IL108788A - Recombinant infectious bursal disease proteins and poultry vaccines containing them - Google Patents

Description

RECOMBINANT INFECTIOUS BURSAL DISEASE PROTEINS AND POULTRY VACCINES CONTAINING THEM FIELD OF THE INVENTION The invention relates to recombinant Infectious Bursal Disease (IBD) viral proteins and their hybrids and vaccines against IBD containing the same.

BACKGROUND OF THE INVENTION / , Infectious diseases in domestic fowl are one of the most important economic factors in the poultry industry . The mini-malization of losses from diseases, by means of effective vaccines, plays a major part in achieving profit in today's intensive poultry industry. The health of domesticated birds depends on management, on the availability of effective vaccines, and on an adequate vaccination system. Some diseases suppress elements of the immune system, and thereby decrease its activity. One of the principal causes of this sort of disease is Infectious Bursal Disease Virus (IBDV). This virus initiates the destruction of lymphatic tissue, especially in the Bursa of Fabricius. As a result, the immune response to disease is decreased, as is the effectiveness of response to various vaccines. The disease is especially prevalent during the ages 3-6 weeks [Lukert, P.D. and Hitchner, S.B. (1984) Infectious Bursal Disease Virus. In: Diseases of Poultry, 8th ed. M.S. Hofstad, H.J. Barnes, B.W. Calnek, W.M. Reid and H.W. Yonder, Jr. eds. Iowa State University press, Ames , Iowa pp. 566-576]. Heavy financial loss results from outbreaks of IBD, with its symptoms of weight loss and mortality. Furthermore, as a result of lowered resistance, it leads to outbreaks of other diseases. Conventional immunization against IBDV is through maternal antibodies, which confer protection to young chicks, which later on are actively immunized. In recent years, the effectiveness of IBDV vaccine has dropped, and heavy losses due to the disease, in many parts of the world, have occurred as a result.

The IBD virus belongs to the birnavirus family. These are membraneless viruses, measuring «60 nm, relatively resistant to heat, active at pH 3, and resistant to ether and chloroform. The genome of this virus family consists of double-stranded RNA segments [Dobos, P. (1979) J. Virol. 32 : 1046-1050], encoding the protein of the virus. The size of the larger IBD virus segment is »3.4Kb, the smaller «2.9Kb [Azad et al. (1985) Virol. 143 ; 35-44] , the former being responsible for encoding the structural proteins, and the latter for encoding the RNA polymerase of the virus [Hudson et al. (1986) Nucleic Acid Res. 14.: 5001-5012; Spies et al. (1987) J. Comp. Pathol. 85:597-610]. The IBD virus consists of 4 proteins: VP-1, which is evidently the poly- merase of the virus, vith a molecular weight of =90KD; while the molecular weights of the other proteins are 37-40KD, 32-35 KD and 24-29 KD [see Summary Table in Kibenge et al. (1988) J. Gen. Virol. 6£.1757-1775 ] .

There are two serotypes of the virus. Serotype II has been isolated in turkeys, but is not virulent in chicken [Jaclcwood et al. (1982) Avian Dis. 26.: 871-882 ] . Antibodies produced against the virus of this serotype do not neutralize the virulent virus [Becht et al. (1988) J. Gen. Virol. 69.: 631-640 ] . Maternal antibodies against one serotype do not protect chicks against exposure to the second [Chettle, N.J. and Wyeth, P.J. (1989) Br. Vet. J. 145 : 165-169 ] . Serotype I has been found to be virulent in chicken [Lukert, P.D. and Hitchner, S.B. (1984) ibid.]. A number of variants have been found, with different levels of pathogenicity, antigenic similarity, serologic crossing response, etc. [Becht et al., ibid.; Ismail et al. (1990) Avian Dis. 34.: 141-145; Mazariegos et al. (1990 ) Avian Dis. 34.: 203-208] . Two varieties of IBD virus have been recently isolated in the U.S.A., grown in culture. They were identified by agar gel precipitation (AGP), virus neutralization test (VN), immunoprecipitation and electron microscopy.

These tests proved the existence of the two variants of serotype I of the IBD virus [Rosales et al. (1989) Avian Dis. 33: 35-41]. Differences in their influence on various elements of the immune system were found [Sharma et al. (1989) Avian Dis. 33.: 112-124] . Isolates of the virus from the field, in the last few years, have shown that variant strains of the virus appear from time to time, compared with lines identified previously [Jackwood et al. (1987) Avian Dis. .31:370-375; Snyder et al . (1988) Avian Dis. 32:535-539]. The pathogenicity of new lines was also found to be different [Rosales et al., ibid.]. Highly virulent isolates of the "classical" strain have been reported in accounts of outbreaks of the disease in the U.K. and the Netherlands, since 1988 [Chettle & Wyeth, ibid.], and these are different from the virus in the U.S.

Antibodies effective in neutralizing the virus are formed principally against certain polypeptides, the main one being the structural protein VP-2 [Becht et al«/ ibid.; Fahey et al. (1989) J. Gen. Virol. 70:1473-1481], A second structural protein, VP-3, also stimulated the production of antibodies, but its degree of effectiveness in neutralizing the virus was low [Fahey et al. (1985a) J. Gen. Virol. 66:2693-2702].

The expression of the gene encoding VP-2 led to the formation of a protein which, when injected, stimulated the formation of a high level of antibodies that neutralized the virus and protected chicks against infection by the disease [MacReadie et al. (1990) Vaccine 8:549-552]. When the bird was first exposed to the virus, the major part of the antibodies formed were against a single polypeptide (VP-3). Additional and continuing exposure led to the formation of antigens against VP-2 [Fahey et al. (1985b) J. Gen. Virol. 66:1479-1488].

Sera from a variety of sources were tested in the inventors1 laboratories. In the blood of a bird from a flock four days post-infection, antibodies against only a single polypeptide chain (VP-3) were found. In breeder chicken which were immunized with attenuated vaccine, and exposed to the virus for prolonged time, antibodies against three different polypeptide chains (VP-2, VP-3, VP-4) were found.

In considering the development of a poultry vaccine, a number of basic facts concerning the poultry industry must be taken into account: (a) the price of a single bird is relatively low, so the cost of producing and delivering the vaccine is critical. If the cost of producing even the most efficient vaccine is too high, its use will not be economically feasible. A single vaccine that gives protection against a number of disease factors is greatly advantageous; (b) the number of chicken reared in the poultry industry is high, in many cases 100,000 birds or more in a single flock. A vaccine that does not require individual treatment (e.g. injection) would be desirable.

