IL160346A

IL160346A - Antibodies specific for proteinase k resistant surface protein of neisseria meningitidis and uses thereof

Info

Publication number: IL160346A
Application number: IL160346A
Authority: IL
Inventors: Bernard Brodeur; Denis Martin; Josee Hamel; Clement Rioux
Original assignee: Bernard Brodeur; Denis Martin; Josee Hamel; Clement Rioux; Id Biomedical Corp; Shire Biochem Inc
Priority date: 1995-03-17
Filing date: 2004-02-11
Publication date: 2010-05-17
Also published as: IL160346A0

Description

17256/np2/04D 1603 6 ^,453339 NEISSERIA MENINGITIDIS 7LU Π3ΰΰΠ Π37Π TJ]D Ε ΤΟΤ.Π O^im Ό Π"1 ϋΠΤΤΊϋΊ K ΤΝΓΝϋΠ37 ΊΠΤ-ΙΙΠ ANTIBODIES SPECIFIC FOR PROTEINASE K RESISTANT SURFACE PROTEIN OF NEISSERIA MENINGITIDIS AND USES THEREOF TECHNICAL FIELD OF THE INVENTION The present application is a divisional application of Israel Patent Application No. 117483 (hereinafter "the parent application" or "the parent invention").

The parent invention relates to a highly conserved/ immunologically accessible antigen at the surface of Neisseria meningitidis organisms. This unique antigen proviaes the basis for new immunotherapeutic, prophylactic 10 and diagnostic agents useful in the treatment, prevention and diagnosis o£ Neisseria meningitidis diseases. More particularly, the parent invention relates to a proteinase K resistant Neisseria meningitidis surface protein having an apparent molecular weight of 22 kDa, the corresponding IS nucleotide and derived amino acid sequences (SEQ ID N0:1 to SEQ ID NO: 26 and recombinant DMA methods for the production of the Neisseria meningitidis 22 kDa surface protein. The present invention relates to the production of antibodies that bind to the Neisseria meningitidis 22 kDa surface protein and methods and 20 compositions for the diagnosis, treatment and prevention of Neisseria meningitidis diseases.

BACKCROUBD OF THE IKVSWTIOT • Neisseria meningitidis is a major cause of death and morbidity throughout the world. Neisseria, meningitidis causes both endemic and epidemic diseases, principally meningitis and meningococcemia [Gold, Evolution of meningococcal disease, p. 69, Vedxos N.A., CRC Press (1987); Schwartz et al., Clin. Microbiol . Rev., 2, p. S118 (1989)1. In fact, this organism is one of the most common causes, after Haemophilus influenzae type b, of bacterial meningitis in the united States, accounting for approximately 0% of all cases. It has been well documented that serum bactericidal activity is the major defense mechanism against Neisseria meningitidis and that I protection against invasion by the bacteria correlates with the presence in the serum of anti-meningococcal antibodies [Goldschneider et al., J. Exp. Med. 129, p. 1307 (1969); Goldschneider et al., J. Epy Med. , 129, p. 1327 (1969)].

Weisseria meningitids are subdivided into serological groups according to the presence of capsular antigens. Currently, 12 serogroups are recognized, but serogroups A, B, C, Y, and W-135 are most commonly found. Within serogroups, serotypes, subtypes and immunotypes can be identified on outer membrane proteins and lipopolysaccharide [Frasch et al., Rev. Infect. Pis. 7, p. 504 (1985) J.

The capsular polysaccharide vaccines presently available are not e fective against all Neisseria meningitidis isolates and do not effectively induce the production of protective antibodies in young infants [Frasch, Clin. Microbiol. Rev. 2, p. S134 (1989); eingold et al., Lancet, p. 114 (1985); Zollinger, in Woodrow and Levine, New generation vaccines, p. 325, Harcel Dekker Inc. N,Y. (1990)]. The capsular polysaccharide of serogroups A, C, Y and W-135 are presently used in vaccines against this organism. These polysaccharide vaccines are effective in the short term, however the vaccinated subjects do not develop an immunological memory, so they must be revaccinated within a three-year period to maintain their level of resistance.

Furthermore, these polysaccharide vaccines do not induce sufficient levels of bactericidal antibodies to obtain the desired protection in children under two years of age, whoare the principal victims of this disease. No effective vaccine against serogroup B isolates is presently available even though these organisms are one of the primary causes of meningococcal diseases in developed countries, indeed, the serogroup B polysaccharide is not a good inmunogen, inducing only a poor response of. IgM of low specificity which is not protective [Gotschlich et al., J. Exp. Med., p. 129, 1349 (1969); Skevakis et al., J. Infect. Pis., 149, p. 387 (1984); Zollinger et al., J. Clin. Invest., 63, p, 836 (1979)]. Furthermore, the presence of closely similar, crossreactive structures in the glycoproteins of neonatal human brain tissue [Finne et al., Lancet, p. 355 (1983)] might discourage a tests at improving the iiranunogenicity of oerogroup B polysaccharide .

To obtain a more effective vaccine, other Neisseria meningitidis surface antigens such as lipopolysaccharide, pili proteins and proteins present in the outer membrane are under investigation. The presence of a human immune response and bactericidal antibodies against certain of these proteinaceous surface antigens in the sera of ixnmunized volunteers and convalescent patients was demonstrated [Mandrell and Zollinger, Infect. Intmun. , 57, p. 1590 (1989)? Poolman et al., Infect. Iromun. , 40, p. 398 (1983); Rosenquist et al., J. Clin. Microbiol., 26/ p, 1543 (1988); Wedege and Proholm, Infect. Immun. 51, p. 571 (1986); Wedege and Michaelsen, J. Clin. Microbiol » , 25, p. 1349 (1987)].

Furthermore, monoclonal antibodies directed against outer membrane proteins, such as class 1, 2/3 and 5, were also reported to be bactericidal and to protect against experimental infections in animals [Brodeur et a . , Infec. Immun. , 50, p. 510 (1985); Frasch et al, Clin. Invest. Med. , 9, p. 101 (1986); Saukkonen et al. Micro .

Pathogen. , 3, p. 261 (1987); Saukkonen et al., Vaccine, 7, p. 325 (1989)].

Antigen preparations based on Neisseria, meningitidis outer membrane proteins have demonstrated immunogenic effects in animals and In humans and some of them have been tested in clinical trials [Bjune et al., Lancet, p. 1093 (1991); Costa et al., NIPH Annals. 14, p. 215 (1991); Fraech et al., Med. Trop., 43, p. 177 (1982); Prasch et al., Eur. J. Clin. Microbiol., 4, p. 533 (1985); Fraech et al. in Bobbins, Bacterial Vaccines, x>. 262, Praeger Publications, N.Y. (1987); Frasch et al, J.

Infect. Pis., 158, p. 710 (1988); Moreno et al. Infec. Immun. , 47, p. 527 (1985); Rosenqvist et al., J. Clin. Microbiol. , 26, p. 1543 (1988); Sierra et al., NIPH ' Annals, 14, p. 195 (1991); Wedege and Froholm, mfec. immun. 51, p. 571 (1986); Wedege and Michaelsen, J. Clin. Microbiol., 25, p. 1349 (1987); Zollinger et al., J. Clin. Invest . , 63, p. 836 (1979); Zollinger et al., NIPH Annals, 14, p. 211- (1991)]. However, h e-AlaLwm-ts o£ great: interstrain antigenic variability in the outer membrane proteins can limit their use in vaccines [Frasch, Clin. Microb., Rev. 2, p. S134 (1989)]. Indeed, most of these preparations induced bactericidal antibodies that were restricted to the same or related serotype from which the antigen was extracted [Zollinger in Woodrow and Levine, New Generation Vaccines,, p. 325, Marcel Defcker Inc. N.Y. (1990)]. Furthermore, the protection conferred by these vaccines in young children has yet to be clearly established. The highly conserved Neisseria meningitidis outer membrane proteins such as the class 4 iMunkley et al. Microb. Pathogen., 11, p. 447 (1991)] and the lip protein (also called H.8) [Woods et al., infect. immu . , 55, p. 1927 (1987)] are not interesting vaccine candidates since they do not elicit the production of bactericidal antibodies. To improve these vaccine preparations, there is a need for highly conserved proteins that would be present at the surface of all Neisseria meningitidis strains and that would be capable of eliciting bactericidal antibodies in order to develop a broad spectrum vaccine. 160346/2 Ί¾β current laboratory diagnosis of Neisseria meningitidis is usually done by techniques such as Gram stain of smear preparations,, latex agglutination or coagglutination, and the culture and isolation on enriched and selective media tMorello et al., in Balows", Manual of Clinical Microbiology, p. 258, American Society for Microbiology, Washington (1991)]. Carbohydrate degradation tests are usually performed to confirm the identification of Neisseria meningitidis isolates. Most of the described procedures are time-consuming processes requiring trained personnel. Commercial agglutination or coagglutination kits containing polyvalent sera directed against the capsular antigens expressed by the most prevalent serogroups are used for the rapid identification of N&isseria meningitidis. However, these polyvalent sera often nonspecificalZy cross-react with other bacterial species and for that reason should always be used in conjunction with Gram stain and culture. Accordingly, there is a need for efficient alternatives to these diagnostic assays that will improve the rapidity and reliability of the diagnosis. 160346/1 SUMMARY OF THE INVENTION The invention relates to an isolated antibody or antigen-binding fragment thereof that specifically binds to a Neisseria cell surface polypeptide that is capable of inducing an immune response against Neisseria bacteria, wherein said polypeptide is selected from (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID ΝΟ^2, (b) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4, (c) a polypeptide comprising the amino acid sequence set forth in SEQ ID ΝΟ^β, and (d) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO^8.

The said antibody may be a monoclonal antibody or antigen-binding fragment thereof. The said monoclonal antibody may be of murine or human origin. The said monoclonal antibody may be an IgG isotype.

In an embodiment of the invention, the antibody is a monoclonal antibody produced by the hybridoma cell line American Type Culture Collection (ATCC) Accession HB 11959 or the hybridoma cell line ATCC Accession HB11958, or antigen-binding fragments thereof.

The said Neisseria species may be Neisseria meningitides.

In a further embodiment, the invention relates to a method for isolating the said antibody of the invention, the method comprising introducing a preparation of Neisseria meningitides to a non-human mammal and isolating from the non-human mammal serum containing said antibody.

The invention also relates to a method for isolating a monoclonal antibody of the invention comprising introducing a preparation of Neisseria meningitides to a non-human mammal; fusing antibody producing cells from 5a 01898659V23-01 160346/1 the non-human mammal with myeloma cells to form hybridoma cells." and isolating said monoclonal antibody from the hybridoma cells.

In a further embodiment, the invention relates to a pharmaceutical composition comprising one or more antibodies or an antigen-binding fragment thereof in accordance with the invention, and a pharmaceutically acceptable excipient.

The pharmaceutical composition of the invention may be a vaccine. The antibody comprised in the pharmaceutical composition of the invention may be produced by the hybridoma cell line ATCC Accession HB 11959 or the hybridoma cells line ATCC Accession HB 11958.

In a further embodiment, the invention relates to use of the antibody or antigen-binding fragment thereof in accordance with the invention, in the preparation of a medicament for the treatment of a Neisseria meningitides infection.

In another embodiment, the invention relates to a method for the detection of a Neisseria antigen in a biological sample containing or suspected of containing the Neisseria antigen comprising (a) incubating an antibody in accordance with the invention or an antigen-binding fragment thereof with the biological sample to form a mixture! and (b) detecting specifically bound antibody or bound antigen-binding fragment in the mixture which indicates the presence of the Neisseria antigen. In this method, the antibody may be produced by the hybridoma cell line ATCC Accession HB 11959 or the hybridoma cell line ATCC Accession HB 11958. The Neisseria antigen may be from N. meningitides, N. gonorrhoeae, or N lactamica. 5b 01898659\23-01 1603.46/1 DISCLOSURE OF THE INVENTION The parent invention as well as the present invention solve the problems referred to above. The parent invention provides a highly conserved, immunologically accessible antigen at the surface of Neisseria meningitidis organisms. Also provided by the parent invention are recombinant DNA molecules that code for the foregoing antigen, unicellular hosts transformed with those DNA molecules, and a process for making substantially pure, recombinant antigen. The present application provides antibodies specific to the foregoing Neisseria meningitidis antigen. The antigen of the parent application and the antibodies of the present invention provide the basis for unique methods and pharmaceutical compositions for the detection, 5c prevention and treatment of Neisseria meningitidis diseases.

The preferred antigen provided by the parent invention is the Neisseria meningitidis 22 kDa surface protein, including fragments, analogues and derivatives thereof. The preferred^ntibodies provided by the present invention are the Me-1 and Me-7 monoclonal antibodies specific to the Neisseria meningitidis 22 kDa surface protein. These antibodies are highly bacteriolytic against Neisseria meningitidis and passively protect mice against experimental infection.

The present invention further provides methods for preparation of antibodies specific for novel Neisseria meningitidis surface antigens.

BRIE? DgSGRIPTIOSf Qg THE DHAWIMGfl Figure 1 depicts the nucleotide and derived amino acid sequences of the Neisseria meningitidis strain 608B 22 kDa surface protein (SEQ ID N0:1; SEQ ID N0:2) .

Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 143 to the stop codon at base 667. The box indicates the putative ribosome binding site whereas the putative -10 promoter sequence is underlined. A 19- amino-acid signal peptide is also underlined.

Figure 2 is a photograph of a Coomassie Blue stained 14% SDS-PAGE gel displaying a-chymotrypsin and trypsin digests of Neisseria meningitidis strain 608B (B:2a:PI.2) outer membrane preparations. Lane 1 contains the following molecular weight markers: Phosphorylase b (97,400); bovine serum albumin {66,200); ovalbumin (45,000); carbonic anhydrase (31,000); soybean trypsin inhibitor (21,500); and lysozyme- (14,400). Lane 2 contains undigested control outer membrane preparation.

Lane 3 contains a-chymotrypsin treated preparation (2mg of 6 enzyme per mg of protein) ; lane 4 contains trypsin treated preparation.

Figure 3a is a photograph of a Coommasie Blue stained 14% SDS-PAOE gel displaying proteinase K digests of Neisseria meningitidis strain 608B (B:2a.P1.2) outer membrane preparations. Lanes 1, 3f 5, and 7 contain ■undigested control. Lanes 2, 4 , 6 and 8 contain outer membrane preparations digested with proteinase K (2 IU per mg of protein). Lanes 1 to 4 contain preparations treated at pH 7.2. Lanes 5 to 8 contain preparations treated at pH 9.0. Lanes 1, 2, 5 and 6 contain preparations treated without SDS. Lanes 3, 4, 7 and 8 contain preparations treated in the presence of SDS. Molecular weight markers are indicated on the left (in kilodaltons) .

