IL292348A - Methods of treating cancer - Google Patents

Methods of treating cancer

Info

Publication number
IL292348A
IL292348A IL292348A IL29234822A IL292348A IL 292348 A IL292348 A IL 292348A IL 292348 A IL292348 A IL 292348A IL 29234822 A IL29234822 A IL 29234822A IL 292348 A IL292348 A IL 292348A
Authority
IL
Israel
Prior art keywords
cancer
patient
slfn11
dna
expression level
Prior art date
Application number
IL292348A
Other languages
Hebrew (he)
Original Assignee
Astrazeneca Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Astrazeneca Ab filed Critical Astrazeneca Ab
Publication of IL292348A publication Critical patent/IL292348A/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6855—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from breast cancer cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Description

WO 2021/078925 PCT/EP2020/079856 METHODS OF TREATING CANCER FIELD 1. 1. id="p-1" id="p-1" id="p-1" id="p-1" id="p-1" id="p-1" id="p-1" id="p-1" id="p-1"
[001] The instant disclosure generally relates to methods of treating cancer.
BACKGROUND 2. 2. id="p-2" id="p-2" id="p-2" id="p-2" id="p-2" id="p-2" id="p-2" id="p-2" id="p-2"
[002] WEEl is a nuclear kinase that belongs to the serine/threonine family of protein kinases.
WEEl inhibits cyclin-dependent kinases (CDKs) by phosphorylating CDKs on two different sites (Tyrl5 and Thrl4). WEEl therefore plays a role in regulating mitotic entry and initiation of DNA replication, cell size, and DNA damage checkpoints. Inhibitors of WEEl have been tested for the treatment of cancer as monotherapy and in combination with other cancer treatments. 3. 3. id="p-3" id="p-3" id="p-3" id="p-3" id="p-3" id="p-3" id="p-3" id="p-3" id="p-3"
[003] Schlafen ll (SLFNl 1) belongs to the Schlafen family of proteins and is only expressed in humans and some primates. Inactivation of SLFNll in cancer cells has been shown to result in resistance to anticancer agents that cause DNA damage and replication stress. Thus, SLFNll is a determinant of sensitivity to different classes of DNA-damaging agents and PARP inhibitors. See Zoppoli et al., PNAS 2012, 109: 15030-35, Murai et al., Oncotarget 2016, 7: 76534-50, Murai et al., Mol. Cell 2018, 69: 371-84. 4. 4. id="p-4" id="p-4" id="p-4" id="p-4" id="p-4" id="p-4" id="p-4" id="p-4" id="p-4"
[004] A number of cancer treatments have been developed and approved. However, some cancer treatments are only effective in a fraction of patients. Moreover, a fraction of cancer patients become resistant to certain cancer treatments. Thus, a need exists for methods of identifying patients that are responsive to cancer treatments so that the cancer treatments can be targeted to appropriate patients. In addition, a need exists for methods of reversing resistance to cancer treatments that is observed in some patients.
BRIEF SUMMARY . . id="p-5" id="p-5" id="p-5" id="p-5" id="p-5" id="p-5" id="p-5" id="p-5" id="p-5"
[005] The foregoing needs are met by the methods described herein. In particular, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining whether the patient’s cancer cells are SLFNl l-deficient, and, c) if the patient’s cancer cells are SLFNll-def1cient, co-administering a WEEl inhibitor and a DNA- damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFNll expression. 6. 6. id="p-6" id="p-6" id="p-6" id="p-6" id="p-6" id="p-6" id="p-6" id="p-6" id="p-6"
[006] In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining whether SLFNll expression is lower in the patient’s cancer cells relative to the patient’s SLFNl l-expressing non- cancer cells, and, c) if SLFNll expression is lower in the patient’s cancer cells relative to the 1 WO 2021/078925 PCT/EP2020/079856 patient’s SLFN11-expressing non-cancer cells, co-administering a WEE1 inhibitor and a DNA- damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. 7. 7. id="p-7" id="p-7" id="p-7" id="p-7" id="p-7" id="p-7" id="p-7" id="p-7" id="p-7"
[007] In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer; b) determining the expression level of SLFN11 in the patient’s cancer cells; and, c) if the expression level of SLFN11 is < 10%, co- administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, the expression level of SLFN11 is 0%. 8. 8. id="p-8" id="p-8" id="p-8" id="p-8" id="p-8" id="p-8" id="p-8" id="p-8" id="p-8"
[008] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether the patient’s cancer cells are SLFN11-deficient, and, b) if the patient’s cancer cells are SLFN11- deficient, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. 9. 9. id="p-9" id="p-9" id="p-9" id="p-9" id="p-9" id="p-9" id="p-9" id="p-9" id="p-9"
[009] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN11- expressing non-cancer cells, and, b) if SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN11-expressing non-cancer cells, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. . . id="p-10" id="p-10" id="p-10" id="p-10" id="p-10" id="p-10" id="p-10" id="p-10" id="p-10"
[0010] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells, and, b) if the expression level of SLFN11 is < %, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient. In some embodiments, the expression level of SLFN11 is 0%. 11. 11. id="p-11" id="p-11" id="p-11" id="p-11" id="p-11" id="p-11" id="p-11" id="p-11" id="p-11"
[0011] In some embodiments, the expression level of SLFN11 is determined by immunohistochemistry, mass spectrometry, in-situ hybridization, NanoString, reverse transcription quantitative polymerase chain reaction (RT-qPCR), microarray analysis, bisulfite sequencing, or quantitative methylation-specific polymerase chain reaction (Q-MSP). In a specific embodiment, the expression level of SLFN11 is determined by immunohistochemistry. 12. 12. id="p-12" id="p-12" id="p-12" id="p-12" id="p-12" id="p-12" id="p-12" id="p-12" id="p-12"
