) 0.64 0.CCL27 (Q9Y4X3) 1.07 0.CXCL16 (Q9H2A7) 1.05 0.CXCL5 ( P42830) 1.11 0.CCL26 (Q9Y258) 0.80 0.CXCL6(P80162) 2.73 0.CXCL1 ( P09341/P19875/P19876) 1.15 0.28 Protein name M1:M2a ratio P-valueCCL14 (Q16627) 0.11 0.00CCL16 ( O15467) 0.82 0.IL-9 (P15248) 0.71 0.IL-17F ( Q96PD4) 0.48 0.IL-18 Bpa ( O95998) 0.76 0.IL-28A ( Q8IZJ0) 0.34 0.IL-29 ( Q8IU54) 0.63 0.IL-31 ( Q6EBC2) 1.06 0.CXCL10 (P02778) 2.22 0.00CXCL11 (O14625) 11.43 0.00LIF ( P15018) 1.26 0.TNFSF14 (O43557) 0.98 0.XCL1 (P47992) 0.87 0.CCL8 (P80075) 1.16 0.CCL7 (P80098) 1.38 0.0CCL13 (Q99616) 0.10 0.00CCL22 (O00626) 0.87 0.MIF ( P14174) 1.11 0.CCL20 (P78556) 5.73 0.00CCL19 (Q99731) 11.04 0.00CCL23 (O00175) 0.46 0.0MST1 ( P26927) 1.29 0.PPBP(P02775) 1.18 0.SPP1 (P10451) 1.45 0.CCL18 ( P55774) 0.79 0.PF4 ( P02776) 1.55 0.CXCL12 (P48061) 1.97 0.0CCL17 (Q92583) 0.26 0.0CCL25 ( O15444) 1.03 0.TSLP (Q969D9) 1.38 0.
It was found that 9 cytokines were significantly higher in the M2a hMdɸ‒conditioned medium (Table 3A), while 15 cytokines were significantly higher in the M1 hMdɸ‒conditioned medium ( Table 3B ). Several of the 9 cytokines that were increased in the M2a hMdɸ‒conditioned medium were previously reported to play a role in various inflammatory processes, including ocular inflammatory diseases and neurodegenerative diseases; these cytokines include eotaxin (Segal-salto et al. 2019; Shoji et al. 2017), MCP-4 (Méndez-enríquez et al. 2014; Mendez-Enriquez et al. 2013), TARC, MPIF-1 (Simats et al. 2018), and HCC-1 (Liu et al, 2016).
Table 3A: Cytokines that are significantly higher in the M2a hMdɸ‒conditioned medium M2a-upregualted Protein M1:M2a ratio P-value TGFa 0.00 0.01HCC-1 0.10 0.00MCP-4 0.11 0.00TARC 0.27 0.00MPIF-1 0.51 0.00Eotaxin-2 0.52 0.01PDGF-BB 0.70 0.04IL-7 0.78 0.02TNFb 0.81 0.02 Table 3B: Cytokines that are significantly higher in the M1 hMdɸ‒conditioned medium conditioned medium M1-upregualted Protein M1:M2a ratio P-value BLC 99.24 0.00G-CSF 40.72 0.05IL-6 39.66 0.000I-TAC 17.91 0.00MIP-3b 15.27 0.00MIP-3a 6.33 0.00RANTES 5.47 0.00VEGF 4.74 0.0108 IL-10 3.08 0.02GCP-2 2.60 0.05I-309 2.50 0.02SDF-1a 2.43 0.00IP-10 2.27 0.00PF4 1.65 0.06MCP-3 1.40 0.00IL-11 1.21 0.05 Interestingly, three of these cytokines (HCC-1, MCP-4, and MPIF-1) are ligands of the C-C chemokine receptor , including, CCR1. To confirm these multiplex ELISA results, the inventors performed real-time quantitative PCR (qPCR) analysis of the mRNAs that encode these three CCR1 ligands and found significantly higher levels of both MPIF1 and MCP4 mRNA in M2a hMdɸs compared to M1 hMdɸs (Fig. 6A and Fig. 6B); in contrast, no significant difference in HCC1 mRNA levels were found between M2a and M1 hMdaɸs (Fig. 6C).
Next, the inventors attempted to identify which cell type(s) in the retina express CCR1 and are therefore affected by the cytokines released by M2a hMdɸs and drive photoreceptor cell death in response to photic-induced injury. Using immunofluorescence, increased levels of CCR1 protein were found in the mouse retina-primarily in the ONL— 48 hours after inducing photic injury (Fig. 7A, middle panel). The inventors also measured robust CCR1 immunofluorescence in the inner nuclear layer (INL) and inner plexiform layer (IPL) seven days after photic injury (Fig. 7A, right panel). The inventors then performed dual immunostaining for CCR1 and the glial cell marker GFAP in retinal sections and found strong co-localization of these two proteins following photic injury (Fig. 7E). These results indicate that CCR1 is expressed primarily in Müller cells, the only retinal cell type that spans all of the layers of the retina (Bringmann et al. 2006).
Using TUNEL staining, the inventors found a large number of apoptotic photoreceptor cells 48 hours after photic injury (Fig. 7B, middle panel); 7 days after photic injury, apoptotic photoreceptor cells were still present (Fig. 7B, right panel), albeit it to a lesser extent as previously reported. To confirm that photic injury increases the expression of CCR1 in the retina, Ccr1 mRNA was measured using qPCR days after photic injury and found significantly increased retinal expression of Ccrcompared to control mice (Fig. 7C). The inventors also measured retinal function using ERG recordings and found a strong inverse correlation between retinal Ccr1 mRNA levels and b-wave amplitude following photic injury (Fig. 7D), suggesting that Ccrexpression may play a role in determining the extent of retinal damage.
