IL140224A - Composition for the treatment of hiv-1 infection containing a heterocyclyl carb (ox/thio) anilide derivative - Google Patents

Description

A COMPOSITION FOR THE TREATMENT OF HIV-1 INFECTION CONTAINING A HETEROCYCLYL CARB (OX/THIO) ANILIDE DERIVATIVE 2Ί ^ ^ΊΌΠ JTTttM ^ DH ι-η>π οιηηη ί7ΊΟ> ! *ι>νοη *P >JN (1NW?p1N) This invention relates to a composition for the prevention or treatment of HIV-1 infection. More particularly, this invention relates to a composition for the prevention and/or treatment of HIV-1 infection which comprises, as active ingredients, an HIV-1 reverse transcriptase-inhibiting heterocyclyl carb (ox/thio) anilide compound, a second HIV-1 reverse transcriptase (RT) inhibitor compound, such as a 2', 5'-bis-0-(tert-butyldimethylsilyl)-3'-spiro-5"-(4"-amino-1", 2"-oxathiole-2", 2"-dioxide) (TSAO) derivative, which does not select for the same HIV-1 mutant strain or strains selected for by the heterocyclyl carb(ox/thio)anilide compound, and, optionally, a third HIV reverse transcriptase inhibitor.

The present invention is divided from Israel Specification No. 115,944, filed November 9th, 1995. In order that the invention may be better understood and appreciated, description from Israel Specification No. 115,944 being specifically disclaimed and not forming a part of the present invention.

Background of the Invention Various compounds have been described as inhibitors of human immunodeficiency virus type 1 (HIV-1) in vitro and are targeted at the virus-encoded reverse transcriptase (RT), e.g., nevirapine, pyridinone, TIBO, BHAP, TSAO, and quinoxaline. The selectivity of these compounds for HIV-1 is due to a highly specific interaction with HIV-1 RT.

The rapid emergence of HIV-1 strains resistant to several HIV-1 -specific RT inhibitors in cell culture and in AIDS patients has caused concern for further development of these inhibitors in the clinic. However, HIV-l resistance to one HIV-l-specific RT inhibitor does not necessarily imply cross-resistance to other HIV-l- specific RT inhibitors. Indeed, it has been proven that HIV-l-specific RT inhibitors show differential activity against HIV-l mutant strains containing different amino acid substitutions in their RT. For example, HIV-l strains containing the 100 Leu -> lie mutation in their RT are resistant to TIBO R82913 and R821S0 but not to nevirapine and the TSAO derivatives TSAO-T and TSAO-m3T. Also, HIV-l strains containing the 138 Glu -> Lys mutation in their RT are resistant to TSAO derivatives but not to the other HIV-l-specific RT inhibitors, such as BHAP and nevirapine. In contrast, the 181 Tyr -> Cys mutation in the RT of HIV-l strains renders the mutant viruses resistant to virtually all HIV-l specific RT inhibitors described to date except certain oxathiin carboxanilide derivatives described in U.S. Patent No. 5,268,239. See, e.g., Balzarini et al, J. Virology £7(9): 5353-5359 (1993) ("Balzarini I") and Balzarini et al, Virology 192: 246-253 (1993) ("Balzarini II").

Unsuccessful attempts have been made to combine . various HIV-l RT inhibitors to eliminate virus resistance. See, e.g., Balzarini I.

Accordingly, it is the purpose of this invention to provide a composition comprising a combination of certain HIV RT inhibitor compounds which can inhibit or suppress the emergence of drug-resistant HIV-l strains.