[0012] In some embodiments of the methods disclosed herein, the cancer is selected from the group consisting of pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, lung cancer, colorectal cancer, colon cancer, rectal cancer, prostate cancer, breast cancer, brain cancer, cervicocerebral cancer, esophageal cancer, thyroid cancer, stomach cancer, gallbladder WO 2021/078925 PCT/EP2020/079856 cancer, liver cancer, choriocarcinoma, uterus body cancer, uterocervical cancer, kidney cancer, bladder cancer, testicular cancer, skin cancer, neuroblastoma, osteosarcoma, Ewing’s sarcoma, leukemia, Hodgkin’s lymphoma, acute myeloid leukemia, diffuse large B-cell lymphoma, and head and neck cancer. 13. 13. id="p-13" id="p-13" id="p-13" id="p-13" id="p-13" id="p-13" id="p-13" id="p-13" id="p-13"
[0013] In some embodiments of the methods disclosed herein, the DNA-damaging agent is selected from the group consisting of gemcitabine, etoposide, cisplatin, carboplatin, oxaliplatin, picoplatin, methotrexate, doxorubicin, daunorubicin, 5-fluorouracil, irinotecan, mitomycin, temozolomide, topotecan, camptothecin, epirubicin, idarubicin, trabectedin, capecitabine, bendamustine, fludarabine, hydroxyurea, trastuzumab deruxtecan, and pharmaceutically acceptable salts thereof. 14. 14. id="p-14" id="p-14" id="p-14" id="p-14" id="p-14" id="p-14" id="p-14" id="p-14" id="p-14"
[0014] In some embodiments of the methods disclosed herein, the WEEI inhibitor is adavosertib or a pharmaceutically acceptable salt thereof.
BRIEF DESCRIPTION OF THE DRAWINGS . . id="p-15" id="p-15" id="p-15" id="p-15" id="p-15" id="p-15" id="p-15" id="p-15" id="p-15"
[0015] FIG. 1A shows positive and negative staining from the SLFNll immunohistochemistry (IHC) assay in DUl45 Xenograft (SLFNll-prof1cient) and HT29 xenograft tissue (SLFNl l-deficient), respectively. 16. 16. id="p-16" id="p-16" id="p-16" id="p-16" id="p-16" id="p-16" id="p-16" id="p-16" id="p-16"
[0016] FIG. 2A shows immunoblots for SLFNll and GAPDH in SLFNll wild-type (WT) and knockout (KO) DUl45 isogenic cells. KO 1 and KO 2 were two different CRISPR-KO clones. 17. 17. id="p-17" id="p-17" id="p-17" id="p-17" id="p-17" id="p-17" id="p-17" id="p-17" id="p-17"
[0017] FIG. 2B shows synergy scores (Loewe) resulting from treatment of wild-type SLFNll (WT) or SLFNll knockout DUl45 cell lines (K01 and K02) with a combination of gemcitabine (Gem.) and adavosertib. 18. 18. id="p-18" id="p-18" id="p-18" id="p-18" id="p-18" id="p-18" id="p-18" id="p-18" id="p-18"
[0018] FIG. 2C shows synergy scores (Loewe) resulting from treatment of wild-type SLFNll (WT) or SLFNll knockout DUl45 cell lines (K01 and K02) with etoposide (ETP) and adavosertib. 19. 19. id="p-19" id="p-19" id="p-19" id="p-19" id="p-19" id="p-19" id="p-19" id="p-19" id="p-19"
[0019] FIG. 2D shows survival curves of the indicated DNA damaging agents (gemcitabine, etoposide, camptothecin, cisplatin, and hydroxyurea) in the absence or presence of 0.36 uM adavosertib in DUl45 isogenic cells. . . id="p-20" id="p-20" id="p-20" id="p-20" id="p-20" id="p-20" id="p-20" id="p-20" id="p-20"
[0020] FIG. 3A shows log IC50 values of gemcitabine monotherapy in a panel of pancreatic cell lines that are either SLFNll-def1cient or SLFNll-prof1cient. 21. 21. id="p-21" id="p-21" id="p-21" id="p-21" id="p-21" id="p-21" id="p-21" id="p-21" id="p-21"
[0021] FIG. 3B shows log IC50 values of adavosertib monotherapy in a panel of pancreatic cell lines that are either SLFNl l-deficient or SLFNl l-proficient.
WO 2021/078925 PCT/EP2020/079856 22. 22. id="p-22" id="p-22" id="p-22" id="p-22" id="p-22" id="p-22" id="p-22" id="p-22" id="p-22"
[0022] FIG. 3C shows synergy scores for the combination of gemcitabine and adavosertib in a panel of pancreatic cell lines that are either SLFNll-def1cient or SLFNI l-proficient.
DETAILED DESCRIPTION 23. 23. id="p-23" id="p-23" id="p-23" id="p-23" id="p-23" id="p-23" id="p-23" id="p-23" id="p-23"
[0023] While embodiments of the invention are shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only.
Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein may be employed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
Definitions 24. 24. id="p-24" id="p-24" id="p-24" id="p-24" id="p-24" id="p-24" id="p-24" id="p-24" id="p-24"
[0024] The terms "treat," "treating," or "treatment," and other grammatical equivalents as used herein, include alleviating, abating or ameliorating a disease or condition or one or more symptoms thereof, ameliorating the underlying metabolic causes of symptoms, inhibiting the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition. 77 (C . . id="p-25" id="p-25" id="p-25" id="p-25" id="p-25" id="p-25" id="p-25" id="p-25" id="p-25"
[0025] The terms "administer," "administering, administration," and their grammatical equivalents, as used herein, refer to the methods used to deliver pharmaceutical compositions disclosed herein to the desired site of biological action. 77 (C 26. 26. id="p-26" id="p-26" id="p-26" id="p-26" id="p-26" id="p-26" id="p-26" id="p-26" id="p-26"
[0026] The terms "co-administer," "co-administration, administered in combination with" and their grammatical equivalents, as used herein, are meant to encompass administration of the active agents to a single individual, and, unless specified otherwise, include treatment regimens in which the agents are administered by the same or different route of administration or at the same or different times. They include simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which one or more active agents are present. 27. 27. id="p-27" id="p-27" id="p-27" id="p-27" id="p-27" id="p-27" id="p-27" id="p-27" id="p-27"
[0027] The term "pharmaceutically acceptable," as used herein, refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the active agent, and is relatively nontoxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. 28. 28. id="p-28" id="p-28" id="p-28" id="p-28" id="p-28" id="p-28" id="p-28" id="p-28" id="p-28"