Previous studies suggest that CCR1, CCR2, and CCR5 may be functionally redundant (Gladue et al. 2010). The inventors therefore examined whether photic injury also increases the level of CCR2 and/or CCR5 protein in Müller cells in the mouse retina using immunofluorescence. Interestingly, however, neither CCR(Fig.8A) nor CCR5 (Fig. 8B) was detected in these cells in either control or photic-injured mice.
Consistent with previous reports that photic injury can promote the recruitment of inflammatory cells particularly macrophages that express CCR1, CCR2, and CCR(Rutar et al, 2015)—it was found that cells expressing CCR1, CCR2, and CCR5 were recruited to the subretinal space in photic-damaged mice (Fig. 8C). Moreover, the inventors measured increased levels of both Ccr2 (Fig. 8D) and Ccr5 (Fig. 8E) mRNA following photic injury, as well as an even larger increase in Ccr1 expression (data not shown). Taken together, these results suggest that the increased expression of CCRand CCR5 following photic injury stems primarily from immune cells that were recruited to the site of damage, while the increased expression of CCR1 likely stems from both increased expression in Müller cells as well as the recruitment of inflammatory cells to the damaged retina.
Example 5: Increased expression of CCR1 in rd10 mice and senescent mice Next, the inventors examined whether CCR1 is also upregulated in others model of retinal degeneration. The rd10 mouse is a model of autosomal recessive retinitis pigmentosa in which a mutation in the Pde gene (which encodes the enzyme phosphodiesterase in rod cells) causes degeneration of photoreceptor cells starting at around postnatal day 18. At 7 days of age—i.e., before the onset of photoreceptor cell apoptosis—the inventors measured extremely low levels of CCR1 in the retina (Fig. 9A, left panel). In contrast, a significantly higher expression of CCR1 was measured in both the INL and ONL at 3 and 6 weeks of age, together with a reduction in ONL thickness of approximatively 50% and 90% at 3 and 6 weeks, respectively (Fig. 9A, middle and right panels). Co-staining for CCR1 and GFAP at 6 weeks of age confirmed that the increased expression of CCR1 occurred specifically in Müller cells (Fig. 9B). qPCR analysis of Ccr1 mRNA confirmed the increased expression of CCR1 in rd10 mice at both 3 and 6 weeks of age compared to 1 week (Fig. 9C). Similarly, the inventors also measured increased levels of both Ccr2 and Ccr5 mRNA at 3 weeks of age compared to 1 week (Fig. 9D); however, neither CCR2 nor CCR5 was present in Müller cells based on immunohistochemistry. Finally, similar to the inventors’ results obtained using the inventors’ photic injury model, the inventors found that the increase in Ccr1 expression in rd10 measured at 3 weeks of age was larger than the increase in both Ccr2 and Ccr5. Together, these results support the notion that CCR1 expressed in Müller cells plays a distinct role in photoreceptor cell death.
As the name suggests, age-related macular degeneration primarily affects the elderly Interestingly, the inventors found that 18-month-old wild-type BALB/c mice (i.e., "elderly" or senescent mice) express CCR1 in both the INL and ONL (Fig. 9E), and co-immunostaining for CCR1 and GFAP shows that CCR1 is expressed primarily in Müller cells (Fig. 9F and Fig. 9G). Moreover, qPCR analysis confirmed that senescent mice have increased levels of retinal Ccr1 mRNA compared to young mice (Fig. 9H); in contrast, the inventors found no difference between senescent and young mice with respect to Ccr2 or Ccr5 mRNA levels (Fig. 9H), and immunohistochemistry confirmed that neither CCR2 nor CCR5 is expressed in Müller cells.
Example 6: Inhibiting CCR1 reduces photic injury‒induced retinal damage Based on these finding that CCR1 expression is upregulated in the retina in: i) photic-injured mice, ii) rd10 mice in parallel with the onset of retinal degeneration, and iii) senescent mice, the inventors hypothesized that inhibiting this receptor may slow the rate of photoreceptor loss. To test this hypothesis, the inventors injected mice with the CCR1-specific inhibitor BX471 (or vehicle in control mice) immediately after inducing photic injury. The inventors found that BX471-treated mice had both a larger b-wave amplitude on ERG (Fig. 10A) and increased ONL thickness compared to vehicle-treated mice (Fig. 10B), suggesting that inhibiting CCR1 can help against photic injury in mice.
Interestingly, immunostaining for the protein IBA-1 (ionized calcium-binding adaptor molecule 1, a marker of microglial activation) revealed that photic injury‒induced microglial activation was reduced in BX471-treated mice. Specifically, the inventors found that BX471-treated mice photic-injured had elongated microglial cells that were localized primarily to the ganglion cell layer (GCL) and INL (Fig. 10C, right panel); in contrast, vehicle-treated photic-injured mice had amoeboid-shaped microglial cells that infiltrated both the ONL and subretinal space (Fig. 10C, left panel). Moreover, qPCR analysis revealed that photic injury increased the recruitment of macrophages to the retina (based on increased retinal expression of the macrophage marker F4/80), and this recruitment was significantly reduced in BX471-treated mice (Fig. 10D). The inventors also found that BX471 reduced CCR1 expression in Müller cells in photic-injured mice compared to control-treated mice (Fig. 10E); this finding was confirmed using qPCR to measure Ccr1 mRNA (Fig. 10F).