In Israel Specification 115,944, there is described and claimed composition for the prevention or treatment of HIV-1 infections which comprises therapeutically effective amount of: a) a first HIV-1 RT inhibitor compound of the formula (I) wherein X1 and X2 are independently 0 or S; Q is -C=NOR4 or COYR5; R3 Y is 0 or S; R1 is hydrogen, halogen, C-.-C, alkyl, Cj-Ci alkoxy, C3-C4 alkenyloxy, C3-C4 alkynyloxy, mono-, di- or tri- halomethyl, trifluoromethoxy, ς,,-C alkylthio, C3-C4 branched alkylthio, nitro, or cyano; R2 is hydrogen, Cj-Q alkyl or halogen; R3 is hydrogen or Cj-Q alkyl; R* is C3-C6 alkyl, C3-C6 alkenyl, C3-Ce alkynyl, haloalkyl, Cj-Cg alkoxyalkyl, Cj-C8 alkylthioalkyl, -Cg hydroxyalkyl, aroyloxyalkyl, 0-.-0Β carboxyalkyl, Cj-Cg alkylcarboxyalkyl, C8-C^ arylcarboxyalkyl, Ca-C, aminoalkyl, C^-C8 alkylaminoalkyl, Cj-Cg dialkylaminoalkyl, C^-Cg trialkylsilylalkyl, wherein each of the aforementioned alkyl moieties may be straigh -chain or branched; C3-CB cycloalkyl, phenyl, (CJ-CJ alkyl) henyl, arylalkyl, Cj-C^ alkarylalkyl, or heterocyclylalkyl, wherein the heterocyclic moiety is morpholinyl, piperidinyl, pyrrolidinyl, piperazinyl, oxiranyl, oxetanyl, furanyl, tetrahydropyranyl or tetrahydrofuranyl; and JRS is -4a- wherein X1 and X2 are independently O or S; Q is -C=N0R4 or COYR5; i> Y is O or S; R1 is hydrogen, halogen, C^C, alkyl, C^-C, alkoxy, C3-C4 alkenyloxy, C3-C4 alkynyloxy, mono-, di- or tri-halomethyl, trifuluoromethoxy, C,:--C4 alkylthio, C3-C4 branched alkylthio, nitro, or cyano; Ra is hydrogen, ^-C^ alkyl or halogen; R3 is hydrogen or C^C, alkyl; R4 is C3-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl-, C^-Cg haloalkyl, ^Ca alkoxyalkyl, Cj-Cg alkylthioalkyl, C^-Ce hydroxyalkyl, Cj-Cg acyloxyalkyl, C^-Cg aroyloxyalkyl, Cj-Cg carboxyalkyl, Ca-Ce alkylcarboxyalkyl, Cg-C^ ' arylcarboxyalkyl, Cj.-C8 aminoalkyl, Cj-Cg alkylaminoalkyl, Cj-C8 dialkylaminoalkyl, trialkylsilylalkyl, wherein each of the aforementioned alkyl moieties may be straigh -chain or branched; C3-Ce cycloalkyl, phenyl, (Ci-Ce alkyDphenyl, C--C12 arylalkyl, Ο,-Οα alkarylalkyl, or heterocyclylalkyl, wherein the heterocyclic moiety is tnorpholinyl, piperidinyl, pyrrolidinyl, piperazinyl, oxiranyl, oxetanyl, furanyl, tetrahydropyranyl or tetrahydro uranyl; and E5 is i} phenyl cr Cj-C, cycloalkyl, optionally substituted by one or more C^-C^ alkyl; or - 4b - whersin JLS is hydrogen or linear, branched or cyclic, Cj-Ce alkyl, C-Q hydrcayaikyl , fC alkenyl, ¾-C, hydrcxyalkenyi, Cj-Q alkynyl, C2- Cfi hycrcxyalknyl, C,-^ mono-, di- or tri- halcalkyl or -C3 thioalkyl; and R7 and Ra are, independently, hydrogen or, linear, branched or cyclic, C-.-C¾ alkyl, Ca-C6 hydroxyalkyl, alkenyl, C3-C6 hydroxyalkenyl, Cj-Cg alkynyl, Cj-Q hydroxyalkynyl, ^-Cs mono-, di- or tri- haloalkyl or C^-Q thioalkyl ; ; b) a second non-nucleoside HIV-1 RT inhibitor compound which does not select for the same HIV-1 mutant strain or strains selected for by the first HIV-1 RT inhibitor compound of a) wherein said second HIV-1 RT inhibitor is a TSAO compound of the formula B is i) a pyrimidine of the formula wherein X2 is a hydrogen, Ca-C4 alkyl, C2-C4 alkenyl, C2- C4 alkynyl, halogen, cyano, thiocyano, hydroxymethyl , ^-Ca haloalkyl, nitro or amino; X3 is hydrogen, Cx-C4 alkyl, alkenyl or .-C4 alkynyl; X4 is OH, SH, H2, NHCH3, N(CH3)2 or NHCOCH3; - c - 140,224/2 ii) :¾ purine cf the foraiula or a purine of the formula " wherein Xs is H or C, -C4 alkyl; and Xs is H, OH, halogen, NHj, HCH3 or N(CH3)2; or (iii) a triazole of the formula wherein X7 and Xa are each independently hydrogen, Cj-C^ alkyl, C-.-C, haloalkyl , trimethylsilyl, acetyl, C,-C¾ aikoxycarbcnyl , C,-C3 alkylcarbonyl , CONH- R1' is amino, C,-C4 aminealkyl , C2-C¾ amincaik C.-C, aminoalkynyl ; and 2' and R3' are each independently, siiyl tri- subs ituted by the sacs or different, phenyl or C linear or branched alkyl .

Detailed Description of the Invention The term "HIV-l RT inhibitor compound" means any compound which inhibits the replication of HIV-1 by interfering with the function of the reverse transcriptase enzyme of HIV-1.

The term "HXV RT inhibitor compound" means any compound which inhibits the replication of any type or strain of HIV, e.g., HIV-1 or HTV-2, by interfering with the function of the reverse transcriptase enzyme of the HIV.

For the purposes of this invention, "select for a HIV-1 mutant strain or strains" means the mutant HIV-l strain or strains which are resistant to a particular HIV-l RT inhibitor compound.

To determine which HIV-1 mutant strain or strains, a particular HIV-1 RT inhibitor compound selects for, one can use the method described in Balzarini I and Balzarini II.

Compounds useful in the composition of this invention as the second HIV-1 RT inhibitor compound can be any RT inhibitor compound which does not select for the same HIV-1 mutant strain or strains as the first HIV-1 RT inh itor compound of formula I. Such HIV-1 RT inhibitor compounds are known and include, for example, the TSAO derivatives described in U.S. Patent No. 5,527,900, filed on September 3, 1992; Camarasa et al, J. Med. Chem. 11(15): 2721-2727 (1992) .and Perez-Perez et al, J. Med. Chem. 21(16): 2988-2995 (1992); dipyridodiazepinones such as nevirapine, Merluzzi et al, Science 250 : 1411-1413 (1990); pyridinone derivatives, such as 3-{ [ (4,7-dichloro-l,3-benzoxazol-2- yl)methyl] amiri0}-5-ethyl-6-methylpyridin-2 (1H) -one (L-697,661), described in Goldman et al, Proc. Natl. Acad. Sci. USA 88. 6863-6867 (1991); quinoxaline, such as quinoxaline S-2720, as described in leim et al, Antimicrob. Agents Chemother. 3J7, 1659-1664 (1993); bis (heteroaryl)piperazine (BHAP) derivatives, such as N-isopropyl-2- [4- (2-ketoindolyl) -l-piperazinyl] -3-pyridinamine (BHAP U-88204) , as described in Romero et al, Proc. Natl. Acad. Sci. USA 88: 8806-8810 (1991); tetrahydroimidazo [4,5, 1-jk] [(1,4) -benzodiazepin-2 (1H) -one and -thione (TIBO) derivatives, such as (+) -S-4, 5, 6, 7-tetrahydro-9-chloro-5-methyl-6- (3-methyl-2-butenyl-imidazo[4,5,l-jk] [1,4] -benzodiazepin-2 (1H) -thione (R82913), as described in Pauwels et al, Nature 343 : 470-474 (1990) ; coumarin derivatives such as calanolide A, Kashman et al, J. Med. Chem.23.. 2735-2743 (1992); diarylsulfones such as nitrophenylphenylsulfone (NPPS) , McMahon et al, Antimicrobial. Agents Chemother. 3J7, 754-760 (1993) ; anilidophenylacetamides (alpha-APA) such as R89439, Pauwels et al, Proc. Natl. Acad. Sci. (USA) JLfi, 1711-1715 (1993) ; phenethylthiazolethiourea derivatives (PETT) such as LY 300046.HC1, Zhang et al, Abstr. 2nd Int. Workshop on HIV Drug Resistance (June 3-5, Noordwisk, The Netherlands) (1993) no. 30; l-[(2-hydroxyethoxy)methyl] -6- (phenylthio) thymine (HEPT) derivatives, Baba et al, Biochem. Biophys. Res. Comm. 165. 1375-1381 (1989) .