Until recently, immunization against the IBD virus was performed by injection of inactivated vaccine to breeder flocks before point of lay, which provided the offsprings with protection by passive immunization. Sometimes a live attenu-ated virus vaccine is used for broilers at various ages, via drinking water. In the last few years, however, even high levels of maternal antibodies have not provided chicks with protection, and as a result the need to immunize chicks has risen. Since a high level of maternal antibodies inhibits the effectiveness of developing immune response at an early age with a virus that has lost its pathogenicity, it is necessary to use semi-virulent strains of the virus ("intermediate" strains), which will overcome the maternal antibodies and stimulate the immune response of chicks [Mazariegos et al. ibid.]* The danger of using vaccines of this sort is that they may cause outbreaks of the disease, or immunosupress the chicks. The use of attenuated vaccines and even inactivated ones always bears a danger, due to the possibilities that inactivation may not be complete, or that mild attenuated virus will revert to virulence. An additional problem is that the reliance on tissue culture, embryonated SPF eggs or live chicken providing bursa tissue for vaccine virus propagation in large quantities is a major expenditure. In recent years, there have been developments in two directions: 1. The effectiveness of sub-unit virus vaccines has been tested. During the first step in this field of research, polypeptides of the entire virus were isolated by means of gels and various filters [Fahey et al. (1985a) ibid.; Fahey et al . (1989) ibid.]. The segments that were examined, the structural proteins VP-2 and VP-3, were found to stimulate neutralizing antibodies. The method of isolating the virus was of great importance. The next step, after determining the nucleotide sequence, was to deactivate cDNA segments coding for these polypeptides, and to express the proteins obtained, and test their influence on birds. It was found that a segment of the VP-2 protein, expressed in yeast and injected into birds, caused the formation of antibodies that neutralized the IBD virus in birds. These antibodies provided passive protection to birds infected by live virus [MacReadie et al., ibid.]. 2. Fowlpox virus (FPV) was found to be a suitable vector for the expression of foreign proteins. This is a virus responsible for one of the first diseases identified in the poultry industry, affecting sensitive birds at all ages. The disease appears in two forms: the external form, in which pox appear on the skin, and a diphtheretic form, in which lesions appear in mouth and other internal tissues. This disease was of major economic importance 30-40 years ago, but has been almost entirely eliminated, as a result of improved management and the development of an effective vaccine. Immunization against fowl pox is conferred by transdermal or subcutaneous injection [Tripathy and Hanson (1975) Am. J. Vet. Res. 36:541-544]. The fowl pox virus has characteristics that enable it to be used as an efficient vector: (a) the large size of the genome, which permits the introduction of foreign DNA without affecting its reproductive ability; (b) since the reproduction of the virus is limited to fowls, it can be used as a vector without endangering humans; (c) attenuated FPV has been used on chicken farms since the 1920 's and is still widely used by poultry growers.

The efficacy of immunization by the recombinant virus has been reported for a number of disease-causing viruses. The infection of birds by the recombinant virus expressing the protein haemaglutinin of Avian Influenza provided protection to birds exposed to this disease [Tailor et al . (1988) J. Virol. 64:1441-1450; Tipathy and wittek (1990) Avian Dis. 34: 218-220]. The immunization of birds with recombinant FPV, into which the gene of the HN protein of the Newcastle Disease Virus (NDV) had been inserted, induced birds to produce antibodies which protected them against the disease [Edbauer et al. (1990) Virology 179:901-9041. Furthermore, it was found that the birds which had been immunized with this recombinant virus developed resistance to NDV without any decrease in the resistance to FPV [Ogawa et al. (1990) Vaccine 8:486-490].

Since FPV has a large genome, the target gene cannot be inserted into it directly: an intermediate vector (plasmid) is required. Such a plasmid contains a DNA segment of FPV, encoding the enzyme tymidine kinase (TK), which is not essential to the reproduction of the virus. The target gene is inserted into this section of tJie DHA, under the control of a proraotor that will be expressed in the FP virus, as a result of which the gene encoding TK is damaged. The plasmid, together with the viral DNA, are joined to the target cell, which is TK*" originating from the bird. In the course of the development of the virus in the cell, an interchange takes place between the plasmid segments and the viral segments, giving rise to the recombinant virus, in which an inessential area is formed in the area containing the target gene. A virus of this sort is TK~, and can be positively selected in a growth substrate that supports cells and TK~ viruses. The use of this approach gives rise to a recombinant virus, in which the Influenza haemagglutinin gene is expressed and stimulates the formation of antigens that inhibit it. This method is said to allow the building of various recombinants for the production of fowl vaccines. Recombinants of this sort are cheap and effective for the delivery of vaccines to birds [Schnitzlein et al. (1988) Virus Res. 10.: 65-76]. Recently, following research and trials for the development of multi-component vaccines in the FP virus, new ways to deliver the vaccine have been tested, apart from the conventional subcutaneous method. It has been found that adding the virus to drinking water in larger than usual quantities provides suitable protection to the same degree as subcutaneous injection [Nagy et al. (1990) Avian- Dis. 3 : 677-682]. The delivery of vaccine through drinking water is the most convenient and cheapest way, and causes least stress to the bird. 108788/1 - 7a - The above work by Macreadie et al., and likewise works by Heine et al. [Heine et al. (1993) Arch. Virol. 131:277-292] and Azad et al. [(1991) Vaccine 9:715-722], were performed with an attenuated virus strain O02-73, not with a very virulent strain. Vakharia et al. [Vakharia et al. (1993) J. Gen. Virol. 74:1201-1206] worked with the strain GLS-5, which is a virulent, but not very virulent strain. Bayliss et al. [Bayliss et al. (1991) Arch. Virol. 120:193-205] described a vaccine obtained from the virulent, but not very virulent strain 52/70. following challenge with the 52/70 strain, or with the very virulent stain CS89, only partial protection was observed.

Hudson et al. [Hudson et al. (1986) Nuc. Acid Res. 14(12):5O01] described the virus strain 002-73, which differs from the strains used by the present invention by 15 amino acid residues, and thus has different biological activity.

In summary, there is a lot to be desired in presently available vaccines against IBDV. The use of subunits of the virus does produce neutralizing antibodies. The use of FPV provided protection against disease-causing viruses, to it is a reasonable assumption that the use of FPV, to express polypeptide units of IBDV that have immunity-conferring properties, would be an effective vaccination against the disease. 108788/2 SUMMARY OF THE INVENTION The invention relates to a substantially pure DNA sequence encoding a virus protein (VP) of a very virulent Infectious Bursal Disease Virus, wherein the DNA sequence encoding said virus protein comprises the nucleotide sequence as set forth in Figure 1, the virus protein encoded by said sequence being the VP-2 protein, and functional analogues thereof having the same biological activity, and preferably a DNA sequence encoding a VP-2 protein substantially the same as the DNA sequence set forth in Figure 1.