Figure 3b is a photograph of a Coomassie Blue stained 14% SDS-PAQB gel displaying the migration prof les of affinity purified recombinant 22 kDa protein. Lane 1 contains molecular weight markers: Fhosphorylase b ( 7,40ο)* bovine serum albumin (66,200), ovalbumin ■ (45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500) and lysozyme (14,400). Lane 2 contains 5 μg of control af inity purified recombinant 22 kDa protein. Lane 3 contains 5 \ig of affinity purified recombinant 22 kDa protein heated at 100°C for 5 min. . Lane 4 contains 5 ug of af inity purified recombinant 22 kDa protein heated at 100°C for 10 min. . Lane 5 contains 5 \iq of affinity purified recombinant 22 kDa protein heated at 100°C for 15 min.

Figure 4 is a photograph of Coomassie Blue stained 14% SDS-PAGE gels and their corresponding Western immunoblots showing the reactivity of monoclonal antibodies specific to the Neisseria meningitidis 22 kDa surface protein. Outer membrane preparation from Neisseria meningitidis strain 608B (B:2a:Pl.2) (A) untreated; (B) Proteinase K treated (2 IU per mg of protein) . Lane 1 contains molecular weight markers .and characteristic migration profile on 14% SDS-PAGE gel of outer membrane preparations. Lane 2 contains Me-2 Lane 3 contains Me-3; lane 4 contains Me-5; lane 5 contains Me-7; and lane 6 contains an unrelated control monoclonal antibody. The molecular weight markers are phosphorylase b (97 400), bovine serum albumin (66,200), ovalbumin (45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500) and lysozyme (14,400). The immunoblot results shown in Figure 4 for Me-2, Me-3, Me-5, Me-S and Me-7 are consistent with the insmanoblot results obtained for Me-1.

Figure 5 is a graphic depiction of the binding activity of the monoclonal antibodies to intact bacterial cells. The results for representative monoclonal antibodies Me-5 and Me-7 are presented in counts per minute ("CPM") on the vertical axis. The various bacterial strains used in the assay are shown on the ■ horizontal axis. A Haemophilus influenzae porin-specif c monoclonal antibody was used as a negative control.

Background counts below 500 CPM were recorded and were subtracted from the binding values.

Figure 6 is a photograph of stained 14% SDS-rPAGE gels and their corresponding Western imnninoblot demonstrating the purification of the recombinant 22 kDa Neisseria, meningitidis surface protein from concentrated culture supernatant of Escherichia coii strain BL21(DE3).

Figure 6(A) is a photograph of a Coomassie Blue and silver stained 14% SDS-Page gel. Lane 1 contains the following molecular weight markers: phosphorylase b (97,400), bovine serum albumin (66,200), ovalbumin (45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500) and lysozyme (14,400). Lane 2 contains outer membrane protein preparation extracted from Neisseria meningitidis strain ' 608B (serotype B:2a:pl.2) (10 mg) . Lane 3 contains 8 concentrated culture supernatant of Escherichia coli BL2KDE3) (10 mg) . Lane 4 contains affinity purified recombinant 22 kDa Neisseria meningitidis surface protein (1 mg) . Figure 6(B) is a photograph of a Cooirjassie Blue stained 14% SDS-PAGE gel of cc-chymotrypsin, trypsin and proteinase K digests of affinity purified recombinant 22 kDa Neisseria meningitidis surface protein. Lane 1 contains the following molecular weight markers: phosphorylase b (97,400), bovine serum albumin (66,200), ovalbumin (45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500) and lysozyme (14,400). Lanes 2 to 5 contain purified recombinant 22 kDa Neisseria meningitidis surface protein (2 mg) . Lanes 7 to 10 contain bovine serum albumin (2 mg) . Lanes 2 and 7 contain undigested protein ("NT")- Lanes 3 and 8 contain a-chymotrypsin ("C") treated protein (2 mg of enzyme per mg of protein) . Lanes 4 and 9 contain trypsin ( "T* ) treated protein (2 mg of enzyme per mg of protein) . Lanes 5 and 10 contain proteinase K ("K") treated protein (2 IU per mg of protein). Figure 6(C) is a photograph of the Western immunoblotting of a duplicate gel using monoclonal antibody Me-5.

Figure 7 is a graphical depiction of the bactericidal activity of protein A-purified anti-Jtfeisseria meningitidis 22 kDa surface protein monoclonal antibodies against Neisseria meningitidis strain 608B (B:2a:Pi.2) . The vertical axis of the graph shows the percentage of survival of the Neisseria meningitidis bacteria after exposure to various concentrations of monoclonal antibody (shown on the horizontal axis of the graph) . riguxe 8 depicts the nucleotide and derived amino acid sequences of the Neisseria meningitidis strain MCH88 22 kDa surface protein (SEQ ID NO:3; SEQ ID MO:4).

Conventional three letter symbols are used -for the amino 9 acid residues. The open reading frame extends from the start codon at base 116 to the stop codon at base 643.

Figure 9 depicts the nucleotide and derived amino acid sequences of the Neisseria meningitidis strain Z4063 22 kDa surface protein (SEQ ID NO: 5; SEQ ID NO:6) .

Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 208 to the stop codon at base 732.

Figure 10 depicts the nucleotide and derived amino acid sequences of the Neisseria gonorrhoeae strain b2, 22 kDa surface protein (SEQ ID NO.7; SEQ ID NO: 8) .

Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 241 to the stop codon at base 765.

Figure 11 depicts the consensus sequence established from the DNA sequences of the four strains of Neisseria and indicates the substitutions or insertion of nucleotides specific to each strain.

Figure 13 depicts the consensus sequence established from the protein sequences of the four strains of Neisseria and indicates the substitutions or insertion of amino acid residues specific to each strain.

Figure 13 represents the time course of the irnmune response to the recombinant 22 kDa protein in rabbits expressed as the reciprocal BLISA titer. The rabbits were injected with outer membrane preparations from E. coll strain JM109 with plasmid pN2202 or with control plasmid pW S30. The development of the specific humoral response was analysed by ELISA using outer membrane preparations obtained from Neisseria meningitidis strain 608B (B:2a:Pl.2) as coating antigen. · Figure 11 represents the time course of the immune response to the recombinant 22kDa protein in Macaca fascicul&ris (cynomolgus) monkeys expressed as the reciprocal SLISA titer. The two monkeys were respectively immunized with ΙΟ μς (K28) and 2QQ\ig (1276) of affinity purified 22kDa protein per inje tion. The control monkey (K65) was iimminized with ISQpg of unrelated recombinant protein following the same procedure. The development of the specific humoral response was analysed by ELISA using outer membrane preparations obtained from Neisseria ' meningitidis strain 608B (B:2a:Pl.2) as coating antigen. -figure IS is a graphic representation of the synthetic peptides of the parent invention as well as their respective position in the full 22kOa protein of Neisseria, meningitidis strain 603B (B:2a:Pl-2) .

■ Figure 16 is a map of plasmid pNP2204 containing the gene which encodes the Neisseria meningitidis 22 kDa surface protein 22kOa, Neisseria meningitidis 22 kDa surface protein gene; AmpiR, ampicillin-resistance coding region; ColEl, origin of replication; cI857, bacteriophage λ cI857 temperature-sensitive repressor gene; XPL, bacteriophage λ transcription promoter; Tl transcription terminator. The direction of transcription is indicated by the arrows. BglTl and BaffiHl are the restriction sites used to insert the 22 kDa gene in the p629 plasmid.

DETAILED DBSCHIgTIOW OF TH¾ IHVEHTION During our study of the ultrastrueture of the outer membrane of Neisseria meningitidis we identified a new low molecular weight protein of 22 kilodaltons which has very unique properties. This outer membrane protein is highly resistant to extensive treatments with proteolytic ensymes, such as proteinase K, a serine protease derived from the mold TritiracMum album limber. This is very surprising since proteinase K resistant proteins are very rare in nature because of the potency, wide pH optimum, and low peptide bond specificity of this enzyme [Barrett/ A.J. and N.D. Rawlings, Biochem. Soc. Transactions (1991) Jl 19: 707-715]. Only a few reports have described proteins of prokaryotic origin that axe resistant to the enzymatic degradation of proteinase K. Proteinase resistant proteins have been found in .Leptospira species [Nicholson, V.M. and J.P. Prescott, Veterinary Microbiol. (1993) 36:123-138]/ Mycoplasma species [Butler, G.H. et al.

Infec. Immun. (1991) 59:1037-1042], Spiroplasma mlrvm (Bastian, P.O. et al. J. Clin. Microbiol. (1987) 25:2430- 2431] and in viruses and prions [Onodera, T. et al.

Microbiol . Iitintunol . (1993) 37:311-316; Prusiner, S.B. et al. Proc. Nat. Acad. Sci. USA (1993) 90:2793-2797].

The parent application as well as the present application describe the use of this protein as a means for the improved prevention, treatment and diagnosis of Neisseria meningitidis infections.

Thus according to one aspect of the parent invention the inventors provide a highly conserved, inanunologically accessible Neisseria meningitidis surface protein/ and fragments, analogues, and derivatives thereof. As used herein, 'Neisseria, meningitidis surface protein" means any Neisseria meningitidis surface protein encoded by a naturally occurring Neisseria meningitidis gene. Hie Neisseria meningitidis protein according to the parent invention as well as the present invention nay be of natural origin, or may be obtained through the application of molecular biology with the object of producing a recombinant protein, or fragment thereof.

As used herein/ "highly conserved" means that the gene for the Neisseria meningitidis surface protein and the protein itself exist in greater than 50% of known strains of Neisseria meningitidis. Preferably, the gene and its protein exist in greater than 99% of known strains of Neisseria meningitidis. Bxasqles 2 and 4 set forth methods by which one of skill in the art would be able to test a variety of different Neisseria meningitidis surface proteins to determine if they are "highly conserved" . 12 As used herein, "immunologically accessible" means that the Neisseria, meningitidis surface protein is present at the surface of the organism and is accessible to antibodies. Example 2 sets forth methods by which one of skill in the art would be able to test a variety of · different Neisseria, meningitidis surface proteins to determine if they are •i-onmunologically accessible" .

Immunological accessibility may be determined by other methods, including an agglutination assay, an ELISA, a RXA, an immunoblotting assay, a dot-enzyme assay, a surface accessibility assay, electron microscopy, o a combination of these assays.

As used herein, "fragments" of the Neisseria meningitidis surface protein include polypeptides having at least one peptide epitope, or analogues and derivatives thereof. Peptides of this type may be obtained through the application of molecular biology or synthesized using conventional liquid or solid phase peptide synthesis techniques.

As used herein, "analogues" of the Neisseria meningitidis surface protein include those proteins, or fragments thereof, wherein one or more amino acid residues in the naturally occurring sequence is replaced by another amino acid residue, providing that the overall functionality and protective properties of this protein are preserved. Such analogues may be produced synthetically, or by recombinant DNA technology, for example, by mutagenesis of a naturally occurring Neisseria meningitidis surface protein. Such procedures are well known in the art.

For example, one such analogue is selected from the recombinant protein that may be produced from the gene for the 22KDa protein from Neisseria gonorrhoeae strain b2, as depicted in Figure 10. A further analog may be obtained 13 from the isolation of the corresponding"gene from Neisseria laetamica.

As used herein, a "derivative" of the Neisseria meningitidis surface protein ia a protein or fragment thereof that has been covalently modified, for-example, with dinitrophenol, in order to render it immunogenic in humans . The derivatives of the parent invention also include derivatives of the amino acid analogues the parent invention. It will be understood that by following the examples of this invention/ one of skill in the art may determine without undue experimentation whether a particular fragment, analogue or derivative would be useful in the diagnosis, prevention or treatment of Neisseria meningitidis diseases.

The parent invention also includes polymeric forms of the Neisseria meningitidis surface proteins, fragments, analogues and derivatives. These polymeric forms include, for example, one or more polypeptides that have been crosslinked with crosslinkers such as avidin/biotin, gluteraldehyde or dimethylsuberimidate. Such polymeric forms also include polypeptides containing two or more tandem or inverted contiguous Neisseria meningitidis sequences, produced from mul icistronic mRKAs generated by recombinant ENA technology.

The parent invention provides substantially pure Neisseria meningitidis surface proteins. The term "substantially pure" means that the Neisseria meningitidis surface protein according to the invention is free from other proteins of Neisseria meningitidis origin. Substantially pure Neisseria meningitidis surface protein preparations can be obtained by a variety of conventional processes, for example the procedure described in Examples 3 and 11.

In a further aspect, the parent invention particularly provides a 22 kDa surface protein of Neisseria meningitidis having the amino acid sequence of Figure 1 14 (SEQ ID NO:2)/ or a fragment, analogue or derivative thereof .

In a further aspect, the parent invention particularly provides a 22 kDa surface protein of Neisseria. meningitidis having the amino acid sequence of Figure 8 (SEQ ID NO;4), Figure 9 (SEQ ID NQ:6) or a fragment, analogue or derivative thereof. Such a fragment may be selected from the peptides listed in Figure 15 (SEQ ID NO:9 to SEQ ID NO:26) .

In a further aspect, the parent invention provides a 22kDa surface protein of Neisseria gonorrhoeae having the amino acid sequence of Figure 10 (SEQ ID NO:8), or a fragment, analogue or derivative thereof. As will be apparent from the above, any reference to the Neisseria meningitidis 22JcDa protein also encompasses 22kDa proteins isolated from, or made from genes isolated from other species of Neisseriacae such as Neisseria gonorrhoeae or Neisseria lactamica.

A Neisseria meningitidis 22 KDa surface protein according to the parent invention may be further characterized by one or more of the following features: (1) it has an approximate molecular weight of 22 kDa as evaluated on SDS-P&GE gel; (2) its electrophoretic mobility on SDS-PAGE gel is 25 not modified by treatment with reducing agents; (3) it has an isoelectric point (pi) in a range around pi 8 to pi 10; (4) it is highly resistant to degradation by proteolytic enzymes such as o-chymotrypsin, trypsin and proteinase K; (5) periodate oxidation does not abolish the specific . binding of antibody directed against the Neisseria meningitidis 22 kDa surface protein; (6) it is a highly conserved antigen; (7) it is accessible to antibody a the surface of intact Neisseria meningitidis organisms; (8) it can induce the production of bactericidal antibodies; (9J it can induce the production of antibodies that can protect against experimental infection; (10) it can induce, when injected into an animal host, the development of an immunological response that can protect against Ne ss ria meningitidis i-afection.

The parent invention also provides, for the first time, a DNA sequence coding for the Neisseria meningitidis 22 kDa surface protein (SEQ ID NO;l, NO:3, NO:5, and ΝΌ:7) . The preferred DNA sequences of the parent invention are selected from the group consisting of: (a) the DNA sequence of Figure 1 (SEQ ID NO;D? (b) the DNA sequence of Figure 8 {SEQ ID NO:3); (c) the DNA sequence of Figure 9 (SEQ ID NO: 5); (d) the DMA sequence of Figure 10 (SEQ ID NO:7) ; (e) analogues or derivatives of the foregoing DNA sequences; (f) DNA sequences degenerate to any of the foregoing DNA sequences; and (g) fragments of any of the foregoing DNA sequences; wherein said sequences encode a product that displays the immunological activity of the Neisseria meningitidis 22 kDa surface protein.

Such fragments are preferably peptides as depicted in Figure 15 (SEQ ID NO:9, through SEQ ID N0:26) .