The finding that CCR1 is expressed primarily in Müller cells suggests that this receptor may play a key functional role in these cells. The inventors therefore measured whether three genes encoding markers of activated Müller cells—namely, Ccl2, Cxcl1, and/or Cxcl10—are upregulated following photic injury. Consistent with previously reports (Natoli et al. 2017; Rutar et al. 2015), the inventors found increased expression of all three genes following photic injury (Fig. 10G). In addition, treating mice with the CCR1 inhibitor BX471 reduced expression to control levels (Fig. 10G). Taken together, these results indicate that inhibiting CCR1 can reduce the retinal inflammation induced by photic injury and increase the survival of photoreceptor cells.
Example 7: Inhibiting CCR1 reduces the neurotoxic effects of M2a macrophages Given that CCR1 is a chemokine receptor expressed by a wide range of immune cells, including mononuclear cells (Mantovani et al. 2006), the inventors suggested that inhibiting this receptor can affect the functional properties of M2a hMdɸs via an autocrine signaling process. The inventors found that both M1 and M2a hMdɸs express CCR1 (Fig. 11A); however, cell sorting analysis revealed that a significantly larger percentage of M2a hMdɸs express CCR1 compared to M1 hMdɸs (Fig. 11B), suggesting that M2a hMdɸs may be more susceptible to the effects of inhibiting CCR1.
The inventors therefore examined whether inhibiting CCR1 could reduce M2a hMdɸ‒mediated neurotoxicity and found that treating M2a hMdɸs with either 0.5 µM or 5 µM BX471 significantly reduced their production of ROS (Fig. 11C). In addition, treating monocytes from patients with AMD with 10 µM BX471 significantly reduced the ability of M2a to attract monocytes (Fig. 11D), indicating that the recruitment of mononuclear cells by M2a hMdɸs is mediated in part by CCR1 signaling.
Example 8: CCR1 knockout is associated with decreased lesions As shown in Figs. 12A to 12O, auto-fluorescence imaging of the retina fundus revealed that the deletion of Ccr1 is associated with a decrease of fundus lesions as indicated by the presence of multiple bright spots in the retina. Specifically, in the control wild-type mice (Figs. 12A to 12E), bright spots in the retina were not observed, whereas in the Ccr1 wild type, Crb1rd8 mice (Figs. 12F to 12J) multiple bright spots in the retina were observed. Interestingly, in the Ccr1 Knockout, Crb1rd8 mice (Figs. 12K to 12O), a decrease in the number of bright spots was observed as compared to the Ccr1 wild type, Crb1rd8 mice (Figs. 12F to 12J).
The inventors further measured whether genes encoding markers of activated Müller cells, namely, Gfap, Vimentin, Ccl2, Cxcl1, and/or Cxcl10, are modulated in Ccr1 Knockout, Crb1rd8 mice. Figs. 13A-13F show real-time quantitative PCR (qPCR) analysis of Cxcl10, Gfap, Vimentin, Cxcl1 and Ccl2. As can be seen, a reduction of Muller cells – gliotic response in Ccr1 knockout, Crb1rd8 mice was observed compared to Ccr1 wild type, Crb1rd8 mice. In addition, a decrease of number of retinal macrophages, indicated by F4/80 mRNA level, was observed in Ccr1 knockout, Crb1rd8 mice compared to Ccr1 wild type, Crb1rd8 mice.
These results indicated that Ccr1 deletion diminishes the level of retinal stress in the Crb1rd8 mice model (n=6 per group, Student’s t-test). These results are consistent with the results shown in Example 6.
Example 9: Inhibition of CCR1 in rd10 mice To test the effect of the CCR1-specific antagonist BX471 in rd10 mice, a group of mice at postnatal day 21 received subcutaneous injections of either BX471 at a dose of 50 mg/kg body weight (obtained from Tocris, Bristol, UK) (n=6) or a vehicle solution (composed of 40% cyclodextrin in saline) (n=5) every 8 hours for a duration of 4 days. Fig. 14A shows the full-field electroretinography (ERG) measurements prior to the experiment and on day 5 of the experiment. As can be seen from this figure, the b-wave amplitude, plotted against flash intensity, revealed that at P25, the BX471-treated mice exhibited a larger b-wave amplitude on ERG compared to the vehicle-treated group. Fig. 14B shows the average b-wave amplitudes that were 57.33 ± 4.and 119.45 ± 9.51 μV for vehicle-treated mice and BX471-treated mice at P25, respectively, as the light intensity achieved 1.0 log cd s m−2. This represented a reduction of 62% and 29% from their respective baselines (vehicle-treated mice, 156.30 ± 9.39 μV; b-wave, 169.4 ± 10.4 μV).
Representative scotopic ERG signals of vehicle-treated and BX471-treated mice, at P21 and at P25 are shown in Fig. 14C. Together these results indicate that the Ccr1 deletion delays the decrease of retinal function in the rd10 mice.
To further test the effect of Ccr1 deletion in this model, ERG measurements were recorded at P21 for both, rd10 mice and rd10 mice with Ccr1 deletion. As can be seen in Fig. 15, the b-wave amplitude, plotted against flash intensity, revealed that Ccr1 deletion in rd10 model is associated with a larger b-wave amplitude on ERG compared to rd10 mice without Ccr1 deletion.