The invention also relates to a recombinant VP-2 protein of Infectious Bursal Disease Virus encoded by the above DNA sequence, having an amino acid sequence which is at least about 90% conserved in relation to the amino acid sequence set forth in Figure 3 and functional homologues and immunologically active essential fragments thereof having the same biological activity, preferably a recombinant VP-2 protein having an amino acid sequence substantially the same as the amino acid sequence set forth in Figure 3, and immunologically active essential fragments thereof having the same biological activity.

The invention also relates to a VP-2 protein encoded by a DNA sequence as defined above, as well as immunologically active essential fragments thereof having the same biological activity.

The invention further relates to a recombinant vector comprising a DNA sequence as defined above. A particular vector is the plasmid pUC19VP2. Still further, the invention relates to an expression vector comprising a vector capable of expressing structural DNA comprised therein in a host and a DNA sequence as defined above. In particular embodiments, the 108788/2 -9- said vector capable of expressing structural DNA comprised therein in a host is a baculovirus or a fowl pox virus.

Still further, the invention relates to a host cell transformed with an expression vector of the invention. A particular cell may be an insect cell, more particularly a Spodoptera frugiperda cell.

The invention also relates to a vaccine for immunizing chicken against Infectious Bursal Disease comprising an effective immunizing amount of at least one protein according to the invention and a physiologically acceptable carrier.

The invention also relates to a vaccine for immunizing chicken against Infectious Bursal Disease comprising an effective immunizing amount of the expression vector of the invention.

In a yet further embodiment, the invention relates to a method of immunizing chicken against Infectious Bursal Disease by administering to the chicken an effective immunizing amount of at least one protein of the invention, or of a vaccine in accordance with the invention, or of the DNA sequence as defined above. - 10 - 108788/2 BRIEF DESCRIPTION OF THE FIGURES Figure 1 DNA sequence encoding VP-2 of IBDVks; Figure 2 DNA sequence encoding VP-3 of IBDVks; Figure 3 Deduced amino acid sequence of VP-2 of IBDVks; Figure 4 Deduced amino acid sequence of VP-3 of IBDVks; Figure 5 Exemplary immunologically active fragments of VP-2; Figure 6 Exemplary immunologically active fragments of VP-3; Figure 7 Homology comparisons of DNA sequences (a) and deduced amino acid sequences (b) between IBDVks and various other IBDV strains . Virulent strain STC designated IBDSA, virulent strain Cu-1 designated IBDVA, virulent strain GLS designated IBDVPIV, - 11 - virulent strain 52/70 designated IBDVSEGA, attenuated strain PBG-98, serotype II strain OH-IBDV designated IBDVP234; Figure 8: (a) VP-2 production detected by Western blot analysis. 800 ng of cytoplasmic fraction from cells infected by baculovirus w.t. (lane 1) and baculovirus-VP2 (lane 2) and complete IBDV, with all proteins (lane 3), were separated on % polyacrylamide gel which was electrotrans- ferred to nitrocellulose membrane and incubated with chick serum infected with IBDV. Antibodies were visualized by ECL detection system; (b) VP-3 production detected by Western blot analysis. Nuclear fraction (50 ng protein) of cells infected with baculovirus-VP3 (lane 1) and cells infected with baculovirus w.T. (lane 2). Cytoplasmic fraction (300 ng protein) of cells infected with baculovirus-VP3 (lane 3) and cells infected with baculovirus W. . (lane 4). Whole IBDV proteins (lane 5). Samples were separated on 10% polyacrylamide gel which was electrotransferred to nitrocellulose membrane.

The membrane was incubated with serum of chicks which were infected with IBDV. Antibodies were visualized by ECL detection system; Figure 9 : Anti-IBDV antibody response in sera of hens injected with PBS , Provac and VP-2, as measured by ELISA over a five and a half months period. Each value represents 3-5 birds. Blood was sampled on day 0, one day before the first injection, and on days 11, 70, 119, 131 and 167 of the experiment.

The injections (marked by arrows) were administered on day 1 and on day 152 of the experiment; and Figure 10: Examples of recombinant fusion proteins. a. Nucleotide and deduced amino acid sequences of VP-2 and VP-3 fused into one open reading frame; b. the 3' end of VP-2 and 5' end of VP-3 fused sequences .

Figure 11: (a) Partial purification of recombinant VP-2 Cytoplasmic fraction of Sf-9 cells infected with baculovirus-VP2 (lane 1) was precipitated with 25% ammonium sulfate (lane 2). The super- . natant was further precipitated from 25-40% ammonium sulfate (lane 3). Cytoplasmic fraction of cells infected with W.T. baculovirus (lane 4) was precipitated with 25% aminoni-um sulfate (lane 5) and the supernatant was further precipitated from 25-40% ammonium sulfate (lane 6). All fractions contained 25 Mg protein, (b) Recombinant VP-3 expression in Sf-9 cells by baculovirus-VP3 : Sf-9 cells infected with bacu- lovirus-VP3 or baculovirus W.T. for 72 hrs were harvested and nuclei were fractionated from cells. Protein samples (40 /zg) were separated on 10% polyacrylamide gel stained with Coomassie blue. The cytoplasmic fractions of cells, infected with baculovirus-VP3 (lane 1), and baculovirus W.T. (lane 2). Nuclear fractions . of cells, infected with baculovirus-'VPS (lane 3), and baculovirus W.T. (lane 4).

DETAILED DECRIPTION OF THE INVENTION In accordance with the invention, the possibility of vaccinating fowls with some proteinous subunit of the virus has been examined. The advantages of such vaccination are that (a) it eliminates the danger of an outbreak of the disease as a result of reversion of the virus to virulence, or its complete - 13 - inactivation, which is inherent in the use of live or inactivated vaccines; (b) it involves a limited number of antigens, these being the ones essential to stimulate response and lead to the formation of antibodies capable of neutralizing the virus which would allow for optimal immunity formation, while preventing exposure to antigens that may be immunosupressive; and (c) insertion into the genetic segment and its use would allow rapid adaptation of the synthesized antigen to any changes that might take place in the virus.

The inventors followed the suggestion that once a vector has been developed that will express polypeptide chains that stimulate the formation of neutralizing antibodies, it will be possible to produce a vaccine with a far greater efficiency than available today. The insertion of a segment into the genome of fowlpox vaccine, and its expression with an efficacy equal to that of the vector Vaccinia [Mackett, M. and Smith, G.L. (1986) J. Gen. Virol. 67:2067-2082], would create a vaccine with an efficacy equal to that obtained against other viruses. It would thus be possible to insert into the carrier also genes of other causes of disease in the future, and thereby create additional vaccines in the same way.