The optional third HIV RT inhibitor compound of c) can be any HIV RT inhibitor compound other than the first HIV-1 RT inhibitor or the second HIV-1 RT inhibitor.

Such HIV RT inhibitor compounds are known and include such compounds as, e.g., the HIV-1 RT inhibitor compounds described above as useful as the second HIV-1 RT inhibitor compound or HIV reverse transcriptase inhibitors which do not discriminate between HIV-1 and HIV-2, such as, for example, zidovudine (AZT) , didanosine (ddl) , zalcitabine (ddC) , (-) -2 ' -deoxy-3 ' -thiacytidine (3TC) , D4T, PMEA, and the like. Preferably, the optional HIV RT inhibitor compound of c) is an HIV RT inhibitor compound which does not select for the same HIV-1 mutant strain or strains as the first HIV-1 RT inhibitor' compound or the second HIV-1 RT inhibitor compound, such as a third HIV-1 RT inhibitor compound which does not select for the same HIV-1 mutant strain or strains as the first HIV-1 RT inhibitor compound or the second HIV-1 RT inhibitor compound.

Preferably, this invention relates to a composition for the prevention or treatment of HIV-1 infections which comprises a therapeutically effective amount of: a) a first HIV-1 RT inhibitor compound of the formula (I) wherein X1 is 0 or S, preferably 0; X2 is 0 or S, preferably S; Q is -C=NOR4 or, preferably, COYR5; R3 Y is 0 or S, preferably 0; R1 is hydrogen, halogen, Cj-C, alkyl, Cx-C4 alkoxy, C3-C4 alkenyloxy, C3-C4 alkynyloxy, mono-, di- or tri-halomethyl, trifluoromethoxy, Cj-C, alkylthio, C3-C4 branched alkylthio, nitro, or cyano, preferably, hydrogen, halogen or Ci-C4 alkyl, and, more preferably, halogen; R3 is hydrogen, Ci-C4 alkyl or halogen, preferably hydrogen or Cj-C4 alkyl, and, more preferably, hydrogen, - 8 -methyl or ethyl; R3 is hydrogen or C^-C^ alkyl; R4 is C3-C6 alkyl, C3-C6 alkenyl, C3-Ce alkynyl, C^CS haloalkyl, Cj-Cg alkoxyalkyl, alkylthioalkyl , hydroxyalkyl, Cj-Cg acyloxyalkyl , C-C3 aroyloxyalkyl , C1~CB carboxyalkyl , Ci-Cg alkylcarboxyalkyl, Cg-G^ arylcarboxyalkyl, Cx-C8 aminoalkyl, alkylaminoalkyl , Ci-Cg dialkylaminoalkyl , trialkylsilylalkyl , wherein each of the aforementioned alkyl moieties may be straight-chain or branched; C3-C8 cycloalkyl, phenyl, (Ci-Ce alkyl) henyl , alkarylalkyl , or heterocyclylalkyl, wherein the heterocyclic moiety is morpholinyl, piperidinyl, pyrrolidinyl, pxperazinyl, oxiranyl, oxetanyl, furanyl, tetrahydropyranyl or tetrahydrofuranyl , preferably, C3-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, haloalkyl, (Cj-Cg alkyl) alkyl), C3-Ce cycloalkyl or phenyl; and Rs is i) phenyl or C3-C7 cycloalkyl, optionally substituted by one or more Cj-C, alkyl, preferably one or two methyl; or ii) wherein R6 is hydrogen or linear, branched or cyclic, Ci-Cg alkyl, Cj-C6 hydroxyalkyl, C2-C6 alkenyl, C2-C6 hydroxyalkenyl , C2-C6 alkynyl, C3- C6 hydroxyalkynyl , Cj-Cg mono-, di- or tri- haloalkyl or C^-C6 thioalkyl, preferably C3-C6 alkyl, C^-C^ mono-, di- or tri-haloalkyl or Cx-C6 thioalkyl; and R7 and R8 are, independently, hydrogen or, linear, branched or cyclic, Ci-C6 alkyl, Cx-Ce hydroxyalkyl, Ca-C6 alkenyl, C2-C6 - 9 - hydroxyalkenyl, Cj-Cg al3ynyl, C2-C6 hydroxyalkynyl, Cj-Q mono-, di- or tri- haloalkyl or C^-C,; thioalkyl, preferably, hydrogen or Cz-Ct alkyl, and more preferably, hydrogen; a second HIV-l RT inhibitor compound of the wherein: B is i) a pyrimidine of the formula preferably, a pyrimidine of the formula wherein X2 is a hydrogen, Ca-C4 alkyi, ¾-C4 alkenyl, C2- C4 alkynyl, halogen, cyano, thiocyano, hydroxymethyl, Cj-Ca haloalkyl, nitro or amino, preferably, hydrogen or alkyl; - 10 - X¾ is hydrogen, C^C^ alkyl, C2-C4 alkenyl or C2-C4 allcynyl, preferably, hydrogen or alkyl; X4 is OH, SH, NH2, NHCH3, N(CH3)2 or NHCOCH3, preferably, NH2, NHCH3 or N{CH3)2; ii) a purine of the formula or, preferably, of the formula wherein Xs is H or, preferably, ^C^ alkyl; and X6 is H, OH, halogen, !«¾, NHCH3 or N(CH3)2; or (iii) a triazole of the formula wherein X7 and Xs are each independently hydrogen, Cx-C* alkyl, Ci-C, haloalkyl, trimethylsilyl, acetyl, Cj-Ce alkoxycarbonyl, Cx-C6 alkylcarbonyl , CONH2, CONHCH3, CON(CH3)a, or, preferably, NH2, NHCH3 or N(CH3)2; - 11 - R1' is amino, Cj-C« aminoalkyl, C2-C4 aminoalkenyl or C2-C4 aminoalkynyl, preferably, amino or Cx-C4 aminoalkyl; and R2' and R3' are each independently, silyl tri-substituted by the same or different, phenyl or C linear or branched alkyl; and c) optionally, a third HIV RT inhibitor compound which does not select for the same HIV-l mutant strain or strains selected for by either the first HIV-1 RT inhibitor compound of a) or the second HIV-1 RT inhibitor compound of b) .