[0028] The term "pharmaceutically acceptable salt," as used herein, refers to salts that retain the biological efficacy of the free acid or base of the active agent and that are not biologically or 4 WO 2021/078925 PCT/EP2020/079856 otherwise undesirable. The active agents may react with inorganic or organic bases, or inorganic or organic acids, to form a pharmaceutically acceptable salt. These salts can be prepared in situ during the final isolation and purification, or separately by reacting the purified compounds with a suitable inorganic or organic base, or inorganic or organic acid, and isolating the salt thus formed. 29. 29. id="p-29" id="p-29" id="p-29" id="p-29" id="p-29" id="p-29" id="p-29" id="p-29" id="p-29"
[0029] The terms "patient," "subject," and "individual" are used interchangeably herein. As used herein, they refer to humans suffering from cancer. . . id="p-30" id="p-30" id="p-30" id="p-30" id="p-30" id="p-30" id="p-30" id="p-30" id="p-30"
[0030] As used herein, the term "the expression level of SLFNll is" some amount, e. g. 0%, means that the stated amount of cancer cells in the patient’s cancer tissue express SLFNI 1.
Similarly, as used herein, the term "the expression level of SLFNll is <" some amount, e.g. %, means that less than the stated amount of cancer cells in the patient’s cancer tissue express SLFNI l. 31. 31. id="p-31" id="p-31" id="p-31" id="p-31" id="p-31" id="p-31" id="p-31" id="p-31" id="p-31"
[0031] As used herein, the term "SLFNl l-deficient" refers to an expression level of SLFNll in the relevant patient, animal, tissue, cell, etc. that is inadequate to exhibit the normal phenotype associated with the gene, or for the protein to exhibit its physiological function. In the context of preclinical models, cells or animals in which the SLFNll gene is knocked out (K0) are examples of "SLFNl l-deficient." 32. 32. id="p-32" id="p-32" id="p-32" id="p-32" id="p-32" id="p-32" id="p-32" id="p-32" id="p-32"
[0032] As used herein, the term "SLFN-ll proficient" refers to an expression level of SLFNll in the relevant patient, animal, tissue, cell, etc. that is adequate to exhibit the normal phenotype associated with the gene, or for the protein to exhibit its physiological function. In the context of preclinical models, cells or animals in which the SLFNll gene is expressed at normal levels, i.e., wild-type (WT) cells or animals, are examples of "SLFNl l-proficient." Methods of treatment 33. 33. id="p-33" id="p-33" id="p-33" id="p-33" id="p-33" id="p-33" id="p-33" id="p-33" id="p-33"
[0033] In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining whether the patient’s cancer cells are SLFNl l-deficient, and, c) if the patient’s cancer cells are SLFNI l-deficient, co- administering a WEEI inhibitor and a DNA-damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFNll expression. 34. 34. id="p-34" id="p-34" id="p-34" id="p-34" id="p-34" id="p-34" id="p-34" id="p-34" id="p-34"
[0034] In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining whether SLFNll expression is lower in the patient’s cancer cells relative to the patient’s SLFNl l-expressing non- cancer cells, and, c) if SLFNll expression is lower in the patient’s cancer cells relative to the patient’s SLFNI l-expressing non-cancer cells, co-administering a WEEI inhibitor and a DNA- WO 2021/078925 PCT/EP2020/079856 damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. . . id="p-35" id="p-35" id="p-35" id="p-35" id="p-35" id="p-35" id="p-35" id="p-35" id="p-35"
[0035] In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer; b) determining the expression level of SLFN11 in the patient’s cancer cells; and, c) if the expression level of SLFN11 is < 25%, co- administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining the expression level of SLFN11 in the patient’s cancer cells, and, c) if the expression level of SLFN11 is < 20%, co-administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining the expression level of SLFN11 in the patient’s cancer cells, and, c) if the expression level of SLFN11 is < 15%, co-administering a WEE1 inhibitor and a DNA- damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer, b) determining the expression level of SLFN11 in the patient’s cancer cells, and, c) if the expression level of SLFN11 is < 10%, co-administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co- administered if the expression level of SLFN11 is < 9%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 8%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 7%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 6%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 5%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is < 4%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 3%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is < 2%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 1%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is 0%. 36. 36. id="p-36" id="p-36" id="p-36" id="p-36" id="p-36" id="p-36" id="p-36" id="p-36" id="p-36"
[0036] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether the WO 2021/078925 PCT/EP2020/079856 patient’s cancer cells are SLFN11-deficient, and, b) if the patient’s cancer cells are SLFN1 1- deficient, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. 37. 37. id="p-37" id="p-37" id="p-37" id="p-37" id="p-37" id="p-37" id="p-37" id="p-37" id="p-37"
[0037] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN1 1- expressing non-cancer cells, and, b) if SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN11-expressing non-cancer cells, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient. In some embodiments, the patient’s cancer cells are negative for SLFN11 expression. 38. 38. id="p-38" id="p-38" id="p-38" id="p-38" id="p-38" id="p-38" id="p-38" id="p-38" id="p-38"