Since 1988 a new strain of IBDV appeared in Europe and then in other parts of the world, including Israel. A virulent strain (IBDVks) that the "old", vaccines (like Winterfield, Lukert and other strains) did not provide protection against, was isolated also in the inventors' laboratory. The sequence of the large RNA fragment was determined and found to, be different from any other published sequence. This specific VP-2 protein, when expressed, showed protection against the new violent virus strain higher then any other acieved by killed or attenuated virus strains.

The present invention thus relates to a substantially pure DNA sequence encoding a VP-2 protein of Infectious Bursal Disease Virus and functional analogues thereof, wherein the DNA sequence encoding said VP-2 protein comprises the nucleotide sequence as set forth in Figure 1 and preferably a DNA sequence encoding a VP-2 protein substantially the same as the DNA sequence set forth in Figure 1.

The present invention also relates to a substantially pare DNA sequence encoding a VP-3 protein of Infectious Bursal Disease-Virus and functional analogues thereof, wherein the DNA sequence encoding said VP-3 protein comprises the nucleotide sequence as set forth in Figure 2 and preferably a DNA sequence encoding a VP-3 substantially the same as the DNA sequence set forth in Figure 2.

In a further embodiment the invention relates to a recombinant VP-2 protein of Infectious Bursal Disease Virus having an amino acid sequence which is at least about 90% conserved in relation to the amino acid sequence set forth in Figure 3 and functional homologues and immunologically active essential fragments thereof, preferably a recombinant VP-2 protein of Infectious Bursal disease Virus having an amino acid sequence substantially the same as the amino acid sequence set forth in Figure 3 and immunologically active essential fragments thereof .

In addition, the invention relates to a recoi binant VP-3 protein of Infectious Bursal Disease Virus having an amino acid sequence which is at least about 90% conserved in relation to the amino acid sequence set forth in Figure 4 and functional homologues and immunologically active essential fragments thereof, particularly a recombinant VP-3 protein of Infectious Bursal Disease Virus having an amino acid sequence - 15 - substantially the same as the amino acid sequence set forth in Figure 4 and immunologically active essential fragments thereof .

The proteins of the invention provide protection against the virulent strains in the field. Moreover, the method for identifying and cloning of relevant sequences is easy and enables fast production of new vaccines whenever new mutant strains may appear.

It is further suggested that the invention may provide a method for fast adjustment to future changes in the viral sequence of IBDV. The VP-2 and VP-3 proteins contain few epitopes that may be related to neutralizing antibody production. All or part of these sequences expressing antigenic sites can be fused and expressed in one piece that contains only relevant sequences for protection. The possibility to produce hybrid proteins would eliminate the need to expose the bird to nonrelevant fragments of the protein and, on the other hand, would enable the production of a wide variety of neutralizing antibodies. A change in one site of the virus will not affect immediately the efficacy of the vaccine. Thus, the advantages of the different responses of the immune system to the different proteins can be exploited.

Therefore, the invention additionally relates to a recombinant fusion protein comprising a VP-2 protein according to the invention or immunologically active essential fragments thereof and a VP-3 protein according to the invention or immunologically active essential fragments thereof and a substantially pure DNA sequence encoding the same. Fusion proteins comprising fused essential fragments of VP-2 protein or fused essential fragments of VP-3 protein are also encompassed within the invention. An exemplary fusion protein comprising - 16 - immunologically active fragments of VP-2 and VP-3 is depicted in Figure 5.

The immunologically active fragments of the VP-2 and VP-3 proteins may be from about 6 to about 800 amino acid residues long, preferably from about 12 to about 100 amino acid residues long, and -% functional omologues thereof. An exemplary immunologically active fragment of the VP-2 is the amino acid sequence depicted in Figure 5. An exemplary immunologically active fragment of VP-3 is depicted in Figure 6.

The invention also relates to substantially pure DNA sequences encoding the various fusion proteins according to the invention .

Variations of the DNA and amino acid sequences of the invention are also within scope of the invention. The variations may from about 5% to about 20% of the total number of nucleotide bases or amino acid residues. However, other variants are also possible, provided the immunological functionalty of the product against IBDV is preserved.

Yet a further aspect of the invention are recombinant vectors comprising the said nucleotide sequences .

Still further, the invention relates to expression .vectors comprising a vector capable of expressing structural DNA comprised therein in a host and at least one of the nucleotide sequences of the invention, preferably an expression vector wherein said vector capable of expressing structural DNA comprised therein in a host is a baculovirus or a fowl pox virus or a bacterial host cell.

The expression vectors according to the invention may further comprise other nucleic acid sequences, svich as expression control sequences, markers, promotors, signal sequences such as initiation and termination sequences, as known to the man skilled in the art.

While baculovirus and fowlpox virus may be preferred vectors, others, such as, e.g. bacteria and yeasts are possible.

It may be particularly preferred for the vectors of the invention to also comprise DNA sequences encoding other, and at least one, polypeptide which affords immunity against other fowl diseases such as NDV, MDV, influenza, etc.

These additional DNA sequences are inserted in the expression vectors of the invention in reading frame, to enable expression in the host. The different sequences may be either separated, by termination and initiation sequences or they may form a single reading frames and thus produce a single fusion protein. The construction of suitable vectors is within the capabilities of the man versed in the art .

Still further, the invention relates to a host transformed with an expression vector of the invention. Various host cells may be transformed with the expression vectors of the invention such as insect cells, bacterial cells, yeast cells and other viral host cells. Preferred host cells are insect cells, for example, Spodoptera frugiperda cells.

In yet a further aspect, the invention relates to vaccines for immunizing chicken against infectious bursal disease comprising an effective immunizing amount of at least one protein according to the invention and a physiologically acceptable carrier.

As stated above, it is within the scope of the invention to provide fusion proteins which would confer immunity against infectious bursal disease and also against at least one other poultry disease. Thus, multiple-purpose vaccines, comrising an effective immunizing amout of such fusion proteins are also within the scope of the invention. Still further, it is possible to employ vaccines for immunizing chicken against infectious bursal disease comprising an effective immunizing amount of at least one expression vector of the invention. There are two major ways of vaccination. In one way, a subunit vaccine, which is not capable of propagating in the vaccinated bird is used. A subunit vaccine cannot convert into virulent species, endangering the vaccinated bird, or humans. In a second way, vaccination is effected with a live vector, which enables expression of the vaccine in the bird. The advantages of such a live vector vaccine are that it is possible to vaccinate birds without having to inject each bird, and the continuous stimulation of the bird's immune system.