More preferably, this invention relates to a composition for the prevention or treatment of HIV-1 infections which comprises a therapeutically effective amount of: a) a first HIV-1 RT inhibitor compound of the formula wherein Y is O; R1 is hydrogen, halogen, or Cx-Ct alkyl; R2 is hydrogen or Cx~Ct alkyl; R3 is hydrogen or ^-C^ alkyl; R4 is C3-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, Cj-Ce \ - 12 -haloalkyl, ' or'' (Cj-C, alkyl) thioiCj-Cg) alkyl, wherein each of the aforementioned alkyl moieties may be straight-chain or branched; C3-C8 cycloalkyl or phenyl; and Rs is i) phenyl or C3-C7 cycloalkyl, optionally substituted by one or two methyl; or wherein R6 is hydrogen or linear, branched or cyclic, Ci-Cj alkyl, C^C^ hydroxyalkyl , C2-C6 alkenyl, C2-Ce hydroxyalkenyl , C2-C6 alkynyl, C2 C6 hydroxyalkynyl , mono-, di- or tri- haloalkyl or Cj-C6 thioalkyl; and R7 and R8 are hydrogen or ^Ct alkyl, linear, branched or cyclic; b) a second HIV-l RT inhibitor compound of the formula wherein: B is i) a pyrimidine of the formula - 13 - wherein X2 is a hydrogen or C^C^ alkyl; X3 is hydrogen or C^-Q, alkyl; X4 is NH2, HHCH3 or N(CH3)2; ii) a purine of the formula wherein Xs is C^-C, alkyl; or (iii) a triazole of the formula wherein X7 and X8 are each independently hydrogen, alkyl, haloalkyl, trimethylsilyl, acetyl, Cj-Cg alkoxycarbonyl, Cx-C6 alkylcarbonyl, CONH2 CO HCH3, CON(CH3)2, or, preferably, NH2, NHCH3 or N(CH3)2 R1' is amino or Cx-C, aminoalkyl; and R2' and R3' are each independently, silyl tri-substituted by the same or different, phenyl or Cx-C4 linear or branched alkyl; and - 14 -c) optionally, a third EIV RT inhibitor compound which does not select for the same HIV-1 mutant strain or strains selected for by either the first HIV-1 RT inhibitor compound of a) or the second HIV-1 RT inhibitor compound of b) .

Most preferably, this invention relates to a composition for the prevention or treatment of HIV-1 infections which comprises a therapeutically effective amount of: a) a first HIV-1 RT inhibitor compound of the formula R2 is hydrogen, methyl or ethyl; and R5 is i) phenyl or C3-C7 cycloalkyl; or wherein R6 is hydrogen or linear, branched or cyclic, C3-C6 alkyl, Cj-C6 mono-, di- or tri- haloalkyl or C -C6 thioalkyl; and R7 and R8 are hydrogen; b) a second HIV-1 RT inhibitor compound of the formula - 15 - •v. ■ wherein: B is i) a pyrimidine of the formula wherein X2 is a hydrogen or C^-^ alkyl; X3 is hydrogen or Cj-C, alkyl; ii) a purine of the formula wherein Xs is alkyl; or (iii) a triazole of the formula wherein X7 and Xs are each independently NH2, 16 NHCH3 or N(CH)2 R1' is amino or Cj-C, amiiioalkyl; and R3' and R3' are each independently, silyl tri- substituted by the same or different, phenyl or Cj-C, linear or branched alkyl; and c) optionally, a third HIV RT inhibitor compound which does not select for the same HTV-l mutant strain or strains selected for by either the first HIV-i RT nhibitor compound of a) or the second EIV-1 RT inhibitor compound of b) .

Compounds of formula I useful as the first EXV-i RT inhibitor compounds in the composition of this invention can be prepared, e.g., as described in U.S. Patent No. 5,268,389 and Israel Specification 95956. TSAO compounds useful as the second HIV-1 RT inhibitor compounds in the composition of this invention can be prepared, e.g., as described in published European Patent Application No. 0 530 407.

The composition of the present invention can be administered orally, parenterally, sublingually, by inhalation spray, rectally, or topically in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, and vehicles. Suitable carriers, adjuvants and vehicles can be found in standard pharmaceutical texts such as, e.g., Remington's Pharmaceutical Sciences. 16th Edition, Mack Publishing Company, Easton, PA (1980) .

The therapeutically effective amount of the active ingredients that can be combined with the carrier to produce a single dosage form will vary depending upon the - 17 -age and condition of the host treated and the particular mode of administration. In general, the active ingredients of the composition of this invention are most desirably administered at a concentration level that will generally afford anti-virally effective results without causing any harmful or deleterious side effects.

The ratio of the first HIV-1 RT inhibitor compound to the second HIV-l RT inhibitor compound in the composition of this invention can vary depending on the first HIV-1 RT inhibitor compound and the second HIV-l RT inhibitor compound selected and on the symptoms and/or severity of the HIV-1 infection, but will usually be from about 1:100 to about 100:1 by weight, preferably from about 1:5 to about 5:1 by weight. In the composition of this invention comprising the optional third HIV RT inhibitor compound, the percent amount of third HIV RT inhibitor compound in the composition will vary depending on the symptoms and/or severity of the HIV-1 infection and on the third HIV RT inhibitor compound selected, but will usually be from about 1% to about 99% by weight of the total composition, preferably from about 20% to about 60% by weight of the total composition.

The first HIV-1 RT inhibitor compound, the second HIV-1 RT inhibitor compound, and the third HIV RT inhibitor compound, if selected, can be administered to a patient as a composition comprising all the ingredients, or the ingredients can be administered separately to the patient. For example, the first HIV-1 RT inhibitor compound can be administered to the patient first, then the second HIV-1 RT inhibitor compound can be administered to the patient, and then, if selected, the third HIV RT inhibitor compound can be administered.