[0038] In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells, and, b) if the expression level of SLFN11 is < %, co-administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells, and, b) if the expression level of SLFN11 is < 20%, co- administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells, and, b) if the expression level of SLFN11 is < 15%, co- administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, disclosed herein is a method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells, and, b) if the expression level of SLFN11 is < 10%, co- administering a WEE1 inhibitor and a DNA-damaging agent to the patient. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 9%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is < 8%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 7%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is < 6%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 5%. In some embodiments, a WEE1 inhibitor and a DNA- WO 2021/078925 PCT/EP2020/079856 damaging agent are co-administered if the expression level of SLFN11 is < 4%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 3%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is < 2%. In some embodiments, a WEE1 inhibitor and a DNA-damaging agent are co-administered if the expression level of SLFN11 is < 1%. In some embodiments, a WEE1 inhibitor and a DNA- damaging agent are co-administered if the expression level of SLFN11 is 0%. 39. 39. id="p-39" id="p-39" id="p-39" id="p-39" id="p-39" id="p-39" id="p-39" id="p-39" id="p-39"
[0039] In the methods disclosed herein, the expression level of SLFN11 may be determined by any suitable method known to those of ordinary skill in the art. In some embodiments, the expression level of SLFN11 is determined by mRNA transcript levels or DNA promoter hypermethylation. In some embodiments, the expression level of SLFN11 is determined by immunohistochemistry, mass spectrometry, in-situ hybridization, NanoString, reverse transcription quantitative polymerase chain reaction (RT-qPCR), microarray analysis, bisulf1te sequencing, or quantitative methylation-specific polymerase chain reaction (Q-MSP). In a specific embodiment, the expression level of SLFN11 is determined by immunohistochemistry (IHC).
Diseases 40. 40. id="p-40" id="p-40" id="p-40" id="p-40" id="p-40" id="p-40" id="p-40" id="p-40" id="p-40"
[0040] The methods described herein are applicable to the treatment of a variety of cancers.
In some embodiments, the cancer is selected from the group consisting of pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, lung cancer, colorectal cancer, colon cancer, rectal cancer, prostate cancer, breast cancer, brain cancer, cervicocerebral cancer, esophageal cancer, thyroid cancer, stomach cancer, gallbladder cancer, liver cancer, choriocarcinoma, uterus body cancer, uterocervical cancer, kidney cancer, bladder cancer, testicular cancer, skin cancer, neuroblastoma, osteosarcoma, Ewing’s sarcoma, leukemia, Hodgkin’s lymphoma, acute myeloid leukemia, diffuse large B-cell lymphoma, and head and neck cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is platinum resistant ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is breast cancer.
WEE1 Inhibitors 41. 41. id="p-41" id="p-41" id="p-41" id="p-41" id="p-41" id="p-41" id="p-41" id="p-41" id="p-41"
[0041] Adavosertib has the chemical name 2-allyl-( l -[6-(l -hydroxy- l -methylethyl)pyrindin- 2-yl]-6-{ [4-(4-methylpiperazin- l -yl)phenyl]amino}- l ,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin- 3-one and the following chemical structure: WO 2021/078925 PCT/EP2020/079856 42. 42. id="p-42" id="p-42" id="p-42" id="p-42" id="p-42" id="p-42" id="p-42" id="p-42" id="p-42"
[0042] AdaVosertib’s activity as an inhibitor of WEE1, utility in treating Various cancers, and synthesis are described in U.S. Patent No. 7,834,019. Various crystalline forms of adavosertib are described in U.S. Patent Nos. 8,703,779 and 8,198,281. In some embodiments, the WEE1 inhibitor administered in methods described herein is adavosertib or a pharmaceutically acceptable salt thereof. In some embodiments, the WEE1 inhibitor administered in methods described herein is adavosertib. 43. 43. id="p-43" id="p-43" id="p-43" id="p-43" id="p-43" id="p-43" id="p-43" id="p-43" id="p-43"
[0043] 3-(2,6-dichlorophenyl)-4-imino-7-[(2'-methyl-2',3'-dihydro-1'H-spiro[cyclopropane- 1,4'-isoquinolin]-7'-yl)amino]-3,4-dihydropyrimido[4,5-d]pyrimidin-2(1H)-one is a WEE1 inhibitor with the following chemical structure: CI N 11 " N NH Cl HN / N x J\ N N H 44. 44. id="p-44" id="p-44" id="p-44" id="p-44" id="p-44" id="p-44" id="p-44" id="p-44" id="p-44"
[0044] 3-(2,6-dichlorophenyl)-4-imino-7-[(2'-methyl-2',3'-dihydro-1'H-spiro[cyclopropane- 1,4'-isoquinolin]-7'-yl)amino]-3,4-dihydropyrimido[4,5-d]pyrimidin-2(1H)-one’s activity as an inhibitor of WEE1, utility in treating cancer, and synthesis are described in U.S. Patent No. 8,436,004. In some embodiments, the WEE1 inhibitor administered in methods described herein is 3-(2,6-dichlorophenyl)-4-imino-7-[(2'-methyl-2',3'-dihydro-1'H-spiro[cyclopropane- 1,4'-isoquinolin]-7'-yl)amino]-3,4-dihydropyrimido[4,5-d]pyrimidin-2(1H)-one.
DNA-Damaging Agents 45. 45. id="p-45" id="p-45" id="p-45" id="p-45" id="p-45" id="p-45" id="p-45" id="p-45" id="p-45"
[0045] As used herein, a "DNA-damaging agent" or "DDA" is a cancer treatment that functions by causing damage to the DNA of cancer cells. DDAs act Via a Variety of mechanisms, including DNA crosslinking, interference with DNA replication, and inhibition of DNA synthesis. Non-limiting examples of DDAs that may be used in the methods described herein include gemcitabine, etoposide, cisplatin, carboplatin, oxaliplatin, picoplatin, methotrexate, doxorubicin, daunorubicin, 5-fluorouracil, irinotecan, mitomycin, temozolomide, topotecan, camptothecin, epirubicin, idarubicin, trabectedin, capecitabine, bendamustine, WO 2021/078925 PCT/EP2020/079856 fludarabine, hydroxyurea, trastuzumab deruxtecan, and pharmaceutically acceptable salts thereof.