By the term "effective immunizing amount" is meant an amount which is sufficient to stimulate the immune system and confer immunity against infectious bursal disease and against the other diseases in the case of multiple-purpose vaccines. This effective immunizing amount is preferably from about 0.1 ^g to about 100 g of the crude protein, partially purified protein or the purified protein. The vaccines may be provided in various forms, for example lysate of cells expressing the recombinant protein, partially or completely purified proteins, vectors carrying the gene of interest (such as fowl pox virus or other viral vector, bacterial vector, or a plas id carrying the gene of interest - "naked DNA" ) .

The physiologically acceptable carriers for vaccines for poultry are known to the man versed in the art. It is evident that the carrier should not interfere with the elicitation of the bird's immune response, nor with the expression of the polypeptide product.

It is of course possible to add to the vaccines of the invention other physiologically acceptable additives. Such additives may be adjuvants, stabilizers, diluents, immune response enhancers, etc.

Also provided by the invention are methods of immunizing chicken against infectious bursal disease by administering to the chicken an effective immunizing amount of at least one protein of the invention or an effective immunizing amount of a vaccine of the invention. Adopting the "naked DNA" approach, methods of immunizing chicken against infectious bursal disease by administering to the chicken an effective immunizing amount of at least one DNA sequence according to the invention are also within scope of the invention.

Administration may be by individual injections, or by mass vaccination via the chicken drinking water or by aerosol droplets .

Apart from the immunity conferred to chicken vaccinated according to the invention, the vaccination according to the invention confers immunity to progeny of the immunized chicken, via maternal antibodies.

The vaccines or naked DNA may confer immunity by a single administration. However, It is possible to repeat administration at predetermined time intervals. Vaccination may be effected at any age from day 1. It is preferred to vaccinate the birds at the age of 1 to 14 days by a first injection. In broilers, a second vaccination may be given using fowlpox - 20 - virus. In breeding flocks, a subunit or fowlpox virus or naked DNA may be used before laying starts, at 18-20 weeks of age.

The invention will be described in more detail on hand of the following Examples. It is to be understood that the Examples do not in any sense limit the invention and are illustrative only.

EXAMPLES Example 1 Isolation of IBDVks IBDV was isolated during an outbreak of Infectious Bursal Disease from a flock of sick chicken, three to five days after the beginning of mortality. The bursae were removed from birds which died in the outbreak. Distilled water, twice the volume of the tissue, were added and the bursae were ground and homogenized for 2-5 min. The tissue homogenate was frozen and thawed three times at -70° C and 30"C respectively. After breaking the cells, the solution was centrifuged at 10000 x g at 4°C for 10 min. The supernatant was added on top two layers of sucrose, 60% and 40%. After certrifligation at 26000 RPM for 3 hrs at 4°C in SW28 rotor, a band that contained the virus was found in between the two sucrose layers. The virus band was collected, diluted in Tris EDTA (TE) , and repeleted by centrifugation at 26000 RPM for 2 hrs. The pellet was •collected, resuspended in distilled water and dialysed against TE. The virus was stored at -20° C until use.

Example 2 Purification of IBDV RNA The virus was incubated for 3 hrs in a solution containing 0.01M Tris, 0.01M NaCl, 0.01M EDT.A, 0.5% SDS, and 50 mg/ml proteinase K. Following the incubation, the bands of the IBDV RNA were separated by electrophoresis on 0.8% agarose gel. The - 21 - two RNA fragments of the virus, at sizes of 3.4 and 2.9 kb, were visualized by ethidium bromide. Each fragment was isolated separately from the agarose gel using glass beads.

Example 3 Reverse transcription of IBDV DNA sequence comparison of several strains of IBEV that are available, at the Genebank revealed high homology between the different strains. Yet, there are regions which are highly conserved and regions that are subjected to variations at both the DNA and protein levels. It is conceivable that these differences reflect the difference in virulence between the different strains. Since IBDVks is a newly isolated virulent strain, it was crucial to determine its sequence. Primers corresponding to a conserved 5' region as well as the 3' regions of the putative open reading frame of VP-2, were synthesized (see primers below VP21 and VP22 respectively). Restriction sites were incorporated into these synthetic oligonucleotides that would facilitate convenient cloning site. To get cDNA of VP-2 of IBDV, 2 ^g of dsRNA were boiled for 5 min and immediately left on ice. 100 pmole of primers corresponding to the 5' and 3· conserved ends of VP-2 (VP21: GCTAGCGGATCCCGGGACGATCGCAGCGGATGACAAACCTG and VP22 : GCTAGCGGATCCCGGGGCACAGCTATCCTCCTTAT, respectively), 10 mM of dNTP's, 12 units of AMV reverse transcriptase, 2 μΐ of 0.1 M DTT, 0.5./zl of 10 ng/ml BSA in PCR buffer (20 mM Tris-HCl pH=8.3, 50 mM KC1, 2 mM MgCl2) were mixed to final volume of 50 il. Following 1 hr incubation at 42 'C and 30 min at 52° C the reaction was stopped at 95° C for 10 min.

Example 4 Amplification of IBDV cDNA VP-2 cDNA was amplified by the polymerase chain reaction (PCR). 5 ng of cDNA were incubated with 1 unit of Taq polyme- - 22 - rase (USB Biochemicals) and 25 pmole of each primer according to the manufacturer instructions in a final volume of 50 μΐ. The PCR reaction scheme was as follows: 5 min 94"C, (60 sec 58eC/ 60 sec 72eC/ 60 sec 94°C) x 28 cycles and 15 min at 72" C. The amplified segment corresponding to VP-2 was separated on 1.2% agarose gel and the proper band was excised and purified by glass beads procedure. The size of the amplified VP-2 DNA is 1372bp as was deduced from the published sequence of other IBDV strains.

Example 5 Cloning of the amplified VP-2 and VP-3 segments into the plasmid pUC19.

To facilitate blunt end ligation, the VP-2 and VP-3 amplified fragments ends were filled in by Klenow fragment reaction and ligated to pUC19 that was digested with Hindu. The ligated DNA was transformed into E. coli XLl-blue cells and white colonies that grew on LB plates containing ampicillin (100 mg/ml) and X-Gal (200 ng/ml) were isolated. Plasmid DNA was extracted from the different clones and analyzed with several restriction enzymes. Several cDNA clones corresponding to VP-2 and VP-3 in both orientation with respect to the multiple cloning site of pUC19 were isolated and were further used for DNA sequencing as well as for cloning VP-2 and VP-3 into baculovirus transfer vector.

Example 6 Sequence analysis of the cloned VP-2, VP-3, VP-4.