Alternatively, for example, the second HIV-1 RT inhibitor compound can be administered to the patient first, then the first HIV-l RT inhibitor compound, and then, if selected, the third HIV RT inhibitor compound. Or, for example, if selected, the third HIV RT inhibitor compound can be administered first to the patient and then followed by the administration of the first HIV-1 RT inhibitor compound and the second HIV-1 RT inhibitor. Or, the first and second HIV-1 RT inhibitor compound can be administered to the patient as a composition, then the third HIV RT inhibitor can be administered. Or, the first HIV-1 RT inhibitor compound and third HIV RT inhibitor compound can be administered to the patient as a composition, then the second HIV-1 RT inhibitor compound can be administered. Or, the second HIV-1 RT inhibitor compound and the third HIV RT inhibitor compound can be administered to the patient first, then the first HIV-1 RT inhibitor compound can be administered, and so forth.

While the active ingredients o the composition of this invention can be administered as the sole active pharmaceutical agents, the active ingredients can also be used in combination with one or more other pharmaceutical agents which are not deleterious to the activity of the active ingredients of the composition of this invention or whose combination with the active ingredients will not have a deleterious effect on the host treated. 18a With specific reference ,iow to the examples and tables in detail, it is stressed that the particular described are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this context, it is to be noted that only subject matter embraced in the scope of the claims appended hereto, whether in the manner defined in the claims or in a manner similar thereto and involving the main features as defined in the claims, is intended to be included in the scope of the present invention, while subject matter of Israel Specification No. 1 15,944, although described and exemplified to provide background and better understanding of the invention, is not intended for inclusion as part of the present invention.

EXAMPLES Materials and Methods Test compounds The TSAO derivative [l-P'.S'-bis-O-itert- *· , 19 butyldimethylsilyl) -β-D-ribofuranosyl] -3-N-methylthymine- 3' -spiro-5"- (4"-amino-ln ,2"-oxathiole 2" ,2" -dioxide (TSA0-m3T) was synthesized as described in Perez -Perez et al, supra. TIBO R82913 was provided by Zhang Hao (National Institutes of Health, Bethesda, MD) or obtained from Pharmatech International Inc. (West Orange, NJ) . Nevirapine (BI-RG-587) and pyridinone L-fi97,661 were provided by Boehringer Ingelheim Pharmaceuticals, Inc. (Ridgefield, CT) and Merck, Sharp & Dohme (West Point, PA), respectively. BHAP U- 88204 (N-isopropyl-2- [4- (2-ketoindolyl) -1-piperazinyl] -3-pyridinatnine) was obtained from The Upjohn Company (Kalamazoo, MI) and BHAP U-90152 was obtained from Hoechst AG (Frankfurt, Germany) . MCK-442 was provided by Fukushima Medical College (Fukushima, Japan) . Compounds I, II, III, IV, and V, tabulated in Table A below, were prepared using the procedures described in U.S. Patent 5,268,389 and Israel Specification 95956.

TABLE A 8 - 20 - ΒΗΆΡ TJ-90152 has the following structure: MCK-442 has the following structure: Cells and vjruses CEM cells were obtained from the American Tissue Cell Culture Collection (Rockville, Md.). HIV-1 (IIIB) was originally obtained from the culture supernatant of persistently HIV-1-infected H9 cells and was provided by R.C. Gallo and M. Popovic (National Institutes of Health, Bethesda, MD) .

Selection of HIV-1 (IIIP) mutant strains resistant to HIV-^.-specific RT inhibitors administered as a single drug or in VQtik imKim HIV-1 (IIIB) was subjected to two to three passages in 5 ml CEM cell cultures (4 x 105 cells per ml) in the presence of several fixed concentrations of the test compounds in 25 cm3 culture flasks (Falcon; Becton Dickinson) to produce mutant HIV-1 strains. The culture medium consisted of RPMI 1640 containing 10% fetal bovine - 21 - serum, 2 mM L-glutamine, and 0.075% NaHC03. The multiplicity of the initial infection was -1000 times the CCIDS0(50% cell culture infective dose). Passages were performed every 3 to 4 days by adding 0.5 to 1.0 ml of the infected culture eupernatant to 5 ml of a suspension containing 4 x 10s uninfected CE cells per ml. Syncytium formation was used as a parameter of virus breakthrough in the cell cultures. In the drug combination experiments, the compounds were combined at the same initial concentrations as used for the two lowest concentrations in the single-drug experiments.

Sensitivity of several HIV-1 mutant strains to the test compounds in CEM cell cultures CEM cells were suspended at 250,000 cells per ml of culture medium and infected with wild-type HIV-I(lilB) or mutant HIV-l strains at 100 50% cell culture infective doses per ml. Then 100 μΐ of the infected cell suspensions was added to 200-μ1 microtiter plate wells containing 100 μΐ of an appropriate dilution of the test compounds. After 4 days incubation at 37°C, the cell cultures were examined for syncytium formation. The 50% effective concentration (EC50) was determined as the compound concentration required to inhibit HIV-1-induced syncytium formation by 50%.

Preparation of mutant HIV-1-infected CEM cell cultures for polymerase chain reaction analysis and sequencing of the pol gene of the mutant HIV-1 strains The procedure that was utilized is described in Balzarini I, supra, and Balzarini et al, Proc. Natl.

Acad. Sci. USA ££: 6952-6956 (1993) ("Balzarini III").

Oligonucleotides were chosen to give a 727-bp fragment covering RT amino acids 50 to 270. Amplification of proviral D A (35 cycles) was performed with extract from - 22 - 1 x 10s cells in 10 mM Tris.HCl (pH 8.3), 50 mM KCi, 1.5 m MgCl2, 0.1% Triton X-100, 2.5 units of thermostable DNA polymerase (Dyna Zyme, Finnzymes Inc.) and 15 μΜ of each primer in a final volume of 100 ΐ. The first set of primers (5' -GTAGAAITCTGTTGACTCAGATTGG and 5 ' - TTCTGCCAGTTCTAGCTCTGCTTCT) gave a 900-bp product of the proviral reverse transcriptase gene. One tenth of the reaction from the first PGR was then transferred as template to a new 35-cycle PCR with a second set of primers (5' -CCTGAAAATCCATACAATACTCCAGTATTTG and 5'- AGTGCTTTGGTTCCTCTAAGGAGTTTAC) which gave a 727-bp reverse transcriptase fragment covering the amino acids 50-270. The second set of oligonucleotides primed for DNA synthesis internally from the first set of oligonucleotides and thereby amplified specific products from the first PCR, while unspecific products were not further amplified. The PCR products were made visible on a 1% agarose gel.

