IE922074A1

IE922074A1 - Means for improving the growth of plants

Info

Publication number: IE922074A1
Application number: IE207492A
Authority: IE
Inventors: Jean Garbaye; Robin Duponnois
Original assignee: Agronomique Inst Nat Rech
Priority date: 1991-06-26
Filing date: 1992-07-01
Publication date: 1992-12-30
Also published as: FR2678281A1; AU2243592A; CA2112398A1; WO1993000421A1; EP0521758A1; FR2678281B1; EP0592513A1

Abstract

The invention relates to means for improving the growth of plants, consisting of bacterial strains capable of specifically stimulating the formation of mycorrhizae by inoculated mycorrhizal fungi, these strains exerting an antagonistic effect towards contaminant fungi which compete against the inoculated fungus.

Description

The invention relates to means for improving the growth of plants, more especially forest trees, by perfecting techniques of controlled mycorrhization.

It is known that a large number of plants, notably forest trees, from the seedling stage live in obligatory symbiosis with fungi which are associated with them at the level of the roots. The mixed root and fungal organs bear the name of mycorrhizas. The effectiveness of the symbiosis, estimated in terms of stimulation of the growth of a given plant in specific environmental conditions, varies considerably depending on the identity of the associated fungus. There are a large number of potential symbiotic fungi for any given culture. By the term controlled mycorrhization is meant the body of techniques aimed at artificially directing mycorrhization in a sense which favours the growth of plants, for example by inoculating plants with fungal strains selected for their greater than average efficacy in this regard.

In order to improve the effect of fungal inocula, it is possible to play with cultural factors such as fertilization or disinfection of soil. This latter aspect is particularly important. In effect, the success of mycorrhizal inoculation can only be assured in the absence of competition from other symbiotic fungi. One can judge, therefore, that all innovation reducing this competition and the requirements of disinfection would be a considerable advancement of controlled mycorrhization.

The co-inventors have also described the production of bacteria capable of stimulating the mycorrhization of varieties of forest trees such as Douglas fir. These co-inventors have also defined the concept of auxiliary bacteria of mycorrhization (ABM).

Continuing research in this field has enabled the inventors to show that certain bacteria directly associated with mycorrhizal fungi in symbiosis with a plant host constitute highly valuable specific auxiliaries of mycorrhization, thus indirectly favouring the growth of these plants.

The invention, therefore, has as an object the provision of new bacteria capable of greatly accelerating the symbiosis between a mycorrhizal fungus and the plant host and, consequently, permitting an improvement in the growth of the plant.

The invention also has as an object the provision of a process for isolating these strains.

The invention has as a further object the provision of a highly effective process of mycorrhization and compositions which can be used in carrying out this process.

The bacterial strains according to the invention are characterised in that they are capable of specifically stimulating the formation of mycorrhizas by mycorrhizal fungi, said strains exerting an antagonist effect vis ά vis fungal competitors of the inoculated fungus.

The specific stimulating effect vis ά vis the inoculating fungus is such that the rate of mycorrhization, that is to say the relationship between the percentage of mycorrhizal roots formed and the total number of roots, is significantly enhanced by at least about 10% relative to the system without the benefit of the bacteria.

This being so, the person skilled in the art will readily appreciate as regards a plant, fungal or culture system the threshold from which the rate of mycorrhization will result in a practical advantage.

In the same manner, the antagonistic effect vis a vis a competing fungus is such that the percentage of mycorrhizal roots formed thereby is significantly reduced to a value less than about 10%.

One will judge the desirability of this two fold effect, which allows one to valorize the principle of controlled mycorrhization.

The invention provides in effect means for simultaneously reinforcing and accelerating the establishment of symbiosis between the inoculated fungus and the plant host and for inhibiting the establishment of the competing fungus. Thus, it is possible to dispense with the operation of disinfecting the soil which is presently essential before sowing and inoculation.

The bacterial strains according to the invention consist of Gram positive bacteria of the Bacillus genus.

As examples of bacteria of this genus, one can mention those of the species Bacillus subtilis, in particular that hereinafter referred to as A2 deposited at the C.N.C.M. (Collection Nationale de Cultures de Microorganismes) the June 11, 1991 under the number 1-1112 and Bacillus sp (hereinafter designated A15) deposited at the C.N.C.M. on the same day under the number 1-1113.

