IL279463A - Coronavirus derived peptides and uses thereof - Google Patents

Description

CORONAVIRUS DERIVED PEPTIDES AND USES THEREOF FIELD AND BACKGROUND OF THE INVENTION The present invention, in some embodiments thereof, relates to coronavirus-derived peptides and vaccines comprising same. In December 2019, a new respiratory disease, Coronavirus Disease (COVID-19), emerged in Wuhan, China, and rapidly spread throughout the world. COVID-19 is caused by the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV-2), which belongs to the beta coronavirus genus. Various studies have shown that viral antigens are proteolytically processed by infected cells into peptides and then bound to HLA molecules, to be presented to T cells. This ‘HLA peptidome’ serves as an immunological signature that can be selectively recognized by CD8+ and CD4+ T cells, via their TCR, potentially leading to cell lysis and catalyzing other immune responses. Efforts are, therefore, underway to develop vaccines and adoptive cell therapies in which T cells are reprogrammed with recombinant TCRs based on viral antigen profiles. Background art includes Nelde et al, 2020, Tsao et al., 2006, Cheung et al, 2007, Ohno et al., 2009, Sylvester-Hvid et al., 2004. SUMMARY OF THE INVENTION According to an aspect of the present invention there is provided a method of treating or preventing a coronavirus disease of a subject comprising administering to the subject an immunologically effective amount of a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51, wherein the peptide is selected according to the HLA profile of the subject as set forth in Table 4, thereby treating or preventing the coronavirus disease of the subject. According to an aspect of the present invention there is provided a method of treating a coronavirus disease of a subject comprising administering to the subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51, wherein the T cells are selected according to the HLA profile of the subject as set forth in Table 4, thereby treating the coronavirus disease of the subject.

According to an aspect of the present invention there is provided a population of T cells genetically modified to express a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51. According to an aspect of the present invention there is provided a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-for use in treating or preventing a coronavirus mediated disease in a subject, wherein the peptide is selected for treating the subject according to the HLA profile as set forth in Table 4. According to an aspect of the present invention there is provided an antibody comprising an antigen binding domain which is capable of binding a peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51 in an HLA restricted manner, wherein the HLA is according to Table 4. According to an aspect of the present invention there is provided a peptide-HLA complex, wherein the peptide comprises one of the amino acid sequences as set forth in SEQ ID NOs: 1-51 and the HLA is the corresponding HLA according to Table 4. According to an aspect of the present invention there is provided a vaccine comprising at least one peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51 and an adjuvant. According to an aspect of the present invention there is provided a method of treating or preventing COVID of a subject comprising administering to the subject an immunologically effective amount of a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-53, wherein the peptide is selected according to the HLA profile of the subject as set forth in Table 4, thereby treating or preventing the COVID. According to an aspect of the present invention, there is provided a composition comprising T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51, for use in treating or preventing a coronavirus mediated disease in a subject, wherein the peptide is selected for treating the subject according to the HLA profile as set forth in Table 4.

According to an aspect of the present invention there is provided a method of treating COVID of a subject comprising administering to the subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-53, wherein the T cells are selected according to the HLA profile of the subject as set forth in Table 4, thereby treating COVID of the subject. According to embodiments of the present invention, the peptide has an amino acid sequence as set forth in SEQ ID NOs: 1 or 2. According to embodiments of the present invention, the coronavirus disease is COVID. According to embodiments of the present invention, the coronavirus is selected from the group consisting of SARS-CoV-2, SARS-CoV, HCoV NL63, HKU1 and MERS-CoV. According to embodiments of the present invention, the TCR binds to a peptide having a sequence as set forth in SEQ ID NO: 1 in a complex with HLA-A*01:01 allele in the subject. According to embodiments of the present invention, the T cells are autologous to the subject. According to embodiments of the present invention, the T cells are non-autologous to the subject. According to embodiments of the present invention, the T cells are genetically modified to express the T cell receptor. According to embodiments of the present invention, the T cells comprise CD8+ T cells. Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings: FIG. 1. SARS-CoV-2 peptide identification pipeline. Based on the selection of the most frequent HLA-I alleles in the world population, B cell lines with mono-allelic or endogenous HLA-I expression were chosen. Cells were infected with SARS-CoV-or transduced with SARS-CoV-2 genes. An HLA-I and HLA-II peptidome analysis revealed recurrent peptides and presentation hotspots presented by the B cells. Some of identified peptides were cultured with peripheral blood mononuclear cell (PBMCs) from SARS-CoV-2-infected donors, eliciting a T cell response that was detected by binding to pHLA multimers. FIGs. 2A-C. The most frequent HLA-I alleles in the world population predicted to bind SARS-CoV-2 peptides. (A) The frequency of HLA-I alleles (A/B/C) in the countries containing the relevant allele. The most frequent alleles identified in the largest amount of countries are marked in red; these were used for further analysis. (B) Maximal number of selected HLA-A/B/C alleles from the number of countries they were selected in, which were used for further analysis. (C) The percentages of SARS-CoV-2 peptides from the Envelope, Membrane, Nucleocapsid and nspproteins that match the most frequent HLA-A/B/C allele are indicated. The allele with the best %rank binding prediction by NetMHCpan was assigned to each peptide. FIGs. 3A-C. Differently presented peptide repertoire in IHW1070 B cell line after infection with SARS-CoV-2. (A) Volcano plot of proteins identified in the proteomic analysis of the cells, comparing infected and non-infected IHW01070. Type I interferon response proteins are marked in red, beta proteasome subunits are marked in blue. (B-C) Volcano plots were plotted to identify the peptides that were differentially presented by the cell’s HLA-I and HLA-II molecules, of infected compared to the uninfected control. The red dots indicate proteins involved in immune regulation pathways, indicated in Table 5. FIG. 4. Identified SARS-CoV-2 peptides are predicted as strong and weak binders. The %rank of all predicted peptides (black) for each gene and allele pair, from which we identified peptides using HLA peptidomics, was plotted compared to the position of the peptide in the protein. The identified peptides are marked in red. FIGs. 5A-C. Presented SARS-CoV-2 peptides are immunogenic. (A) a map of all peptides previously found to be immunogenic in different studies (black). Our identified peptides were plotted above (red) and showing an overlap with the immunogenic peptides. (B) Heatmap displaying the CD8 T cell responses (n=4) detected in COVID-19 patients (n=3) including information about the magnitude of the response and disease status for each patient. (C) CD8 T cell recognition was assessed for the identified HLA-I peptides using fluorescent pHLA tetramers. Flow cytometry plots of detected SARS-CoV-2-specific CD8 T cell responses in COVID-patients. The magnitude of the response is defined as the percentage of double- positive pHLA+ cells of total CD8 cells. FIG. 6. Relative expression of SARS-CoV-2 genes in B cell lines. The relative expression of envelope, nucleocapsid, nsp6, membrane SARS-CoV-2 genes in LCL 721.221 mono-allelic cell lines and IHW1161 and IHW1070. The assay was performed in triplicates and normalized to GAPDH; the bars represent the mean ± SD. The statistical correlation of data between groups was analyzed by way of a Student’s t-test, significance: ***p<0.001, **p<0.01, *p<0.05. FIG. 7: The length distribution of SARS-CoV-2-derived peptides is similar to the expected length of HLA-I and HLA-II peptides. Presented is the length of SARS-CoV-2 HLA-I (red) and HLA-II (gray) peptides identified in the B cell lines. FIG. 8. SNPs in the SARS-CoV-2 genome. The percentage of sequences in which we found a SNP in the SARS-CoV-2 genomes was plotted for each position in the SARS-CoV-2 genes. FIGs. 9A-B. Gating strategy for SARS-CoV-2 pHLA multimer staining. (A) Heatmap displaying the total number of COVID-19 patients samples (n=15) checked for CD8 T cell recognition. Including information about the magnitude of the response and disease status for each patient. CD8 T cell recognition was assessed for the identified MHC class I epitopes (n=9) using fluorescent pHLA tetramers. (B) Flow cytometry gating strategy plots of detected SARS-CoV-2-specific CD8 T cell responses.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION The present invention, in some embodiments thereof, relates to coronavirus-derived peptides and vaccines comprising same. Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. T cells play central roles in orchestrating the immune response to the SARS-CoV-2 and impact disease severity and outcome. The viral antigens, which are proteolytically processed by infected cells into peptides and then bound to human leukocyte antigen (HLA) molecules, to be presented to T cells, serve as an immunological signature that can be selectively recognized by T cells via their T cell receptor (TCR). The SARS-CoV-2 ‘HLA peptidome’ is currently unknown. The present inventors utilized HLA-peptidomics to identify SARS-CoV-2-derived peptides presented on highly prevalent HLA class-I (HLA-I) molecules, using human B cell lines with endogenous or mono-allelic expression of HLA-I. 15 unique HLA-I peptides derived from the genes spike, envelope, membrane, nucleocapside and non-structural protein 6 (nsp6) were identified, together with 43 unique HLA class-II (HLA-II) peptides derived from the nucleocapside, envelope and membrane genes (see Table 4, herein below). Two HLA-I peptides derived from the envelope and nucleocapsid genes were found to be recurrently presented by two or three different cell lines, respectively. Overlapping peptides, from three different genes, created presentation hotspots, the longest of which, harboring 29 peptides, was derived from the membrane gene, and repeated (with variations) in three different cell lines. Such recurrent antigens should have great clinical value, as they may aid the development of effective, virus-specific, "off-the-shelf" therapies. 30 Furthermore, CD8 T cell-positive pHLA tetramers staining revealed CD8 T cell response targeting two HLA-I peptides, one which was recurrently identified in different B cell lines. The present inventors propose that these results will allow for the identification of cognate TCRs reactive to SARS-CoV-2-HLA-presented peptides, supporting the development of vaccines and adoptive cell therapies where T cells are reprogrammed with recombinant TCRs based on viral antigen profiles. Thus, according to a first aspect of the present invention, there is provided a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51. The peptides of this aspect of the present invention are derived from SARS-CoV-2 proteins – envelope protein, nuclocapsid protein, nonstructural protein 6 (nsp6) and membrane protein. In one embodiment, the peptide consists of a sequence selected from the group consisting of SEQ ID NOs: 1-51. The peptides of this aspect of the present invention may comprise one, two or three mutations (as compared to the sequences provided herein). Preferably, the mutation is one that still allows the peptide to be presented by the corresponding MHC molecule as summarized in Table 4, as further explained herein below. Thus, according to a particular embodiment, the peptide has a sequence at least 80 % identical, at least 81 % identical, at least 82 % identical, at least 83 % identical, at least % identical, at least 85 % identical, at least 86 % identical, at least 87 % identical, at least 88 % identical, at least 89 % identical, at least 90 % identical, at least 95 % identical, at least 96 % identical, at least 97 % identical, at least 98 % identical, at least % identical to one of the sequences as set forth in SEQ ID NOs: 1-51. The "percent identity" of two amino acid sequences may be determined using the algorithm of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST protein searches can be performed with the XBLAST program, score=50, word length=3 to obtain amino acid sequences homologous to the protein molecules of interest. Where gaps exist between two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecule described herein. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score 50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul S F et al., (1997) Nuc Acids Res 25: 3389 3402. Alternatively, PSI BLAST or PHI BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, PSI Blast and PHI Blast programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., National Center for Biotechnology Information (NCBI) on the worldwide web, ncbi.nlm.nih.gov). Another specific, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11 17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps, such that any software for protein sequence alignment can be used. In calculating percent identity, typically only exact matches are counted. In some embodiments, the one or more mutations are conservative mutations. In some embodiments, the one or more mutations are non-conservative mutations. In some embodiments, the one or more mutations are a mixture of conservative and non-conservative mutations. The may be a substitution, a deletion or an insertion. The term "peptide" as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder. Peptide bonds (-CO-NH-) within the peptide may be substituted, for example, by N-methylated amide bonds (-N(CH3)-CO-), ester bonds (-C(=O)-O-), ketomethylene bonds (-CO-CH2-), sulfinylmethylene bonds (-S(=O)-CH2-), -aza bonds (-NH-N(R)-CO-), wherein R is any alkyl (e.g., methyl), amine bonds (-CH2-NH-), sulfide bonds (-CH2-S-), ethylene bonds (-CH2-CH2-), hydroxyethylene bonds (-CH(OH)-CH2-), thioamide bonds (-CS-NH-), olefinic double bonds (-CH=CH-), fluorinated olefinic double bonds (-CF=CH-), retro amide bonds (-NH-CO-), peptide derivatives (-N(R)-CH2-CO-), wherein R is the "normal" side chain, naturally present on the carbon atom. These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) bonds at the same time. Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non-natural aromatic amino acids such as 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr. The peptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc). The term "amino acid" or "amino acids" is understood to include the naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2- aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L-amino acids. Tables 1 and 2 below list naturally occurring amino acids (Table 1), and non-conventional or modified amino acids (e.g., synthetic, Table 2) which can be used with some embodiments of the invention.