Summary The role of monocytes—and macrophages in particular—in the pathogenesis of AMD has received increasing attention in recent years. Here, the inventors provided additional insights into the function of specific hMdɸ phenotypes in the context of aAMD. The inventors found that M2a hMdɸs mediate neurotoxicity in both in vitro and in vivo models of aAMD. In addition, and contrary to the prevailing hypothesis that M1 macrophages likely underlie tissue damage during inflammation, the inventors found that M1 macrophages do not appear to play a major role in retinal damage in the context of aAMD. With respect to the potential underlying mechanism, the inventors found that M2a hMdɸs produce high levels of ROS ex vivo; however, the in vivo effects of M2a hMdɸs may also be mediated by additional mechanisms such as increased production of cytokines that promote neurotoxicity and drive the recruitment of additional mononuclear cells. These findings presented herein may therefore explain the relatively high contribution of M2a macrophages to the pathogenesis of AMD. Indeed, oxidative stress—particularly ROS-induced cellular damage—was recently reported as a cause of retinal inflammation (Abokyi et al 2020), and the recruitment of other immune cell types can exacerbate inflammation in the eye, an immune-privileged organ in which overstimulation of the immune system can be detrimental (Buschini et al, 2011).
By examining the molecular mechanism by which M2a hMdɸs drive retinal damage, the inventors found that these cells can interact with retinal cells via the chemokine receptor CCR1 to mediate photoreceptor cell death. Although this receptor is expressed by a wide range of immune cell types and plays a key role in recruiting monocytes (Trebst et al, 2002), the inventors’ results provide the first evidence that CCR1 is also expressed in Müller cells, and this expression increases during acute retinal damage (for example, following photic injury) and during progressive retinal degeneration (for example, in the rd10 mouse). The inventors also found increased retinal expression of CCR1 in senescent mice, supporting the notion that this receptor is involved in age-related neurodegenerative diseases, including AMD. Finally, the inventors found that inhibiting CCR1 significantly reduced the severity of retinal damage induced by photic injury, suggesting that CCR1 antagonists may have therapeutic applications in aAMD.
The data presented herein support the notion that infiltrating monocytes interact with Müller cells during retinal disease, with deleterious effects. Although largely known for their structural role in the retina, Müller cells also play an essential role in maintaining metabolic homeostasis and function in the retina. For example, Müller cells can exchange ions, water, and bicarbonate molecules in order to regulate the composition of the extracellular fluid, and these cells use a variety of complex mechanisms to regulate synaptic activity, guide incoming light, and both support and protect neurons (Reichenbach et al. 2013). Importantly, Müller cells also serve as a source of cytokines and growth factors that drive neuronal and immune responses (Abcouwer et al.; 2017; Coughlin et al. 2017). During ocular inflammation, Müller cells are activated by a process known as gliosis, which allows them to interact with immune cells and microglial cells recruited to the site of inflammation (Bringmann et al. 2006). With respect to their role in pathogenesis, previous studies suggest that Müller cells are associated with the progression of several inflammatory eye diseases such as diabetic retinopathy (Capozzi et al. 2018) by activating the CD40 receptor ( Portillo et al. 2016, 2017) or by acting upon the microvascular to promote angiogenesis (Xin et al, 2013).
Müller cells have also been shown to promote the development of glaucoma in an experimental model of chronic ocular hypertension (Zhong-feng et al. 2016). In addition, other studies suggest that these cells play a role in the development of proliferative vitreoretinopathy (Bringmann et al. 2012), retinitis pigmentosa, and AMD (Massengill et al. 2018). Indeed, drusen formation has been associated with Müller cells gliosis (Telegina et al. 2018; Wu et al. 2003). However, the mechanism by which Müller cells contribute to the progression of AMD has not been identified. Here, the inventors show that CCR1 expression in Müller cells is correlated directly with retinal function in an animal model that recapitulates many of the features associated with aAMD. Furthermore, the inventors show that inhibiting CCR1 reduces Müller cell activation and reduces both retinal inflammation and photoreceptor cell loss.
Despite having distinct etiologies, both retinitis pigmentosa and AMD culminate in the loss of photoreceptor cells. Using models for both diseases, the inventors found that CCR1 expression in Müller cells is correlated with photoreceptor cell death. Although previous studies have shown that Müller cells can directly cause the death of retinal ganglion cells (Xue et al, 2016) and endothelial cells (Portillo et al, 2016), the notion that Müller cells can be activated by neurotoxic macrophages—and thus may directly cause the death of photoreceptor cells—is novel and warrants further study.
Müller cells were shown previously to induce photoreceptor cell death by recruiting immune cells (Matsumoto et al, 2018) and through crosstalk with microglial cells (Wang et al, 2011). Similarly, the inventors found that inhibiting CCR1 reduced macrophage infiltration and prevented activation of microglial cells. Interestingly, previous studies found that the chemokine receptor ligand CCL2 can act as an inflammatory cytokine, promoting photoreceptor cell death by recruiting macrophages (Nakazawa et al, 2007), while other studies found that the ligand CXCL10 can activate microglial cells via the CCR3 receptor (Clarner et al, 2015). Here, the inventors found that inhibiting CCR1 was associated with decreased expression of CCL2 and-albeit to a slightly lesser extent-CXCL10 in Müller cells. Taken together, these findings suggest that CCR1 may play an essential role in the activation of Müller cells, thus leading to photoreceptor cell death.