Other bacteria of major interest for mycorrhization are Gram negative bacteria of the genus Pseudomonas.

Among bacteria of this genus, those of the species Pseudomonas fluorescens exert particularly advantageous agonistic and antagonistic effects, such as those defined above.

The strains Pseudomonas sp. and Pseudomonas fluorescens (hereinafter referred to respectively as B5 and B8), deposited at the C.N.C.M. on June 11, 1991 under the numbers 1-1114 and 1-1115, respectively, exhibit a high efficacy in this regard. These strains have served as the object of a molecular characterisation. As reported in example 1, the strain B8 is characterised by the presence in its 16S ribosomal DNA of the sequence: '-ATGTAAGGCCATGGTAAGTTCTTCGACGATTT-3' This strain is also characterised by its polypeptide profile, such as represented in figure 7, obtained by one dimensional electrophoresis in denaturing conditions on gel.

The invention relates more especially to bacterial strains coming 5 from the rhizosphere of forestry trees.

According to another aspect, the bacterial strains of the invention are characterised in that they are isolated from the mantle of mycorrhizas and the carpophores of ectomycorrhizal fungi.

The bacteria of the invention constitute auxiliaries of significant 10 interest vis ά vis ectomycorrhizal fungi.

Ectomycorrhizas are found in numerous forestry species. They are formed by numerous fungi, basidiomycetes and higher ascomycetes.

Some fungi of this type having a particularly high symbiotic efficacy comprise Laccaria sp. (for example: Laccaria laccata and Laccaria bicolor) Hebeloma sp. (for example: H. crustuliniforme, H. cylindrosporus), Paxillus involutus, Rhizopogon sp. (for example R. vinocolor) Suillus sp., Scleroderma sp and Boletus edulis.

The efficacy of the strains of the invention relative to competing fungi of the above ectomycorrhizal fungi is particularly high.

For example, the antagonistic effect relative to T. terrestris, one of the most widespread contaminants in the nursery, leads to a practically total inhibition of the development of this fungus.

This effect is equally important in relation to undesirable strains with respect to a given selected fungus, which may nevertheless include one of the fungi mentioned above, even though it has not been selected for mycorrhization.

The bacterial selectivity on the ectomycorrhizal fungus brings about the emission of gaseous compounds by the isolated bacteria.

Thus, gas phase chromatography coupled with mass spectrometry has allowed the identification in pseudomonas type bacterial cultures extracted with the aid of ethyl ether, different gaseous compounds such as oleic acid, isoamyl alcohol and 2-phenyl ethanol. The emission of such compounds constitutes, therefore, a characteristic of the strains of the invention.

The bacterial strains of the invention are also characterised by their capacity to degrade the intercellular cement and to facilitate the penetration of hyphae between cells due at least to one of the following enzymatic activities: endoglucanase, cellobiose hydrolase, pectate lysase or xylanase.

Their survival power and decolonisation of soil is increased as shown by their lipase, amylase or protease activity.

According to another aspect, the bacterial strains of the invention are characterised in that they are obtained by a process comprising: suspending carpophores and mycorrhizal mantles taken from Laccaria laccata in symbiosis with Douglas fir, - culture in an appropriate medium, such as TSA, according to standard techniques, addition of an inoculum of L. laccata, seeding with seeds of Douglas fir, the selection in vitro, in the greenhouse or in the nursery, of bacterial isolates capable of giving rise to a rate of mycorrhization of at least about 80% by L. laccata and practically totally inhibiting the formation of mycorrhizas by competing fungi such as T. terrestris.

The invention also relates to a process for obtaining bacterial strains such as those defined above.

This process is characterised in that it comprises: suspending carpophores and mycorrhizas taken from 5 mycorrhizal fungi associated with plant hosts, serial dilution of these suspensions and the application thereof on a medium suitable for the growth thereof, the selection of isolates capable of giving rise to a rate of mycorrhization, on a mycorrhizal fungus inoculated in a plant host, which is significantly enhanced by about 10% relative to the system without the benefit of bacteria and of practically totally inhibiting the establishment of competing fungi, competitors of the inoculating fungus Tests carried out in various conditions, namely in vitro synthesis in controlled microbial conditions, pot trials under glass and nursery trials, have shown that the bacteria defined above greatly reinforce and accelerate the establishment of symbiosis between a plant host and a mycorrhizal fungus and thus the growth of the plant, while at the same time inhibiting the development of competing fungi which are ineffectual as regards symbiosis. Thus, the bacteria constitute biological adjuvants of major interest for processes of mycorrhization.