Combination Therapies 46. 46. id="p-46" id="p-46" id="p-46" id="p-46" id="p-46" id="p-46" id="p-46" id="p-46" id="p-46"
[0046] In some embodiments, WEE1 inhibitors and DDAs co-administered in the methods disclosed herein are co-administered with one or more additional cancer therapies. A physician is capable of determining the one or more additional cancer therapies to co-administer to a patient depending on the particular characteristics of the patient and cancer being treated. The one or more additional cancer therapies may be administered concurrent with, prior to, or after administration of the WEE1 inhibitor and DDAs according to the methods described herein. In some embodiments, the one or more additional cancer therapies are selected from ionizing radiation, tubulin interacting agents, kinesin spindle protein inhibitors, spindle checkpoint inhibitors, poly(ADP-ribose) polymerase inhibitors, matrix metalloproteinase inhibitors, protease inhibitors, proteasome inhibitors, Bcl-2 inhibitors, heat shock protein modulators, histone deacetylase inhibitors, antiestrogens, selective estrogen receptor modulators, antiandrogens, LHRH agonists, Soc-reductase inhibitors, cytochrome P450 C17 lyase inhibitors, aromatase inhibitors, EGFR kinase inhibitors, dual erbBl and erbB2 inhibitors, ABL kinase inhibitors, VEGFR-l inhibitors, VEGFR-2 inhibitors, polo-like kinase inhibitors, aurora kinase inhibitors, JAK inhibitors, c-MET kinase inhibitors, cyclin-dependent kinase inhibitors, PI3K inhibitors, and mTOR inhibitors.
EXAMPLE S 47. 47. id="p-47" id="p-47" id="p-47" id="p-47" id="p-47" id="p-47" id="p-47" id="p-47" id="p-47"
[0047] The examples provided below further illustrate and exemplify the present disclosure and do not limit in any way the scope of the claims.
Example 1: Development of an FFPE IHC assay that is specific for SLFN11 and characterization of DU145 SLFN11 KO cell lines.
Methods 48. 48. id="p-48" id="p-48" id="p-48" id="p-48" id="p-48" id="p-48" id="p-48" id="p-48" id="p-48"
[0048] Knockout of SLFNll in DU145 prostate cancer cells was performed by CRISPR/Cas9. sgRNAS targeting SLFNll in exon 4 (GCGTTCCATGGACTCAAGAGAGG, protospacer adjacent motif bolded) were designed with in-house CRISPR3 software, synthesized by Integrated DNA Technology (IDT), and cloned into a vector containing CAS9 and a GFP cassette (azPGEO2-Cas9-T2A-GFP). The vector was subsequently transfected into DU145 prostate cancer cells using Lipofectamine 3000 (Thermofisher Scientific). After 48 hours, cell pools with the highest green fluorescent protein (GFP) expression were single cell sorted into 96-well plates. Clones that had lost their wild-type allele were expanded to obtain cell lines WO 2021/078925 PCT/EP2020/079856 from single clones. Two SLFN11-deficient clones were profiled and selected for pharmacological studies (clone K01 and clone K02). Cell lysates from SLFN11-proficient (wt) and from SLFN11-deficient (K01 and K02) were prepared and analyzed by standard SDS- PAGE immunoblotting. The antibodies used for immunoblotting detection were: anti-SLFN11 antibody (ab121731, 111000, Abcam) and, as loading control, anti-GAPDH antibody (14C10, 1:2ooo, CST). 49. 49. id="p-49" id="p-49" id="p-49" id="p-49" id="p-49" id="p-49" id="p-49" id="p-49" id="p-49"
[0049] DU145 (SLFN11-proficient) and HT29 (SLFN11-deficient) xenografts were grown according to the AstraZeneca Global Bioethics policy, UK Home Office legislation and the Animal Scientific Procedures Act 1986 (ASPA). SLFN11 immunohistochemistry was performed on 4 uM thick tumor sections of formalin fixed paraffin embedded tissues and carried out on Bond RX (Leica Microsystems) using ER1 antigen retrieval. Slides were stained with primary rabbit polyclonal anti-SLFN11 antibody (Abcam, ab121731) at 0.5 ug/ml for sections from xenograft tissue and at 2.5 ug/ml for sections from human tissue. Digital slides were acquired with the Aperio AT2 scanner (Leica) using a 20X objective. 0 50. 50. id="p-50" id="p-50" id="p-50" id="p-50" id="p-50" id="p-50" id="p-50" id="p-50" id="p-50"
[0050] SLFN11 immunohistochemistry of SLFN11-positive DU145 and SLFN11-negative HT29 tissue confirmed the respective presence and absence of SLFN11 in these two models (FIG. 1A).
Example 2: Resistance to DDA in DU145 SLFN11 K0 cells can be reversed by combination treatment with a WEE1 inhibitor.
Methods 51. 51. id="p-51" id="p-51" id="p-51" id="p-51" id="p-51" id="p-51" id="p-51" id="p-51" id="p-51"
[0051] Adavosertib was synthesized at AstraZeneca. Gemcitabine, cisplatin, hydroxyurea (HU), and etoposide were obtained from Tocris, and camptothecin from Sigma. Stock solutions of gemcitabine (50 mM), cisplatin (1.67 mM) and HU (1M) were prepared in aqueous solution; all other drugs were dissolved at 10 mM concentration in dimethylsulfoxide (DMSO) (10 mM). 52. 52. id="p-52" id="p-52" id="p-52" id="p-52" id="p-52" id="p-52" id="p-52" id="p-52" id="p-52"
[0052] DU145 isogenic cells (WT and SLFN11 K0) were seeded in 384-well plates and allowed to settle overnight. FIG. 2A shows immunoblots for SLFN11 WT and K0 DU145 isogenic cells used in the experiments. K0 1 and K0 2 were two different CRISPR-K0 clones.
Cells were dosed with compound solutions in a 6x6 concentration matrix, with top doses of 3 uM adavosertib, 0.1 uM gemcitabine, and 1 uM etoposide, using an Echo 555 (LabCyte). Five days following continuous treatment, cell viability was determined by live-dead SyTox green assay (Life Technologies, Carlsbad, CA, USA). The number of live cells was calculated by subtracting the dead and total reads. Using this methodology, cell numbers per well were also determined at the point of treatment (day 0). Data are shown using the equation [1-(Ti-Tz)/(C- 11 WO 2021/078925 PCT/EP2020/079856 Tz)] X100 for values for which TiZTz and [l-(Ti-Tz)/Tz] X100 for concentrations for which Ti cells. This gives a 0-200% scale of live cell number, where 0-100% represents growth inhibition and l00-200% represents cell killing. 53. 53. id="p-53" id="p-53" id="p-53" id="p-53" id="p-53" id="p-53" id="p-53" id="p-53" id="p-53"