Preferably, the parent invention also provides, for the first time, a DNA sequence coding for the Neisseria meningitidis 22 kDa surface protein (SEQ ID N0:1) . More preferred DNA sequences of the parent invention are selected from the group consisting of: (a) the DNA sequence of Figure 1 (SEQ ID NO:l); 16 (b) analogues or derivatives of the foregoing DA sequences; (c) DMA sequences degenerate to any of the foregoing DMA sequences; and (d) fragments.of any of the foregoing DA sequences; wherein said sequences encode a product that displays the inaaunological activity of the Neisseria meningitidis 22 kDa surface protein.

Analogues and derivatives of the Neisseria meningitidis 22 kDa surface protein coding gene will hybridize to the 22 kDa surface protein-coding gene under the conditions described in Example 4.

For purposes of this invention, the fragments, analogues and derivatives of the Neisseria meningitidis 22 kDa surface protein have the "immunological activity" of the Neisseria meningitidis 22 kDa surface protein if tney can induce, when injected into an animal host, the development of an immunological response that can protect against Neisseria meningitidis infection. One of skill in the art may determine whether a particular DNA sequence encodes a product that displays the immunological activity of the' Neisseria meningitidis 22 kDa surface protein by following the procedures set forth herein in Example 6.

The Neisseria meningitidis surface proteins of the parent invention may be isolated by a method comprising the following steps: a) isolating a culture of Neisseria meningitidis bacteria, b) isolating an outer membrane portion from the cul ure of the bacteria; and c) isolating said antigen from the outer membrane portion.

In particular, the foregoing step (c) may include the additional steps of treating the Neisseria meningitidis outer membrane protein extracts with proteinase K, 17 followed by protein fractionation using-conventional separation techniques such as ion exchange and gel chromatography and electrophoresis.

Alternatively and preferably, the Neisseria meningitidis surface proteins of the parent invention may be produced by the use of molecular biology techniques, as more particularly described in Example 3 herein. The use of molecular biology techniques is particularly well- suited for the preparation of substantially pure recombinant Neisseria meningitidis 22 kDa surface protein.

Thus according to a further aspect of the parent invention we provide a process for the production of recombinant Neisseria meningitidis 22 kDa surface protein, including fragments, analogues and derivatives thereof, comprising the steps of (1) culturing a unicellular host organism transformed with a recombinant ΠΝΑ molecule including a ' DMA sequence coding for said protein, fragment, analogue or derivative and one or more expression control sequences operatively linked to the DKA sequence, and (2) recovering a substantially pure protein, fragment, analogue or derivative.

As is well known in the art, in order to obtain high expression levels of a transfected gene in a host, the gene must be operatively linked to transcriptional and translational expression control sequences that are functional in the chosen expression host. Preferably, the expression control sequences, and the gene of interest, will be contained in an expression vector that further comprises a bacterial selection marker and origin of replication. If the expression host is a euJcaryotic cell, the expression vector should further comprise an expression marker useful in the expression host.

A wide variety of expression host/vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E.coli, including col El, pCRl, pBR322, pMB9 and their derivatives, wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g. NM989, and other UNA phages, such as M13 and filamentous single stranded DNA phages, Useful expression vectors for yeast cells include the 2 u plasmid and derivatives thereof. Useful vectors for insect cells include pVL 941.

In addition, any of a wide variety of expression control sequences may be used in these vectors to express the DNA. sequences of the parent invention. Such useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors. Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter, for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast alpha-mating system and other sequences known to control expression of genes of prokaryotic and eukaryotic cells or their viruses/ and various combinations thereof. The Neisseria meningitidis 22 k a surface protein's expression control sequence is particularly useful in the expression of the JHeiassria. meningitidis 22 kDa surface protein in E.coli (Example 3).

Host cells transformed -with the foregoing vectors form & further aspect of this invention. A wide variety of unicellular host cells are useful in expressing the DNA sequences of the parent Invention; These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E.coli, Pseudomanas, Bacillus, Streptom ces, fungi, yeast, insect cells such as Sbodoptera frugiperda (SP9) , animal 5 cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS 7, BSC 1, BSC 40, and BMT 10, and human cells and plant cells in tissue culture. Preferred host organisms include bacteria such as E.coli and Bacillus subtilis and mammalian cells in tissue culture. 10 It should of course be understood that not all vectors and expression control sequences will function equally wall to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one of skill in 15 the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation and without departing from the scope of the parent invention. For example, in selecting a vector,- the host must be considered because the vector must replicate 20 in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the • sequence, its controllability, and its compatibility with the DNA sequences of the parent invention, particularly as regards potential secondary structures. Unicellular hosts 30 should be selected by consideration of their compatibility with the chosen vector, the toxicity of the -product coded for by the DNA sequences of the parent invention, their secretion characte istics, their ability to fold the protein correctly, their fermentation or culture requirements, and the ease of purification from them of the products coded for by the DMA. sequences of the parent invention.

Within these parameters, one of skill in the art may select various vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture.

The polypeptides encoded by the DNA sequences of the parent invention may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods. One of skill in the art may select the most appropriate isolation and purification techniques without departing from the scope of this invention.

The Neisseria meningitidis surface proteins of the parent invention are useful in prophylactic, therapeutic and diagnostic compositions for preventing, treating and diagnosing diseases caused by Neisseria meningitidis infection.

The Neisseria meningitidis surface proteins of the parent invention are useful in prophylactic, therapeutic and diagnostic compositions for preventing, treating and diagnosing diseases caused by Neisseria gonorrhoeae, or Neisseria J ct rnica infection.

The Neisseria meningitidis surface proteins according e parent invention are particularly well-suited for the generation of antibodies and for the development of a protective response against Neisseria meningitidis diseases as shown by the present invention.

The Ne sse ia meningitidis surface proteins according to this invention are particularly well-suited or the generation of antibodies and for, the development of a protective response against Neisseria gonorrhoeae or Neisseria lactarnica diseases.

In particular, we provide a Neisseria meningitidis 22 kDa surface protein having an amino acid sequence of Figure 1 (SEQ ID N0:2) or a fragment, analogue, or derivative thereof for use as an immunogen and as a vaccine.

In particular, the present invention provides a Neisseria meningitidis 22 kDa surface protein having an amino acid sequence of Figure 1 (SEQ II? NO:2), Figrure 8 (SEQ ID NO: ) , Figure 9 (SEQ ID NO: 6), or Figure 10 (SEQ ID NO:8), or a fragment, analogue, or. derivative -thereof for uoc aa an immunogen and as a vaccine.

Standard immunological techniques may be employed with the Neisseria meningitidis surface proteins in order to use them as immunogens and'as vaccines. In particular, any suitable host may be injected with a pharmaceutically effective amount of the Neisseria meningitidis 22 kDa surface protein to generate monoclonal or polyvalent anti- Neisseria meningitidis antibodies or to induce the development of a protective immunological response against Neisseria meningitidis diseases. Prior to injection of the host, the Neisseria meningitidis surface proteins may be formulated in a suitable vehicle, and thus we provide a pharmaceutical composition comprising one or more Neisseria meningitidis surface antigens or fragments thereof. Preferably, the antigen is the.Neisseria meningitidis 22 kDa surface protein or fragments, analogues or derivatives thereof together with one or more pharmaceutically acceptable excipients. As used herein, "pharmaceutically effective amount" refers to an amount of • one or more Neisseria meningitidis surface antigens or fragments thereof that elicits a sufficient titer of anti- Neisseria meningitidis antibodies to treat or prevent Neisseria meningitidis infection,.

The Neisseria meningitidis ·surface proteins of the parent invention may also form the basis of a diagnostic test ofthe present invention for Neisseria meningitidis infection. Several diagnostic methods are possible. For example, the present invention .22 provides a method for the detection of Neisseria meaingitidis antigen in a biological sample containing or suspected of containing Neisseria meningitidis antigen comprising: a) isolating the biological · sample from a patient; b) incubating an anti'Neisseria meningitidis 22 kDa surface protein antibody or fragment thereof with the biological sample to form a mixture; and c) detecting specifically bound antibody or bound 10 fragment in the mixture which indicates the presence of Neisseria meningitidis antigen.

Preferred antibodies in the foregoing diagnostic method are Me-1 and Me-7.

Alternatively, the present invention provides a method for 15 the detection of antibody specific to Neisseria meningitidis antigen in a biological sample containing or suspected of containing said antibody comprising: a) isolating the biological sample from a patient; b) incubating a Neisseria meningitidis surface protein of the parent invention or fragment thereof with the biological sample to form a mixture; and c) ' detecting specifically bound antigen or bound fragment in the mixture which indicates the presence of .antibody specific to Neisseria meningitidis antigen.

One of skill in the art will recognize that this diagnostic test may take several forms, including an immunological test such as an enzyme-linked immunosorbent assay (ELISA) , a radioimmunoassay or a latex agglutination assay, essentially to determine whether antibodies specific for the protein are present in an organism.

The DNA sequences of the parent invention may also be used to design DNA probes for use in detecting the presence of the pathogenic Neisseria bacteria in a biological suspected of containing such bacteria. The detection method of the parent invention comprises the steps of: 23 a) isolating the biological sample from a patient; b) incubating a DNA probe having a DNA sequence of this invention with the biological sample to form a mixture; and c) detecting specifically bound DNA probe in the mixture which indicates the presence of Neisseria bacteria.

Pre erred DNA probes have the base pair sequence of Figure 1 (SSQ ID NO:l), Figure 8 (SEQ ID N0:3), Figure 9 (SEQ ID O:5), or Figure 10 (SEQ ID NO;7), or consensus sequence of Figure 11 (SEQ ID NO:9).

A more preferred DNA probe has the 525 base pair sequence of Figure 1 (SEQ ID O:l) .

The DNA probes of the parent invention may also be used for detecting circulating Neisseria meningitidis nucleic, acids in a sample, for example using a polymerase chain reaction, as a method of diagnosing Neisseria meningitidis infections. The probe may be synthesized using conventional techniques and may be immobilized on a solid phase, or may be labeled with a detectable label.

A preferred DNA probe for the parent application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the Neisseria meningitidis 22 kDa surface protein gene of Figure 1 (SSQ ID NO:l), Figure 8 (SBQ ID NO:3), Figure 9 (SEQ ID 170:5) , Figure 10 (SEQ ID O:7), or consensus sequence of Figure 11 (SEQ JED 110:9).

A more pre erred DKA probe for the parent application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the Neisseria meningitidis 22 kDa surface protein gene of Figure 1 (SEQ ZD NO:l) .

Another diagnostic method for the detection of Neisseria meningitidis in a patient comprises the steps of: a) labeling an antibody of this invention or fragment thereof with a detectable label; 24 b) administering the . labeled antibody or labeled fragment to the patient; and c) detecting specifically bound labeled antibody or labeled fragment in the patient which indicates the presence of Neisseria meningitidis.

Por purification of any anti-Xieisseria meningitidis surface protein antibody, use may be made of affinity chromatography employing an immobilized Neisseria meningitidis surface protein as the affinity medium.

Thus according to another aspect of the present invention we provide a Neisseria meningitidis 22 kDa surface protein having an amino acid sequence which includes the sequence of Figure 1 (SEQ ID NO:2) , Figure 8 (SEQ ID NO:4) , Figure 9 (SEQ ID NO: 6), or Figure 10 (SEQ ID NO; 8), or portion thereof or an analogue thereof, covalently bound to an insoluble support.

Thus according to a preferred aspect of the invention we provide a Neisseria meningitidis 22 kDa surface protein having an amino acid sequence which includes the sequence of Figure 1 {SEQ ID NO:2), or portion thereof or an analogue thereof, covalently bound to an insoluble support .

A further feature of the present invention is the use of the Neisseria meningitidis surface proteins of the parent invention as ixnmuogens for the production of specific antibodies for the diagnosis and in particular the treatment of Neisseria meningitidis infection. Suitable antibodies may be determined using appropriate screening methods, for example by measuring the ability of a particular antibody to passively protect against Neisseria meningitidis infection in a test model. One example of an animal model is the mouse model described in the Examples herein. The antibody may be a whole antibody or an antigen-binding fragment thereof and may in general belong to" any immunoglobulin class. The antibody or fragment may be of animal origin, specifically of mammalian origin and more specifically of murine, rat or human origin. It may be a natural antibody or a fragment thereof, or if desired, a recombinant antibody or antibody fragment. The term recombinant antibody or antibody fragment means antibody or antibody fragment which were produced using molecular biology techniques. The antibody or antibody fragments may be of polyclonal, or preferentially, monoclonal origin. It may be specific for a number of epitopes associated with the Neisseria meningitidis surface proteins but it is preferably specific for one.

Preferably, the antibody or fragments thereof will be specific for one or more epitopes associated with the Neisseria meningitidis 22 k a surface protein. Also preferred are the monoclonal antibodies Me-1 and Me-7 described herein.

EXAMPLES In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only, and are not to be construed as limiting the scope of the invention in any manner.

Exam le 1 describes the treatment of Neisseria meningitidis outer membrane preparation with proteolytic enzymes and the subsequent identification of the Neisseria meningitidis 22 kDa surface protein.

Example 2 describes the preparation of monoclonal antibodies specific for Neisseria meningitidis 22 kDa surface protein.

Example 3 describes the preparation of Neisseria meningitidis recombinant 22 kDa surface protein.

Example 4 describes the use of DMA probes for the identification of organisms expressing the Neisseria meningitidis 22 kDa surface protein. 26 Example 5 describes the use of an anti-Msisseria meningitidis 22 kDa surface protein monoclonal antibody to protect mice against Neisseria meningitidis infection. Xxample 6 describes the use of purified recombinant 22 kDa surface protein to induce a protective response against Neisseria meningitidis infection.

.Example 7 describes the identification of the sequence for the 22kDa protein and protein-coding gene for other strains of JVeisseria meningitidis (MCH88, and Z4Q63), and one strain of Nelssrla gonorrhoeae.

Example 8 describes the immunological response of rabbits and monkeys to the 22kDa Neisseria meningitidis surface protein.

Example 9 describes the procedure used to map the different immunological epitopes of the 22kDa Neisseria meningitidis surface protein.

Example 10 describes the induction by heat of an expression vector for the large scale production of the 22 kDa surface protein.

Example 11 describes a purification process for the 22kDa surface protein when produced by recombinant technology. Example 12 describes the use of 22kDa surface protein as a human vaccine.

K3HWPLB 1 Treatment of Jfeisseria meningitidis Outer Membrane Preparations With Proteolytic z zymes And The Subsequent Identification Of An Enzyme Resistant neisseria meningitidis 22 kDa Surface Protein Several antigenic preparations derived from whole cell, lithium chloride, or sarcosyl extracts were used to study the ultrastructure of Neisseria meningitidis outer membrane. The outer membrane of Gram-negative bacteria 27 acts as an interface between the environment and the interior of the cell and contains most of the antigens that are freely exposed to the host immune defense. The main goal of the study was the identification of new r antigens which can induce a protective response against Neisseria meningitidis. One approach used by the inventors to identify such antigens, was the partial disruption of the antigenic preparations mentioned above with proteolytic enzymes. The antigenic determinants generated by the enzymatic treatments could then be identified by the subsequent analysis of the immunological and protective properties of these treated antigenic preparations. To our surprise we observed after electrophore ic resolution of Neisseria meningitidis lithium chloride outer membrane extracts, that one lo molecular weight band, which was stained with Coomassie Brilliant Blue R-250, was not destroyed by proteolytic enzyme treatments. Coomassie Blue is used to stain proteins and peptides and .has no or very little affinity for the polysaccharides or lipids which are also key components of the outer membrane. The fact that this low molecular weight antigen was stained by Coomassie blue suggested that at least part of it is made up of polypeptides that are not digested by proteolytic enzymes, or that are protected against the action of the enzymes by other surface structures. Moreover, as demonstrated below the very potent enzyme proteinase K did not digest this low molecular weight antigen even after extensive treatments.