Using the plasmids pUC19VP2 harboring VP-2, pUC19VP3 harboring VP-3 and pUCl9VP4 harboring VP-4 DNA sequence analysis was performed by the dideoxy chain termination method using Sequenase version 2.0 kit (USB Biochemicals) according to the manufacturer instructions. The sequence analysis was initiated from both ends of the fragments on pUC19 using two commer- - 23 - cially available primers corresponding to the 5' and the 3' ends of the pUC19 multiple cloning site (Universal Primers / New-England Biolabs). 250-350bp were resolved in a typical sequencing reaction. Synthetic primers corresponding to sequences near ends of the progressing DNA sequences were synthesized to facilitate further DNA sequence analysis. The sequences of VP-2, VP-3 and Vp-4 corresponding to IBDVks strain and the comparison to the published sequences of other IBDV strains is given in Fig. 7. As expected, the sequences of IBDVks strain share high sequence homology both at the DNA level and at the protein level with the other strains. Yet there are some changes in the sequence that are unique to this strain that may reflect its unique virulence in comparison to other strains. Part of the sequencing was done from fragments isolted from PCR by Applied Biosystems 373A analyzer.

Example 7 Production of large amounts of IBDV VP-2 and VP-3 coat proteins using the baculovirus expression system, (a) General Notes The baculovirus expression vector system (BEVS) is widely applicable as an alternative to prokaryotic or other eukaryo-tic systems for the expression of heterologous proteins [Luckow, V.A. and Summers, M.D. (1988) Bio/Technology 6.: 47-55]. A variety of recombinant proteins produced by the system was recently reviewed [Luckow, V.A., Cloning and expression of heterologous genes in insect cells with baculovirus vectors, p. 97-152, In: c. Ho, A. Prokop and R. Bajpai (eds.), Recombinant DNA Technology and Applications (1990) McGraw-Hill, New York], These proteins are usually produced by replacing the viral polyhedrin gene with a foreign gene of interest. The polyhedrin structural gene is a non-essential late gene that is highly expressed in infected insect cells - 24 - propagation in tissue cultured insect cells [Summers, M.D. and Smith, G.E. (1988) A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555]. Post-transcriptional and post-translational modifications such as: RNA-splicing, glycosylation, phosphorylation, assembly of multimeric proteins and signal recognition have been observed in BEVS [Luckow (1988) ibid.; Miller, L.K. (1988) Ann. Rev. Microbiol. 42.: 177-199 ] . Moreover, in some cases a high level of expression of a certain recombinant protein was achieved only by BEVS [Levi B. Z. and Ozato, K. (1991) The Use of the Baculovirus Expression System for the Study of DNA Binding Proteins In: Biologicals from Recombinant Microorganisms and Animal Cells, M.D. White, S. Reuveny and A. Shafferman (Eds.) VCH Verlagsgesellschaft mbH, Weinheim; Marks, M.S. et al. (1992) Mol. Endocrinol. 6: 219-230]. Yields of recombinant protein produced via BEVS, although varying widely, can exceed 600 mg/1 [Maiorella, B. and Harano, D. (1988) Bio/Technology 6:1406-1409] . (b) Cloning VP-2 and VP-3 into the baculovirus transfer vector pAcYMl .

The plasmids pUC19VP2 and pUC19VP3 carrying the VP-2 and VP-3 cDNA were digested with the restriction enzyme BamHI and the isolated fragments were ligated to the baculovirus transfer vector pAcYMl [Matsuura, Y. et al. (1987) J. Gen. Virol. 68: 1233-1250] that was digested with BamHI and dephosphorylated with alkaline phosphatase to prevent self ligation. Clones in the right orientation with respect to the polyhedrin promoter were identified following digestion with the restriction enzymes Apal and Ndel . (c) Isolation of recombinant baculovirus carrying VP-2 and VP-3 cDNA.

Spodoptera fruaiperda Sf-9 cells were maintained as described [Cohen, T. et al. (1992) Growth Factors 2:131-138; Neutra, R. et al. (1992) Appl. Microbiol. Biotechnol. 37:74-78; Summers and Smith (1988) ibid.]. Wild type baculovirus, Autoorapha californica nuclear polyhedrosis virus (AcMNPV) and its recombinant derivatives were maintained and propagated as previously described [Summers and Smith (1988) ibid.]. The DNA corresponding to the transfer vectors carrying VP-2 and VP-3, pAcYMl-VP2 pAcYMl-VP3 were purified over CsC12 gradient and cotransfected with baculovirus wild type DNA into Sf-9 cells as described before [Cohen et al. (1992) ibid.; Neutra et al. (1992) ibid.]. In principle 1 /zg of transfer vector and 0.5 of viral DNA were cotransfected by the calcium phosphate method into Sf-9 cells and the supernatant was collected 4 days later. Recombinant viruses were isolated by the limited dilution method as described before [Pen, J. et al . (1989) Nucleic Acid Res. 17.: 451; Summers and Smith (1988) ibid.] 32 using [P]-labeled fragments corresponding to VP-2 and VP-3. Three independent isolates of recombinant virus in each case were purified and tested for protein production . (d) Production of recombinant VP-2 and VP-3 in infected insect cells.