[0053] Combination activity (synergism) was calculated using the Loewe dose-additivity model in Genedata Screener (Genedata, Basel, Switzerland) software. This model calculates the expected result if the effects of the two compounds were additive based upon the two monotherapies. The excess score reflects how much above the predicted additive effect the experimental result is. The program provides a synergy score for the combination, which reflects both the strength of the excess score, and the dose dependency. A score >5 is deemed synergistic. 54. 54. id="p-54" id="p-54" id="p-54" id="p-54" id="p-54" id="p-54" id="p-54" id="p-54" id="p-54"
[0054] For cell survival experiment in 96 well plate, cells were seeded in 96-well plates, following compound dosing using a HP dispenser. 72 hours later, cell viability was determined with end-point CellTiter-Glo luminescent assays (Promega). Percentage growth was calculated using the equation (T-T0)/(C-T0) x 100, where T = compound-treated cells, T0 = cells at 0 h time point and C = control cells. Dose response curves were plotted in GraphPad prism.
E 55. 55. id="p-55" id="p-55" id="p-55" id="p-55" id="p-55" id="p-55" id="p-55" id="p-55" id="p-55"
[0055] Combination treatment with adavosertib and gemcitabine or etoposide consistently produced higher synergy scores in SLFNll KO cells when compared to wild-type, SLFNl l- proficient cells (FIG. 2B and 2C, respectively). The higher synergy scores indicate that the combination treatments with a WEEI inhibitor and a DDA are more effective in SLFNll KO cells relative to wild-type cells, relative to the effect of the monotherapies with either agent. The combination synergy experiment was validated by lower throughput assay formats. The results are shown in FIG. 2D for combination of different indicated DDAs (gemcitabine, etoposide, camptothecin, cisplatin, and hydroxyurea) with adavosertib. In all cases, SLFNll KO cells (dotted grey lines) were found resistant to each of the DDAs when compared to wild type cells (continuous grey lines). Combination of DDA with adavosertib did not add significant antiproliferative effect in the SLFNl l-proficient cells (solid black lines). In SLFNll KO cells, however, the same combinations led to a significant curve-shift compared to the DDA monotherapy in SLFNll deficient cells (shown in dotted black line), confirming that these cells can be completely re-sensitized to DDA treatment by co-administering adavosertib. 12 WO 2021/078925 PCT/EP2020/079856 Example 3: Resistance to gemcitabine in SLFN11-deficient cell lines can be reversed by combination treatment with a WEE1 inhibitor.
Methods 56. 56. id="p-56" id="p-56" id="p-56" id="p-56" id="p-56" id="p-56" id="p-56" id="p-56" id="p-56"
[0056] SLFN11 RNA seq data (log2 RPKM values) were downloaded from cancer cell line encyclopedia (CCLE) (Barretina J. et al., Nature, 2012, 483: 603-607) and drug response data (log(IC5o) and area under the dose-response curve (AUCs)) from drug sensitivity in cancer database (Yang W et al., Nucleic Acids Res, 2013, 41: D955-61). Cell lines with CCLE RNA seq log2 RPKM values below 1 were defined as SLFN11-deficient and cell lines with log2 RPKM values above 1 as SLFN11-proficient. Nineteen pancreatic cell lines in 384-well plates were dosed with increasing concentrations of adavosertib and gemcitabine in a 6x6 concentration matrix using an Echo 555 (LabCyte). The dose range was 0 - 3 uM for adavosertib, and 0 - 0.3 uM for gemcitabine, in both cases dilutions 1:3 from the top dose were performed. Five days following continuous treatment, cell viability was determined by live- dead SyTox green assay (Life Technologies, Carlsbad, CA, USA). Synergy was analyzed in Genedata screener software using the Loewe dose-additivity model as described above.
E 57. 57. id="p-57" id="p-57" id="p-57" id="p-57" id="p-57" id="p-57" id="p-57" id="p-57" id="p-57"
[0057] The results presented in Example 2 were validated in a panel of pancreatic cancer cell lines. In this panel, upon dose response treatments with gemcitabine monotherapy, SLFN11- deficient cell lines were found on average 100 times less sensitive than the SLFN11-proficient cells (FIG. 3A). SLFN11-deficient and SLFN11-proficient pancreatic cancer cell lines showed the same response to adavosertib monotherapy treatment (FIG. 3B). However, combination treatment with gemcitabine and adavosertib was significantly more synergistic in SLFN11- deficient than SLFN11-proficient pancreatic cancer cells (FIG. 3C). The results indicate that combination therapy with a WEE1 inhibitor and a DDA is expected to be more effective in patients with SLFN11-deficient cancer cells compared to monotherapy with the WEE1 inhibitor or DDA. 13 WO 2021/078925 PCT/EP2020/079856 1/7 FIG. 1A PC: D145 xenor NC: HT29 xensgraffi ‘ aw, y » V‘ V V V V V stmmal cells Synergy scores SLFNM GAPDH FIG. 2B 0VVTOKO1VKO2 * O " - O V " . _ .....o.o-g--p-u--o-o—..........o 0...
T Gem./Adavosertib WO 2021/078925 PCT/EP2020/079856 3/7 FIG. 2C OVVFO K01‘? K02 " 3": E 10- 0 $3 3 > 0') O I o__ O T.
ETP/Adavosertib WO 2021/078925 PCT/EP2020/079856 4/7 WWW WI’ FIG. 2D W W KO : WI’ + Adavosertib - - KO + Adavosertib 100 E E > ._ L 2 :3 5o-- .3 $ $ 100 Gemcitabine [nM] Etoposide MM] 100 100 E .2 E E .2 :3 5o-- 5 5o_ 3 ‘'2 °\ 0 0- 100 Camptothecin [n M] Cisplatin [pm] 100 E .2 S to 50-- $ 0' Wm M 1 mm KO -— WT 4- Adavosertib HVd|'0XVUTe3 [HM] - - KO +AdavosertEb WO 2021/078925 PCT/EP2020/079856 /7 FIG. 3A N IOQ {C53 Gemcitabine mm] C? -2 SLFN11 Proficient Deficient log |C50 Adavosertib [uM] 6/7 FIG. 3B O O O O O O O O I I Proficient Deficient Loewe synergy SCOTB SLFN11 7/7 FIG. 3C Pancreatic cell lines Gemcitabine - Adavosertib * C o<°>O' T: 0 o -5 C -10 Proficient Deficient WO 2021/078925 PCT/EP2020/079856