Table 1 Amino Acid Three-Letter Abbreviation One-letter SymbolAlanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic Acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V Any amino acid as above Xaa X Table 2 Non-conventional amino acid Code Non-conventional amino acid Code ornithine Orn hydroxyproline Hyp -aminobutyric acid Abu aminonorbornyl- carboxylate Norb D-alanine Dala aminocyclopropane- carboxylate Cpro D-arginine Darg N-(3-guanidinopropyl)glycine Narg D-asparagine Dasn N-(carbamylmethyl)glycine Nasn D-aspartic acid Dasp N-(carboxymethyl)glycine Nasp D-cysteine Dcys N-(thiomethyl)glycine Ncys D-glutamine Dgln N-(2-carbamylethyl)glycine Ngln D-glutamic acid Dglu N-(2-carboxyethyl)glycine Nglu D-histidine Dhis N-(imidazolylethyl)glycine Nhis D-isoleucine Dile N-(1-methylpropyl)glycine Nile D-leucine Dleu N-(2-methylpropyl)glycine Nleu D-lysine Dlys N-(4-aminobutyl)glycine Nlys D-methionine Dmet N-(2-methylthioethyl)glycine Nmet D-ornithine Dorn N-(3-aminopropyl)glycine Norn D-phenylalanine Dphe N-benzylglycine Nphe D-proline Dpro N-(hydroxymethyl)glycine Nser D-serine Dser N-(1-hydroxyethyl)glycine Nthr D-threonine Dthr N-(3-indolylethyl) glycine Nhtrp D-tryptophan Dtrp N-(p-hydroxyphenyl)glycine Ntyr D-tyrosine Dtyr N-(1-methylethyl)glycine Nval D-valine Dval N-methylglycine Nmgly D-N-methylalanine Dnmala L-N-methylalanine Nmala D-N-methylarginine Dnmarg L-N-methylarginine Nmarg D-N-methylasparagine Dnmasn L-N-methylasparagine Nmasn D-N-methylasparatate Dnmasp L-N-methylaspartic acid Nmasp D-N-methylcysteine Dnmcys L-N-methylcysteine Nmcys D-N-methylglutamine Dnmgln L-N-methylglutamine Nmgln D-N-methylglutamate Dnmglu L-N-methylglutamic acid Nmglu D-N-methylhistidine Dnmhis L-N-methylhistidine Nmhis D-N-methylisoleucine Dnmile L-N-methylisolleucine Nmile D-N-methylleucine Dnmleu L-N-methylleucine Nmleu D-N-methyllysine Dnmlys L-N-methyllysine Nmlys D-N-methylmethionine Dnmmet L-N-methylmethionine Nmmet D-N-methylornithine Dnmorn L-N-methylornithine Nmorn D-N-methylphenylalanine Dnmphe L-N-methylphenylalanine Nmphe D-N-methylproline Dnmpro L-N-methylproline Nmpro D-N-methylserine Dnmser L-N-methylserine Nmser D-N-methylthreonine Dnmthr L-N-methylthreonine Nmthr D-N-methyltryptophan Dnmtrp L-N-methyltryptophan Nmtrp D-N-methyltyrosine Dnmtyr L-N-methyltyrosine Nmtyr D-N-methylvaline Dnmval L-N-methylvaline Nmval L-norleucine Nle L-N-methylnorleucine Nmnle L-norvaline Nva L-N-methylnorvaline Nmnva L-ethylglycine Etg L-N-methyl-ethylglycine Nmetg L-t-butylglycine Tbug L-N-methyl-t-butylglycine Nmtbug L-homophenylalanine Hphe L-N-methyl-homophenylalanine Nmhphe -naphthylalanine Anap N-methyl- -naphthylalanine Nmanap penicillamine Pen N-methylpenicillamine Nmpen -aminobutyric acid Gabu N-methyl- -aminobutyrate Nmgabu cyclohexylalanine Chexa N-methyl-cyclohexylalanine Nmchexa cyclopentylalanine Cpen N-methyl-cyclopentylalanine Nmcpen -amino- -methylbutyrate Aabu N-methyl- -amino- -methylbutyrate Nmaabu -aminoisobutyric acid Aib N-methyl- - Nmaib aminoisobutyrate D- -methylarginine Dmarg L- -methylarginine Marg D- -methylasparagine Dmasn L- -methylasparagine Masn D- -methylaspartate Dmasp L- -methylaspartate Masp D- -methylcysteine Dmcys L- -methylcysteine Mcys D- -methylglutamine Dmgln L- -methylglutamine Mgln D- -methyl glutamic acid Dmglu L- -methylglutamate Mglu D- -methylhistidine Dmhis L- -methylhistidine Mhis D- -methylisoleucine Dmile L- -methylisoleucine Mile D- -methylleucine Dmleu L- -methylleucine Mleu D- -methyllysine Dmlys L- -methyllysine Mlys D- -methylmethionine Dmmet L- -methylmethionine Mmet D- -methylornithine Dmorn L- -methylornithine Morn D- -methylphenylalanine Dmphe L- -methylphenylalanine Mphe D- -methylproline Dmpro L- -methylproline Mpro D- -methylserine Dmser L- -methylserine Mser D- -methylthreonine Dmthr L- -methylthreonine Mthr D- -methyltryptophan Dmtrp L- -methyltryptophan Mtrp D- -methyltyrosine Dmtyr L- -methyltyrosine Mtyr D- -methylvaline Dmval L- -methylvaline Mval N-cyclobutylglycine Ncbut L- -methylnorvaline Mnva N-cycloheptylglycine Nchep L- -methylethylglycine Metg N-cyclohexylglycine Nchex L- -methyl-t-butylglycine Mtbug N-cyclodecylglycine Ncdec L- -methyl-homophenylalanine Mhphe N-cyclododecylglycine Ncdod -methyl- -naphthylalanine Manap N-cyclooctylglycine Ncoct -methylpenicillamine Mpen N-cyclopropylglycine Ncpro -methyl- -aminobutyrate Mgabu N-cycloundecylglycine Ncund -methyl-cyclohexylalanine Mchexa N-(2-aminoethyl)glycine Naeg -methyl-cyclopentylalanine Mcpen N-(2,2-diphenylethyl)glycine Nbhm N-(N-(2,2-diphenylethyl) carbamylmethyl-glycine Nnbhm N-(3,3-diphenylpropyl)glycine Nbhe N-(N-(3,3-diphenylpropyl) carbamylmethyl-glycine Nnbhe 1-carboxy-1-(2,2-diphenyl ethylamino)cyclopropane Nmbc 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid Tic phosphoserine pSer phosphothreonine pThr phosphotyrosine pTyr O-methyl-tyrosine 2-aminoadipic acid hydroxylysine The peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclization does not severely interfere with peptide characteristics (e.g. presentation by HLA), cyclic forms of the peptide can also be utilized. The peptides of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis. For solid phase peptide synthesis, a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973. For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965. In general, these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage. The protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound. By simple modification of this general procedure, it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide and so forth. Further description of peptide synthesis is disclosed in U.S. Pat. No. 6,472,505. A particular method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis. Large scale peptide synthesis is described by Andersson Biopolymers 2000;55(3):227-50. The present inventors have found that the peptides of this aspect of the present invention may act as T cell antigens. T cell antigens are presented on class I or II MHC receptor thus forming ternary complexes that can be recognized by a T-cells bearing a matching T-cell receptor binding to the MHC/peptide complex with appropriate affinity. Peptides binding to MHC class I molecules are typically about 8- 14 amino acids in length. T-cell epitopes that bind to MHC class II molecules are typically about 12-30 amino acids in length. In the case of peptides that bind to MHC class II molecules, the same peptide and corresponding T cell epitope may share a common core segment, but differ in the overall length due to flanking sequences of differing lengths upstream of the amino-terminus of the core sequence and downstream of its carboxy terminus, respectively. A T-cell epitope may be classified as an antigen if it elicits an immune response. The peptides described herein may be used in various forms (as described herein below) to treat and/or prevent diseases mediated by coronaviruses - e.g. COVID-19. Exemplary coronaviruses that may be targeted include SARS-CoV-2, SARS-CoV, HCoV NL63, HKU1 and MERS-CoV. According to a particular embodiment, the coronavirus is SARS-CoV-2. In one embodiment, the peptides are used as a vaccine. As used herein, the term "vaccine" refers to a pharmaceutical preparation (pharmaceutical composition) or product that upon administration induces an immune response, in particular a cellular immune response, which recognizes and attacks the virus or a diseased cell such as a virally infected cell. The vaccine may be used for the prevention or treatment of a coronavirus mediated disease such as COVID. The term "personalized vaccine" or "individualized vaccine" concerns a particular patient and means that a vaccine is adapted to the needs or special circumstances of an individual patient. In one embodiment, the vaccine comprises at least one of the peptides as set forth in SEQ ID NOs: 1-51, or a nucleic acid, preferably RNA, encoding the peptide or polypeptide. The vaccines provided according to the invention when administered to a patient provide one or more T cell epitopes suitable for stimulating, priming and/or expanding T cells specific for the coronavirus. The T cells are preferably directed against cells expressing antigens from which the T cell epitopes are derived. Thus, the vaccines described herein are preferably capable of inducing or promoting a cellular response, preferably cytotoxic T cell activity, against the coronavirus. The vaccine can comprise one or more T cell epitopes described herein, such as 2 or more, 5 or more, 10 or more, 15 or more, 20 or more, 25 or more, 30 or more and preferably up to 60, up to 55, up to 50, up to 45, up to 40, up to 35 or up to 30 T cell epitopes. According to a particular embodiment, the T cell epitope consists of a sequence as set forth in any one of SEQ ID NOs: 1-53. According to a more particular embodiment, the T cell epitope consists of a sequence as set forth in any one of SEQ ID NOs: 1-51. The vaccines of the present invention may further comprise an adjuvant. The adjuvant serves to stimulate the immune system such that antigen presenting cells will phagocytize the peptides and present them on their surface. The term "adjuvant" as used herein refers to an agent that nonspecifically increases an immune response to a particular antigen thereby reducing the quantity of antigen necessary in any given vaccine and/or the frequency of injection necessary in order to generate an adequate immune response to the antigen of interest. Suitable adjuvants for use herein include, but are not limited to, poly IC; synthetic oligodeoxynucleotides (ODNs) with a CpG motif; modified polyinosinic:polycytidylic acid (Poly-IC) including, but not limited to, Poly-IC/LC (Hiltonol) and Poly-IC12U (Ampligen); Poly-K; carboxymethyl cellulose (CMC); Adjuvant 65 (containing peanut oil, mannide monooleate, an aluminum monostearate); Freund's complete or incomplete adjuvant; mineral gels such as aluminum hydroxide, aluminum phosphate, and alum; surfactants such as hexadecylamine, octadecylamine, lysolecithin, dimethyldioctadecylammonium bromide, N,N-dioctadecyl-N',N''-bis(2-hydroxymethyl)propanediamine, methoxyhexadecylglyerol and pluronic polyols; polyanions such as pyran, dextran sulfate, polyacrylic acid, and carbopol; peptides such as muramyl dipeptide, dimethylglycine and tuftsin; and oil emulsions. The adjuvants of the present invention may include nucleic acids based on inosine and cytosine such as poly I:poly C; poly IC; poly dC; poly dI; poly dIC; Poly-IC/LC; Poly-K; and Poly-IC12U as well as oligodeoxynucleotides (ODNs) with a CpG motif, CMC and any other combinations of complementary double stranded IC sequences or chemically modified nucleic acids such as thiolated poly IC as described in U.S. Pat. Nos. 6,008,334; 3,679,654 and 3,725,545. The present invention further contemplates vaccines of antigen presenting cells which are pre-loaded with the viral antigens that are described herein. Antigen presenting cells (APC) are cells which present peptide fragments of protein antigens in association with MHC molecules on their cell surface. Some APCs may activate antigen specific T cells. According to a particular embodiment, the APCs used in the vaccine of the present invention expresses MHC class I and MHC class II molecules. Preferably, the APC can also stimulate CD4+ helper T cells as well as cytotoxic T cells. Examples of APCs include, but are not limited to dendritic cells, macrophages, Langerhans cells and B cells. Dendritic cells (DCs) are leukocyte populations that present antigens captured in peripheral tissues to T cells via both MHC class II and I antigen presentation pathways. It is well known that dendritic cells are potent inducers of immune responses and the activation of these cells is a critical step for the induction of antiviral immunity. Dendritic cells are conveniently categorized as "immature" and "mature" cells, which can be used as a simple way to discriminate between two well characterized phenotypes. However, this nomenclature should not be construed to exclude all possible intermediate stages of differentiation. Immature dendritic cells are characterized as antigen presenting cells with a high capacity for antigen uptake and processing, which correlates with the high expression of Fcgamma receptor and mannose receptor. The mature phenotype is typically characterized by a lower expression of these markers, but a high expression of cell surface molecules responsible for T cell activation such as class I and class II MHC, adhesion molecules (e.g. CD54 and CD11) and costimulatory molecules (e.g., CD40, CD80, CD86 and 4-BB). Dendritic cell maturation is referred to as the status of dendritic cell activation at which such antigen-presenting dendritic cells lead to T cell priming, while presentation by immature dendritic cells results in tolerance. Dendritic cell maturation is chiefly caused by biomolecules with microbial features detected by innate receptors (bacterial DNA, viral RNA, endotoxin, etc.), pro-inflammatory cytokines (TNF, IL-1, IFNs), ligation of CD40 on the dendritic cell surface by CD40L, and substances released from cells undergoing stressful cell death. The dendritic cells can be derived by culturing bone marrow cells in vitro with cytokines, such as granulocyte-macrophage colony-stimulating factor (GM-CSF) and tumor necrosis factor alpha. In one embodiment, the vaccine comprises dendritic cells derived from a patient’s own cells. In one protocol, a large amount of peripheral blood mononuclear cells (PBMCs) are harvested from the patient via an invasive leukapheresis process. Monocytes are then isolated from PBMCs and differentiated into DCs. These monocyte-derived DCs (moDCs) are loaded with viral antigens, matured and injected back to the patient. Currently, several antigen loading approaches have been used in DC vaccine production. Protein- or virus lysate-loading provides the possibility to present multiple antigenic epitopes without being restricted by a subject's MHC haplotype. Peptide-pulsing is a simple approach to load DCs with viral antigen for presentation to CD8+ T cells, in which the MHC-restricted viral antigenic peptides bind directly to the MHC class I molecule without going through the antigen processing pathways. Nucleic acid-based antigen loading approach may extend antigen presentation duration in DCs. In this approach, viral antigen-coding DNA or RNA are delivered into DCs and the expression of these viral antigen-coding nucleic acids may provide an endogenous supply of cytosolic viral antigens that incline to be presented via endogenous pathway. The antigen presentation efficiency using such approach depends largely on high-level transgene expression in DCs. For DNA-based antigen loading, viral vectors tend to be used. For RNA-based antigen loading, viral antigen- coding RNA can be delivered via electroporation into the DC cytoplasm, where the RNA is translated to produce viral antigens. MHC (or HLA)-restricted peptides of this aspect of the present invention may serve as antigens to generate antibodies which are capable of binding the peptides in an HLA restricted manner. As used herein "binding" or "binds" refers to an antibody-antigen mode of binding, which is generally, in the case of clinically relevant TCRLs, and in this case in the range of KD below 5 nM (e.g., 3.5-4.9 nM), as determined by Surface Plasmon Resonance assay (SPR). The affinity of the antibody to its antigen may be determined by Surface Plasmon Resonance (SPR) using a captured or immobilized monoclonal antibody (MAb) format to minimize contribution of avidity. For affinity evaluation, the antigen may be used in its soluble form. As used herein the term "KD" refers to the equilibrium dissociation constant between the antigen binding domain and its respective antigen. The term "antibody" as used in this invention includes intact molecules e.g., IgG as well as fragments thereof. According to a specific embodiment, the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab')2 fragments, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VL that are capable of binding to the peptides disclosed herein in an HLA restricted manner. As used herein, the "variable regions" and "CDRs" may refer to variable regions and CDRs defined by any approach known in the art, including combinations of approaches. According to a specific embodiment, the CDRs are determined according to Kabat et al. (supra). According to a specific embodiment, the antibody is a humanized antibody.