CCR1 was first identified as a chemokine receptor expressed in specific immune cell types such as monocytes (Chia-lin et al, 1998), which are recruited during photic injury (Rutar et al. 2015). Although the inventor’s results provide the first evidence that CCR1 is expressed in Müller cells, the inventors cannot exclude the possibility that the systemically injected CCR1 inhibitor BX471 may have prevented the infiltration of immune cells in the retina, thereby reducing retinal inflammation and protecting photoreceptor cells from apoptosis. In addition, the inventors found that BX471 significantly decreased the number of macrophages recruited to the photic-injured retina in vivo and reduced the capacity of M2a hMdɸs to attract human monocytes in vitro. Moreover, the inventors found that inhibiting CCR1 altered the functional properties of M2a hMdɸs, rendering them less neurotoxic by reducing their production of ROS.
Reducing the recruitment of monocytes by inhibiting chemokine receptors has been explored as a possible therapeutic strategy for treating several inflammatory diseases (Sennlaub et al. 2013). With respect to ocular inflammatory disease, a recent clinical trial tested a dual CCR2/CCR5 antagonist for treating diabetic macular edema; however, the results of the phase 2 clinical trial showed that this treatment was inferior to currently approved treatments (Gale et al, 2018). This is consistent with the suggested role of Müller cells in photoreceptor cell death. Although the inventors found that both CCR2 and CCR5 were upregulated in the photic injury model and in rd10 mice, these receptors do not appear to be expressed in Müller cells. Finally, although CCR1 antagonists have been tested in clinical trials for the treatment of endometriosis and leukemia, their therapeutic value with respect to ocular diseases has not been investigated.
In summary, the results presented herein indicate that the mechanism underlying CCR1-mediated photoreceptor cell death seems to include an intrinsic retinal process involving the activation of Müller cells, as well as the recruitment of neurotoxic macrophages to the retina and the functional modulation of M2a hMdɸs. These complementary roles played by CCR1-which include gliosis and the recruitment and polarization of macrophages in the retina-suggest that this receptor may serve as a promising new target for treating ocular degenerative diseases such as aAMD.
List of References: Abcouwer SF (2017) Müller Cell–Microglia Cross Talk Drives Neuroinflammation in Diabetic Retinopathy. Diabetes 66: 261–2 Abokyi S, To CH, Lam TT & Tse DY (2020) Central Role of Oxidative Stress in Age-Related Macular Degeneration: Evidence from a Review of the Molecular Mechanisms and Animal Models. Oxid Med Cell Longev 79012 Bringmann A, Pannick T, Grosche J, Francke M, Wiedemann P, Skatchkov SN, Osborne NN & Reichenbach A (2006) Muller cells in the healthy and diseased retina. Prog Ret Eye Res Bringmann A & Wiedemann P (2012) Müller Glial Cells in Retinal Disease. Ophtalmologica 227: 1– Buschini E, Piras A, Nuzzi R & Vercelli A (2011) Age related macular degeneration and drusen: neuroinflammation in the retina. Prog Neurobiol 95: 14– Capozzi ME, Giblin MJ & Penn JS (2018) Palmitic Acid Induces Müller Cell Inflammation that is Potentiated by Co-treatment with Glucose. Sci Rep 8: 54 Chia-lin T, Gladue Ron P, A CL, Paradis T, Boyd JG, Nelson RT, Neote K & Charo IF (1998) Identification of C-C Chemokine Receptor 1 (CCR1) as the Monocyte Hemofiltrate C-C Chemokine (HCC)-1 Receptor. J Exp Med 188: 603–6 Clarner T, Janssen K, Nellessen L, Skripuletz T, Krauspe B, Denecke B, Beutner C, Neumann H, Vallières L, Ohl K, et al (2015) CXCL10 Triggers Early Microglial Activation in the Cuprizone Model. J Immunol 194: 3400–34 Coughlin BA, Feenstra DJ & Mohr S (2017) Müller cells and diabetic retinopathy. Vision Res 139: 93–1 Gale JD, Berger B, Gilbert S, Popa S, Sultan MB, Ronald A, Girgenti D & Perros-huguet C (2018) A CCR2/5 Inhibitor, PF-04634817, Is Inferior to Monthly Ranibizumab in the Treatment of Diabetic Macular Edema. Invest Ophthalmol Vis Sci 59:2659-2669.