Reverse transcriptase assay The reaction mixture (50 μΐ) contained 50 mM Tris.HCl, pH 7.8, 5 mM dithiothreitol, 300 mM glutathione, 500 μΜ EDTA, 150 mM KCl, 5 mM MgCla, 1.25 /xg of bovine serum albumin, a fixed concentration of the labeled substrate [2,8-3H]dGTP (2.95 Μ, 2 μθ.) , a fixed concentration of the template/primer poly(C) .oligo (dG) (0.1 mM) , 0.06% Triton X-100, 5 μΐ of inhibitor solution [containing various concentrations (5-fold dilutions) of the test compounds] , and 5 μΐ of the RT preparation. The reaction mixtures were incubated at 37°C for 30 min, at which time 100 μΐ of calf thymus DNA (150 μg/ml) , 2 ml of Na4Pa07 (0.1 M in 1M HCl) , and 2 ml of trichloroacetic acid (10%, v/v) were added. The solutions were kept on ice for 30 min, after which the acid-insoluble material was washed and analyzed for radioactivity. The IC50 of the test compounds was determined as the compound concentration that inhibited the virus particle-derived - 23 - RT activity by 50%.

Results Antiviral activity spectrum of Compounds I. II. Ill, IV. end v Compounds, I, II, III, IV and V, proved markedly inhibitory to HIV-1(IIIB) replication in CEM cells. Their 50% inhibitory concentration ranged between 0.004 and 0.05 μg ml . The inhibitory activity of the most active of Compounds I, II, III, IV and V against wild-type HIV-l was superior to that of the HIV-l-specific RT inhibitors nevirapine, BHAP, pyridinone, TIBO and TSAO-m3T (Table 1) . However, in striking contrast with the latter HIV-l-specific RT inhibitors, Compounds I, II, III, IV, and V, proved substantially more inhibitory to the cytopathicity of the pyridinone-resistant RT/181-Cys HIV-l mutant in CEM cells. As a rule, the activity of Compounds I, II, III, IV and V against the RT/181-Cys mutant virus was at least one to two orders of magnitude more pronounced than that of the other HIV-l-specific RT inhibitors.

Also, the antiviral potency of Compounds I, II, III, IV and V against other mutant HIV-l strains containing the 138 Glu -» Lys and 106 Val -* Ala mutations in their RT was at least 10- to 50-fold more pronounced than noted for the other compounds. Compounds I, II, III, IV and V were less active against the RT/100-Ile mutant and the RT/103-Asn mutant virus strains than against wild-type virus. Yet, their antiviral potency was still in the ng/ml range, which is lower than for other HIV-l specific RT inhibitors, which had ECS0 values close to or even markedly higher than l g/ml (Table 1) . - 24 - TABLE 1 SEMSITIVTTV/RESISTANCE SPECTRUM OF DIFFERENT MUTANT HUM STRAINS • WT - wild type * 50% Effectiw concentration, or compound concentration required to inhibit virus-induced cytopathicity in CEM ceDs by 50%.

* Mutant virus strains that contain the 100 Leu → lb, 103 Lys → Asn, 106 Val → Ala, 138 Giu → Lys or 181 Tyr → Cys mutation in their RT were obtained after selection in cell culture in the presence of TIBO R82150, TIBO R82913, nevirapira, TSAO-mT and pyridinone L-697,661, respectively. The amino acid mutations have been characterized in Batzarini I, Baizarini Π and Babaran ill, supra. - 25 - Inhibitory'effect of Compounds I. II, IV and V against HIV-l RT Compounds I, III, IV and V were evaluated for their inhibitory effect on recombinant HIV-l RT. They proved to be very potent inhibitors of the HIV-l RT, using poly (C oligo(dG) as the template primer and 2.95 μ [2,8-3H]dGTP as the radiolabeled substrate. Their ICS0 values invariably ranged between 0.018 and 0.077 μg/ml. Higher IC50 values were noted for nevirapine, pyridinone, BHAP and TIBO, and the IC50 of TSA0-m3T for HIV-l RT was even 20- to 50-fold higher than those of Compounds I, II, IV and V (Table 2) .

TAB1I 2 ΑΜΠ-ΗΠ RT nam AcnyrTv •50% Inhibitory unantratton. Substrate: P.e-'HldGTP (2.95 /ΛΛ). Template: poly(rC)oBgo(d6). - 27 - Knock-out concentrations Compounds I, II, III, IV and V and also BHAP U8S204 and nevirapine were added to HIV-1 (IIIB) -infected CEM cells at initial concentrations of 0.1, 0.5 and 2.5 jig/ml. The drug concentrations were kept constant throughout the whole time period of the experiment (10 subcultivations or 35 days) . Then the drugs were removed from the cell cultures, and the cells were further subcultured for at least 5 additional passages. Virus only emerged in the presence of the lowest concentrations (i.e., 0.1 g ml) of Compounds I, II, III and IV.

Compound V allowed late virus breakthrough at 0.5 /xg/ml (Table 3) . In contrast, virus resistant to the inhibitory effects of 0.1 and 0.5 jig/ml BHAP and 0.1, 0.5 and 2.5 μg/ml nevirapine emerged in the infected cell cultures under similar experimental conditions. Thus, Compounds I, II, III, IV and V could prevent virus breakthrough in HIV-1-infected cell cultures at least 5-to 25-fold more efficiently than BHAP or nevirapine, respectively (Table 3). At the 10th subcultivation, the HIV-1-infected CEM cell cultures that were fully protected against HIV-l-induced cytopathicity by the UR derivatives did not produce detectable p24 levels, and lacked any proviral DNA. Also, after removal of the test compounds, and further subcultivation of the cells in the absence of the test compounds, virus did not emerge.