According to a specific embodiment, the antibody is a chimeric antibody. As used herein "a chimeric antibody" refers to an antibody in which at least one chain is of a non-human (e.g., murine) animal and a constant region [e.g., constant region e.g., CL (kappa or lambda)] is human. Thus, for example, the antibody can be a full antibody or a fragment thereof in which both chains comprise non-human variable regions and human constant regions. According to another example, one chain is humanized and another chain comprises non-human variable regions and human constant regions. A bi-specific configuration of a chimeric antibody is described hereinbelow. Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse in this case, having the desired specificity, affinity and potency (cell killing). In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. The humanized antibody comprises all of the CDR regions corresponding to those of a non-human immunoglobulin and all or substantially all of the FR regions of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)]. Other agents used in the arsenal for treating coronovirus (e.g. SARS-CoV-2) infections include T cell populations that are capable of binding to the peptide epitopes described herein for adoptive cell therapy (ACT). Exemplary T cell populations include CD8+ T cells and/or CD4+ T cells. ACT refers to the transfer of cells, most commonly immune-derived cells, back into the same patient or into a new recipient host with the goal of transferring the immunologic functionality and characteristics into the new host. If possible, use of autologous cells helps the recipient by minimizing GVHD issues. In one embodiment TCRs are selected for administering to a subject based on binding to at least one of the peptides as identified herein. In one embodiment T cells are expanded using methods known in the art. Expanded T cells that expressing coronavirus specific TCRs may be administered back to a subject. In another embodiment PBMCs are transduced or transfected with polynucleotides for expression of TCRs and administered to a subject. T cells expressing TCRs specific to coronavirus (e.g. SARS-CoV-2) specific antigens are expanded and administered back to a subject. In one embodiment T cells that express TCRs for the coronavirus (e.g. SARS-CoV-2) specific antigens uncovered herein, that result in cytolytic activity when incubated with the virus or virally infected cells are expanded and administered to a subject. Thus, for example the present invention contemplates use of T cell populations comprising T cell receptors that can bind to at least one of the peptide epitopes having the sequences as set forth in SEQ ID NOs: 1-51 in an HLA restricted manner, as described in Table 4, herein below. Alternatively, or additionally, the present invention contemplates use of T cell populations expressing chimeric antibodies (CAR-T cells) on the surface thereof that can bind to at least one of the peptide epitopes having the sequences as set forth in SEQ ID NOs: 1-51 and have antigenic specificity towards the corresponding peptides when presented with their corresponding HLA. The phrase "antigenic specificity," as used herein, means that the TCR (or antibody) can specifically bind to and immunologically recognize the peptide target, with high avidity. For example, a TCR may be considered to have "antigenic specificity" for the specific peptide target if T cells expressing the TCR secrete at least about 200 pg/mL or more (e.g., 200 pg/mL or more, 300 pg/mL or more, 4pg/mL or more, 500 pg/mL or more, 600 pg/mL or more, 700 pg/mL or more, 10pg/mL or more, 5,000 pg/mL or more, 7,000 pg/mL or more, 10,000 pg/mL or more, 20,000 pg/mL or more, or a range defined by any two of the foregoing values) of IFN-gamma upon co-culture with (a) antigen-negative corresponding HLA target cells pulsed with a low concentration of target peptide (e.g., about 0.05 ng/mL to about ng/mL, 0.05 ng/mL, 0.1 ng/mL, 0.5 ng/mL, 1 ng/mL, 5 ng/mL, or a range defined by any two of the foregoing values of SEQ ID NOs: 1-51) or (b) antigen-negative HLA-A target cells into which a nucleotide sequence encoding the mutated target has been introduced such that the target cell expresses the particular peptide. Cells expressing the inventive TCRs may also secrete IFN-gamma upon co-culture with antigen-negative corresponding HLA target cells pulsed with higher concentrations of target peptide. Alternatively or additionally, a TCR may be considered to have "antigenic specificity" for a peptide target if T cells expressing the TCR secrete at least twice as much IFN-gamma upon co-culture with (a) antigen-negative HLA corresponding target cells pulsed with a low concentration of target peptide or (b) antigen-negative HLA corresponding target cells into which a nucleotide sequence encoding the peptide target has been introduced such that the target cell expresses the peptide target as compared to the amount of IFN-gamma expressed by a negative control. The negative control may be, for example, (i) T cells expressing the TCR, co-cultured with (a) antigen-negative HLA corresponding target cells pulsed with the same concentration of an irrelevant peptide (e.g., some other peptide with a different sequence from the mutated target peptide) or (b) antigen-negative HLA corresponding target cells into which a nucleotide sequence encoding an irrelevant peptide has been introduced such that the target cell expresses the irrelevant peptide, or (ii) untransduced T cells (e.g., derived from PBMC, which do not express the TCR) co- cultured with (a) antigen-negative HLA corresponding target cells pulsed with the same concentration of target peptide or (b) antigen-negative HLA corresponding target cells into which a nucleotide sequence encoding the peptide target has been introduced such that the target cell expresses the target peptide. IFN-gamma secretion may be measured by methods known in the art such as, for example, enzyme-linked immunosorbent assay (ELISA). Alternatively or additionally, a TCR may be considered to have "antigenic specificity" for a mutated target if at least twice as many of the numbers of T cells expressing the TCR secrete IFN-gamma upon co-culture with (a) antigen-negative HLA corresponding target cells pulsed with a low concentration of target peptide or (b) antigen-negative HLA corresponding target cells into which a nucleotide sequence encoding the peptide target has been introduced such that the target cell expresses the peptide target as compared to the numbers of negative control T cells that secrete IFN-gamma. The concentration of peptide and the negative control may be as described herein with respect to other aspects of the invention. The numbers of cells secreting IFN-gamma may be measured by methods known in the art such as, for example, ELISPOT. Methods of engineering T cells to express recombinant T cell receptors for treatment of disease are disclosed in Ping et al Protein Cell. 2018 Mar; 9(3): 254–266. The invention provides a TCR comprising two polypeptides (i.e., polypeptide chains), such as an alpha (alpha) chain of a TCR, a beta chain of a TCR, a gamma (gamma) chain of a TCR, a delta (delta) chain of a TCR, or a combination thereof. The polypeptides of the inventive TCR can comprise any amino acid sequence, provided that the TCR has antigenic specificity for the peptide target. In an embodiment of the invention, the TCR comprises two polypeptide chains, each of which comprises a variable region comprising a complementarity determining region (CDR)1, a CDR2, and a CDR3 of a TCR. As well as CDRs, the TCRs disclosed herein also comprise V regions and J regions The T cell populations may be genetically modified to express a T cell receptor that binds to at least one of the peptides as disclosed herein The TCRs (and antibodies) of the invention of the invention can comprise synthetic amino acids in place of one or more naturally-occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, alpha-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4- carboxyphenylalanine, beta-phenylserine beta-hydroxyphenylalanine, phenylglycine, alpha-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, alpha-aminocyclopentane carboxylic acid, alpha- aminocyclohexane carboxylic acid, alpha-aminocycloheptane carboxylic acid, .alpha.- (2-amino-2-norbornane)-carboxylic acid, alpha, gamma-diaminobutyric acid, alpha, beta-diaminopropionic acid, homophenylalanine, and alpha-tert-butylglycine. The TCRs (and antibodies) of the invention (including functional variants thereof) can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated. The TCRs (and antibodies) of the invention can be obtained by methods known in the art such as, for example, de novo synthesis. Also, polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4.sup.th ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012). Alternatively, the TCRs, polypeptides, and/or proteins described herein (including functional variants thereof) can be commercially synthesized by companies, such as Synpep (Dublin, Calif.), Peptide Technologies Corp. (Gaithersburg, Md.), and Multiple Peptide Systems (San Diego, Calif.). In this respect, the inventive TCRs, polypeptides, and proteins can be synthetic, recombinant, isolated, and/or purified. Included in the scope of the invention are conjugates, e.g., bioconjugates, comprising any of the inventive TCRs, polypeptides, or proteins, nucleic acids, recombinant expression vectors, host cells, populations of host cells, and antibodies, or antigen binding portions thereof. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art. An embodiment of the invention provides a nucleic acid comprising a nucleotide sequence encoding any of the TCRs (or antibodies) described herein. "Nucleic acid," as used herein, includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. In an embodiment, the nucleic acid comprises complementary DNA (cDNA). It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions. Preferably, the nucleic acids of the invention are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication. The nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Green and Sambrook et al., supra. For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetyl cytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N-substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio- N.sup.6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, Colo.) and Synthegen (Houston, Tex.).