Claims (33)

1. A method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer; b) determining whether the patient’s cancer cells are SLFNl 1-deficient; and; c) if the patient’s cancer cells are SLFNI l-deficient; co-administering a WEEl inhibitor and a DNA-damaging agent to the patient.
2. A method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer; b) determining whether SLFNll expression is lower in the patient’s cancer cells relative to the patient’s SLFNl l-expressing non-cancer cells; and; c) if SLFNll expression is lower in the patient’s cancer cells relative to the patient’s SLFNl l-expressing non-cancer cells; co-administering a WEEl inhibitor and a DNA-damaging agent to the patient.
3. The method of claim 1 or 2; wherein the patient’s cancer cells are negative for SLFNll expression.
4. The method of any one of claims 1 to 3; wherein the expression level of SLFNll is determined by immunohistochemistry; mass spectrometry; in-situ hybridization; NanoString; reverse transcription quantitative polymerase chain reaction (RT-qPCR); microarray analysis; bisulfite sequencing; or quantitative methylation-specific polymerase chain reaction (Q-MSP).
5. The method of any one of claims 1 to 3; wherein the expression level of SLFNll is determined by immunohistochemistry.
6. A method of treating cancer in a patient comprising: a) selecting a patient diagnosed with cancer; b) determining the expression level of SLFNll in the patient’s cancer cells; and; c) if the expression level of SLFNll is < 10%; co-administering a WEEl inhibitor and a DNA-damaging agent to the patient.
7. The method of claim 6; wherein the expression level of SLFNll is 0%. 14 WO 2021/078925 PCT/EP2020/079856
8. The method of claim 6 or 7, wherein the expression level of SLFN11 is determined by immunohistochemistry, mass spectrometry, in-situ hybridization, NanoString, reverse transcription quantitative polymerase chain reaction (RT-qPCR), microarray analysis, bisulfite sequencing, or quantitative methylation-specific polymerase chain reaction (Q-MSP).
9. The method of claim 6 or 7, wherein the expression level of SLFN11 is determined by immunohistochemistry.
10. A method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether the patient’s cancer cells are SLFN11-deficient, and, b) if the patient’s cancer cells are SLFN11-deficient, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient.
11. A method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining whether SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN11-expressing non-cancer cells, and, b) if SLFN11 expression is lower in the patient’s cancer cells relative to the patient’s SLFN11-expressing non-cancer cells, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient.
12. The method of claim 10 or 11, wherein the patient’s cancer cells are negative for SLFN11 expression.
13. The method of any one of claims 10 to 12, wherein the expression level of SLFN11 is determined by immunohistochemistry, mass spectrometry, in-situ hybridization, NanoString, reverse transcription quantitative polymerase chain reaction (RT-qPCR), microarray analysis, bisulfite sequencing, or quantitative methylation-specific polymerase chain reaction (Q-MSP).
14. The method of any one of claims 10 to 12, wherein the expression level of SLFN11 is determined by immunohistochemistry. 15 WO 2021/078925 PCT/EP2020/079856
15. A method of treating cancer in a patient that is resistant to treatment with a DNA-damaging agent, comprising: a) determining the expression level of SLFN11 in the patient’s cancer cells; and, b) if the expression level of SLFN11 is < 10%, co-administering a WEE1 inhibitor with the DNA-damaging agent to the patient.
16. The method of claim 15, wherein the expression level of SLFN11 is 0%.
17. The method of claim 15 or 16, wherein the expression level of SLFN11 is determined by immunohistochemistry, mass spectrometry, in-situ hybridization, NanoString, reverse transcription quantitative polymerase chain reaction (RT-qPCR), microarray analysis, bisulfite sequencing, or quantitative methylation-specific polymerase chain reaction (Q-MSP).
18. The method of claim 15 or 16, wherein the expression level of SLFN11 is determined by immunohistochemistry.
19. The method of any one of claims 1 to 18, wherein the cancer is selected from the group consisting of pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, lung cancer, colorectal cancer, colon cancer, rectal cancer, prostate cancer, breast cancer, brain cancer, cervicocerebral cancer, esophageal cancer, thyroid cancer, stomach cancer, gallbladder cancer, liver cancer, choriocarcinoma, uterus body cancer, uterocervical cancer, kidney cancer, bladder cancer, testicular cancer, skin cancer, neuroblastoma, osteosarcoma, Ewing’s sarcoma, leukemia, Hodgkin’s lymphoma, acute myeloid leukemia, diffuse large B-cell lymphoma, and head and neck cancer.
20. The method of any one of claims 1 to 18, wherein the cancer is ovarian cancer.
21. The method of any one of claims 1 to 18, wherein the cancer is platinum resistant ovarian cancer.
22. The method of any one of claims 1 to 18, wherein the cancer is endometrial cancer.
23. The method of any one of claims 1 to 18, wherein the cancer is pancreatic cancer. 16 WO 2021/078925 PCT/EP2020/079856
24. The method of any one of claims 1 to 18, wherein the cancer is breast cancer.
25. The method of any one of the preceding claims, wherein the DNA-damaging agent is selected from the group consisting of gemcitabine, etoposide, cisplatin, carboplatin, oxaliplatin, picoplatin, methotrexate, doxorubicin, daunorubicin, 5-fluorouracil, irinotecan, mitomycin, temozolomide, topotecan, camptothecin, epirubicin, idarubicin, trabectedin, capecitabine, bendamustine, fludarabine, hydroxyurea, trastuzumab deruxtecan, and pharmaceutically acceptable salts thereof.
26. The method of any one of the preceding claims, wherein the DNA-damaging agent is selected from the group consisting of gemcitabine, etoposide, camptothecin, cisplatin, hydroxyurea, and pharmaceutically acceptable salts thereof.
27. The method of any one of the preceding claims, wherein the DNA-damaging agent is gemcitabine or a pharmaceutically acceptable salt thereof.
28. The method of any one of claims 1 to 25, wherein the DNA-damaging agent is trastuzumab deruxtecan.
29. The method of any one of the preceding claims, wherein the WEEI inhibitor is adavosertib or a pharmaceutically acceptable salt thereof.
30. The method of any one claims 1 to 24, wherein the DNA-damaging agent is gemcitabine or a pharmaceutically acceptable salt thereof, and the WEEI inhibitor is adavosertib or a pharmaceutically acceptable salt thereof.
31. The method of any one of claims 1 to 24, wherein the DNA-damaging agent is trastuzumab deruxtecan, and the WEEI inhibitor is adavosertib or a pharmaceutically acceptable salt thereof.
32. The method of claim 30, wherein 175 mg adavosertib is administered to the patient on days 1, 2, 8, 9, l5, and 16, and 800 mg/m2 gemcitabine or a pharmaceutically acceptable salt thereof is administered to the patient on days 1, 8, and 15 on a 28-day cycle. 17 WO 2021/078925 PCT/EP2020/079856
33. The method of claim 30, wherein 175 mg adavosertib is administered to the patient on days 1, 2, 8, 9, 15, and 16, and 1,000 mg/m2 gemcitabine or a pharmaceutically acceptable salt thereof is administered to the patient on days 1, 8, and 15 on a 28-day cycle. 18
IL292348A 2019-10-25 2020-10-23 Methods of treating cancer IL292348A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962926055P 2019-10-25 2019-10-25
PCT/EP2020/079856 WO2021078925A1 (en) 2019-10-25 2020-10-23 Methods of treating cancer