Lithium chloride extraction was used to obtain the outer membrane preparations from di ferent strains of Neisseria meningitidis and was performed in a manner previously described by the inventors [Brodeur et al. , Infect. Immun. , 50, p. 510 (1985 ) ] . The protein content of these preparations were determined by the Lowry method 28 adapted to membrane fractions [Lowry etTal., J. Biol.

Chem. 193, p, 265 (1951)]. Outer membrane preparations derived from Neisseria meningitidis strain 608B (B:2a:Pi.2) were treated for 24 hours at 37°C and continuous shaking with either a-chymotrypsin from bovine pancreas (B.C. 3.4.21.1) (Sigma) or trypsin type 1 from bovine pancreas (B.C. 3.4,21.4) (Sigma). The enzyme concentration was adjusted at 2 mg per mg of protein to be treated. The same outer membrane preparations were also treated with different concentrations (0.5 to 24 mg per mg of protein) of Proteinase K from Tritirachiurn album limber (Sigma or Boehringer Mannheim, Laval, Canada) (B.C. 3.4.21.14) . In order to promote protein digestion by proteinase , different experimental conditions were used. The samples were incubated for 1 hour, 2 hours, 24 hours or 48 hours at 37°C or 56°C with or without shaking. The pH of the mixture samples was adjusted at either pH 7.2 or pH 9.0. One % (vol/vol) of sodium dodecyl sulfate (SDS) was also added to certain samples. Immediately after treatment the samples were resolved by SDS-PAGE gel electrophoresis using the MiniProteanll® (Bio-Rad, Missiseauga, Ontario, Canada) system on 14% (wt/vol) gels according to the manufacturer's instructions. Proteins were heated to 10Q°C for 5 minutes with 2-mercaptoe hanol and SDS, separated on 14% SDS gels, and stained with Cooraassie Brilliant Blue R-250.

Figure 2 presents the migration profile on 14% SDS- PAGB gel of the proteins present in outer membrane preparations derived from Neisseria meningitidis strain 608B {B:2a:PI.2) after treatment at 37°C for 24 hours with a-chymotrypsJ-n and trypsin. Extensive proteolytic digestion of the high molecular weight proteins and of ■ several major outer membrane proteins can be observed for the treated samples (Figure 2, lanes 3 and 4) compared to the untreated control (Figure 2, lane 2). On the 29 contrary, a protein band With an apparent molecular weight of 22 kDa was not affected even after 24 hours of contact with either proteolytic enzyme.

■ This unique protein was further studied using a more aggressive proteolytic treatment with Proteinase K (Figure 3) . Proteinase K is one of the most powerful proteolytic enzymes since it has a low peptide bond specificity and wide pH optimum. Surprisingly, the 22 kDa protein was resistant to digestion by, 2 International Units (IU) of proteinase K for 24 hours at 560C (Figure 3, lane 2 ) . This treatment is often used in our laboratory to produce lipopolysaccharides or DMA that are almost free of proteins. Indeed, only small polypeptides can be seen after such an aggressive proteolytic treatment of the outer membrane preparation. Furthermore, longer treatments, up to 48 hours, or higher enzyme concentrations (up to 24 IU) did not alter the amount of the 22 kDa protein. The amount and migration on SDS-PAGB gel of the 22 kDa protein were not affected when the pH of the reaction mixtures was increased to pH 9 .0 , or when 1. 0% of SDS, a strong protein denaturant was added (Figure 3 , lanes 4 , 6 and 8 ) . The combined use of these two denaturing conditions would normally result in the complete digestion of the proteins present in the outer membrane preparations, leaving only amino acid residues. Polypeptides of low molecular weight were often observed in the digests and were assumed to be fragments of sensitive proteins not effectively digested during the enzymatic treatments. These fragments were most probably protected from further degradation by the carbohydrates and lipids present in the .outer membrane. The bands with apparent molecular weight of 28 'kDa and 34 kDa which are present in treated samples are respectively the residual enzyme and a contaminating protein present in all enzyme preparations tested.

Interestingly, this study about the resistance of the 22kDa protein to proteases indicated that another protein band with apparent molecular weight of 18kDa seems to be also resistant to enzymatic degradation (Figure 3a) . Clues about this 18kDa protein band were obtained when the migration profiles on SDS-PAGB gels of affinity purified recombinant 22kDa protein were analyzed (Figure 3b) . The 18 kDa band was apparent only when the affinity purified recombinant 22kDa protein was heated for an extended period of time in sample buffer containing the detergent SDS before it was applied on the gel. N-terminal amino acid analysis using the Edman degradation (Example 3) clearly established that the amino acid residues (E-G-A-S-O-F-Y-V-Q) identified on the 18 kDa band corresponded to the amino acids 1-9 (SEQ ID N0:l).^These results indicate that the 18 and 22kDa bands as seen on the SDS-PAGE is in fact derived from the same protein. This last result also indicates that the leader sequence is cleaved from the mature 18 kDa protein. Further studies will be done to identify the molecular modifications explaining this shift in apparent molecular weight and to evaluate their impact on the antigenic and protective properties of the protein.

In conclusion, the discovery of a Neisseria meningitidis outer membrane protein with the very rare property of being resistant to proteolytic digestion warranted further study of its molecular and immunological characteristics. The purified recombinant 22 kDa surface protein produced by Escherichia coli in Example 3 is also highly resistant to proteinase K digestion. We are presently trying to understand the mechanism which confers to the Neisseria meningitidis 22 kDa surface protein this unusual resistance to proteolytic enzymes. 31 BXaaSLB 2 Ceaeration of Monoaloa l Antibodies Specific for the 22 WD Neisseria meningitidis fluxfaae Protein The monoclonal antibodies described herein were obtained from three independent fusion experiments.

Female Balb/c mice (Charles River Laborato es, St-Constant, Quebec, Canada) were immunized with- outer membrane, preparations obtained from .Neisseria jneningi idiir strains 604A, 608B and 2241C respectively serogrouped A, B and C. The lithium chloride extraction used to obtain these outer membrane pseparafeionc-was-porforine in -a-manner previously described by the inventors. [Brodeur et al., Infect. Immun. 50, p. 510 (1985)]. The protein content of these preparations were determined by the Lowry method adapted to membrane fractions [Lowry et al . , J .

Biol. Chem. 193, p. 265 (1951)]. Groups of mice were injected intraperitoneally or subcutaneously twice, at three-week intervals with 10 mg of different combinations of the outer membrane preparations described above.

Depending on the group of mice, the adjuvants used for the immunisations were either Freund's complete or incomplete adjuvant (Gibco Laboratories, Grand Island, N.Y.), or QuilA (CedarLane Laboratories, Hornby, Ont., Canada).

Three days before the fusion procedure, the immunized mice received a filial intravenous injection of 10 mg of one of the outer membrane preparations described above. The fusion protocol used to produce the bybridoma cell lines secreting the desired monoclonal antibody was described previously by the inventors [Kernel et al., J. Clin.

Microbiol. , 25, p. 2434 (1987)]. The class, subclass and light-chain type of monoclonal antibodies Me-1, Me-2, Me-3, Me-5, Me-6 and Me-7 were determined by ELISA as previously reported [Martin et al., J. Clin. Microbiol., 28, p. 1720 (1990)1 and are presented in Table 1.

The specificity of the monoclonal "antibodies was established using Western immunoblotting following the method previously described by the inventors [Martin et al,, Bur. J. Immunol. 18, p. 601 (1988)1 with the following modifications. Outer membrane preparations obtained from different strains of Neisseria meningitidis were resolved on 14% SDS-PAGE gels. The proteins were transferred from the gels to nitrocellulose membranes using a semi-dry apparatus ( io- ad) . A current of 60 mA per gel (6X10cm) was applied for 10 minutes in the electroblot buffer consisting of 25 mM Tris-HCl, 192 mM glycine and 20% (vol/vol) methanol, pH 8.3. The Western immunoblotting experiments clearly indicated that the monoclonal antibodies Me-1, Me-2, Me-3, Me-5, Me-6 and Me-7 recognized their specific epitopes on the Neisseria meningitidis 22 fcDa protein (Figure 4A) . Analysis of the SDS-PAGE gels and the corresponding Western immunoblots also indicated that the apparent molecular weight of this protein does not vary from one strain to another.

However, the amount of protein present in the outer membrane preparations varied from one strain to another and was not related to the serogroup of the strain.

Moreover, these monoclonal antibodies still recognized their epitopes on the Neisseria meningitidis 22 kDa surface protein after treatment of the outer membrane preparation with 2 IU of proteinase K per mg of protein (treatment described in Example 1, supra) (Figure 46) . Interestingly, the epitopes remained intact after the enzyme digestion thus confirming that even if they are accessible in the membrane preparation to the antibodies they are not destroyed by the enzyme treatment. This latter result suggested that the' mechanism which explains the observed proteinase resistance is most probably not related to surface structures blocking the access of the enzyme to the protein, or to the protection offered by the membrane to proteins which are deeply embedded. While not shown in Figure 4, the results of the iitirnunoblots for Me-l were consistent with the results for the other five monoclonal antibodies.. ^ A series of experiments were performed to partially characterize the Neisseria meningitidis 22 kDa surface protein and to differentiate it from the other known meningococcal surface proteins. No shift in apparent molecular weight on SDS-PAGE gel of the Neisseria. meningitidis 22 kDa surface protein was noted when outer membrane preparations were heated at 100°C for 5 minutes, or at 37°C and 56°C for 30 minutes in electrophoresis sample buffer with or without 2-mercaptoethanol . This indicated that the migration of the 22kDa surface protein, when present in the outer membrane, was not heat- or 2-mercaptoethanol-modifiable.

Sodium periodate oxidation was used to determine if the monoclonal antibodies reacted with carbohydrate epitopes present in the outer membrane preparations extracted from Neisseria meningitidis organisms. The method used to perform this experiment was previously described by the inventors . tMartin et al. , In ec .

Immun. , 60, pp. 2718-2725 (1992) ]. Treatment of outer membrane preparations with 100 mW of sodium periodate for 1 hour at room temperature did not alter the reactivity of the monoclonal antibodies toward the Neisseria mening tidis 22 kDa surface protein. This treatment normally abolishes the binding of antibodies that are specific for carbohydrates.

Monoclonal antibody 2-1-CA2 (provided by Dr. A.

Bhattacha jee, Walter Reed Army Institute of Research, Washington, D.C.) is specific for the lip protein (also called H.8), a surface antigen common to all pathogenic Neisseria species. The reactivity of this monoclonal antibody with outer membrane preparations was compared to the reactivity of monoclonal antibody Me-5. The lip- specific monoclonal antibody reacted with a protein band having an apparent molecular weight of 30 kDa, while monoclonal antibody Me-5 reacted with the protein band of 22 ka. This result clearly indicates that there is no relationship between Neisse ia meningitidis 22 kDa surface protein and the lip protein, another highly conserved outer membrane protein.

To verify the exposure of the 22 kDa protein at the surface of intact Neisseria meningitidis bacterial cells, a radioimmunoassay was performed as previously described by the inventors [Proulx et al., Infec. Immu . , 59, p. 963 (1991)]. Six-hour and 18-hour bacterial cultures were used for this assay. The six monoclonal antibodies were reacted with 9 Neisseria, meningitidis strains (the serogroup of the strain is indicated in parentheses on Figure 5), 2 Neisseria gonorrhoeae strains {'NG'), 2 Moxaxella catarrhalis strains CMC) and 2 Neisseria lactrnica strains ("NL"). The radioimmunoassay confirmed that the epitopes recognized by the monoclonal antibodies are exposed at the surface of intact Neisseria meningitidis isolates of different serotypes and serogroups and should also be accessible to the proteolytic enzymes (Figure 5) . The monoclonal antibodies bound strongly to their target epitopes on the surface of all Neisseria meningitidis strains tested. The recorded binding values (between 3, 000 to 35 000 CPM) , varied from one strain to another, and with the physiological state of the bacteria. A Haemophilus influenzae porin-specific monoclonal antibody was used as a negative control for each bacterial strain. Counts below 500 CPM were obtained and subsequently subtracted from each binding value. With respect to the Neisseria meningitidis strains tested in this assay, the results shown in Figure 5 for monoclonal antibodies Ke-5 and Me-7 are representative of the results obtained with monoclonal antibodies Me-T, Me-2, Me-3 and Me-6. With respect to the other bacterial strains tested, the binding activities Bhovm for Me-7 are representative of the binding activities obtained with other monoclonal antibodies that recognized the same bacterial^strain.

The antigenic conservation of the epitopes recognized by the monoclonal antibodies was also evaluated. A dot enzyme immunoassay was used for the rapid screening of the monoclonal antibodies against a large number of bacterial strains. This assay was performed as previously described by the inventors [Lussier et al., J. Immunoassay, 10, p. 373 (1989)]. A collection of 71 Neisseria meningitidis strains was used in this study. The sample included 19 isolates of serogroup A, 23 isolates of serogroup B, 13 isolates of serogroup C, 1 isolate of serogroup 29Ξ, 6 isolates of serogroup W-135, 1 isolate of serogroup X, 2 isolates of serogroup Y, 2 isolates of serogroup Z, and 4 isolates that were not serogrouped CHS") . These isolates were obtained from the Caribbean Epidemiology Centre, Port of Spain, Trinidad; Children's Hospital of Eastern Ontario, Ottawa, Canada; Department of Saskatchewan Health, Regina, Canada; Laboratoire de Sante Publique du Quebec, Montreal, Canada; Max-Planck Insti ut fur Molekulare Genetik, Berlin, FRG; Montreal Children Hospital, Montreal, Canada; Victoria General Hospital, Halifax, Canada; and our own strains collection. The following bacterial species were also tested: 16 Neisseria gonorrhoeae, 4 Neisseria cinerea, 5 Neisseria lac arnica, 1 Neisseria flava, 1 Neisseria flavescens, 3 Neisseria . mucosa, A Neisseria perflava/sicca, 4 Neisseria perflava, 1 Neisseria sicca, 1 Neisseria subflava and 5 Moraxella catarrhalis, 1 Alcaligenes feacalis (ATCC 8750), 1 Citrobacter frevndil (ATCC 2080), 1 Edwarsiella tarda (ATCC 15947), 1 .Baterobacter cloaca (ATCC 23355), 1 snterabacter aerogenes (ATCC 13048), 1 Escherichia coll, 1 Flavobacterium odoratunt, 1 Haemophilus influenzae type b (Bagan strain), X Klebsiella pneumoniae {ATCC 13883), 1 Proteus rettgeri (ATCC 25932), 1 Proteus vul ais (ATCC 13315), 1 Pseudomona.? aeruginosa (ATCC 9027), Salmonella tphiimxrium (ATCC 14028), 1 Serrati marcescen ' (ATCC 8100), 1 Shigella flexnerl (ATCC 12022), 1 Shigella sonnei (ATCC 9290) . They were obtained from the American Type Culture Collection or a collection held in the Laboratory Centre for Disease Control, Ottawa, Canada. The reactivities of the monoclonal antibodies with the most relevant Neisseria strains are presented in Table 1. One monoclonal antibody, Me-7, recognized its specific epitope on 100% of the 71 Neisseria meningitidis strains tested. This monoclonal antibody, as well as Me-2, Me-3, Me-5 and Me-6 also reacted with certain strains belonging to other Neisseria! species indicating that their specific epitope is also expressed by other closely related Nelsseriaceae. Except for a faint reaction with one Neisseri ■lactamica strain, monoclonal antibody Me-1 reacted only with Neisseiria meningitidis isolates. Me-1 was further tested with another sample of 177 Neisseria meningitidis isolates and was able to correctly identify more than 99% of the total Neisseria meningitidis strains tested.