Gladue RP, Brown MF & Zwillich SH (2010) CCR1 Antagonists : What Have We Learned From Clinical Trials. Curr Top Med Chem 10: 1268–12 Hagbi-Levi S, Grunin M, Jaouni T, Tiosano L, Rinsky B, Elbaz-Hayoun S, Peled A & Chowers I (2016) Pro-Angiogenic Characteristics of Activated Macrophages from Patients with Age-related Macular Degeneration. Neurobiol Aging 51: 71– Liu F, Ding X, Yang Y, Li J, Tang M, Yuan M, Hu A, Zhan Z, Li Z & Lu L (2016) Aqueous humor cytokine profiling in patients with wet AMD. Mol Vis 22: 352– Mantovani A, Bonecchi R & Locati M (2006) Tuning inflammation and immunity by chemokine sequestration : decoys and more. Nat Rev Immunol 6: 907–9 Mantovani A, Sozzani S, Locati M, Allavena P & Sica A (2002) Macrophage polarization: tumor-associated macrophages as a paradigm for polarized Mmononuclear phagocytes. Trends Immunol 23: 549–5 Massengill MT1, Ahmed CM1, Lewin AS1 IC (2018) Neuroinflammation in Retinitis Pigmentosa, Diabetic Retinopathy, and Age-Related Macular Degeneration: A Minireview. Adv Exp Med Biol 1074: 185–1 Matsumoto H, Sugio XS, Gailly XP & Shibasaki XK (2018) Retinal Detachment-Induced Muller Glial Cell Swelling Activates TRPV4 Ion Channels and Triggers Photoreceptor Death at Body Temperature. J Neurosci 38: 0897– Méndez-enríquez E, Medina-tamayo J, Soldevila G, Fortoul TI & Anton B (2014) A CCL chemokine-derived peptide (CDIP-2) exerts anti-inflammatory activity via CCR1 , CCR2 and CCR3 chemokine receptors : Implications as a potential therapeutic treatment of asthma. Int Immunopharmacol 20: 1– Mendez-Enriquez E1 G-ZE (2013) The multiple faces of CCL13 in immunity and inflammation. Inflammopharmacology 21: 397–4 Nakazawa T, Hisatomi T, Nakazawa C, Noda K, Maruyama K, She H, Matsubara A, Miyahara S, Nakao S, Yin Y, et al (2007) Monocyte chemoattractant protein 1 mediates retinal detachment-induced photoreceptor apoptosis. Proc Natl Acad Sci U S A 104: 2425–30 Natoli R, Fernando N, Madigan M, Chu-Tan JA, Valter K, Provis J & Rutar M (2017) Microglia-derived IL-1β promotes chemokine expression by Müller cells and RPE in focal retinal degeneration. Mol Neurodegener 12: Portillo JC, Corcino YL, Dubyak GR, Kern TS, Matsuyama S & Subauste CS (2016) Ligation of CD40 in Human Muller Cells Induces P2X7 Receptor–Dependent Death of Retinal Endothelial Cells. Invest Ophthalmol Vis Sci 57: 6278–62 Portillo JC, Corcino YL, Miao Y, Tang J, Sheibani N, Kern TS & Dubyak GR (2017) CD40 in Retinal Müller Cells Induces P2X 7 -Dependent Cytokine Expression in Macrophages / Microglia in Diabetic Mice and Development of Early Experimental Diabetic Retinopathy. Diabetes 66: 483–4 Reichenbach A & Bringmann A (2013) New Functions of Muller Cells. Glia 61: 651– Rutar, M., et al. Chemokine-mediated inflammation in the degenerating retina is coordinated by Müller cells, activated microglia, and retinal pigment epithelium. J Neuroinflammation 12: 1-15, 8 (2015).
Segal-salto M, Barashi N, Katav A, Edelshtein V, Aharon A, Hashmueli S, George J, Maor Y, Pinzani M, Haberman D, et al (2019) A blocking monoclonal antibody to CCL24 alleviates liver fibrosis and inflammation in experimental models of liver damage Authors. J Hepatol 2: 1000 Sennlaub F, Auvynet C, Calippe B, Lavalette S, Poupel L, Hu SJ, Dominguez E, Camelo S, Levy O, Guyon E, et al (2013) CCR2(+) monocytes infiltrate atrophic lesions in age-related macular disease and mediate photoreceptor degeneration in experimental subretinal inflammation in Cx3cr1 deficient mice. EMBO Mol Med 5: 1775–17 Shoji J, Aso H & Inada N (2017) Clinical Usefulness of Simultaneous Measurement of the Tear Levels of CCL17 , CCL24 , and IL-16 for the Biomarkers of Allergic Conjunctival Disorders Clinical Usefulness of Simultaneous Measurement of the Tear Levels of CCL17 , CCL24 , and IL-16 for the B. Curr Eye Res 42: 677–6 Simats A, Garc T, Penalba A, Giralt D, Llovera G, Jiang Y, Ramiro L & Bustamante A (2018) CCL23 : a new CC chemokine involved in human brain damage. J Intern Med 283: 461–475 Telegina D V, Kozhevnikova OS & Kolosova NG (2018) Changes in Retinal Glial Cells with Age and during Development of Age Related Macular Degeneration. Biochemistry 83: 1009–10 Trebst C, Sorensen TL, Kivisakk P, Cathcart MK, Hesselgesser J, Horuk R, Sellebjerg F, Lassmann H & Ransohoff RM (2002) Chemokine receptors on mononuclear phagocytes in the central nervous system of patients with multiple sclerosis. Ernst Scher Res Found Work 39: 193–2 Wang M, Ma W, Zhao L, Fariss RN & Wong WT (2011) Adaptive Müller cell responses to microglial activation mediate neuroprotection and coordinate inflammation in the retina. J Neuroinflammation 8:1 Wu KHC, Madigan MC, Billson F & Penfold PL (2003) Differential expression of GFAP in early v late AMD: a quantitative analysis. Br J Ophthalmol 87: 1159-11 Xin X, Rodrigues M, Umapathi M, Kashiwabuchi F & Ma T (2013) Hypoxic retinal Müller cells promote vascular permeability by HIF-1 – dependent up-regulation. Proc Natl Acad Sci U S A 110: E3425–E34 Xue B, Xie Y, Xue Y, Hu N, Zhang G, Guan H & Ji M (2016) Involvement of P2X7 receptors in retinal ganglion cell apoptosis induced by activated Müller cells. Exp Eye Res 153: 42– Yuan A, Hsiao Y, Chen H, Chen H & Ho C (2015) Opposite Effects of M1 and M2 Macrophage Subtypes on Lung Cancer Progression. Sci Rep 5: 142 Zhong-feng W & Xiong-li Y (2016) Glutamate receptor-mediated retinal neuronal injury in experimental glaucoma. acta Physiol Sin 68: 483–491

Claims (41)

CLAIMS:
1. An effective amount of at least one small molecule compound (SMC) modulatorfor use in a method for modulating activity of CCR1 in a Müller cell of a subject in need thereof.