Publications (1)

Publication Number Publication Date
IL292348A true IL292348A (en) 2022-06-01

Family

ID=73030090

Family Applications (1)

Application Number Title Priority Date Filing Date
IL292348A IL292348A (en) 2019-10-25 2020-10-23 Methods of treating cancer

Country Status (12)

Country Link
US (1) US20220387468A1 (en)
EP (1) EP4048277A1 (en)
JP (1) JP2022554157A (en)
KR (1) KR20220088896A (en)
CN (1) CN114599399A (en)
AU (1) AU2020369996A1 (en)
BR (1) BR112022007609A2 (en)
CA (1) CA3158274A1 (en)
IL (1) IL292348A (en)
MX (1) MX2022004934A (en)
TW (1) TW202131925A (en)
WO (1) WO2021078925A1 (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR060635A1 (en) 2006-04-27 2008-07-02 Banyu Pharma Co Ltd DERIVATIVES OF 1,2-DIHIDRO-3H-PIRAZOLO [3,4-D] PIRIMIDIN-3-ONA, PHARMACEUTICAL COMPOSITIONS THAT INCLUDE THEM AND THEIR USE IN THE TREATMENT OF CANCER
EP2155752B1 (en) 2007-04-25 2018-09-19 Merck Sharp & Dohme Corp. Polymorph of dihydropyrazolopyrimidinone derivative as weel kinase.inhibitor
ES2608940T3 (en) 2007-06-15 2017-04-17 Msd K.K. Bicycloaniline derivative
DK2477628T3 (en) 2009-09-15 2014-11-24 Merck Sharp & Dohme Preparation of crystalline hemihydratformer of dihydropyrazolopyrimidinon
SG11201908788YA (en) * 2017-03-31 2019-10-30 Seattle Genetics Inc Combinations of chk1- and wee1 - inhibitors
AU2018289512A1 (en) * 2017-06-20 2020-02-06 Memorial Sloan-Kettering Cancer Center Quantifying SLFN11 protein for optimal cancer therapy

Also Published As

Publication number Publication date
TW202131925A (en) 2021-09-01
CA3158274A1 (en) 2021-04-29
JP2022554157A (en) 2022-12-28
AU2020369996A1 (en) 2022-06-02
EP4048277A1 (en) 2022-08-31
WO2021078925A1 (en) 2021-04-29
US20220387468A1 (en) 2022-12-08
MX2022004934A (en) 2022-05-16
KR20220088896A (en) 2022-06-28
BR112022007609A2 (en) 2022-07-19
CN114599399A (en) 2022-06-07

Similar Documents

Publication Publication Date Title
US20210000824A1 (en) Intermittent dosing of mdm2 inhibitor
JP2022520079A (en) Pharmaceutical combination containing TNO155 and KRASG12C inhibitor
JP2023159152A (en) Compositions and methods for treating cancer
AU2009277179A1 (en) Methods for regulating cell mitosis by inhibiting serine/threonine phosphatase
WO2011069962A1 (en) Bibw 2992 for use in the treatment of triple negative breast cancer
BR112019016737A2 (en) COMBINED ANTICANCER THERAPY
JP2021527039A (en) Treatment of malignant lymphomatous disorders
Gwak et al. Combined action of the dinuclear platinum compound BBR3610 with the PI3‐K inhibitor PX‐866 in glioblastoma
US7947653B1 (en) Methods for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant cancers
CN113194946A (en) Compositions and methods for treating vascular ehler-dalos syndrome and related disorders
US20230255974A1 (en) Use of thyromimetics for the treatment of cancer
WO2018092064A1 (en) Combinations of mdm2 inhibitors and bcl-xl inhibitors
IL292348A (en) Methods of treating cancer
US20220356494A1 (en) Methods and compositions for treating cancer
CA2980611A1 (en) A method of treating neoplasias
Tenzer et al. Signal transduction inhibitors as radiosensitizers
US8323883B1 (en) Methods of assessing therapeutic benefits of patients having cancers resistant to epidermal growth factor receptor kinase inhibitors
WO2024086533A2 (en) Methods for treating or preventing neuroendocrine tumor formation using cdc7 inhibitors
EP4320244A1 (en) Means and methods for enhancing receptor-targeted gene transfer
Chandler Multi-omics Characterization of the Breast Cancer Radiation Response Identifies Apoptosis and Cell Cycle Proteins as Mediators of Radiation Resistance
Rossana et al. Thymic Malignancies in the Targeted Therapies Era
WO2023196545A1 (en) Cancer treatments using mta-cooperative prmt5 inhibitors
TW202202143A (en) Co-treatment with cdk4/6 and cdk2 inhibitors to suppress tumor adaptation to cdk2 inhibitors