Besides the Neisseria strains presented in Table 1, the monoclonal antibodies did not react with any of the other bacterial species mentioned above.

In conclusion, six monoclonal antibodies which specifically reacted with the Neisseria meningitidis 22 kDa surface protein were generated by the inventors.

Using these monoclonal antibodies we demonstrated that their specific epitopes are 1) located on a proteinase K resistant 22 kDa protein present in the outer membrane of Neisseria meningitidis, 2) conserved among Neisseria meningitidis isolates, 3) exposed at the surface of intact .Neisseria meningitidis cells and accessible to antibody, and 4) the reactivity of these monoclonal antibodies with the .Neisseria meningitidis 22 kDa surface protein is not modified by a treatment with sodium periodate, suggesting that their specific epitopes are not located on carbohydrate .

Although we found that the migra ion of the Neisseria meningitidis 22kDa protein is moved to an apparent molecular weight of about 18kDa when heated under stringent conditions, we observed that the migration is not modified by 2-mercaptoethanol treatment.

We also demonstrated that the Neisseria meningitidis 22 kD surface protein has no antigenic similarity with the lip protein, another low molecular weight and highly conserved protein present in the outer membrane of Neisseria, meningitidis.

As will be presented in Example 3, these monoclonal antibodies also reacted with the purified, recombinant 22 kDa surface protein produced a ter trans ormation of Escherichia coli strain BL21 (DB3 ) with a plasmid vector pUP2202 containing the gene coding for the Neisseria meningitidis 22 kDa surface protein. 38 Table 1. Reactivity of the monoclonal antibodies with Neia&eris isolates solates not serogrouped SXAHPLZ 3 Molecular Cloning, Sequencing Of The Gene High Yield Expression And Purification Of The Nisseria meningitidis 22 kDa Surface Protein A. Molecular cloning A LairibdaGEM-11 genomic DMA library from Neisseria, meningitidis strain 608B (B:2a:PI.2) was .constructed, according to the manu acturer's recommendations (Promega CO, Madison, WI) . Brie ly, the genomic DNA of the 60SB strain was partially digested with Sau 3AI, and fragments ranging between 9 and 23 Kb were puri ied on agarose gel before being ligated to the Bam Hi sites of the LambdaGEM- 11 arms. The resulting recombinant phages were used to infect Escherichia coli strain LE392 (Promega) which was then plated onto LB agar plate . , Nineteen positive plaques were identified after the inuttuno-screening of the library with the Neisseria meningitidis 22 kDa surface protein-specific monoclonal antibodies of Example 2 using the following protocol. The plates were incubated 15 39 minutes at -20°C to harden the top agar. Nitrocellulose filters were gently applied onto the surface of the plates for 30 minutes at 4°C to absorb the proteins produced by the recombinant viral clones. The filters were then washed in PBS-Tween 0.02% (vol/vol) and immunoblotted as described previously [Lussier et al., J. Immunoassay, 10, p. 373 (1989)]. After amplification and DNA purification, one viral clone, designated clone 8, which had a 13 Kb insert was selected for the subcloning experiments. After digestion of this clone with Sac I, two fragments of 5 and 8 Kb were obtained. These fragments were purified on agarose gel and ligated into the Sac I restriction site of the low copy number plasmid pWKS30 [Wang and Kushner, Gene, 100, p. 195 (1991)]. The recombinant plasmids were used to transform sc r c ia coli strain JM109 (Promega) by electroporation (Bio-Rad, Miesissauga, Ont., Canada) following the manufacturer's recommendations, and the resulting colonies were screened with the Neisseria meningitidis 22 kDa surface protein-speci ic monoclonal antibodies of Example 2. Positive colonies were observed only when the bacteria were transformed with the plasmid carrying the 8 Kb insert. Western blot analysis (the methodology was described in Example 2) of the positive clones showed that the protein expressed by Escherichia coli was complete and migrated on SDS-PAGE gel like the Neisseria meningitidis 22 kDa surface protein. To further reduce the size of the insert, a clone containing the 8 Kb fragment was digested with Cla I and a 2.75 Kb fragment was then ligated into the Cla I site of the pWKS30 plasmid. Western blot analysis of the resulting clones clearly indicated once again that the protein expressed by Escherichia coli. as complete and migrated on SDS-PAGE gel like the native Neisseria, mening tidis 22 kDa surface protein. 40 After restriction analysis, two clones, designated pNP2202 and pNP2203, were shown to carry the 2.75 Kb insert in opposite orientations and were selected to proceed with the sequencing of the gene coding for the Neisseria meningitidis 22 JcDa surface protein. The "Double Stranded Nested Deletion Kit" from Pharmacia Biotech Inc. (Piscataway, NJ) was used according to the manufacturer's instructions to generate a series of nested deletions from both clones. The resulting truncated inserts were then sequenced from the M13 forward primer present on the pWKS30 vector with the "Taq Dye Deoxy Terminator Cycle Sequencing Kit" using an Applied Biosystems Inc. (Foster City, CA) automated sequencer model 373A according to the manufac urer's recommendations .

B, Sequence Analysis After the insert was sequenced in both directions, the nucleotide sequence revealed an open reading frame consisting of 525 nucleotides (including the stop codon) encoding a protein composed of 174 amino acid residues having a predicted molecular weight of 18,000 Daltons and a pi of 9.93. The nucleotide and deduced amino acid sequences are presented in Figure 1 (S£Q ID O;l; SEQ ID O:2).

To confirm the correct expression of the cloned gene, the N-terminal amino acid sequence of the native 22 kDa surface protein derived from Neisseria meningitidis strain 608B was determined in order to compare it with the amino acid sequence deduced from the nucleotide sequencing data. Outer membrane preparation derived from Neisseria meningitidis strain 608B was resolved by electrophoresis on a 14% SDS-PAGE gel and transferred onto a polyvinylidine difluoride membrane (Millipore Products, Bedford lift) according to a previously described method 41 [Sambrook et al./ Molecular Cloning,- a laboratory manual. Cold Spring Harbor Laboratory Press (1989)]. The 22 kDa protein band was excised from the gel and then subjected to Edman degradation using the Applied Biosys£ems Inc. (Poster City, CA) model 473A automated protein sequencer following the manufacturer's recommendations. The amino acid sequence E-G-A-S-G-F-Y-V-Q-A corresponded to amino acids 1-10 (SEQ ID NO:2) of the open reading frame, indicating that the Neisseria meningitidis strain 608B, 22 kDa surface protein has a 19 amino acid leader peptide (amino acid residues -19 to -1 of SEQ ID NO:2) .

A search of established databases confirmed that the Neisseria meningitidis strain 608B, 22 kDa surface protein (SEQ ID N0:2) or its gene {SEQ ID NO:l) have not been described previously.

C. High Yield Expression And Purification of The Recombinant Neiaaeria meningitidis 22 kPa Surface Protein The following process was developed in order to maximize the production and purification of the recombinant Neisseria meningitidis 22 kDa surface protein expressed in Escherichia coli. This process is based on the observation that the recombinant 22 kDa surf ce protein produced by Escherichia coli strain BL2KDE3) [Studier and Moffat, J. Mol. Biol., 189, p. 113 (1986)] carrying the plasmid pNP2202 can be found in large amounts in the outer membrane, but can also be obtained from the culture supernatant in which it is the most abundant protein. The culture supernatant was therefore the material used to purify the recombinant 22 kDa protein using affinity chromatography (Figure 6A) .- To generate an affinity chromatography matrix,, monoclonal antibodies Me-2, Me-3 and Me-5 (described in Example 2) were immobilised on GNBr-activated sepharose 4B 42 (Pharmacia Biotech Inc., Piscataway, NJ) according to the manufacture 1a instructions .

To prepare the culture supernatant, an overnight culture of Escherichia coli strain BL21(DE3) ^harboring the plasmid pNP2202 was inoculated in LB broth {Gibco Laboratories, Grand Island, N.Y.J containing 25 mg/ml of ampicillin (Sigma) and was incubated 4 hours at 37°c with agitation. The bacterial cells were removed from the culture media by two centrifugations at 10,000 Xg for 10 minutes at 4°C. The culture supernatant was filtered onto a 0.22 mm membrane ( illipore, Bedfords, HA) and then concentrated approximately 100 times using an ultrafiltration membrane (Amicon Co., Beverly, MA) with a molecular cut off of 10,000 Daltons. To completely solubilize the membrane vesicles, Empigen BB (Calbiochem Co., LaJolla, CA) ) was added to the concentrated culture supernatant to a final concentration of 1% (vol/vol) . The suspension was incubated at room temperature for one hour, dialyzed overnight against several liters of 10 mM Tris-HCl buffer, pH 7.3 containing 0.05% Empigen BB (vol/vol) and centrifuged at lO.OOOXg for 20 minutes at 4°C. The antigen preparation was added to the a finity matrix and incubated overnight at 4°C with constant agitation. The gel slurr was poured into a chromatography column and washed extensively with 10 mM Tris-HCl buffer,' pH 7.3 containing 0.05% Empigen BB (vol/vol) . The recombinant 22 kDa protein was then eluted from the column with 1 M LiCl in 10 on Tris-HCl buffer, pH 7.3. The solution containing the eluted protein was dialyzed extensively against several liters of 10 mM Tris-HCl buffer, pH 7,3 containing 0.05% Empigen BB. Coomassie Blue and silver stained SDS-Page gels [Tsai and Frasch, Analytical Biochem., 119, pp. 19 (1982)] were used to evaluate the purity of the recombinant 22 kDa surface protein at each step of the purification process and representative results are 43 presented in Figure 6A. Silver staining of the gels clearly demonstrated that the purification process generated a fairly pure recombinant 22 kDa protein with only a very small quantity of Escherichia coli lipopolysaccharide. ^ The resistance to proteolytic cleavage of the purified recombinant 22 kDa surface protein was also verified and the results are presented in Figure 6B.

Purified recombinant 22 kDa surface protein was treated as described in Example 1 with a-chymotrypsin and trypsin at 2 mg per mg of protein and with 2 IU of proteinase κ per mg of protein for 1 hour at 37°C with constant shaking. Ho reduction in the amount of protein was observed after any of these treatments. In comparison, partial or complete digestion depending on the enzyme selected was observed for the control protein which was in this case bovine serum albumin (BSA, Sigma) . Furthermore/ longer periods of treatment did not result in any modification of the protein. These latter results demonstrated that transformed Escherichia coli cells can express the complete recombinant 22 kDa surface protein and that this protein is also highly resistant to the action of these three proteolytic enzymes as was the native protein found in Neisseria meningitidis. In addition, the purified recombinant 22 kDa surface protein which is not embedded in the outer membrane of Escherichia coli is still highly resistant to the action of the proteolytic enzymes.

We also verified the effect of the enzymatic treatments on the antigenic properties of the recombinant 22 kDa protein. As determine by BLISA and Western inraunoblotting, the monoclonal antibodies described in Example 2 readily recognized the recombinant 22 kDa surface protein that was purified according to the process described above (Figure 6C) . Moreover, the reactivity of monoclonal antibody Me-5, as well as the reactivity of 44 other 22 kDa protein-specific monoclonal antibodies, with the purified recombinant 22 kDa surface protein was not altered by any of the enzyme treatments, thus confirming that the antigenic properties of the recombinant 22 kDa protein seem similar to the ones described for the native protein.

Important data were presented in Example 3 and can be summarized as follows: 1) the complete nucleotide and amino acid sequences of the Neisseria meningitidis 22 kDa surface protein were obtained (SEQ ID NO:l SEQ ID NO:2) 2) N- erminal sequencing of the native protein confirmed that the Neisseria mening idis 22 kDa gene was indeed cloned; 3) this protein was not described previously; 4) it is possible to transform a host such as Escherichia coli and obtain expression of the recombinant Neisseria meningitidis 22 kDa surface protein in high yield; ) it is possible to obtain the recombinant protein free of other Neisseria meningitidis molecules and almost free of components produced by Escherichia coll; 6) the purified recombinant 22 kDa surface protein remains highly resistant to the action of proteolytic enzymes such as α-chymo rypsin, trypsin and proteinase K; and 7) the antigenic properties of the recombinant 22 kDa protein compare to the ones described for the native Neisseria meningitidis 22 kDa surface protein. ¾x¾MPL¾ 4 Molecular Conservation, Of thm Gene Coding for the Neisseria meningitidis 22. kDa Surface Protein 45 To verify the molecular conservation among Neisseria. isolates of the gene coding for the Neisseria meningitidis 22 kDa surface protein, a UNA dot blot hybridization assay was used to test different Neisseria species and other bacterial species. First, the 525 base pair gene coding for the Neisseria meningitidis 22 kDa surface protein was amplified by PGR, purified on agarose gel and labeled by random priming with the non radioactive DIG DNA labeling and detection system (Boehringer Mannheim, Laval, Canada) following the manufacturer's instructions.

The NA dot blot assay was done according to the manufacturer's instructions (Boehringer Mannheim) .

Briefly, the bacterial strains to be tested were dotted onto a positively charge nylon membrane (Boehringer Mannheim) , dried and then treated as described in the DIG System's user's guide for colony lifts. Pre-hybridizations and hybridizations were done at 42°C with solutions containing 50% formamide (Sigma) . The pre-hybridization solution also contained 100 mg/ml of denatured herring sperm DNA (Boehringer Mannheim) as an additiona blocking agent to prevent non-specific hybridization of the DNA probe. The stringency washes and detection steps using the chemiluminescent lumigen PPD substrate were also done as described in the DIG System's user's guide.

For the 71 Neisseria meningitidis strains tested the results obtained with monoclonal antibody He-7 and the 525 base pair DNA probe were in perfect agreement. According to the results, all the Neisseria meningitidis strains tested have the Neisseria meningitidis 22 kDa surface protein gene and they express .the protein since they were all recognized by the monoclonal antibody, thus confirming that this protein is highly conserved among the Neisseria meningitidis isolates (Table 2) . 46 The DNA probe also detected the gene coding for the ; Neisseria meningitidis 22 kDa surface protein in all Neisseria gonorrhoeae strains tested.