Production of recombinant VP-2 and VP-3 in infected insect cells was determined by two criteria: Coomassie blue stained gels, and Western blot analysis. Sf-9 cells at a concentration of 2xl06 cells/ml were infected in 10 cm tissue culture plates with the different isolates of recombinant virus at multiplicity of infection of 10. The cells were harvested by centrifu-gation 48, 72, and 96 hrs post-infection (P.I) and washed once in phosphate buffered saline (PBS) and resuspended in tenth volume of fractionation buffer (10 mM NaCl, 1% triton, 10 mM Tris-HCl pH=7.4 and 1 mM PMSF). To separate between nuclear fraction and cytoplasmic fraction the cells passed 5 times through 25.5 gauge needle. Nuclei were precipitated by low speed centrifugation (170 x g) and resuspended in protein sample buffer while the supernatant was cleared further by higher speed centrifugation (15,000 x g) and the supernatant was diluted in 2x sample buffer. Nuclear samples as well as cytoplasmic sample were separated on a 10% SDS polyacrylamide gel electrophoresis (PAGE). The gels were either Coomassie blue stained or subjected to western transfer analysis. Sf-9 cells infected with W.T. virus or uninfected cells served as a control. A single band with a molecular weight of 50kD was observed only in coomassie stained samples of recombinant viruses and not in the control samples i.e. W.T. infected cells and uninfected cells. This bard size correlates well with the expected size of recombinant VP—2 which has an open reading frame of 465 amino acids. The band is more prominent in cytoplasmic samples as compared to nuclear samples. A single band with a molecular weight of 32kD was observed only in coomassie stained samples of recombinant viruses and not in the control samples, i.e. W.T. infected cells and uninfected cells. This band size correlates well -with the expected size of recombinant VP-3 which has an open reading frame of 291 amino acids. The band is more prominent in nuclear samples as compared to cytoplasmic samples. Similar results were obtained by Western blot analysis. The protein samples that were separated on 10% SDS-PAGE gels were electro-transferred to nitrocellulose membranes that were incubated with a 1:1000 dilution of serum from IBDV infected chicken. Following several washes the membrane were incubated with rabbit anti-chicken serum conjugated with peroxidase (Bio-Makor) and specific bands were visualized by the enhanced chemilumi-nescence (ECL) method (Amersham) . Specific bands with a molecular size of 50kD and 32kD respectively were visible only - 27 - in samples infected with recombinant virus. Thess bands correlate well in size with natural VP-2 and VP-3 bands that were extracted from bursae of infected chicks, separated and visualized under the same procedure. (e) Partial purification of recombinant VP-2 Sf-9 cells were infected at multiplicity of infection (MOI) of 10 and harvested after 48, 72 and 96 hrs. The cells were fractionated to cytoplasmic and nuclear fractions by passing the cells 5 times through a 25.5 gauge needle in a lysis buffer (10 mM NaCl, 1% triton X-100, 10 mM Tris-HCl pH=7.0 and 1 mM PMSF). Nuclei were pelleted at 170 x g and the cytoplasmic fraction (the remaining supernatant) was cleared further by spinning at 1500 x g. Equal amounts of proteins were separated on a 10% SDS-PAGE and following electro-transfer to a nitrocellulose membrane Western blot analysis using ECL was performed. The data clearly showed that VP-2 was mainly found in the cytoplasmic fraction and maximal band intensity was detected in the sample that was harvested 72 hrs post-infection. Ammonium sulfate precipitation of proteins was employed in an attempt to partially purify VP-2. The cytoplasmic fraction containing recombinant VP-2 was diluted 1:10 in lysis buffer, chilled on ice, and ammonium sulfate powder was gradually added to a final concentration of 25%. Following 1 hr of gentle shake on ice, proteins were precipitated by spinning 30 min at 1500 x g. The pellet was resuspended in phosphate buffered saline (PBS ) while ammonium sulfate was added to the supernatant to a final concentration of 40% and precipitating protein were recovered as above. Both enriched samples were dialyzed against access volume of PBS and equal amounts of proteins corresponding to the cytoplasmic fraction and the two ammonium sulfate enriched fraction (25% fraction and 40% fraction respectively) were visualized by Coomassie blue stained 10% SDS-gels. It was clear that both ammonium - 28 - sulfate fractions were enriched levels of VP-2 as compared to the original cytoplasmic lysate. Many of the contaminating proteins were not precipitated under this procedure and in each fraction, VP-2 composed 30-50% of total protein. In the cytoplasmic fraction VP-2 was estimated as 10% of total proteins. Therefore, both fractions of ammonium sulfate precipitation procedure, 25% and 40%, were utilized for future use of recombinant VP-2 in different immunization protocols. (f) Large-scale production of recombinant VP-2 in insect cells.

To produce large amounts of recombinant VP-2, Sf-9 cells were grown in suspension in shake flasks as previously described [Neutra et al. (1992) ibid.]. In principle, 1.5xl06 cells/ml were infected with recombinant virus at MOI of 2 in final volume of 100 ml in 250 ml volume shake flask rotating at 90 rpm at 28°C for 72hrs. Recombinant VP-2 was partially purified by ammonium sulfate precipitation as described above.

Example 8 Antibody production Two methods were used to define the quantity and sort of antibodies produced following injection of VP-2 recombinant protein. (a) Enzyme-Linked Immunosorbent Assay (ELISA).

Using the ELISA test, antibody titers were measured. Standar-tization of the ELISA test: Positive antiserum was obtained from infected birds, breeder flocks, and broiler chicks. Negative control sera were prepared from one day old Specific Pathogen Free (SPF) chicken. The positive antigens were virus isolated from Bursa and recombinant VP-2; Negative controls were extract of cells from the Bursa of Fabricius of SPF birds, and Sf-9 cells infected with non-recombinant baculo-virus. The antigens were diluted 1:2000 in coating buffer (0.05 buffer carbonate-bicarbonate, pH=9.6) and polystyrene microtiter plates were coated with the antigen by incubating for 1 hr at 37'C or overnight at 4eC. The antisera were double diluted in PBS + 0.1% BSA. After rinsing the plate vith PBS+ 0.05% T EEN 20 the sera were added to the antigen coated wells, in duplicates, from 1:1024 dilution up to 1:262000. After 2 hrs at 37 "C ,the plates were rinsed in the same solution and rabbit anti-chicken Ig conjugated to alkaline phosphatase was added. The plates were then incubated for 2 hrs at 37 "C and rinsed again. Then the substrate, nitro-phenyl phosphate, was added. The colour of the solution changed to yellow in proportion to the amount of chicken anti-IBDV antibodies. Light absorbances were read in ELISA reader (400 SLT; ATC) at 405 nm wavelength. Standartization between plates was achieved by stopping the reaction at the same absorbance of the reference serum (see Table 1). (b) Analysis of viral proteins and antibodies.

For polyacrylamide gel elctrophoresis (PAGE) and Western blotting, viral preparations were boiled for 3 min in a sample buffer containing 3% sodium dodecyl sulfate (SDS) and 5% -mercaptoethanol . Viral polypeptides were analyzed in 12% w/v polyacrylamide slab gels, using the discontinuous SDS gel system [Laemmli, U.K. (1970) Nature, London 227 : 680-6851. In most cases, two slab gels were electrophoresed simultaneously; one was stained with Coomassie Brilliant Blue R , and the proteins from the second were electrotransferred on to nitrocellulose filter (Hybond-C Amersham) in using the semi-dry system (LKB Model 2117 Multiphor II electrophoresis unit) [as described by Burnette (1981)]. Filters were cut into 5 mm strips and incubated separately in 1:200 dilution of the relevant sera. After several washes in PBS, the filters were incubated with 1:1000 dilution of rabbit anti-chicken IgG or peroxidase conugated (Sigma), followed by incubation in 1 μ,Ο.

[I]-labeled Protein A (Amersham) or 3 , 3 · -diaminobenzidine (Sigma), respectivelly. Protein A labeled filters were exposed to X-ray film (see Fig. 8).