The nucleic acids of the invention can be incorporated into a recombinant expression vector. For purposes herein, the term "recombinant expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The inventive recombinant expression vectors can comprise any type of nucleotide, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector. The recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host cell. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, Calif.), the pET series (Novagen, Madison, Wis.), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, Calif.). Bacteriophage vectors, such as lamdaGT10, lamdaGT11, lamdaZapII (Stratagene), lamdaEMBL4, and lamdaNM1149, also can be used. Examples of plant expression vectors include pBI01, pBI101.2, pBI101.3, pBI121 and pBIN(Clontech). Examples of animal expression vectors include pEUK-C1, pMAM and pMAMneo (Clontech). Preferably, the recombinant expression vector is a viral vector, e.g., a retroviral vector. The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Green and Sambrook et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from Co1E, 2 .mu. plasmid, .lamda., SV40, bovine papillomavirus, and the like. Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host cell (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA-based. The recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein, or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus. The inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. The populations of coronavirus-reactive T cells expressing subject-specific TCRs or may be combined with a pharmaceutically acceptable carrier to obtain a pharmaceutical composition comprising a personalized cell population of coronavirus-reactive T cells. Preferably, the carrier is a pharmaceutically acceptable carrier. With respect to pharmaceutical compositions, the carrier can be any of those conventionally used for the administration of cells. Such pharmaceutically acceptable carriers are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which has no detrimental side effects or toxicity under the conditions of use. A suitable pharmaceutically acceptable carrier for the cells for injection may include any isotonic carrier such as, for example, normal saline (about 0.90% w/v of NaCl in water, about 300 mOsm/L NaCl in water, or about 9.0 g NaCl per liter of water), NORMOSOL R electrolyte solution (Abbott, Chicago, Ill.), PLASMA-LYTE A (Baxter, Deerfield, Ill.), about 5% dextrose in water, or Ringer's lactate. In an embodiment, the pharmaceutically acceptable carrier is supplemented with human serum albumen. The T cells can be administered by any suitable route as known in the art. Preferably, the T cells are administered as an intra-arterial or intravenous infusion, which preferably lasts approximately 30-60 min. Other examples of routes of administration include intraperitoneal, intrathecal and intralymphatic. T cells may also be administered by injection. For purposes of the invention, the dose, e.g., number of cells in the inventive cell population expressing subject specific TCRs, administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject over a reasonable time frame. For example, the number of cells should be sufficient to bind to a viral antigen, or detect, treat or prevent a disease mediated by the coronavirus in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain embodiments, the time period could be even longer. The number of cells will be determined by, e.g., the efficacy of the particular cells and the condition of the subject (e.g., human), as well as the body weight of the subject (e.g., human) to be treated. Many assays for determining an administered number of cells from the inventive cell population expressing subject specific TCRs are known in the art. For purposes of the invention, an assay, which comprises comparing the extent to which target cells are lysed or one or more cytokines such as, e.g., IFN-gamma and IL-2 are secreted upon administration of a given number of such cells to a subject, could be used to determine a starting number to be administered to a mammal. The extent to which target cells are lysed, or cytokines such as, e.g., IFN-gamma and IL-2 are secreted, upon administration of a certain number of cells, can be assayed by methods known in the art. Secretion of cytokines such as, e.g., IL-2, may also provide an indication of the quality (e.g., phenotype and/or effectiveness) of a cell preparation.

The number of the cells administered from the inventive cell population expressing subject specific TCRs may also be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular cell population. The vaccines, antibodies and T cell populations disclosed herein are capable of being used in combination with another therapeutic. Examples of therapeutics that can be used in conjunction with the vaccines disclosed herein include, but are not limited to CRX4 and CCR5 receptor inhibitors such as amantadine and rimantadine and pleconaril. Further antiviral agents that can be used include agents which interfere with viral processes that synthesize virus components after a virus invades a cell. Representative agents include nucleotide and nucleoside analogues that look like the building blocks of RNA or DNA, but deactivate the enzymes that synthesize the RNA or DNA once the analogue is incorporated. Remdesivir is also contemplated. Acyclovir is a nucleoside analogue, and is effective against herpes virus infections. Zidovudine (AZT), 3TC, FTC, and other nucleoside reverse transcriptase inhibitors (NRTI), as well as non-nucleoside reverse transcriptase inhibitors (NNRTI), can also be used. Integrase inhibitors can also be used. Other antiviral agents include antisense oligonucleotides and ribozymes (directed against viral RNA or DNA at selected sites). Some viruses, such as HIV, include protease enzymes, which cleave viral protein chains apart so they can be assembled into their final configuration. Protease inhibitors are another type of antiviral agent that can be used on diagnosis of a viral infection. The final stage in the life cycle of a virus is the release of completed viruses from the host cell. Some active agents, such as zanamivir (Relenza) and oseltamivir (Tamiflu) treat influenza by preventing the release of viral particles by blocking a molecule named neuraminidase that is found on the surface of flu viruses. Still other antiviral agents function by stimulating the patient's immune system are contemplated. Interferons, including pegylated interferons, are representative compounds of this class. The present invention further contemplates tetramers expressing the viral antigens disclosed herein (peptides having an amino acid sequences as set forth in SEQ ID NOs: 1-51). The tetramers can be used in a tetramer assay. The tetramers comprise the 4 copies of one of the peptides as set forth in SEQ ID NOs.1-51, each peptide being presented by the appropriate MHC molecule as summarized in Table 2. The tetramer is typically labeled with a fluorophore. Any cell (e.g. E. coli) may be used to synthesize the light chain and a shortened version of the heavy chain that includes a biotin amino acid recognition tag. For generation of tetramers. These MHC chains are biotinylated with the enzyme BirA and refolded with the antigenic peptide described herein. Fluorophore tagged streptavidin is added to the bioengineered MHC monomers, and the biotin-streptavidin interaction causes four MHC monomers to bind to the streptavidin and create a tetramer. Any of the therapeutic agents described herein may be provided to the subject per se or as part of a pharmaceutical composition. As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism. Herein the term "active ingredient" refers to the T cells and/or peptides accountable for the biological effect. Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not abrogate the biological activity and properties of the administered compound. The carrier may also include biological or chemical substances that modulate the immune response. Techniques for formulation and administration of drugs may be found in "Remington’s Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference. Suitable routes of administration include systemic delivery, including intramuscular, intradermic, subcutaneous, intravenous and intraperitoneal injections. Preferably, the pharmaceutical composition of the present invention is administered subcutaneously or intravenously.

In one embodiment, the pharmaceutical composition and the mode of delivery should be compatible with maintaining cell viability. Thus, the gauge of the syringe should be selected not to cause shearing and the pharmaceutical composition should not comprise any component toxic to cells etc. Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer or inert growth medium. The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (e.g. T cells, peptides) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., COVID-19) or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from animal studies. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans. Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.