On the contrary, the monoclonal antibody Me-7 reacted only with 2 out of the 16 Neisseria gonorrhoeae strains tested indicating that the specific epitope is somehow absent, inaccessible or modified in Neisseria gonorrhoeae strains, or that most of the Neisseria gonorrhoeae strains do not express the protein even if they have the coding sequence in their genome (Table 2).

A good correlation between the two detection methods was also observed for Neisseria lactarnica, since only one strain of Neisseria lactamica was found to have the gene without expressing the protein (Table 2) . This result could also be explained by the same reasons presented in the last paragraph.

This may indicate that, although the 22kDa is not expressed, or not accessible on the surface of Neisseria gonorrhoeae strains, the 22kDa protein-coding gene of the Neisseria gonorrhoeae and Neisseria lactamica strains may be used for construction of recombinant plasmids used for the production of the 22kDa surface protein or analogs.

All such protein or analogs may be used for the prevention, detection, or diagnosis of Neisseria infections. More particularly, such infections may be selected from infections from Neisseria meningitidis, Neisseria gonorrhoeae, and Neisseria lactamica* Therefore, the 22k a surface protein or analogs/ may be used for the manufacture of a vaccine against such infections.

Moreover, the 22k a protein or. analogs, may be used for the manufacture of a kit fox the detection or diagnosis of such infections. - The results obtained with Moraxella catharralis strains showed that out of the 5 strains tested, 3 reacted with monoclonal antibody Me-7, but none of them reacted 47 with tha UNA probe indicating that the gene coding for the Neisseria meningitidis 22 kDa surface protein is absent from the genome of these strains (Table 2) .

Several other Neisserial species as well as other bacterial species (see footnote, Table 2 ) were tested and none of them were found to be positive by any of the two tests . This latter result seems to indicate that the gene for the 22 kDa surface protein is shared only among closely related species of Neisseriaca .

Table 2. Reactivity of tha 535 base pair ΌϋΆ probe monoclonal antibody Ma-7 with different Neisseria species assays and gave negative results: 1 Neisseria cinema, 1 Neisseria flava, 1 Neisseria flavescens, 2 Neisseria mucosa, 4 Neisseria perifavafaicca, 1 Neisseria perflava, 1 N. sicca, 1 N. subttava, 1 AJcal!gene$ feacaJls (ATCC 8750), 1 Bordeteila pertussis (9340), 1 Bordetella bronchiseptica, 1 Ctoobac!er freundS (ATCC 2080), 1 Edwaralelta tarda (ATCC 15947), 1 Ehtercbacter cloaca (ATCC 23365), 1 Enterobacter aerogenes (ATCC 13048), 1 Escherichia oofi, 1 Fiavobacterium odoratum, 1 Haemophilus influenzae type b (Eagan strain), 1 Klebsiella pneumoniae (ATCC 13883), 1 Proteus rettfleri (ATCC 25932), 1 Proteue vulgaris (ATCC 13315), 1 Pseudomonas aeruginosa (ATCC 9027), 1 Salmonella typhlmurium (ATCC 4028), 1 Serratl marcescens (ATCC 8100), 1 Shigella flexneri (ATCC 12022), 1 Shigella sonnet (ATCC 9280), and 1 Xanthomonas maJtophila.

In conclusion, the DNA hybridization assay clearly indicated that the gene coding for the Neisseria 48 meningitidis 22 kDa a rface protein is highly conserved among the pathogenic Neisseria. Furthermore, the results obtained clearly showed that this DNA probe could become a valuable tool for the rapid and direct detection of pathogenic Neisseria bacteria in clinical specimen. This probe could even be refined to discriminate between the Neisseria meningitidis and Neisseria gonorrhoeae.

B30HPLE 5 Bacteriolytic And protective Properties Of She Monoclonal Antibodies The bacteriolytic activity of the purified -Veisseria meningitidis 22 kDa surface protein-specific monoclonal antibodies was evaluated in vitro according to a method described previously [Brodeur et al., Infect. Immun., 50, p. 510 (1985); Martin et al., Infect. Iaraun, , SO, p. 2718 (1992)]. In the presence of a guinea pig serum complement/ purified monoclonal antibodies Me-l and Me-7 efficiently killed Neisseria meningitidis strain 608B. Relatively low concentrations of each of these monoclonal antibodies reduced by more than 50% the number of viable bacteria. The utilization of higher concentrations of purified monoclonal antibodies Me-l and Me-7 resulted in a sharp decrease (up. to 99%) in the number of bacterial colony forming units. Importantly, the bacteriolytic activity of these monoclonal antibodies is complement dependent, since heat-inactivat on of the guinea pig serum for 30 minutes at 5£>°C completely abolished the killing activity. The other monoclonal antibodies did not exhibit significant bacteriolytic activity against the same strain. The combined; representative results of several experiments are presented in Figure 7, wherein the results shown for Me-7 are representative and consistent with the results obtained for Me-l. The results shown for Me-2 are 49 representative and consistent with the results obtained for the other monoclonal antibodies Me-3 , Me-5 and Me-6 .

A mouse model of infection, which was described previously by one of the inventors [Brodeur e£ al, Infect. Iimnun, , 50 , p. 510 ( 1985 ) ; Brodeur et al., Can. J.

Microbiol. , 32, p. 33 (1985)] was used to assess the protective activity of each monoclonal antibody. Briefly, Balb/c mice were injected intraperitoneally with 600 ml of ascitic fluid containing the monoclonal antibodies 18 hours before the bacterial challenge. The mice were then challenged with one ml of a suspension containing 1000 colony forming units of Neisseria meningitidis strain 6Q8B, 4% mucin (Sigma) and 1.6% hemoglobin (Sigma) . The combined results of several experiments are presented in Table 3. It is important to note that only the bacteriolytic monoclonal antibodies Me-1 and Me-7 protected the mice against experimental Neisseria meningitidis infection. Indeed, the injection of ascitic fluid containing these two monoclonal antibodies before the bacterial challenge significantly increased the rate of survival of Balb/c mice to 70% or more compared to the 9% observed in the control groups receiving either 600 ml Sp2/0 induced ascitic fluid or 600 ml ascitic fluid containing unrelated monoclonal antibodies. Results have also indicated that 80% of the mice survived the inf ction if they were previously injected with 400 μg of protein A purified Me-7 18 hours before the bacterial challenge.

Subsequent experiments are presently being done to determine the minimal antibody concentration necessary to protect 50% of the mice. Lower survival rates from 20 to 40% were observed for the other Neisseria meningitidis 22 kDa surface protein-specific monoclonal antibodies. 50 Table 3. Evaluation of the isw-unoprotactive potential of the 22 kDa surface protein-specific monoclonal antibodies against Naigaoria meningitidis strain In conclusion, the results clearly indicated that an antibody specific for the Neisseria meningitidis 22 kDa surface protein can efficiently protect mice against an experimental lethal challenge. The induction of protective antibodies by an antigen is one of the most important criteria to justify further research on potential vaccine candidate.

EXHPLS 6 Imaunizafcion with purified Recombinant 22 kDa Surface Protein Confers Protection Against Subsequent Bacterial Challenge Purified recombinant 22 kDa surface protein was prepared according to the protocol presented in Example 3, and was used to iimmin ze Balb/c mice to determine its protective effect against challenge with a lethal dose of 51 Neisseria meningitidis 608B {S:2a:P1.2)T It was decided to use the purified recombinant protein instead of the native meningococcal protein in order to insure that there was no other meningococcal antigen in the vaccjlne preparation used during these experiments. The mouse model of infection used in these experiments was described previously by one of the inventors [Brodeur et al . , Infec . Iflttttun. , 50, p. 510 (1985); Brodeur et al., Can. J.

Microbiol . , 32, p. 33 (1986)]. The mice were each injected subcutaneously three times at three-week intervals with 100 ml of the antigen preparation containing either 10 or 20 g per mouse of the purified recombinant 22 kDa surface protein. QuilA was the adjuvant used for these experiments at a concentration of 25 ug per injection. Mice in the control groups were injected following the. same procedure with either 10 or 20 Ug of BSA, 20 Ug of concentrated culture supernatant of Escherichia coll strain BL KDE3) carrying the plasmid pWKS30 without the insert gene for the meningococcal protein prepared as described in Example 3, or phosphate-buffered saline. Serum samples from each mouse were obtained before each injection in order to analyze the development of the immune response against the recombinant protein. Two weeks following the third immunization the mice in all groups were injected intraperitoneally with 1 ml of a suspension containing 1000 colony forming units of Neisseria meningitidis strain 608B in 4% mucin (Sigma) and 1.6% hemoglobin (Sigma).

The results of these experiments are presented in Table 4. Eighty percent (80%) of the mice immunized with the purified recombinant 22 kDa surface protein survived the bacterial challenge compared to 0 to 42% in the control groups. Importantly, the mice in the control group injected with concentrated Escherichia coli culture supernatant were not protected against the bacterial 52 challenge. This latter result clearly demonstrated that · the components present in the culture media and the Escherichia coli's antigens that might be present in small amounts after purification do not contribute to the observed protection against Neisseria meningitidis.

Table 4. Iaaounization With Purified Recombinant 22 kDa Surface Protein Confers Protection Against Subsequent Bacterial Challenge with Neisseria, meningitidis 608B (B;2a:PI.2) strain.

CONCLUSION The injection o£ purified recombinant 22 kDa surface protein greatly protected the immunized mice against the development of a lethal infection by Neisseria meningitidis.

Antibodies according to this invention are exempli ied by murine hybridoma cell lines producing monoclonal antibodies He-1 and Me-7 deposited in the American Type Culture Collection in Rockville, Maryland, 53 USA on July 21, 1995. The deposits were assigned accession numbers HB 11959 (Me-l)and BB 11958 (Ma-7) .

EXAKFLB 7 Sequence analysis of other stxalxui oJL Neiss ria meningitidis anfl of Neiasmri* gonorrhoea* The 2.75 W cJai digested DNA fragment containing the gene coding for the 22kDa surface protein was isolated from the genomic DNA of the different strains of Neisseria meningitidis and Neisseria gonorrhoeae as described in Example 3. a) MCH88 strain; The nucleotide sequence of strain MCH88 (clinical isolate) is presented in Figure 8 (SEQ ID NO: 3) .

From experimental evidence obtained from strain 608B (Example 3), a putative leader sequence was deduced corresponding to amino acid -19 to -1 (M-K-K-A-L-A-A-L-I-A-L-A~L~P-A-A-A-L-A) . A search of established databases confirmed that 22kDa surface protein from Neisseria meningitidis strain MCH 188 (SEQ ID NO; ) or its gene (SEQ ID MO:3) have not been described previously. b) Z4063 strain: The nucleotide sequence of strain Z4063 (Wang J.-F. et al. Infect. Irnmun. , 60, p.5267 (1992)) is presented in Figure 9 (SEQ ID NO: 5). From experimental evidence obtained from strain 608B (Example 3), a putative leader sequence was deduced corresponding to amino acid -19 to -1 (M-K-K-A-L-A-T-L-I-A-L-A-L-P-A-A-A-L-A) . A search of established databases confirmed that 22kDa surface protein from Neisseria meningitidis strain Z 063 (SEQ ID NO: 6) or its gene (SEQ ID NO:5) have no been described previously. 54 v c) Neisseria gonorrhoeae strain b2: The nucleotide sequence of neisseria, gonorrhoeae strain b2 (serotype 1, Nat.Ref. Center for Neisseria, LCDC, Ottawa, Canada) is described in Figure 10 (SEQ ID NO: 7) . Prom experimental evidence obtained from strain 608B (Example 3), a putative leader sequence was deduced corresponding to amino acid - 19 to -1 (M-K- -A-L-A-A-L-I-A-L-A-L-P-A-A-A-L-A) . A search of established databases confirmed that 22kDa surface protein from neisseria gonorrhoeae strain b2 (SEQ ID NO: 8) or its gene (SEQ ID NO:7} have not been described previously.

Figure 11 shows the consensus sequence established from the DMA sequence of all four strains tested. The MCH88 strain showed an insertion of one codon (TCA) at nucleotide 217, but in general the four strains showed striking homology.

Figure 12 depicts the homology between the deduced amino acid sequence obtained from the four strains. There is greater than 90% identity between all four strains.

Example 8 Immunological response of rabbits and monkeys to the 22kDa Neisseria Meningitidis surface protein Rabbits and monkeys were immunized with the recombinant 22kDa protein to assess the antibody response in species other than the mouse. a) Rabbits Hale New Zealand rabbits were immunized with outer membrane preparations obtained from S. coli strain JM109 with the plasmid pN2202 or with the control plasmid pWKS30 (the strain and the plasmids are described in Example 3) . The lithium chloride extraction used to obtain these outer membrane preparations was performed in a manner previously 55 described by the inventors [Brodeur et al, Infect. Immun. 50, 510 (1985)]. The protein content of these preparations were determined by the Lowry method adapted to membrane fractions [Lowry et al, J. Biol. Chem. 193, 265 (1951)]. The rabbits were injected subcutaneously and intramuscularly at several sites twice at three week intervals with 150 g of one of the outer membrane preparations described above. QuilA, at a final concentration of 20% (vol. /vol.) (CedarLane Laboratories, Hornby, Ont . , Canada) , was the adjuvant used for these immunizations. The development of the specific humoral response was analyzed by ELISA using outer membrane preparations extracted from Neisseria meningitidis strain 60SB (B:2a:Pl.2) as coating antigen and by Western immunoblotting following methods already described by the inventors [Brodeur et al., Infect. Immun. 50, 510 (1985); Martin et al, Eur. J. iiranunol. 18, 601 (1988)1. Alkaline phosphatase or peroxydase-labeled Donkey anti-rabbit immunoglobulins (Jackson IitnnunoResearch Laboratories, West Grove, PA) were used for these assays.

The injection of B. coli outer membrane preparation containing the 22 kDa recombinant protein in combination with QuilA adjuvant induced in the rabbit a strong specific humoral response of 1/32,000 as determined by ELISA (Figure 13). The antibodies induced after the injection of the recombinant 22 kDa protein reacted with the purified recombinant 22 kDa protein, but more importantly they also recognized the native protein as 56 expressed, folded and embedded in the outer membrane of Neisseria meningitidis. Western Iitanunoblo ting experiments clearly indicated that the antibodies present after the second injection recognized on nitrocellulose membrane the same protein band as the one revealed by Mab Me-2 (described in Example 2), which is specific for the 22 kDa protein. b) Monkeys Two MacacA fascic lari3 (cynomolgus) monkeys were respectively immunized with two injections of 100 pg (K28) and 200 ig (1276) of affinity purified recombinant 22 kDa protein per injection. The methods used to produce and purify the protein from E. coll strain BL2lDe3 were described in Example 3. Alhydrogel, at a final concentration of 20% (vol, /vol.) (CedarLane Laboratories, Hornby, Ont., Canada), was the adjuvant used for these immunizations. The monkeys received two intramuscular injections at three weeks interval. A control monkey (K65) was immunized with an unrelated recombinant protein preparation following the same procedures. The sera were analyzed as described above. Alkaline phosphatase or Peroxydase-labeled Goat anti-human immunoglobulins (Jackson imnunoResearch Laboratories, West Grove, PA) were used for these assays.