Therefore, we may conclude that the HIV-1-infected cell cultures were cleared from virus when cultivated in the presence of markedly lower concentrations of Compounds I, II, III, IV and V than of the other HIV-l-specific RT inhibitors . - 28 - TABLE 3 BREAKTHROUGH OF HIV-HIILHMDUCED CYTDPATHICITY IN CEM CELL CULTURES from the 35th day onwards, «II sufacultivatioiu took place in the absence of the test compounds. - 29 - Characterization of the mutant HIV-1 strains that emerged under therapy with Compounds I. II. III. IV and V The RT genes of seven mutant HIV-1 strains that emerged under therapy with Compounds I, II, III, IV and V, and with Compounds A and B (defined below) , were characterized with regard to potential mutations in their RT. Mutations were found at amino acid positions 100, 101, 103 and 138. Interestingly, three new mutations were discovered. The mutant HIV-l/IV strain contained the 103 Lye -* Thr mutation, due to a transversaon of the second base (A -» C) of codon 103. Compound B selected for a novel mutation at amino acid position 101 of the RT, i.e. substitution of Lys (AAA) by Glu (GAA) . When used at 0.1 jig/ml, Compound V selected for virus containing a double mutation in its RT, namely 101-Lys -» lie and 141-Gly → Glu (Table 4) .

The structure of Compound A is The structure of Compound B is (CB,)a TABLE 4 AMINO ACIO MUTATIONS IN THE REVERSE TRANSCRIPTASE OF MUTANT HIV-1 STRAINS, OBTAINED UNOER SELECTIVE PRESSURE OF COMPOUNDS A. B, I, fl, HI, IV. V, BHAP OR NEVIRAPINE I COMPOUND AMINO ACID AMINO ACID CODON POSITION A 138 Glu-*Lys 6AS-AAG B 101 Lys→Glu AAA→8AA 1/0.1 103 Lys-»Asn AAA-AAC lliO.1 100 Leu-*«B TTA ATA IllitU 103 Lys-*Asn AAA→AAC IViO.1 103 Lys-»Thr AAA→ACA 101 Lys-Hle AAA→ATA Vi0.1 +141 6ly→0lu GGG-GAG VI0.5 103 Lys-»Asn AAA-AAC BHAP U8820 /0.1 181 Tyr Cy¾ TAT→TST BHAP U88204/0.5 181 Tyr-*Cys TAT-TGT Nerirepine 106 VaHAIa &TA→8CA - 31 - The other mutant viruses that emerged under therapy with Compounds I, II, III, IV, V, A and B, contained amino acid changes at positions 100, 101, 103 and 138 in their RT that have been reported previously for other HIV-l-specific RT inhibitors, including TIBO R82150, TIBO R82913, BHAP U88204, pyridinone L-697,661 and TSAO derivatives. The virus that emerged under BHAP and nevirapine treatment contained in their RT the 181 Tyr → Cys and 106 Val ·* Ala mutation, respectively.

Sensitivity/resistance of mutant HIV-1 strains towards other HIV-l-specific RT inhibitors The mutant HIV-l/B containing the novel 101 Lys -* Glu mutation in its RT showed a peculiar resistance pattern. Compound I, as well as all other HIV-1 specific inhibitors, became less effective against this virus strain by at least 2 to 3 orders of magnitude (EC50: > 1 ig/ml) . However, pyridinone L-697,661 retained a marked inhibitory efficacy against this mutant virus strain (ECS0: 0.035 /xg/ml) (Table 5). The three mutant HIV-1 strains containing the 103 Lys -* Asn mutation in their RT markedly differed in their sensitivity spectrum to the HIV-l-specific inhibitors. For example, TIBO, BHAP, nevirapine, pyridinone and MKC-442 were 10- to 30-fold more inhibitory to HIV-1/III (0.1) than HIV-I/V(0.5) . Compounds I, II and IV were only 3- to 5-fold less inhibitory to HIV-1/V(0.5) than HIV-1/III (0.1) , whereas TSA0-m3T was equally inhibitory to both virus mutants. The third RT/103-Asn mutant virus strain [HIV-1/1(0.1)] showed a resistance/sensitivity spectrum to the HIV-l-specific RT inhibitors that was intermediate between that of both other RT/103-Asn mutant viruses.

The HIV-1/V(0.1) strain containing the double (101 Lys -» lie + 141 Gly → Glu) mutation retained marked sensitivity to several compounds, including pyridinone, TSAO-m3T, M C-442, and even Compounds II and III.

TABLE 5 SENSmvrry/RESISTANCE SPECTRUM OF HIV-1 MUTANTS TO HIV-1 -SPECIFIC RT INHIBITORS β H-2'-deuv-3 bl8tytMine D-6228 - 33 - Finally, the HIV-1/IV(0.1) mutant strain, containing the novel Thr mutation at position 103 of its RT, retained sensitivity to most HIV-1-specific inhibitors in the ng/ml range, except for nevirapine, TIBO R82913, Compound III and Compound V, which inhibited this mutant virus only at an EC50 of 1.1 to 2.75 fig/ml.

Double- and triple-druo combination treatment with Compound IV. TSAO-m3T and/or BHAP U90152 Compound IV, BHAP and TSAO-m3T were added to HIV-1- infected CEM cell cultures at 0.04, 0.10 and 0.25 ug/ml (Compound IV and BHAP) or 1.0, 2.5 and 5.0 μ^/ταΐ (TSAO- m3T) . In addition, various double- and triple-drug combinations of Compound IV, BHAP and TSAO-m3T were performed, combining these inhibitors at their lowest (0.04 ftg/ml) or intermediary (0.1 g/ml) concentration as used in the single-drug experiments. Under our experimental conditions, mutant virus emerged under single-drug therapy at all concentrations evaluated.

Under certain conditions, virus emerged as fast as 7 to 11 days after initiation of the experiment. At best, virus breakthrough could be delayed till day 14 (at the higher concentrations of BHAP and TSAO) or day 21 (at the highest concentration of Compound IV) (Table 6) .