The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1). Dosage amount and interval may be adjusted individually to provide sufficient immune activation to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations. Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks months or years or until cure is effected or diminution of the disease state is achieved. Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples. The amount of a composition/vaccine to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above. The active ingredient may be prepared in such a way that it may be viably transferred to a distant location. As used herein the term "about" refers to  10 % The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". The term "consisting of" means "including and limited to". The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts. As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition. When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,0nucleotides, alternatively, less than 1 in 10,000 nucleotides. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements. Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLESReference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference. MATERIALS AND METHODS Selection of most frequent HLA-I alleles in the world populationHLA-I alleles frequency in the world population was downloaded for each available country from the Allele frequency net database. All alleles with frequency above 0.05 were kept for further analysis, and the average frequency for each allele was calculated. The top 8 HLA-A (A*01:01, A*02:01, A*03:01, A*11:01, A*24:02, A*68:01, A*23:01 and A*33:03), 6 HLA-B (B*07:02, B*08:01, B*18:01, B*35:01, B*40:01 and B*51:01) and 6 HLA-C (C*01:02, C*03:04, C*04:01, C*06:02, C*07:01 and C*07:02) alleles that have the highest average frequency and found in the highest number of populations were selected and used for further analyses (Figure 2A). Together these alleles cover at least one of the HLA-A/B/C top allele of each population, and in most cases more than one of the top alleles (Figure 2B). Cells lines EBV-transformed B-cells were purchased from the IHWG Cell and DNA Bank. LCL 721.221 HLA-I null cells were purchased from the ATCC. All cell lines were tested regularly and were found negative for mycoplasma contamination (EZ-PCR Mycoplasma Kit, Biological Industries). All cells were maintained in RPMI 1640 containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, glutamine and sodium pyruvate. HLA typing Genomic DNA for 721.221 cell lines was extracted from 2*10 cells. DNA samples were typed for six loci: HLA-A, -B, -C, -DPB1, -DQB1 and DRB1, using the MX6-1 NGS typing kit (GenDx). HLA typing information is found in Table 3. This table describe the cells used in the study and their endogenous HLA expression and overexpressed HLA alleles. HLA marked in bold are the most frequent alleles in the world population. The SARS-CoV-2 genes overexpressed in the cells are indicated.

Table 3 Cells Endogenous HLA-I alleles Overexpressed HLA-I allele Endogenous HLA-II alleles Gene IHW010 A*01:01, A*02:01, B*08:01, B*40:01, C*07:01 , C*04: - DPA1*01:03, DPB1*04:02, DPB1*04:DQA1*02:01, DQA1*03:01, DQB1*03:02, DQB1*03:DRB1*07:01, DRB1*04: E M N nsp IHW011 A*01:01, A*68:01, B*08:01, B*13:02, C*07:01 , C*03: - DPA1*01:03, DPA1*02:01, DPB1*04:01, DPB1*14:DQA1*01:02, DQA1*02:01, DQB1*02:01, DQB1*06:DRB1*07:01, DRB1*15: E N 721.221 C*01:02 A*01:01 DRB1*01: E M N A*24:02M nsp A*03:01E M N A*11:01E M N B*07:02 N Pooled stable expression of HLA-I alleles in 721.221 cells DNA sequences coding for HLA-I alleles were taken from the IPD-IMGT/HLA database and purchased as synthetic dsDNA from Twist bioscience. Coding sequence was cloned into pCDH-CMV-MCS-EF1 α-Neo vector (SBI, #CD514B-1) and lentiviral particles were produced by co-transfection with envelope and packaging plasmids (PMD2.G and psPAX2) into HEK293T cells using Lipofectamine 2000 (Invitrogen). At 48 hours post transfection, the virus containing media was harvested, filtered, aliquoted and stored at -80˚C. Human B-LCL 721.221 (HLA-I null) were infected, and after 72 hours were selected with neomycin (G418). Pooled stable expression SARS-CoV-2 protein expressing B cells To produce the lentivirus of SARS-CoV-2 envelope, nuclocapsid, nonstructural protein-6 and membrane protein, pLVX-EF1alpha-IRES-Puro plasmids (Gordon et al., 2020) were co-transfected with pCMV-VSV-G and psPAX2 helper plasmids using Lipofectamine 2000 (Life Technologies) into HEK293T-cells. The cells were seeded at 2.5×10per T75 flask. Virus-containing medium was collected hours after transfection, filtered, aliquotted and stored at -80 °C. IHW1161, IHW1070 and 721.221 mono-allelic B cells were infected with the virus for 48 hours and then selected with Puromycin. The expression of the viral genes was confirmed by quantitative PCR assay. Quantitative PCR assayTotal RNA was extracted from cells by using RNeasy Mini Kit (Cat: 74107, QIAGEN), which was then converted into cDNA using iScript reverse Transcription Supermix (Bio-Rad), according to the manufacturer's instruction. Real-time PCR analysis was performed in triplicate using Fast SYBR Green Master Mix (cat: 4385612, appliedbiosystems). The reaction condition was 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 sec and annealing/elongation step at °C for 30 sec. The relative expression was analyzed by the 2 −ΔΔCT method. Envelope: F- TCAGAAGAAACCGGGACACT (SEQ ID NO: 59), R- TGCCAGAAACAAGAGCACAG (SEQ ID NO: 60), Nucleocapsid: F- CGAGGACAGGGTGTACCAAT (SEQ ID NO: 61), R- ACCATCTCCACCTCTGATGC (SEQ ID NO: 62), nsp6: F- CGACCAGGCTATTTCCATGT (SEQ ID NO: 63), R- CCCTCTCGCCAAAAACATAA (SEQ ID NO: 64), Membrane: F-TATTCCTTTGGCTCCTGTGG (SEQ ID NO: 65), R- GCCGCCAGTTATCCAGTTTA (SEQ ID NO: 66). Production and purification of membrane HLA molecules Cell pellets were homogenized by pipetting on ice with a lysis buffer containing 0.25 % sodium deoxycholate, 0.2 mM iodoacetamide, 1 mM EDTA, 1:2Protease Inhibitor Cocktail (Sigma-Aldrich, P8340), 1 mM PMSF and 1% octyl-b-D glucopyranoside in PBS. Samples were then incubated in rotation at 4˚C for 1 hour. The lysates were cleared by centrifugation at 48,000 g for 60 minutes at 4˚C and then passed through a pre-clearing column containing Protein-A Sepharose beads. HLA-I molecules were immunoaffinity purified from cleared lysate with the pan-HLA-I antibody (W6/32 antibody purified from HB95 hybridoma cells) covalently bound to Protein-A Sepharose beads. HLA-II molecules were then purified by transferring the flow-through to similar affinity columns containing a pan-HLA-II antibody (purified from HB-145 hybridoma cells). Affinity columns were washed first with 400 mM NaCl, 20 mM Tris–HCl and then with 20 mM Tris–HCl pH 8.0. The HLA-peptide complexes were then eluted with 1% trifluoracetic acid followed by separation of the peptides from the proteins by binding the eluted fraction to Sep-Pak (Waters). Elution of the peptides was done with 28% acetonitrile in 0.1% trifluoracetic acid for HLA-I and 32% acetonitrile in 0.1% trifluoracetic acid for HLA-II. Mass-spectrometry analysis of eluted HLA peptides ULC/MS grade solvents were used for all chromatographic steps. Each sample was solubilized in 12 µL 97:3 water: acetonitrile with 0.1% formic acid. Samples were loaded using split-less nano-Ultra Performance Liquid Chromatography (10 kpsi nanoAcquity; Waters, Milford, MA, USA). The mobile phase was: A) HO + 0.1% formic acid and B) acetonitrile + 0.1% formic acid. Desalting of the samples was performed online using a reversed-phase Symmetry C18 trapping column (180 µm internal diameter, 20 mm length, 5 µm particle size, Waters). The peptides were then separated using a T3 HSS nano-column (75 µm internal diameter, 250 mm length, 1.µm particle size; Waters) at 0.35 µL/minute. Peptides were eluted from the column into the mass spectrometer using the following gradient: 5% to 28%B in 120 minutes, 28% to 35%B in 15 minutes, 35% to 95% in 15 minutes, maintained at 95% for 10 minutes and then back to initial conditions. The nanoUPLC was coupled online through a nanoESI emitter (10 μm tip; New Objective, Woburn, MA, USA) to a quadrupole orbitrap mass spectrometer (Q Exactive Plus, Thermo Scientific) using a FlexIon nanospray apparatus (Proxeon). For the discovery experiments, data was acquired in data dependent acquisition (DDA) mode, using a Top20 method. MS1 resolution was set to 70,000 (at 400m/z), mass range of 300-1800m/z, automatic gain control (AGC) of 3e6 and maximum injection time was set to 100 msec. MS2 resolution was set to 17,500, quadrupole isolation 1.8m/z, AGC of 1e5, dynamic exclusion of 20 seconds and maximum injection time of 150 msec. Charge exclusion was set to ‘unassigned’, 4-8, greater than 8 and an exclusion list of singly charge, background ions.

Identification of SARS-CoV-2-derived HLA peptides SARS-CoV-2 proteome FASTA file of the infection experiment was generated according to the genome of the virus used for the infections (BetaCoV/Germany/BavPat1/2020 EPI_ISL_406862, GISAID Acc. No. EPI_ISL_406862). For the overexpressed genes, the protein sequences used derived from the SARS-CoV-2 reference genome (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, NCBI Reference Sequence: NC_045512.2). Human proteome was downloaded from UniProt. MS data was analyzed using MaxQuant (Cox and Mann, 2008) version 1.5.0.25. Enzyme specificity was set as "unspecific" and peptides’ FDR was set to 0.05. The "match between runs" option was disabled to avoid the matching of identifications across the samples. For the identification of SARS-CoV-2 derived peptides, as Leucine and Isoleucine residues are generally considered indistinguishable by MS, because their molecular masses are the same, all peptides in which replacing their I/L position (by either I/L) resulted in peptides that can be derived from a human origin were removed from the list. Peptides that have the same sequence (or with a change of I/L) as possible non-coding regions (https://www.gencodegenes.org/human/release_19.html) as well as possible pseudogenes (http://www.pseudogene.org/Human/Human90.txt) were also removed. NetMHCpan (Hoof et al., 2009; Jurtz et al., 2017; Nielsen and Andreatta, 2016) version 4.0 (http://www.cbs.dtu.dk/services/NetMHCpan/) and NetMHCIIpan (Jensen et al., 2018) version 3.(http://www.cbs.dtu.dk/services/NetMHCIIpan/) were used to check if the peptides can bind the patient’s HLA alleles. Peptides with %rank=< 2 or =<10 were kept for HLA-I and HLA-II, respectively. The binding of SARS-CoV-2 derived peptides was predecited also by MixMHCpred (peptide length: 8-14 for HLA-I and >=9 aa for HLA-II, peptides with %rank=<2 were determined as binders) (Bassani-Sternberg et al., 2017; Gfeller et al., 2018), HLAthena (HLA-I peptides, peptide length: 8-11, binders were determined according to columns 'best.MSi_allele' and 'assign.MSi_allele', %rank=<10) (Abelin et al., 2017b; Sarkizova et al., 2020b) and NeonMHC2 (HLA-II peptides, peptide length: >=9, %rank <=10) (Abelin et al., 2019b).