The specific antibody response of monkey K28 which was immunized with 100ug of purified protein per injection appeared faster and was stronger than the one observed for 57 monkey 1276 which was injected with 200pg of protein (Figure 14) . Antibodies specific for the native 22 kDa protein as detected by Western immunoblotting were already present in the sera of the immunized monkeys twenty one days after the first injection, but were absent in the sera of the control monkey after two injections of the control antigen.

Coneluaion The data presented in Examples 2 and 5 clearly showed that the injection of the recombinant 22 kDa protein can induce a protective humoral response in mice which is directed against Neisseria meningitidis strains. More importantly, the results presented in this example demonstrate that this immunological response is not restricted to only one species, but this recombinant surface protein can also stimulate the immune system of other species such as rabbit or monkey.

Example 9 epitope mapping of the 22kDa Neisseria mBolngitidla protein Neisseria meningitidis 22 kDa surface protein was epitope mapped using a method described by one of the inventors [Martin et al. Infect. Immun (1991) : 59:1457-1464] . Identi ication of the linear epitopes was accomplished using 18 overlapping synthetic peptides covering the entire Neisseria meningitidis 22 kDa protein sequence derived from strain 608B (Figure 15) and 58 hyperimmune sera obtained after immunization with this protein. The identification of ijnmunodominant portions on the 22 k a protein may be helpful in the design of new efficient vaccines. Furthermore, the localization of these B-cell epitopes also provides valuable information about the structural configuration of the protein in the outer membrane of .Neisseria meningitidis.

All peptides were synthesized by BioChem Immunosystems Inc. (Montreal, Canada) with the Applied Biosystems (Foster City, Calif,) automated peptide synthesizer.

Synthetic peptides were purified by reverse-phase high-pressure liquid chromatography. Peptides CS-845, CS-847, CS-848, CS-851. CS-852 and CS-856 (Figure 15) were solubilized in a small volume of 6 guanidine-HCl (J.T. Baker, Ontario, Canada) or dimethyl sulfoxide (J.T.

Baker). These peptides were then adjusted to 1 mg/ml.with distilled water. All the other peptides were freely soluble in distilled water and were also adjusted to 1 mgml .

Peptide enzyme-linked immunosorbent assays (ELISA) were performed by coating synthetic peptides onto microtitration plates (Immulon 4, Dynatech Laboratories Inc . , Chantilly, VA) at a concentration of 50 g ml in 50 mM carbonate buffer, pH 9.6. After overnight incubation at room temperature, the plates were washed with phosphate-bu fered saline (PBS) containing 0.05% (wt/vol) Tween 20 (Sigma Chemical Co., St.-Louis, Mo.) and blocked with PBS containing 0.5% (wt/vol) bovine serum albumin (Sigma) . Sera obtained from mice and monkeys immunized with affinity purified recombinant 22 kDa surface protein were diluted and ΙΟΟμΙ per well of each dilution were added to the ELISA plates and incubated for 1 h at 37°C. The plates were washed three times, and 100 μΐ of alkaline phosphatase-conjugated goat anti-mouse or anti-human imraunoglobulins (Jackson immunoResearch Laboratories, West Grove, PA > diluted according to the manufacturer's recommendations was added. After incubation for 1 h at 37°C, the plates were washed and 100 μΐ of diet-hanolamine (10% (vol/vol), pH 9.8) containing p-nitro-phenylphosphate (Sigma) at 1 mg/ml was added. After 60 min., the reaction (λ=410 nm) was read spectrophotometrically with a Biicroplate reader.

House and monkey antisera obtained after immunization with affinity purified recombinant 22 kDa protein (Example 8) were successfully used in combination with eighteen overlapping synthetic peptides to localize B-cell epitopes on the protein. These epitopes are clustered within three antigenic domains on the protein.

The first region is located between amino acid residues 51 and 86. Computer analysis using different algorithms suggested that this region has the highest probability of being immunologically important since it is hydrophilic and surface exposed., Furthermore, comparison of the four protein sequences which is presented in Figure 12 indicates that one of the major variation, which is the 60 insertion of one amino acid residue at position 73, is also located in this region.

The antisera identified a second antigenic domain located between amino acid residues 110 and 140.

Interestingly, the sequence analysis revealed that seven out of the fourteen amino acid residues that are not conserved among the four protein sequences are clustered within this region of the protein.

A third antigenic domain located in a highly conserved portion of the protein, between amino acid residues 31 and 55, was recognized only by the monkeys 'ser .

Example 10 Heat-inducible expression vector for the large gcala production of the 22 kDa surface protein The gene coding for the Neisseria meningitidis 22 kDa surface protein was inserted into the plasmid p629 [George et al. Bio/technology 5: 600-603 (1987)]. A cassette of the bacteriophage λ cI857 temperature sensitive repressor gene, from which the functional Pr promoter has been deleted, is carried by the plasmid p629 that uses the PL promoter to control the synthesis of the 22kDa surface protein. The inactivation of the cI857 repressor by a temperature shift, from 30°C to temperatures above 38°C results in the production of the protein encoded by the plasmid. The induction of gene expression in E. coli cells by a temperature shift is advantageous 61 for large scale fermentation since it can easily be achieved with modem fermentors. Other inducible expression vectors usually require the addition of specific molecules like lactose or isopropylthio-p-D-galactoside (IPTG) in the culture media in order to induce the expression of the desired gene.

A 540 nucleotide fragment was amplified by PCR from the Neisseria meningitidis strain 608B genomic DMA using the following two oligonucleotide primers {OCRR8: 5'-TAATAGATCTATGAAAAAAGCACTTGCCAC-3 ' and OCRR9 : 3 '- CACGCGCAGTTTAAGACTTCTAQAT A-5 ' ) . These primers correspond to the nucleotide sequences found at both ends of the 22 kDa gene. To simplify the cloning of the PCR product, a Bgl II (AGATCT) restriction site was incorporated into the nucleotide sequence of these primers. The PCR product was purified on agarose gel before being digested with Bgl II. This Bgl II fragment of approximately 525 base pairs was then inserted into the Bgl II and Bam HI sites of the plasmid p629. The plasmid containing the PCR product insert named pNP2204 was used to transform E. coli strain DH5aF'IQ. A partial map of the plasmid pNP2204 is presented in Figure 16. The resulting colonies were screened with Neisseria meningitidis 22 kDa surface-protein specific monoclonal antibodies described in Example 2. Western blot analysis of the resulting clones clearly indicated that the protein synthesized by E. coli was complete and migrated on SDS-PAGE gel like the native Neisseria xnenlngitidis 22 kDa surface protein. Plasmid DNA was purified from the selected clone and then sequenced. The nucleotide sequence of the insert present in the plasmid perfectly matched the nucleotide sequence of the gene coding for the Neisseria meningitidis 22 kDa protein presented in Figure I.

To study the level of synthesis of the 22 kDa surface protein, the temperature-inducible plasmid pNP2204 was used to transform the following Z. coli strains: W3110, JM105, BL21, OPPl, T0PP2 and T0PP3. The level of synthesis of the 22 kDa surface protein and the localization of the protein in the different cellular fractions were determined for each strain. Shake flask cultures in LB broth (Gibco BRL, Life Technologies, Grand Island, NY) indicated that a temperature shift from 30°C to 39°C efficiently induced the expression of the g ^e.- -Time course evaluation of the level of synthesis indicated that the protein appeared, as determined on SDS-PAGE gel, as soon as 30 min after induction and that the amount of protein increased constantly during the induction period. Expression levels between 8 to 10 mg of 22 kDa protein per liter were determined for E. coli strains W3110 and TOPPl. For both strains, the majority of the 22 kDa protein is incorporated in the bacterial outer membrane. 63 Sxampla 11 Purification of the Neisseria meningitidis 22kDa protein Since the vast majority of the 22 kDa protein is found embedded in the outer membrane of E. coli strains, the purification protocol presented in this Example is different from the one already described in Example 3 where a large amount of protein was released in the culture supernatant. An overnight culture incubated at 30°C of either E. coli strain W3110 or T0PP1 harboring the plasmid pNP2204 was inoculated in LB broth containing 50 Ug/ml of Ampicillin (Sigma) and was grown at 30°C with agitation (250 rpm) until it reached a cell density of 0.6 (X=600nm) , at which point the incubation temperature was shifted to 39°C for three to five hours to induce the production of the protein. The bacterial cells were harvested by centrifugation a 8,000 xg for 15 minutes at 4°C and washed twice in phosphate buffered saline (PBS) , pH 7.3. The bacterial cells were ultrasonically broken (ballistic disintegration or mechanical disintegration with a French press may also be used) . Unbroken cells were removed by centrifugation at 5,000 xg for 5 minutes and discarded. The outer membranes were separated from cytoplasmic components by centrifugation at 100,000 xg for 1 h at 10°C. The membrane-containing pellets were resuspended in a small volume of, PBS, pH 7.3. To solubilize the 22 kDa surface protein from the membranes, detergents such as Empigen BB (CaUiochem Co., LaJolla, A) , Zwittergent-3, 14 (Calbiochem Co.), or β- octylglucoside (Sigma) were used. The detergent was added to the membrane fraction at final concentration of 3% and the mixture was incubated for 1 h at 20°C. The non soluble material was removed by centrifugation at 100,000 xg for 1 b at 10°C.

The 22 KDa protein was efficiently solubilized by either three of the detergents, however β-octylglucoside had the advantage of easily removing several unwanted membrane proteins since they were not solubilized and could be separated from the supernatant by centrifugation. To remove the detergent, the 22 kDa containing supernatant was dialyzed extensively against several changes of PBS buffer . Proteinase K treatment (as in Example 1) can' be used to further remove unwanted proteins from the 22kDa surface protein preparation. Differential precipitation using ammonium sulfate or organic solvents, and ultrafiltration are two additional steps that can be used to remove unwanted nucleic acid and lipopolysaccnaride contaminants from the proteins before gel permeation and ion-exchange chromatography can be efficiently used to obtain the purified 22 kDa protein. Affinity chromatography, as described in Example 3, can also be used to purify the 22 kDa protein.

Example 12 Use of 22kD* surface protein As a Human Vaccina To formulate a vaccine for human use, appropriate 22kDa surface protein antigens may be selected from the 65 polypeptides described herein. For example, one of skill in the art could design a vaccine around the 22kDa polypeptide or fragments thereof containing an immunogenic epitope. The use of molecular biology techniques is particularly well-suited for the preparation of substantially pure recombinant antigens.

The vaccine composition may take a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as powders, liquid solutions or suspensions, and Liposomes. Based on our belief that the 22JcDa surface protein antigens of this invention may elicit a protective immune response when administered to a human, the compositions of this invention will be similar to those used for immunizing humans with other proteins and polypeptides, e.g. tetanus and diphteria. Therefore, the compositions of this invention will preferably comprise a pharmaceutically acceptable adjuvant such as incomplete Freund's adjuvant, aluminum hydroxide, a inuramyl peptide, a water-in-oil emulsion, a liposome, an ISCOM or CTB, or a non-toxic B subunit form cholera toxin. Most preferably, the compositions will include a water-in-oil emulsion or aluminum hydroxide as adjuvant.

The composition would be administered to the patient in any of a number of pharmaceutically acceptable forms including intramuscular, intradermal, subcutaneous or topic. Preferrably, the vaccine will be administered intramuscularl . 66 Generally, the dosage will consist of an initial injection,most probably with adjuvant, of about 0.01 to 10 rag, and preferably 0.1 to 1,0 mg of 22kDa surface protein antigen per patient, followed most probably by one or more booster injections. Preferably, boosters will be administered at about 1 and 6 months after the intial i jection.

A consideration relating to vaccine development is the question of mucosal immunity. The ideal mucosal vaccine will be safely taken orally or intranasally as one or a few doses and would elicit protective antibodies on the appropriate surfaces along with systemic iimmjnity. The mucosal vaccine composition may include adjuvants, inert particulate carriers or recombinant live vectors.

The anti-22kDa surface protein antibodies of this invention are useful fo passive immunotherapy and i-wnunoprophylaxis of humans infected with Neisseria meninigitidis or related bacteria such as Neisseria gonorrhoeae or Neisseria lactam*ca. The dosage forms and regimens for such passive immunization would be similar to those of other passive immunotherapies .

An antibody according to this invention is exemplified by a bybridoma producing MAbs Me-1 or e-7 deposited in the American Type Culture Collection in Rockville, Maryland, USA on Julyf 21, 1995, and identified as Murine Hybridoma Cell Lines, Me-1 and Me-7 respectively. These deposits were assigned accession numbers HB 11959 (Me-1) and HB 11958 (Me-7) . 67 While we have described herein a number of embodiments of this invention, it is apparent that our basic embodiments may be altered to provide other embodiments that utilize the compositions anoVprocesses of this invention. Therefore, it will be appreciated that the scope of this invention includes all alternative embodiments and variations that are defined in the foregoing specification and by the claims appended thereto; and the invention is not to be limited by the specific embodiments which, have been presented herein by ' way of example.

Parts of the description that are out of ambit of the appended claims do not constitute part of the invention. 6* SEQUENCE LISTING (1) GENERAL INFORMATION! (i) APPLICANT: Brodeur, Bernard R Mar n, Denis Hamel, Josee Rioux, Clement (ii) TITLE OP INVENTION PROTEINASE K RESISTANT SURFACE PROTEIN OF NEISSERIA MENINGITIDIS (ill) NUMBER OF SEQUENCES; 26 (iv) CORRESPONDENCE ADDRESS: FEATURE t (A) NAME/KEY: sig_peptide (B) LOCATION: 143..199 (ix) FEATURE: (A) NAME/KEY: mat_peptide (B) LOCATION: 200..667 (Xi) SEQUENCE DESCRIPTION: SBQ ID NO:l: TCGGCAAAGC AGCCGGATAC CGCTACGTAT CTTGAAGTAT TGAAAATAT ACGATGCAAA 60 AAAGAAAATT TAAGTATAAT ACAGCAGGAT TCTTTAACGG ATTCTTAACA ATTTTTCTAA 120 CTGACCATAA AGGAACCAAA AT ATG AAA AAA GCA CTT GCC ACA CTG ATT GCC Met Lys Lys Ala Leu Ala Thr Leu lie Ala -3,9 -lb -10 CTC GCT CTC CCG GCC GCC GCA CTG GCG GAA GGC GCA TCC GGC TTT TAC 220 Leu Ala Leu Pro Ala Ala Ala Leu Ala Glu Gly Ala Ser Gly Phe Tyx -5. I 5 GTC CAA GCC GAT GCC GCA CAC GCA AAA GCC TCA AGC TC TTA GGT TCT 268 Val Gin Ala Asp Ala Ala His Ala- Lya Ala Ser Ser Ser Leu Gly Ser 15 20 GCC AAA GGC TTC AGC CCG CGC ATC TCC GCA GGC TAC CGC ATC AAC GAC 316 Ala Lya Gly Phe Ser Pro Arg lie. Ser Ala Cly Tyr Arg lie Asn Asp 30 35 .