2. An effective amount of at least one SMC modulator for use in a method forinhibiting Müller cell activation of a subject in need thereof, wherein said SMC modulator modulates activity of CCR1 in the Müller cell.
3. The SMC modulator for use according to claim 1 or 2, wherein said modulatorinhibits CCR1 activity and/or CCR1 expression in said Müller cell.
4. The SMC modulator for use according to any one of claims 1 to 3, wherein saidmodulator inhibit activation of said Müller cell.
5. The SMC modulator for use according to claim 4, wherein said modulator reducesexpression of at least one chemokine to thereby inhibit said Müller cell activation.
6. The SMC modulator for use according to claim 5, wherein said at least onechemokine is at least one of C-C Motif Chemokine Ligand 2 (CCL2), C-X-C Motif Chemokine Ligand 1 gene (CXCL1), C-X-C Motif Chemokine Ligand 10 gene (CXCL10) or any combination thereof.
7. The SMC modulator for use according to claim 4, wherein said modulator reducesexpression of at least one type III intermediate filament protein.
8. The SMC modulator for use according to claim 7, wherein said at least one typeIII intermediate filament protein is GFAP, vimentin or any combination thereof.
9. The SMC modulator for use according to any one of claims 1 to 8, wherein saidmodulator is a CCR1 antagonist.
10. The SMC modulator for use according to any one of claims 1 to 8, wherein saidmodulator is represented by Formula (XII): (XII). wherein each one of R1, R2, R3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, each n, m, q is an integer being independently from each other selected from be 0 to 5.
11. The SMC modulator of claim 10, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido, n and m are each 1 and q is 2, optionally wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido.
12. The SMC modulator for use of claim 10 represented by Formula (XIII): (XIII) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein each one of R 1, R 2, R 3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide.
13. The SMC modulator for use of claim 12, wherein R 1 is a halogen, R 2 is an alkyl, R 3 is a halogen and an ureido, optionally wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido.
14. The SMC modulator for use according to any one of claims 1 to 13, represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
15. The SMC modulator for use according to any one of claims 1 to 14, wherein said Müller cell is of a subject, wherein said subject is (i) suffering from a retinal damage and/or a photoreceptor cell damage, (ii) in need of restoring retinal function, (iii) in need of inhibiting Müller cell and/or decreasing M2a hMdɸs neurotoxicity (iv) suffering from a retinal disease or any associated condition, (v) suffering from a retinal disease associated with activation of Müller cell, (vi) suffering from a retinal disease associated with neurotoxicity of M2a hMdɸs, (vii) suffering from a retinal disease is associated with damage to photoreceptor cell, (viii) suffering from a retinal disease is associated with photoreceptor cell death or (ix) any combination thereof.
16. The SMC modulator for use of any one of claims 1 to 15, in a method of treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein the retinal disease is associated with activation of Müller cell and/or neurotoxicity of M2a hMdɸs.
17. The SMC modulator for use of any one of claims 1 to 15, in a method of treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition by inhibiting Müller cell and/or decreasing M2a hMdɸs neurotoxicity.
18. The SMC modulator for use of any one of claims 1 to 15, in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof by inhibiting damage of photoreceptor cell.
19. The SMC modulator for use according to any one of claims 1 to 15, in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof.
20. The SMC modulator for use of any one of claims 16 to 19, wherein the retinal disease is one or more of an inherited retinal degeneration (IRD) disease, a retinal vascular disease, choroidal vascular disease, inflammatory disease, posterior non-infectious uveitis disease, a retinal detachment disease, glaucoma or any associated disorders.
21. The SMC modulator for use of any one of claims 16 to 19, wherein said retinal disease is at least one of age-related macular degeneration (AMD), diabetic retinopathy, rhegmatogenous retinal detachment (RRD), retinal tractional detachment (RTD), retinitis pigmentosa (RP), glaucoma, cataract and exudative retinal detachment.
22. The SMC modulator for use according to claim 21, wherein the retinal disease is AMD.
23. The SMC modulator for use according to claim 22, wherein the AMD is dry AMD.
24. An effective amount of at least one SMC for use in a method for modulating the activity of CCR1 in a Müller cell of a subject in need thereof, wherein said SMC is represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
25. An effective amount of at least one small molecule compound (SMC) for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of retinal disease or condition in a subject in need thereof, wherein said SMC is represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
26. The SMC modulator for use of claim 24 or 25, wherein the retinal disease is one or more of an inherited retinal degeneration (IRD) disease, a retinal vascular disease, choroidal vascular disease, inflammatory disease, posterior non-infectious uveitis disease, a retinal detachment disease, glaucoma or any associated disorders.
27. The SMC modulator for use of claim 24 or 25, wherein said retinal disease is at least one of age-related macular degeneration (AMD), diabetic retinopathy, rhegmatogenous retinal detachment (RRD), retinal tractional detachment (RTD), retinitis pigmentosa (RP), glaucoma, cataract and exudative retinal detachment.
28. The SMC modulator for use according to claim 27 wherein the retinal disease is AMD.
29. The SMC modulator for use according to claim 28, wherein the AMD is dry AMD.
30. A pharmaceutical composition comprising the SMC of any one of claims 1-and optionally at least one of pharmaceutically acceptable carrier/s, excipient/s, auxiliaries, and/or diluent/s.