The identification of randomly selected peptides was validated by comparing their MS/MS spectra fragmentation to that of synthetic peptides (see methods: "Validation using synthetic peptides"). Human and SARS-CoV-2 derived peptides were clustered using Gibbs clustering, to see if they clustered according to the expected HLA binding motifs of the patient (see methods: "Gibbs clustering"). Hydrophobicity index calculation Sequence specific hydrophobicity index was calculated using the ssrc function from the R package specL v1.6.2 (Krokhin et al., 2004) with default parameters. Observed retention times (RT) were obtained from MaxQuant output file "msms.txt". Peptides’ RTs were plotted against the calculated hydrophobicity index. The measured RTs were regressed against the calculated hydrophobicity index using the lm function from the R package stats v3.6.2, in order to calculate the standard errors of the hydrophobicity index. The residual absolute errors of the lm-regression were plotted using a boxplot with a median and hinges (25% and 75%). The outliers were determined as residual absolute errors greater than 75th percentile + 1.5 * interquartile range (IQR). Validation using synthetic peptides Synthetic peptides (GenScript, 50 fmol/µl) were used to validate the peptides’ fragmentation. Peptides were analyzed in the same MS and conditions as the eluted peptide samples from cell lines. The MSnbase R package (Gatto and Lilley, 2012) was used to calculate the correlation between the matched y and b ions of the synthetic peptides and the endogenous peptides. Pearson correlation and dot product score are indicated for each comparison in the figure. SpectrumSimilarity function from the R package OrgMassSpecR was used to plot a head to tail figure of the endogenous and synthetic peptides fragmentation. Gibbs clustering Each set of peptides was clustered using the GibbsCluster 2.0 server (Andreatta et al., 2017; Andreatta et al., 2013) (cbsdotdtudotdk/services/GibbsCluster), with the "MHC class I ligands of length 8-13" parameters; the number of clusters was set to six and the trash cluster option was enabled. Since the number of peptides per allele is different, for alleles with a higher number of peptides (as the HLA-A alleles), the unbiased clustering sometimes resulted in more than one cluster for these alleles. In these cases, the number of clusters in which only one cluster per HLA allele received, was selected. The variation in the number of peptides per allele also resulted in clusters with mixed motifs that were similar. In these cases, the cluster was assigned to the allele that had the highest representation in the cluster and a note was added as to which other alleles are mixed within. For each cluster, the number of human- and SARS-CoV-2-derived peptides clustered to this allele was indicated. All motifs were generated by Seq2Logo 2.0 (Thomsen and Nielsen, 2012) (http://www.cbs.dtu.dk/biotools/Seq2Logo) with the default settings. In order to classify the clustered peptides into HLA alleles, the corresponding motif was first identified for each allele. This entailed retrieving all HLA-I epitopes registered under this allele from the Immune epitope database (IEDB, www.iedb.org) (Vita et al., 2019). All peptides annotated as positive in "MHC ligand assays" to the specific HLA-I allele and were 8-13 amino acids in length. The GibbsCluster 2.0 server was used to align the peptides using the "MHC class I ligands of length 8-13" parameters; the number of clusters was set to one and the trash cluster option was disabled. HLA alleles to which there were no peptides in the IEDB to create a representative logo for their motif were searched in HLAthena.tools (Sarkizova et al., 2020a). Flow cytometry B cell lines cells were stained with mouse monoclonal IgG1 anti-ACE2 antibody (cat: sc-390851, clone E-11, lot: D2420, Santa Cruz) or anti-TMPRSS2 (cat: sc-515727, clone:H-4, lot:D2420), followed by Alexa Fluor® 488 AffiniPure Goat Anti-Mouse IgG (cat: 115-545-146, lot: 138610). Flow cytometer (BD Biosciences) was used and the data was analyzed using FlowJo software (FlowJo, LLC). SARS-CoV-2 virus stock preparation SARS-CoV-2 virus (BetaCoV/Germany/BavPat1/2020 EPI_ISL_406862, GISAID Acc. No. EPI_ISL_406862) was kindly provided by Bundeswehr Institute of Microbiology, Munich, Germany. The virus was propagated (total 4 passages) and tittered on Vero E6 cells (Finkel et al., 2020; Yahalom-Ronen et al., 2020).