CTC CGC TTC GCC GTC GAT TAC ACG CGC TAC AAA AAC TAT AAA GCC CCA 364 Leu Arg Phe Ala Val Asp Tyr Thr Arg Tyr Lye Asn Tyr Lya Ala Pro 40 45 50 55 TCC ACC GAT TTC AAA CTT TAC AGC ATC GGC GCG TCC CCC ATT TAC GAC 412 Ser Thr Asp Pbe Lye Leu Tyr Ser lie Gly Ala Ser Ala lie Tyr Asp 60 65 70 TTC GAC ACC CAA TCG CCC GTC AAA CCG TAT CTC GGC GCG CGC TTG AGC 460 Phe Asp Thr Gin Ser Pro Val Lys Pro Tyr Leu Gly Ala Arg Leu Ser 75 80 85 CTC AAC CGC GCC TCC GTC GAC TTG GGC GGC AGC GAC AGC TTC AGC CAA 508 Leu Aan Arg Ala Ser Val Asp l_eu Gly Gly Ser Asp Ser Phe Ser Gin 90 95 100 ACC TCC ATC GGC CTC GGC GTA TTG ACG GGC GTA AGC TAT GCC GTT ACC 556 Thr Ser lie Oly Leu Gly Val L«u Thr Cly Val Ser Tyr Ala Val Thr 105 110 115 70 I CCG AAT GTC GAT TTG GAT GCC GGC TAC CGC TAC AAC-AC ATC GGC AAA 604 Pro Aan Val Asp Leu Asp Ala Gly Tyr Arg Tyr Asn Tyr lie Gly Lys 120 125 130 13b GTC AAC ACT GTC AAA AAC GTC CGT TCC GGC GAA CTG TCC GTC GGC GTG 652 Val Asn Thr Val Lys Asn Val Arg Ser Gly Glu Leu Ser Val Gly Val 140 145 150 CGC GTC AAA TTC TGATATGCGC CTTATTCTGC AAACCGCCGA GCCTTCGGCG 704 Arg Val Lyg Phe 155 GTTTTCTTTT CTGCCACCGC AACTACACAA GCCGGCGGTT TTGTACGATA ATCCCGAATG 764 CTGCGGCTTC TGCCGCCCTA TTTTTTGAGG AATCCOAAAT GTCCAAAACC ATCATCCACA 324 ACA 8 0 (2) INFORMATION FOR SEQ ID NO:2: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 174 amino acids (B) TYPB: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPEJ protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NOt2i Met Lys Lys Ala Leu Ala Thr Leu He Ala Leu Ala Leu Pro Ala Ala -19 -15 -10 -5 Ala Leu Ala Glu Gly Ala Ser Gly Phe Tyr Val Gin Ala Asp Ala Ala 1 5 10 Hie Ala Lya Ala Ser Ser Ser Luu Gly Ser Ala Lys Gly Phe Ser Pro 20 25 Arg He Se Ala Gly Tyr Arg He Asn Asp Leu Arg Phe Ala Val Asp 30 35 40 45 'iyr Thr Arg Tyr Lys Asn Tyr Lys Ala Pro Ser Thr Asp Phe Lys Leu 50 55 60 Tyr Ser He Gly Ala Ser Ala He Tyr Asp phe Asp Thr Gin Ser Pro 65 70 " 75 Val Lys Pro Tyr Leu Gly Ala Arg Leu Eer Leu Asn Arg Ala Ser Val 80 85 90 Asp Leu Gly Gly Ser Asp Ser Phe Ser Gin Thr Ser He Gly Leu Gly 95 100 105 Val Leu Thr Gly Val Ser Tyr Ala Val Thr Pro Asn Val Asp Leu Asp 110 115 120 125 Ala Gly Tyr Arg Tyr Asn Tyr He Gly Lys Val Asn Thr Val Lys Asn 130 135 140 Val Arg Ser Gly Glu Leu Ser Val Gly Val Arg Val Lys Phe 145 150 155 71 (2) INFORMATION FOR SEQ ID NOi3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 710 base pairs (B) TYPB: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGYi linear (ii) MOLECULE TYPB: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis (B) STRAIN: MCH88 (ix) FEATURE: ..643 (ix) FEATURE: (A) NAME/KEY: sig_peptide (B) LOCATION: 116..172 (ix) FEATURE: (A) NAMB/KEY: mat_peptide (B) LOCATION: 173..643 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GTATCTTGAG GCATTOAAAA TATTACAATG CAAAAAGAAA ATTTCAGTAT AATACGGCAR 60 GATTCTTTAA CGGATTCTTA ACCATTTTTC TCCCTGACCA TAAAGGAATC AAGAT ATG 118 Met -19 AAA AAA GCA CTT G GCA CTC ATT GCC CTC GCC CTC CCG GCC GCC GCA 166 Lys Lys Ala Leu Ala Ala Lau lie Ala Leu Ala Leu Pro Ala Ala Ala -15 -10 -5 CTG GCG GAA GGC GCA TCC GGC TTT TAC GTC CAA GCC GAT GCC GCA CAC 214 Leu Ala Glu Gly Ala Ser Gly Phe Tyr Val Gin Ala Asp Ala Ala Hie 1 5 10 GCC AAA GCC TCA AGC TCT TTA GOT TCP GCC AAA GGC TTC AGC CCG CGC 262 Ala Lye Ala Ser Ser Ser Leu Gly Ser Ala Lye Gly Phe Ser Pro Arg 15 20 25 30 ATC TCC GCA GGC TAC CGC ATC AAC GAC CTC CGC TTC GCC GTC GAT TAC 310 Ila Ser Ala Oly Tyr Arg lie Asn Aep Leu Arg Phe Ala Val Aap Tyr 40 45 ACG CGC TAC AAA AAC TAT AAA CAA GTC CC TCC ACC GAT TTC AAA CTT 359 Thr Arg Tyr Lys Aan Tyr Lys Gin Val Pro Ser Tbx Aap Phe Lys Leu 50 ' 55 60 TAC AGC ATC GGC GCC TCC GCC ATT TAC CAC TTC GAC ACC CAA TCC CCC 406 Tyr Ser lie Gly Ala Ser Ala lie Tyr Asp Phe Aap Thr -Gin Ser Pro 65 70 75 72 GTC AAA CCG HAT CTC GGC GCG CGC TTG AGC CTC AAC CGC GCC TCC GTC 454 Val r.yp Pro Tyr Leu Gly Ala Arg Leu Ser Leu Aan Ara Ala Ser Val 80 85 90 SAC TTT AAC GGC AGC GAC AGC TTC AGC CAA ACC TCC ACC GGC CTC GGC 502 Asp Phe Aen Gly Ser Aep Ser Phe Ser Gin Thr Ser Thr Gly Leu Gly 95 100 105 HO GTA TTG GCCt GGC GTA AGC TAT GCC GTT ACC CCG AAT GTC GAT TTG GAT 550 Val Leu Ala Gly Val Ser Tyr Ala Val Thr Pro Asn Val Asp Leu Anp 115 120 125 GCC GGC TAC CGC TAC AAC TAC ATC GGC AAA GTC AAC ACT GTC AAA AAT 598 Ala Gly Tyr Arg Tyr Asn Tyr He Gly Lys Val Asn Thr Val Lys Asn 130 135 140 GTC CGT TCC GGC GAA CTG TCC GCC GGC GTA CGC GTC AAA TTC TGATATACGC 650 Val Arg Ser Gly Glu Leu Ser Ala Gly Val Arg Val Lys Phe 145 150 155 GTTATTCCGC AAACCGCCGA GCCTTTCGGC GGTTTTGTTT TCCGCCGCdG CAACTACACA 710 (2) INFORMATION FOR SEQ ID NO: 4: (±) SEQUENCE CHARACTERISTICS: (A) LENGTH: 175 amino acids (B) TYPEI amino acid (D) TOPOLOGY: linear (11) MOLECULE TYPE; protein (xi> SEQUENCE DESCRIPTIONI SEQ ID NO: 4: Met Lys Lys Ala Leu Ala Ala Leu lie Ala Leu Ala Leu Pro Ala Ala -19 -15 -10 -S Ala Leu Ala Glu Gly Ala Ser Gly Phe Tyr al Gin Ala Asp Ala Ala 1 5 10 His Ala Lys Ala Ser Ser Ser Leu Gly Ser Ala Lys Gly Phe Ser Pro 20 25 Arg He Ser Ala Gly Tyr Arg He Asn Asp Leu Arg Phe Ala Val Asp 30 35 40 45 Tyr Thr Arg Tyr Lye Asn Tyr Lys Gin Val Pro Ser Thr Asp Phe Lys 50 55 60 Leu Tyr Ser He Gly Ala Ser Ala He Tyr Asp Phe Asp Thr Gin Ser 65 70 75 Pro Val Lys Pro Tyr Leu Gly Ala Arg Leu Ser Leu Asn Arg Ala Sor 80 85' 90 Val Asp Phe Asn Gly Ser Asp Ser Phe Ser Gin Thr Ser Thr Gly Leu 95 100 105 Gly Val Leu Ala Gly Val Ser Tyr Ala Val Thr Pro Asn Val Asp Leu 110 115 ' 130 125 73 Asp Ala Gly Tyr Arg Tyr Aan Tyx lie Gly Lys VaI~Asn Thr Val Lys 130 13S 140 Asn Val Arg Ser Gly Glu Leu Ser Ala Gly Val Arg Val Lys Phe 145 150 155 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 850 base pairs (B) TYPE: nucleic acid (C) STRANDEDNBSS : double (D) TOPOLOGYi linear (ii) MOLECULE TYPl DNA (genomic) (iii) HYPOTHETICALt NO (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis (B) STRAIN: Z4063 (lX) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 208..732 (ix) FEATURE: ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis (B) STRAINI 608B (xi) SEQUENCE BESCRTPTTO : SEQ ID NO: 15: Phe Ala Val Asp Tyr Thr Arg Tyr Lys Asn Tyr Lys Ala Pro Ser Thr 1 5 10 15 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTHl 15 amino acids (B) TYPB: amino acid (D) TOPOLOGY: linear (li) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria muuingiLidiu (B) STRAIN 6088 80 ( i) SEQUENCE DESCRIPTION: SEQ ID NO: 16: — Tyr Lys Ala Pro Ser Thr Asp Phe Lys Leu Tyr Sar lie Gly Ala 10 IS (2) INFORMATION POR SEQ ID NO: 17 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE: {A) ORGANISM: Neisseria meningitidis (B) STRAIN: 608B (Xi) SEQUENCE DESCRIPTIONI SEQ ID NO: 17: Tyr Ser He Gly Ala Ser Ala lie Tyr Asp Phe Asp Thr Gin Ser 1 5 10 15 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (D) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis (B) STRAIN 608B (xi> SEQUENCE DESCRIPTION: SEQ ID NO; 18: Phe Asp Thr Gin Ser Pro Val Lys Pro Tyr Leu .Gly Ala Arg Leu 1 5 10 15 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTBISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (Vi) ORIGINAL SOURCE.

(A) ORGANISM: Neisseria meningitidis (B) STRAIN: 608B (xi) SEQUENCE DESCRIPTIONι SEQ ID NO: 19: Leu Gly Ala Arg Leu Ser LAU Asn Arg Ala Ser Val Asp Lau Cly 1 5 10 15 81 (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (H) TYPE: amino acid (D) TOPOLOGY linear (ii) MOLECULE TYPE: protein (vi> ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis SEQUENCE DESCRIPTION: SEQ ID N0:24: Tyr He Gly Lya Val Aan Thr Val Lys Asn Val Arg Ser Gly Glu 1 5 10 15 (2) INFORMATION FOR SEQ ID NO:25» (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ill MOLECULE TYPE: protein (vl) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidis (B) STRAIN: 608B ( i) SEQUENCE DESCRIPTION: SEQ ID NO:25: Val Arg Sar Gly Glu Leu Ser Val Gly Val Artf Val Lys Phe 1 5 10 83 (2) INFORMATION FOR SEQ ID NO:26t (i) SEQUENCE CHARACTERISTICS1 (A) LENGTH: 25 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (Vi) ORIGINAL SOURCEI (A) ORGANISM: Neisseria meningitidis (B) STRAIN: 608B

Claims

160346/3 Claims

1. An isolated antibody or antigen-binding fragment thereof that specifically binds to a Neisseria cell surface polypeptide that is capable of inducing an immune response against Neisseria bacteria, wherein said polypeptide is selected from (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2, (b) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4, (c) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6, and (d) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8.

2. The antibody or antigen-binding fragment thereof according to claim 1 which is a monoclonal antibody or antigen-binding fragment thereof.

3. The antibody or antigen-binding fragment thereof according to claim 2 wherein the monoclonal antibody or antigen-binding fragment thereof is of murine origin or human origin.

4. The antibody or antigen-binding fragment thereof according to claim 3 wherein the monoclonal antibody or antigen-binding fragment thereof is an IgG isotype.

5. The antibody or antigen-binding fragment thereof according to claim 2 wherein the monoclonal antibody is produced by the hybridoma cell line American Type Culture Collection (ATCC) Accession HB11959 or the hybridoma cell line ATCC Accession HB11958.

6. The antibody or antigen-binding fragment thereof of claim 1 wherein Neisseria is Neisseria meningitidis. 85 160346/3

7. A method for isolating the antibody according to claim 1 comprising: a) introducing a preparation of Neisseria meningitidis to a non-human mammal; and b) isolating serum from the non-human mammal containing said antibody.

8. A method for isolating the monoclonal antibody of claim 2 comprising: a) introducing a preparation of Neisseria meningitidis to a non-human mammal; b) fusing antibody producing cells from the non-human mammal with myeloma cells to form hybridoma cells; and c) isolating said monoclonal antibody from the hybridoma cells.

9. A pharmaceutical composition comprising one or more antibodies or any antigen-binding fragment thereof according to any one of claims 1 to 6 and a pharmaceutically acceptable excipient.

10. The pharmaceutical composition of claim 8 which is a vaccine.

11. The pharmaceutical composition of claim 8, wherein the antibody is produced by the hybridoma cell line ATCC Accession HBl 1959 or the hybridoma cell line ATCC Accession HBl 1958.

12. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 -6 in the preparation of a medicament for the treatment of a Neisseria meningitidis infection. 86 160346/3

13. A method for the detection of a Neisseria antigen in a biological sample containing or suspected of containing the Neisseria antigen comprising: a) incubating the antibody or antigen-binding fragment thereof according to any one of claims 1-4 with the biological sample to form a mixture; and b) detecting specifically bound antibody or bound antigen-binding fragment in the mixture which indicates the presence of the Neisseria antigen.

14. The method of claim 13 wherein the antibody is produced by the hybridoma cell line ATCC Accession HB 11959 or the hybridoma cell line ATCC Accession HB 11958.

15. The method of claim 12 wherein the Neisseria antigen is from N meningitides, N. gonorrhoeae, or N. lactamica. For the Applicants, PARTNERS 87