Table 1 ELISA titres of SPF chicken following immunization at 14 and 28 days old chicken and postchallenge Injected Pre- Post- Antigen challenge11 challenge (O.D) rVP-2 .85 1.46 (9)1 Bursatin .45 .75 (6) Baculovirus .16 .75 (4) PBS .14 .62 (5) n pre-challenged = 12 1 number in brackets = n post-challenged Example 9 Protection of recombinant VP-2 (rVP-2) against virulent IBDV. In order to test the efficiency of antibodies produced against rVP-2 to protect birds against IBDV, the following experiment was carried out. Fourteen days old SPF birds were bled and divided into four groups. Each group was injected intramuscularly at 14 and 21 days of age with a different antigen that was emulsified in Freund's complete adjuvant in the first inoculum and Freund incomplete adjuvant in the second. The total volume for injection was 0,5 ml per bird. Group 1 was inoculated with 50 μg of rVP, group 2 was a positive control - 31 - and injected with Bursatin Lot No 053 (a commercial vaccine of killed IBD virus). Wild type baculovirus and PBS were injected as negative controls to groups 3 and 4 respectively. Two weeks after the second injection, birds were bled, and then infected 4 4 * . intraoculary with 10 * EID50 of tne V1*"ulent stain IBDVks which was extracted from bursae of infected SPF chicken. Three days post inoculation the birds were weighed and bled. Six birds from each group were sacrificed, their Bursae were removed, weighed and tested for pathologic changes and virus presence. The results summerized in Table 2 show that the birds vaccinated with rVP-2 were fully protected against the virulent strain.

Table 2 Immunogenicity of rVP-2 and its ability to confer protection against infection with virulent IBDV Antigen Antibodies Mortality Body % Bursa/ Antigen injected in serum weight BW in bursa PV1 PI2 (grams) VP-2 12/12 6/6 0/12 603 0.45 0/6 Bursatin 12/12 6/6 0/12 588 0.62 0/6 Cont 1 3/12 4/4 6/12 416 0.41 7/7 Cont 2 3/12 5/5 5/12 456 0.50 5/5 Post vaccination Post challenge infection with virulent virus Mortality at days 3-5 post challenge infection Example 10 Persistence of antibodies in a breeding flock A group of 20 hens from a commercial breeding flock were vaccinated against IBDV at one month of age with an inactivated vaccine . At five months of age the birds were divided into four groups of five birds each and injected with rVP—2, commercial inactivated IBDV vaccine (Provac), PBS and unvaccinated group. At different times antibody level was tested by ELISA. Birds that were injected with r-VP2 showed higher level of anti-IBDV antibodies that persisted for a longer period than birds vaccinated with commercial vaccine Provac (see Fig. 9). The progenies of these hens were tested at 1 day of age and antibodies at a protective level were found in their sera.

Example 11 Production of large amounts of VP-3 structural protein in baculo-virus (eukaryotic) and prokaryotic expression systems Basically/ the same methods as described in Examples 2 to 7 were used in order to produce VP-3 protein. The two main differences are the primers that were used and the method for purification of the protein. The VP-3 that is produced is a fusion protein that contains two amino acids of the polyhedrin gene of the baculovirus (VP-3 could not be produced from the suggested beginning but from another site) . The primers that were used for isolation of VP-3 from the A segment of RNA were: VP-31 starting at nucleotide 2168 and VP-32 starting from the 3* end of the gene at nucleotide 3042. Both primers contain restriction sites for BamHI, Smal and Ndel . VP-3 was also produced in bacteria, using the pet vector. The protein produced by the system show partial protection. However, on immunoblot and other tests anti whole virus antibodies bound to this protein and antibodies raised against VP-3 were bound efficiently to the virus.

Example 12 Building of hybrid genes After isolating the DNA encoding VP-2 and VP-3 separately, the fragments were fused. Oligonucleotides vere synthesized which are complementary to each other. Half of I2B is homologous to 3· end of VP-2 (* above the line) and the other half is homologous to the 5' end (* above the line of VP-3). Half of I3A is homologous to 3' end of VP-2 (* above the line) and the other half is homologous to 5' end of VP-3 (. above the line). VP-2 and VP-3 fragments were amplified in separate tubes with the primers I2B(H) and I3A(H). After cleaning the fragments from the residual primer, the resultant fragments were added together into a tube and PCR procedure was performed using primers of the 5 'end of VP-2 and the 3' end of VP-3. The result was a fragment of aproximately 2.2 kb containing VP-2 and VP-3 sequentially. The DNA sequence in the junction shows that the fragments remain in frame.

I2A> I3A(H)> 1 1 1 Parts of the description which are out of ambit of the appended claims do not constitute part of the claimed invention

Claims (17)

108788/5 -35- CLAIMS:

1. A substantially pure DNA sequence encoding a virus protein (VP) of a very virulent Infectious Bursal Disease Virus, wherein the DNA sequence encoding said virus protein comprises the nucleotide sequence as set forth in Figure 1, the virus protein encoded by said sequence being the VP-2 protein, and functional analogues thereof having the same biological activity.

2. A recombinant VP-2 protein of Infectious Bursal Disease Virus encoded by a DNA sequence according to claim 1, having an amino acid sequence which is at least about 90% conserved in relation to the amino acid sequence set forth in Figure 3. and functional homologues and immunologically active essential fragments thereof having the same biological activity.

3. A recombinant VP-2 protein according to claim 2, having an amino acid sequence substantially the same as the amino acid sequence set forth in Figure 3 and immunologically active essential fragments thereof having the same biological activity.

4. A VP-2 protein encoded by a DNA sequence according to claim 1, and immunologically active essential fragments thereof having the same biological activity.

5. A recombinant vector comprising a DNA sequence according to claim 1.

6. A recombinant vector according to claim 5, being the plasmid pUC19VP2.

7. An expression vector comprising a vector capable of expressing structural DNA comprised therein in a host and a DNA sequence according to claim 1.

8. An expression vector according to claim 7, wherein said vector capable of expressing structural DNA comprised therein in a host is a baculovirus.

9. An expression vector according to claim 7, wherein said vector capable of expressing structural DNA comprised therein in a host is a fowl pox virus. 108788/3 -36-

10. A host cell transformed with the expression vector of any one of claims 8 9.

11. A host cell according to claim 10, being an insect cell.

12. A host cell according to claim 11, wherein said insect is Spodoptera frugiperda.

13. A vaccine for immunizing chicken against Infectious Bursal Disease comprising an effective immunizing amount of at least one protein according to any one of claims 2 to 4 and a physiologically acceptable carrier.

14. A vaccine for immunizing chicken against Infectious Bursal Disease comprising an effective immunizing amount of the expression vector of any one of claims 7 to 9.

15. A method of immunizing chicken against Infectious Bursal Disease by aoministering to the chicken an effective immunizing amount of at least one protein of any one of claims 2 to 4.

16. A method of immunizing chicken against Infectious Bursal Disease by administering to the chicken an effective immunizing amount of the vaccine of claim 13 or 14 or a mixture thereof.

17. A method of immunizing chicken against Infectious Bursal Disease by administering to the chicken an effective immunizing amount of the DNA sequence according to claim 1.