B cell viral infection with SARS-CoV-2 2x10 cells were centrifuged at 300 g for 5 minutes and washed once with RPMI without fetal bovine serum (FBS). Cell pellets were infected with SARS-CoV-virus at a multiplicity of infection (MOI) of 0.05 in RPMI medium supplemented with 2% fetal bovine serum (FBS), MEM non-essential amino acids, 2mM L- Glutamine, 100Units/ml Penicillin, 1% non-essential amino acid, 1% Na-pyruvate and µg per ml TPCK trypsin (Thermo scientific) at a final volume of 2 ml for 1 hour at ºC with gentle agitation every 15 minutes. After 1 hour of infection, additional ml of similar infection medium without TPCK trypsin were added and the infected cells and plated in two T-75 flasks for 24 hours in CO humidified incubator at 37   ºC, 5% CO. Following the 24 hours of infection, cells were centrifuged (300 g, minutes.) washed once with PBS and the cell pellet was stored at -70 ºC. Cell pellets were thawed, suspended in lysis buffer for 1 hour and stored on ice for 1 hour. SARS-CoV-2 B cell infection efficiency Immunofluorescence staining of IHW1070 B cell line was preformed using SARS CoV-2 specific antibodies (Finkel et al., 2020; Yahalom-Ronen et al., 2020). Briefly, cells were infected as described above and 24 hours later 1x10 cells were harvested by centrifugation (300g, 5 minutes), washed once with PBS and fixed with % paraformaldehyde (PFA) in PBS for 20 minutes. Cells were permeabilized with 0.5 % Triton X-100 for 2 minutes, blocked with PBS containing 2% FBS and stained with hyperimmune rabbit serum from intravenous (i.v.) SARS-CoV-2 infected rabbits, for 30 minutes, washed with PBS, and incubated with Alexa Fluor 488-conjugated secondary antibody. Nuclei were visualized by staining with 5 µg/ml of 4’,6-Diamidino-2-Phenylindole (DAPI). Images were acquired with a LSM 7confocal scanning microscope (Zeiss, Jena, Germany) microscope using a 10x objective. Infection rate was above 50 %. Blood samples from COVID-19 patients Peripheral blood samples from COVID-19 patients were collected in accordance with the Declaration of Helsinki after approval by the institutional review boards. Each participant signed informed consent. All COVID-19 patients were tested positive for SARS-CoV-2 using reverse transcriptase chain reaction (RT-PCR) from an upper respiratory tract (nose/throat) swab test in accredited laboratories. Peripheral blood samples were obtained during hospitalization from COVID-19 patients with mild and severe disease, and three months after confirmed infection from asymptomatic COVID-19 patients. Peripheral blood was collected in ethylenediaminetetraacetic acid (EDTA) tubes following subsequent isolation of PBMCs using Ficoll-Paque density centrifugation according to standard protocol. PBMCs were suspended in fetal bovine serum (FCS) with 10% dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. Generation of fluorescent pHLA tetramers MHC complexes were loaded with the peptides of interest via UV-induced peptide exchange, as described previously (Hadrup et al., 2009; Rodenko et al., 2006). Different fluorescent streptavidin (SA) conjugates were added to 10 μl of pHLA monomer (100 μg/ml): 0.6 μl of SA-APC (Invitrogen, S868), 1 μl of SA-BV750 (BD, custom), 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV480 (BD, 564876), 1 μl of SA-BUV615 (BD, 613013), 2 μl of SA-BUV395 (BD, 564176), 1.5 μl of SA-BUV563 (BD, 565765), 1.25 μl of SA-BV711 (BD, 563262), 1 μl of SA-BB790 (BD, custom), 1 μl of SA-BB630 (BD, custom) and 0.9 μl of SA-PE (Invitrogen, S866). For each pHLA monomer, conjugation was performed with two of the fluorescent SA conjugates. Next, milk (1% w/v, Sigma) was added to block unspecific peptide binding residues. After 30 minutes of incubating on ice, D-biotin (26.3 mM, Sigma) in PBS and NaN3 (0.02% w/v) was added to block residual biotin binding sites. The fluorescent pHLA tetramers were left overnight at 4°C before using them. Surface staining with pHLA tetramers and antibodiesPBMCs were thawed, washed and re-suspended in 1 ml complete RPMI (cRPMI; RPMI 1640 supplemented with 10% Human Serum and 1% Penicillin-Streptomycin) and Benzonase nuclease (Merck-Millipore, 2500 IU/ml) and incubated at 37°C for 30 minutes. The cells were washed and stained with the following amounts of fluorescently labelled pHLA tetramers: 2 μl of SA-APC-pHLA and 1 μl of SA-BV750-pHLA, SA-BV650-pHLA, SA-BV480-pHLA, SA-BUV615-pHLA, SA-BUV395-pHLA, SA-BUV563-pHLA, SA-BV711-pHLA, SA-BB790-pHLA, SA-BB630-pHLA and SA-PE-pHLA. The cells were stained in 100 μl of Brilliant Staining Buffer Plus (BD, 563794) according to manufacturer’s protocol. After minutes of incubating at 37 °C, the cells were stained with 2 μl of a(nti)CD8-BUV805 (BD, 612889), 0.5 μl of aCD4-BB700 (BD, 566392), 0.5 μl aCD14-FITC (BD, 345784), 1 μl of aCD16-BUV496 (BD, 612944), 0.5 μl aCD19-BUV661 (BD, 750536) and 0.5 μl of LIVE/DEAD Fixable IR Dead Cell Stain Kit (Invitrogen, L10119) and incubated on ice for 20 minutes. Samples were analyzed on the BD FACSymphony A5. The following gating strategy was applied to identify CD8 T cells: (i) selection of live (IR dye low-dim) single-cell lymphocytes (forward scatter (FSC)-W/H low, side scatter (SSC)-W/H low, FSC/SSC-A), (ii) selection of aCD4, aCD14, aCD16, aCD19 negative and aCD8-positive cells. Antigen-specific CD8 T cell responses that were positive for two and none of the other pHLA tetramer channels were identified using Boolean gating. Cut-off values defining true positive responses were ≥ 0.005% of total CD8 T cells, ≥ 5 events. A minimum of 10,000 CDT cells was acquired per sample. Data was analyzed using FlowJo 10.6.2. Flow cytometer setting for pHLA tetramers The following 21-color instrument settings were used on the BD FACSymphony A5: blue laser (488 nm at 200 mW): FITC, 530/30BP, 505LP; BB630, 600LP, 610/20BP; BB700, 710/50BP, 685LP; BB790, 750LP, 780/60BP. Red laser (637 nm at 140 mW): APC, 670/30BP, APC-R700, 690LP, 630/45BP, IRDye, 750LP, 780/60BP. Violet laser (405 nm at 100 mW): BV421, 420LP, 431/28BP; BV480, 455LP, 470/20BP; BV605, 565LP, 605/40BP; BV650, 635LP, 661/11BP; BV711, 711/85, 685; BV750, 735LP, 750/30BP. UV laser (355 nm at 75 mW): BUV395, 379/28BP, BUV563, 550LP, 580/20BP; BUV615, 600LP, 615/20BP; BUV661, 630LP, 670/25BP; BUV805, 770LP, 819/44BP. Yellow-green laser (5nm at 150 mW): PE, 586/15BP. Appropriate compensation controls were included in each analysis. RESULTS Identification of SARS-CoV-2 HLA peptides in B cells overexpressing SARS- CoV-2 genes To assess the presentation of viral peptides both by endogenous and overexpressed HLA-I molecules, 721.221 B cells were used with mono-allelic expression of the most frequent HLA-I alleles or IHW01070 and IHW01161 B cells with endogenous expression of the most frequent HLA-I alleles. Both of these cell systems co-expressed specific viral genes. B cells were chosen because they are not only infected by viruses (Gu et al., 2005; Pontelli et al., 2020; Sorem et al., 2009; Spear and Longnecker, 2003) but also play a central role in presenting the peptides to the immune system (Cheng et al., 1999; Hong et al., 2018). To increase the ability to identify virus-presented peptides that are shared by a broad fraction of patients, the present inventors focused on those HLA molecules that were present in a large fraction of the world population. To this end, they first selected the most frequent HLA-I alleles according to the allele frequency net database (http://www.allelefrequencies.net/) (Figure 2A). This resulted in the inclusion of at least one of the most frequent HLA-A/B/C alleles for each population (Figure 2B). SARS-CoV-2 genes were overexpressed in the above-noted B cells. The genes were previously shown to have the highest frequency of reactive T cells from exposed and unexposed individuals, tested with pools of predicted peptides derived from these genes (Grifoni et al., 2020; Sekine et al., 2020). The four SARS-CoV-2 genes were envelope, nuclocapsid, nonstructural protein 6 (nsp6) and membrane protein. To assess in which HLA-I context each SARS-CoV-2 gene should be overexpressed, the present inventors performed binding predictions of the viral genes to the most frequent HLA-I alleles and selected for each gene the alleles with the highest combination of allele frequency and number of predicted alleles (Figure 2C, Figure 6, Table 3). HLA-peptidomics was employed to profile HLA-I- and HLA-II-bound antigens in the two cellular systems noted above, as previously described (Abelin et al., 2019; Abelin et al., 2017; Bassani-Sternberg et al., 2016; Kalaora et al., 2016; Kalaora et al., 2018). The raw data from each HLA-peptidomics analysis was searched, using MaxQuant software, against the relevant overexpressed viral gene and the human proteome. This analysis revealed 15 unique HLA-I- and 43 unique HLA-II-associated peptides, respectively (Table 4). Table 4 OE SA RS - Co V- 2 gen e HL A clas s Sequ ence SEQ ID NO: Le ngt h HLA binding prediction NetMHCpan MixMHCpre d HLAthena NeonMHC2 N HL 1 11 A*01:01 A*01:01 A*01:01 A-I nspHLA-I 9 C*07:01;A*02:01;C*04:A*02:01;C*04:04;B*08:C*04:04;B*08:01;A*02: E HLA-I B*40:01 N HLA-I B*07:02 B*07:02 B*07:02 M HLA-I A*11:01 A*11:01 A*11:01 N HLA-I A*03:01 nspHLA-I A*24:02 A*24:02 A*24:02 nspHLA-I A*24:02 A*24:C*01:02;A*24: nspHLA-I 9 A*24:02;C*01:HLA-A*24:A*24:02 E HLA-II DRB1*01:02 DRB1*01: M HLA-II 11 DRB1*01:02 DRB1*01: M HLA-II 12 DRB1*01:02 DRB1*01: M HLA-II 13 DRB1*01:02 DRB1*01: M HLA-II 14 DRB1*01:02 DRB1*01: M HLA-II DRB1*01:02 M HLA-II 16 DRB1*01:02 M HLA-II 17 DRB1*01:02 M HLA-II 18 DRB1*01:02 M HLA-II 19 DRB1*01:02 M HLA-II DRB1*01:02 M HLA-DRB1*01:02 II M HLA-II 22 DRB1*01:02 M HLA-II 23 DRB1*01:02 M HLA-II 24 DRB1*01:02 M HLA-II DRB1*01:02 M HLA-II 26 DRB1*01:02 M HLA-II 27 DRB1*01:02 M HLA-II 28 DRB1*01:02 M HLA-II 29 DRB1*01:02 M HLA-II DRB1*01:02 M HLA-II 31 DRB1*01:02 M HLA-II 32 DRB1*01:02 M HLA-II 33 DRB1*01:02 M HLA-II 34 DRB1*01:02 M HLA-II DRB1*01:02 M HLA-II 36 DRB1*01:02 M HLA-II 37 DRB1*01:02 M HLA-II 38 DRB1*01:02 M HLA-II 39 DRB1*01:02 M HLA-II 40 DRB1*01:02 M HLA-II 41 DRB1*01:02 N HLA-II 42 DRB1*07:01 DRB1*07: N HLA-II 43 DRB1*07: N HLA-II 44 14 DRB1*07:01; DQA1*02:01-DQB1*03:03; DQA1*02:01-DQB1*03:02; DQA1*03:01-DQB1*03:02; DQA1*03:01-DQB1*03:03; DRB1*04: DRB1*04:04 DRB1*07:01; DRB1*04: N HLA-II 45 17 DPA1*02:01-DPB1*14:01; DPA1*01:03-DPB1*14: DRB1*07: N HLA-II 46 DPA1*01:03-DPB1*14: N HLA-II 47 DRB1*07: N HLA-II 48 DRB1*07:01; DQA1*01:02-DQB1*06:N HLA-II 49 DRB1*07: N HLA-II 50 DRB1*07:01 DRB1*07: N HLA-II 51 DRB1*07:01 N HLA-I B*13:02 B*13: nspHLA-I A*24:02 A*24:02 A*24: N HL 54 10 A*11:01 A*11:01 A*11:01 A-I N HLA-I A*03: nspHLA-I 9 C*07:01;B*08:01;C*04:A*02:01;B*08:C*04:04;B*08:01 M HLA-II 57 DRB1*01:02 The length distribution of the identified peptides was consistent with the expected length of HLA-I and HLA-II peptides (Figure 7). The clustering of the 8-identified amino-acid HLA-I peptides from each cell line showed reduced amino-acid complexity of the peptides, as expected for HLA-I peptides, and matched the patient’s HLA alleles’ motif). 7 of the peptides were arbitrarily chosen for validation, by comparing their MS/MS spectra to that of synthetic peptides; all 7 were validated. All the identified viral peptides showed a correlation between their retention time and predicted hydrophobicity, confirming their identification. Identification of HLA/SARS-CoV-2-derived peptides in virus-infected cells To complement the overexpression system, the IHW01070 B cell line was infected with SARS-CoV-2. First, it was confirmed that both IHW01070 cells endogenously express the angiotensin-converting enzyme 2 (ACE2) receptor and transmembrane protease serine 2 (TMPRSS), known to be required for SARS-CoV-entry into the cells (Hoffmann et al., 2020; Matsuyama et al., 2020; Wan et al., 2020; Zhou et al., 2020). Infection conditions were tested to allow a high number of infected cells while keeping high cell viability. Infection with a multiplicity of infection (MOI) of 0.05 was found to result in an infection of 50% of the cells, while preserving cell viability. The lysis buffer used for HLA-peptidomics neutralized the virus, and the samples were processed for HLA-I and HLA-II peptidomics, as was done for the non- infected cells. The HLA-peptidomics raw data was searched against the complete SARS-CoV-2 proteome and human proteome. An HLA-I peptide derived from the spike protein (NEVAKNLNESL - SEQ ID NO: 58) was identified in the IHW01070 cells and matched their B*40:01 allele. It was previously shown that viral infection affects the expression of the interferon and cytokine signaling pathways (Bost et al., 2020; Mandhana and Horvath, 2018). To assess whether the infection of B cells with SARS-CoV-2 alters the intensity of human HLA peptides in IHW01070 cells, the present inventors compared the intensity of peptide presentation in the presence and absence of viral infection. More HLA-I human peptides were found to be differentially presented after infection in comparison to HLA-II peptides (Two side student’s t-test, permutation based FDR = 0.05, S0 = 1, Figure 3A, B). When the peptides that showed a higher intensity after infection for viral effects on particular pathways were interrogated, a statistically significant enrichment (Fisher's Exact test, FDR<0.05) of immune-related pathways, including the JAK/STAT signaling, FAS signaling, B cell and T cell activation, interleukin signaling, apoptosis signaling and p53 pathways (Figure 3C) was observed. In addition, there was an increase in peptides derived from genes known to be upregulated after viral infection, such as focal adhesion kinase (FAK) (fold change (FC): 6.63) and 4F2 antigen heavy chain (FC: 6.0), which play a role in viral entry (Bouchard et al., 2006; Cheshenko et al., 2005; Ito et al., 1992; Kaminsky et al., 2012; Ohta et al., 1994), Lysyl-tRNA synt (FC: 5.7), which is involved in viral synthesis (Cen et al., 2001; Guo et al., 2005), heterogeneous nuclear ribonucleoproteins H1 (hnRNP H1) (FC: 5.15), which is implicated in viral splicing (Kutluay et al., 2019), and transcription elongation factor SPT5 (hSPT5) (FC: 5.07), which is involved in viral replication (Ping et al., 2004; Zhao et al., 2017). Interestingly, RAB7A and SLTM, both of which have been shown to play a role in SARS-CoV-2 viral entry and transcription (Daniloski Z., 2020) were also identified. Further, an increase in peptides derived from genes essential for mounting an anti-viral protective immune response, such as protein tyrosine phosphatase receptor type C (PTPRC/CD45) (Caignard et al., 2013) was noted. Table 5 indicates the pathways that were found to be significantly enriched of the peptides that were significantly more presented after SARS-CoV-2 infection. Table 5 PANTHER Pathways fold Enrichment P-value FDR Genes JAK/STAT signaling pathway (P00038) 8.08 3.83E-052.09E-03PIAS4, JAK1, STA5A, STAT3, STAT1, PTPRC, STAT6, PIAS3 p53 pathway feedback loops (P04398) 4.81 7.77E-066.37E-04CCNA2, PK3CG, RB, CDN1A, P63, PTEN, AKT2, CTNB1, STAT1, P53, ATR, P55G, PDPK2, PK3CA FAS signaling pathway (P00020) 4.42 5.54E-048.26E-03CY1, LMNB1, JUN, PARP4, FAS, CASP3, AKT2, FAF1, PARPHypoxia response via HIF activation (P00030) 4.29 1.30E-031.78E-02PK3CG, PTEN, AKT2, HIF1A, P55G, MTOR, CBP, PK3CA p53 pathway (P00059) 3.75 4.73E-067.75E-04 CCNB1, PK3CG, PML, CDN1A, EP300, FAS, P63, PTEN, GA45B, AKT2, P53, ATR, CDK1, P55G, HDAC1, PDPK2, CBP, PK3CA, DDB B cell activation (P00010) 3.68 5.59E-052.29E-03 PK3CG, JUN, SYK, NFAC1, FOS, PTN6, CD79A, SOS1, PTPRC, CD22, SOS2, PP2BC, GRB2, PP2BA, PK3CA T cell activation (P00053) 3.32 5.75E-051.88E-03 CSK, PK3CG, JUN, AKT2, NFAC1, DQA2, FOS, DMA, SOS1, PTPRC, P55G, SOS2, PP2BC, GRB2, B2MG, PP2BA, PK3CA Interleukin signaling pathway (P00036) 3.12 1.74E-043.57E-03 ELK4, CDN1A, STA5A, STAT3, IL16, AKT2, STAT1, FOS, SOS1, SOS2, I15RA, STAT6, GRB2, MTOR, PDPK2, PK3CA Apoptosis signaling pathway (P00006) 2.84 1.38E-043.22E-03 MCL1, HSP7C, ATF2, PK3CG, MCM5, JUN, M4K2, GHITM, FAS, CASP3, AKT2, B2LA1, FOS, ATF4, BCL2, P53, TF65, IF2A, PK3CA Identification of recurrent SARS-CoV-2-derived HLA peptides and presentation hotspots Shared viral antigens, which are presented on common HLA alleles, should have great clinical value, as they may serve a larger portion of the population, allowing "off-the-shelf" therapies. The present inventors, therefore, sought to identify in their HLA-peptidomics results whether any of the identified peptides are recurrently presented. Indeed, two such HLA-I recurrent peptides were found. The first is NSSPDDQIGYY (SEQ ID NO: 1), which was derived from nucleocapside and matched the A*01:01 allele. It was identified in both the IHW01070 and IHW011cells that endogenously expressed A*01:01, as well in 721.221 cells that overexpressed both A*01:01 and nucleocapside. The second recurrently presented peptide, YCCNIVNVSL (SEQ ID NO: 3), was derived from the envelope protein and was predicted to bind both B*40:01 and C*03:03 alleles. It was identified in IHW01070 and IHW01161 cells. Further analysis of recurrently presented genes revealed overlapping peptides derived from the same protein. These were identified on both HLA-I and HLA-II. Specifically, 29 different HLA-II peptides derived from membrane were identified in 721.221 cells that overexpressed A*24:02 and membrane and matched the DRB1*01:02 allele. Eighteen of the overlapping peptides were identified in 721.2cells overexpressing A*03:01, and 25 of them in the 721.221 cells overexpressing A*11:01. Altogether this hot spot contains 32 different peptides. Nine different HLA- II peptides from nucleocapside were identified in 721.221 cells that overexpressed nucleocapside and matched the DRB1*01:02 allele. HLA-I peptide (ATEGALNTPK - SEQ ID NO: 54) and HLA-II peptide (KDGIIWVATEGALN - SEQ ID NO: 44) from nucleocapside were identified in 721.221 cells that overexpressed nucleocapside and the A*11:01 allele and in IHW01070, respectively, showed 7 amino acids overlap. Two HLA-I peptides from the nsp6 protein, DYLVSTQEF (SEQ ID NO: 53) and VYDYLVSTQEF (SEQ ID NO: 11), were identified in 721.221 cells that overexpress nsp6 and A*24:02 allele . Importantly, three of the presently identified HLA-I peptides were previously shown, using peptide stability and affinity assays, to bind the same allele of the cells in which the present inventors identified the peptide, supporting their findings. Specifically, VYMPASWVM - SEQ ID NO: 9 (which the present inventors identified in 721.221 cells overexpressing nsp6 and HLA A*24:02, was shown to bind to A*24:02; FLLPSLATV – SEQ ID NO: 2, which the present inventors identified in IHW01070 cells overexpressing nsp6, was shown to bind to A*02:01 (IMMUNITRACK website; Covid19 Intavis_Immunitrack stability dataset 1); KTFPPTEPK (SEQ ID NO: 55), which the present inventors identified in 721.221 cells overexpressing nucleocapside and HLA A*03:01, was previously found to bind A*03:01 and DYLVSTQEF (SEQ ID NO: 53), which the present inventors identified in 721.221 cells overexpressing nsp6 and HLA A*24:02, was previously found to bind A*24:02 (Sylvester-Hvid et al., 2004). Furthermore, SYYKLGASQRVA (SEQ ID NO: 29), which the present inventors found to bind to the DRB1*0102 allele, was previously found to bind to the DRB1*04:01 allele (IMMUNITRACK website). In addition, GMSRIGMEV (SEQ ID NO: 52), identified by the present inventors to bind to the B*13:02 allele, was also identified previously to bind to HLA A*02:01 (Cheung et al., 2007). Peptide similarity to other corona viruses and to the human proteome The present inventors assessed the similarity of the SARS-CoV-2 peptides they identified to the proteome of other coronavirus family members to which one might have prior immunity. It was found that, indeed, 11 peptides such as peptides DYLVSTQEF (SEQ ID NO: 53) and GMSRIGMEV (SEQ ID NO: 52) from nucleocapsid showed 100% similarity to SARS-CoV-1 virus, (Cheung et al., 2007; Ohno et al., 2009; Sylvester-Hvid et al., 2004; Tsao et al., 2006). Sixteen peptides showed similarity to SARS-CoV-1 with one amino acid substitution. Similar peptides (exact sequence or one amino acid substitution) were not found when comparing to other members of the CoV species; HCoV-NL63, HCoV-229E, HCoV-OC43, HCoV-HKU1 and MERS-CoV. The present inventors searched if the presently identified peptides were found among the SNPs found in the different strains of the SARS-CoV-2 genome (Figure 8). It was observed that none of them were derived from these areas. This data suggests that the presently identified SARS-CoV-2 identified peptides could use for patients infected with the different virus strains. Presently identified SARS-CoV-2-presented peptides have no sequence similarity with the human proteome The amino acid sequence of all peptides that were predicted to bind the most frequent alleles were compared to the human genome. 3 different peptides were found that had the exact same sequence and that 237/9814 unique peptides (2.5%) were homologous in their sequence to human peptides (with one amino acid substitution), some of them were similar to peptides from different human genes. Most of the similar human sequences were predicted to bind the same allele as the predicted viral peptide, increasing the chance of cross reactivity to these human peptides, in patients that had immune response to the viral peptides. In contrast, when the present inventors assessed whether the presently identified SARS-CoV-2-presented peptides are unique in their sequence or whether they have any homology to peptides in the human proteome, no amino-acid similarities were found, even with a flexibility of one amino-acid change. Presented SARS-CoV-2 peptides are immunogenic Several studies have reported T cell reactivity towards the SARS-CoV-2 HLA-predicted peptides (Grifoni et al., 2020; Nelde et al., 2020; Sekine et al., 2020; Woldemeskel et al., 2020; Zhang et al., 2020). A map of all the available data of experimentally validated reactive SARS-CoV-2 peptides was compiled and searched to see if it includes any of the presently identified presented peptides (Figure 5A). Indeed, five of the peptides were previously found to be immunogenic in blood samples of COVID-19-infected patients. ATEGALNTPK (SEQ ID NO: 54), which was found to be a dominant T cell epitope, causes an immune response in 9/11 (82%) tested samples and KTFPPTEPK (SEQ ID NO: 55) causes an immune response in 7/11 (64%) tested samples (Nelde et al., 2020). The present inventors identified their presentation by HLA-peptidomics of 721.221 B cells overexpressing nucleocapside and the A*11:01 or A*03:01 allele, respectively. Further, they identified FVKHKHAFL (SEQ ID NO: 56) as an HLA-I-presented peptide by the IHW01070 B cells overexpressing nsp6 and endogenously expressing the B*08:01 HLA allele, which is predicted to bind this peptide. Importantly, this peptide was previously found to cause a CD8+ T cell-mediated response in 1/12 (8%) tested samples (Nelde et al., 2020). Finally, HLA-II-presented peptide LSYYKLGASQRVAGD (SEQ ID NO: 57) was identified in the 721.221 B cells overexpressing membrane and expressing the matching DRB1*01:02 allele endogenously. This HLA-II peptide was previously found to cause a CD4+ T cell-mediated response in 10/12 tested samples (Nelde et al., 2020). Finally, GMSRIGMEV (SEQ ID NO: 52), which the present inventors found to bind to the B*13:02 allele, was also identified to bind A*02:01 and to be immunogenic both in human blood samples and in an A*02:01 mice model (Cheung et al., 2007; Ohno et al., 2009; Tsao et al., 2006).