However, when Compound IV and TSA0-m3T were combined at their lowest concentrations (i.e. 0.04 ig/ml for Compound IV and 1.0 jig/ml for TSA0-m3T) , the first signs of HIV-1-induced cytopathicity appeared at day 18 post infection, whereas the combination of Compound IV at 0.04 g ml with TSAO-m3T at 2.5 Mg/ml delayed virus breakthrough for 28 days post infection, that is for a much longer time than when both compounds were added to the cell cultures as single drugs at the same or at 2.5- fold (TSAO-m3T) or 6-fold (Compound IV) higher concentrations (Table 6) . - 34 - Virus breakthrough was even more delayed with the combination of Compound IV (at 0.1 g/ml) and TSAO-m3T (at 1.0 or 2.5 g/ml) . Under these experimental conditions, virus was completely suppressed for up to 13 ·:-subcultivations (day 46 post infection) . Then, when the cultures were further subcultured in the absence of the test compounds for another 10 subcultivations (day 77 post infection) , no virus-induced cytopathicity became evident, and the cultures were proven to be viral antigen (p24) -negative. Again, when Compound IV or TSAO-m3T were used at 2.5- to 5-fold higher concentrations as single drug, virus could be suppressed only for 14 to 25 days in cell culture. Thus, the combination of Compound IV with TSAO-m3T resulted in a marked delay or even complete prevention of mutant virus breakthrough which was not obtained if the compounds were used individually at the same or even 2.5- to 5-fold higher concentrations. The triple combinations of Compound IV, TSAO-tn3T and BHAP afforded an even more striking effect. When added at lower concentrations, the triple-drug combinations were able to substantially delay (till day 39, day 46, or day 56) or even prevent emergence of resistant virus [no virus breakthrough by day 77 (22th subcultivation) ] , whereas the highest single-drug concentrations could only prevent virus breakthrough till day 14 to 21 (Table 6) . All triple-drug combinations in which Compound IV was combined at 0.1 μ /ml were able to clear the HIV-1-infected CEM cell cultures from virus. Indeed, these cultures became provirus-free as evidenced by PCR, did not produce p24 and grew in the absence of test compounds after the 13th passage at a rate that was indistinguishable from the uninfected CEM cell cultures.

D-6228 35 BREAKTHROUGH OF MUTANT HIV-1 STRAINS IN CEM CELL CULTURES IN THE DIFFERENT COMBINATIONS OF HIV- 1 SPECIFIC RT INHBIBIT (Compound IV. TSAO T and BHAP U901S2I Estimation of HIV-1 -induced syncytium formation in CEM cefls (percentage of control Compound Days post infection 4 7 11 14 18 21 25 28 32 35 39 42 48 49 53 58 I BHAP 0.04 0 12.5 75 100 100 100 100 100 100 100 100 100 100 100 100 100 1 010 0 0 0 12.5 75 100 100 100 100 100 100 100 100 100 100 100 0.25 0 0 0 6.25 50 100 100 100 100 100 100 100 100 100 100 100 TSAO 1.0 0 0 0 12.5 75 100 100 100 100 100 100 100 100 100 100 100 2.5 0 0 0 12.5 75 100 100 100 100 100 100 100 100 100 100 100 .0 0 0 0 12.5 75 100 100 100 100 100 100 100 100 100 100 100 1 IV 0.04 0 0 6.25 12.5 100 too 100 100 100 100 100 100 100 100 100 100 0.10 0 0 0 6.25 6.25 B7.5 87.5 100 100 100 100 100 100 100 100 100 0.25 0 0 0 0 0 3.12 18 75 100 100 100 100 100 100 100 100 IV (0.041 ♦ 0 0 0 0 3.12 12.5 50 100 100 100 TSAO (1.0) 100 100 100 100 100 100 IV (0.04) ♦ 0 0 0 0 0 0 0 15 12.5 50 B7.5 100 100 100 100 TSAO (2.5) 100 D-6228 - 36 - TABLE 6 (continued!

Claims (1)

1. 37 WHAT IS CLAIMED composition for the prevention or treatment of an infection which comprises a therapeutically effective amount a first RT inhibitor compound of the formula wherein X1 and X2 are independently 0 or Q is or Y is 0 or is or branched or R2 is alkyl or R3 is hydrogen or is aroyloxyalkyl alkylaminoalkyl wherein each of the aforementioned alkyl moieties may be or alkarylalkyl or wherein the heterocyclic moiety is tetrahydropyranyl or tetrahydrofuranyl and phenyl or optionally substituted by one cr mere or wherein is hydrogen or branched o hydroxyalkyl or haloalkyl or and and hydrogen branched or or aloalkyl or a second RT inhibitor compound which does not select for the same mutant strain or strains selected for by the first RT inhibitor compound of wherein said second RT inhibitor is a TSAO compound of the formula wherein X7 and are each independently trimethylsilyl alkoxycarbonyl CO or is and are each by the or phenyl linear or branched A composition as recited in claim wherein B is a pyrimidine of the formula 41 wherein is a hydrogen or is hydrogen Zi or a purine of the formula wherein Xs is or a triazole of the formula wherein X7 and X8 are each independently trimethylsilyl CQ HCH3 or A composition as recited in claim 1 wherein B is a pyrimidine of the formula wherein is a hydrogen or is or alky a purine of the wherein X5 is or a triazole of the formula wherein X7 and Xe are each independently or 4 A composition as recited in claim 1 wherein is amino or 5 Ά composition as recited in claim 1 wherein the third HIV RT inhibitor compound does not select for the same mutant strain or as the first 1 RT inhibitor compound or the second RT inhibitor 6 as recited in claim 5 wherein the third HIV RT inhibitor compound is a third RT inhibitor compound which does not select the same mutant strain or strains as the first RT inhibitor compound or the second RT inhibitor 43 Ά as recited claim the third HIV ST inhibitor is a RT inhibitor which does discriminate between and A composition as recited in claim I which comprises a first RT inhibitor compound of the formula wherein Q is or R3 Y is O is or R2 is hydrogen or R3 is hydrogen or is or thio wherein each of the aforementioned alkyl moieties may be or cycloalkyl or and Rs is phenyl or optionally substituted by one or two or wherein is branched or 44 cr or are hydrogen or branched cr a second RT inhibitor compound of the formula B is a of the formula wherein is a hydrogen or X3 is hydrogen or X4 is SHCH3 or a purine of formula wherein Xs is or 45 a of the wherein X7 and Xe are each independently NHCH3 or is amino or and and are each silyl substituted by the or phenyl or linear or branched and a third HIV RT inhibitor compound which does not select for the same mutant strain or strains selected for by either the first RT inhibitor compound of or the second RT inhibitor compound A composition as recited in claim 5 which comprises a first RT inhibitor compound of the formula wherein is methyl or phenyl w erein is hydrogen or branched or or or and R7 and R3 are a second RT inhibitor compound of the formula B is a pyrimidine of the formula wherein X2 is a hydrogen or is hydrogen or insufficientOCRQuality