31. A method of inhibiting activity of CCR1 in a Müller cell in a subject in need thereof, said method comprises contacting said cell with an effective amount of at least one SMC modulator.
32. A method of inhibiting Müller cell activation in a subject in need thereof, said method comprising contacting said cell with an effective amount of at least one SMC modulator, wherein said SMC modulator inhibits CCR1 activity in the Müller cell.
33. The method according to claim 31 or 32, wherein said modulator inhibits CCRactivity and/or CCR1 expression in said Müller cell.
34. The method according to any one of claims 31 to 33, wherein said modulator inhibit activation of said Müller cell.
35. The method according to claim 34, wherein said modulator reduces expression of at least one chemokine to thereby inhibit said Müller cell activation.
36. A method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease or condition in a subject in need thereof, said method comprises administering to said subject a therapeutically effective amount of at least one SMC modulator, wherein said SMC modulator is represented by Formula (XII): (XII). wherein each one of R1, R2, R3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide, each n, m, q is an integer being independently from each other selected from be 0 to 5.
37. The method of claim 36, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido, n and m are each 1 and q is 2, optionally wherein R 1 is an F, R 2 is an CH 3, R3 is Cl and an ureido.
38. The method of claim 36 or 37, wherein said SMC modulator is represented by Formula (XIII): (XIII) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof, wherein each one of R1, R2, R3 is independently selected from each other to be an alkyl, a hydroxy alkyl, a halogen, ureido, aminocarbonyl, ureido or glycinamide.
39. The method of claim 38, wherein R1 is a halogen, R2 is an alkyl, R3 is a halogen and an ureido, optionally wherein R 1 is an F, R 2 is an CH 3, R 3 is Cl and an ureido.
40. The method of any one of claims 36 to 39, wherein said SMC modulator is represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
41. Use of an effective amount of at least one SMC modulator of in the preparation of a composition for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a retinal disease or condition in a subject in need thereof, wherein said at least one SMC modulator is represented by Formula (I): (I) or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer or physiologically functional derivative thereof.
IL320391A 2022-10-24 2023-10-24 Modulators and their uses IL320391A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263380675P 2022-10-24 2022-10-24
PCT/IL2023/051103 WO2024089691A1 (en) 2022-10-24 2023-10-24 Modulators and uses thereof

Publications (1)

Publication Number Publication Date
IL320391A true IL320391A (en) 2025-06-01

Family

ID=90830247

Family Applications (1)

Application Number Title Priority Date Filing Date
IL320391A IL320391A (en) 2022-10-24 2023-10-24 Modulators and their uses

Country Status (3)

Country Link
EP (1) EP4608403A1 (en)
IL (1) IL320391A (en)
WO (1) WO2024089691A1 (en)

Also Published As

Publication number Publication date
EP4608403A1 (en) 2025-09-03
WO2024089691A1 (en) 2024-05-02

Similar Documents

Publication Publication Date Title
US11197856B2 (en) Bicyclic compounds and methods for their use in treating autism
JP2000514402A (en) Therapeutic treatment for eye diseases associated with VEGF
US20220362236A1 (en) Novel methods of treating a neurodegenerative disease in a mammal in need thereof
US20240245680A1 (en) Methods of Treating Retinal Vasculopathies
Sun et al. Aqueous inflammation and ischemia-related biomarkers in neovascular glaucoma with stable iris neovascularization
CN106714821B (en) Novel use of cell-penetrating peptide inhibitors of the JNK signaling pathway for the treatment of various diseases
You et al. Cysteine-rich 61, a member of the CCN family, as a factor involved in the pathogenesis of proliferative diabetic retinopathy
US9457013B2 (en) Method for treating a neurological disorder associated with hypoxia using a small moleucule MIF inhibitor
IL320391A (en) Modulators and their uses
WO2011087491A2 (en) Parstatin peptides and uses thereof
KR20180109278A (en) Composition for treating retinal vascular disease comprising mTOR targeting siRNA with cross-species activity
WO2015110802A1 (en) Abl1 inhibitor for treating and preventing ocular neovascularisation
Manhui et al. Crosstalk Between RPE Cells and Choroidal Endothelial Cells via the ANXA1/FPR2/SHP2/NLRP3 Inflammasome/Pyroptosis Axis Promotes Choroidal Neovascularization
Rudraraju Mechanisms of Endothelial-Barrier Regulation and Vascular Permeability in Ocular Inflammatory Diseases
US20230077811A1 (en) Activation of neuropeptide receptors on plasmacytoid dendritic cells to treat or prevent ocular diseases associated with neovascularization and inflammation
JP2024178773A (en) Therapeutic or preventive agent for abnormal angiogenesis and use thereof
WO2009039388A2 (en) Compositions and methods for detecting and treating ophthalmic disorders
Adis et al. 4. Prostanoid receptor gene expression in human and murine anterior ocular segment
Roddy et al. 7. Stanniocalcin-1, a novel ocular hypotensive agent with capacity for sustained intraocular pressure reduction
Liu et al. The Adenosine A2A Receptor Antagonist KW6002 Mitigates Aldosterone-induced Central Serous Chorioretinopathy in Mice
HK40057869A (en) New use of cell-permeable peptide inhibitors of the jnk signal transduction pathway for the treatment of various diseases
WO2016055160A2 (en) New use of cell-permeable peptide inhibitors of the jnk signal transduction pathway for the treatment of various diseases