To test for CD8 T cell recognition of the nine of the presently identified SARS-CoV-2 HLA-I peptides, peripheral blood mononuclear cell (PBMC) samples from COVID-19 patients were analyzed (Figure 9A). Patients were stratified into four groups based on disease state: asymptomatic (n=6), mild (n=4), severe but no longer needing oxygen support (n=2), severe and requiring non-invasive ventilation (n=3). CD8 T cell recognition of the SARS-CoV-2 epitopes was assessed by multiplexing fluorescent pHLA tetramers (Kvistborg et al., 2014; Kvistborg et al., 2012). The present analysis revealed CD8 T cell responses targeted at the NSSPDDQIYY (SEQ ID NO: 1) epitope in two of four HLA-A*01:01-positive patient, and at the FLLPSLATV (SEQ ID NO: 2) epitope in two out of the 10 HLA-C*07:01-positive patients (Figure 5B, C and Figure 9B). The magnitude of the NSSPDDQIYY (SEQ ID NO: 1)-specific CD8 T cell responses was 0.017% and 0.025% of the total CD8 T cells in patients COVID-131 and COVID-007, respectively. The magnitude of the FLLPSLATV (SEQ ID NO: 2)-specific CD8 T cell responses was 0.590% and 0.067% of the total CD8 T cells in patients COVID-131 and COVID-224, respectively.

Claims (18)

1.WHAT IS CLAIMED IS: 1. A method of treating or preventing a coronavirus disease of a subject comprising administering to said subject an immunologically effective amount of a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51, wherein the peptide is selected according to the HLA profile of the subject as set forth in Table 4, thereby treating or preventing the coronavirus disease of the subject.

2. A method of treating a coronavirus disease of a subject comprising administering to the subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51, wherein the T cells are selected according to the HLA profile of the subject as set forth in Table 4, thereby treating the coronavirus disease of the subject.

3. A population of T cells genetically modified to express a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51.

4. A peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51 for use in treating or preventing a coronavirus mediated disease in a subject, wherein the peptide is selected for treating the subject according to the HLA profile as set forth in Table

5. An antibody comprising an antigen binding domain which is capable of binding a peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51 in an HLA restricted manner, wherein said HLA is according to Table 4.

6. A peptide-HLA complex, wherein the peptide comprises one of the amino acid sequences as set forth in SEQ ID NOs: 1-51 and the HLA is the corresponding HLA according to Table 4.

7. A vaccine comprising at least one peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-51 and an adjuvant.

8. The method, population of T cells, peptide or vaccine of any one of claims 1-7, wherein said peptide has an amino acid sequence as set forth in SEQ ID NOs: 1 or 2.

9. The method or peptide of any one of claims 1, 2 or 4, wherein said coronavirus disease is COVID.

10. The method or peptide of any one of claims 1, 2 or 4, wherein said coronavirus is selected from the group consisting of SARS-CoV-2, SARS-CoV, HCoV NL63, HKU1 and MERS-CoV.

11. The method of claim 2, wherein said TCR binds to a peptide having a sequence as set forth in SEQ ID NO: 1 in a complex with HLA-A*01:01 allele in the subject.

12. The method of claim 2, wherein said T cells are autologous to the subject.

13. The method of claim 2, wherein said T cells are non-autologous to the subject.

14. The method of claim 2, wherein said T cells are genetically modified to express said T cell receptor.

15. The method or population of T cells of claims 2 or 3, wherein said T cells comprise CD8+ T cells.

16. A method of treating or preventing COVID of a subject comprising administering to said subject an immunologically effective amount of a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-53, wherein the peptide is selected according to the HLA profile of the subject as set forth in Table 4, thereby treating or preventing the COVID.

17. A method of treating COVID of a subject comprising administering to the subject a therapeutically effective amount of T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-53, wherein the T cells are selected according to the HLA profile of the subject as set forth in Table 4, thereby treating COVID of the subject.

18. A composition comprising T cells expressing a T cell receptor (TCR) which bind specifically to at least one peptide having an amino acid sequence as set forth in SEQ ID NOs: 1-51, for use in treating or preventing a coronavirus mediated disease in a subject, wherein the peptide is selected for treating the subject according to the HLA profile as set forth in Table 4. Dr. Hadassa Waterman Patent Attorney G.E. Ehrlich (1995) Ltd. 11 Menachem Begin Road 5268104 Ramat Gan