Furthermore, the effect of these adjuvants is lasting since it is exerted on the fungus in symbiosis with the plant host, a factor which totally distinguishes the bacteria of the invention from classical GPPR (Growth Promoting Plant Rhizobacteria) isolates of soil or of the rhizosphere.

The invention also relates to the use of the above bacterial strains for the production of compositions for use as adjuvants for the controlled mycorrhization of plants.

These compositions are characterised in that they comprise a bacterial strain such as defined above, in association with an inert solid or liquid vehicle.

The invention relates, in particular, to a bacterial suspension 5 advantageously containing 107 to 1012, preferably from 108 to IO10 bacteria. These suspensions contain necessary preserving adjuvants such as magnesium sulphate, polyethylene glycol or glycerol. The doses will be readily adjusted by the person skilled in the art taking into account the efficacy of a given strain.

The medium of the suspension is an inert liquid vehicle. In practice, one can use sterile water.

The suspension is diluted at the time of use.

This suspension may be inoculated in admixture with a solid vehicle, such as a gel, or an inert, particularly porous material as regards bacteria.

Suitable gelatinous materials include polymers of vegetable or animal origin, such as hydrogels, the alginates being particularly preferred.

Among the particularly preferred materials, one can mention 20 vermiculite, peat or mixtures thereof and expanded clay.

In one embodiment the bacterial strain is presented in a mixed liquid or solid inoculum with the fungus.

In this embodiment, the bacterium is incorporated in the mycorrhizal inoculum, advantageously at doses from 10^ to 10^ bacteria per gram of dry weight of mycelium. A vehicle is used which allows one to readily handle and apply the inoculum. More especially the vehicle is a solid vehicle, notably of a gel or of a particularly porous material such as mentioned above.

Thus, a mixed inoculum is advantageously presented in the form of beads of calcium alginate.

In one embodiment, the inoculum may be directly associated with the seed.

Particularly preferred mixed inocula for conifers such as Douglas fir or oak comprise at least one of the bacteria according to the invention in association with L. laccata.

The invention relates, in particular, to mixed inocula of L. laccata with one of the bacteria deposited at the C.N.C.M. mentioned above.

For the culture of beech, especially suitable mixed inocula include H. crustuliniforme or P. involutus associated with bacteria of the invention.

In general, the mycelial inoculum used with or without the bacteria is advantageously prepared as described in The mycorrhizas of trees and cultivated plants by D.G. Strullu, ed. Lavoisier, Paris, 1991.

This preparation comprises the solid fermentation of the substrate.

In one variant, a liquid fermentation is carried out, followed by inclusion in an inert vehicle such as a gel.

The invention also relates to a process for the controlled mycorrhization of plants, characterised in that it comprises the use of an effective quantity of a bacterial strain of the type defined above.

The invention relates, in particular, to the mycorrhization of varieties of forestry trees. ίο As described in the examples, it is furthermore shown that these bacteria are not specific for a given variety of forest tree, which confers on these bacteria a wide field of application.

Among the varieties of trees which are most often used in 5 reforestation and artificial regeneration, which are particularly suitable for use in accordance with the invention, there can be mentioned confers such as Douglas fir, spruce, pines, larch and tsugas or leafy species such as oaks, beech and eucalyptus.

The effects of the bacterial strains according to the invention are 10 fully conserved between seeding and primary mycorrhizal infection, which enables one to use several supporting methods.

There may be mentioned: the spreading of a bacterial inoculum before or after seeding, or - the bacterial treatment of seeds, in combination with any mycorrhizal inoculation technique, or the addition of bacteria to the mycelial inoculum at the time of preparation thereof.

Thus, the practical conditions for applying the strains according 20 to the invention turn out to be very simple, all the more so given that they obviate the normal requirements of disinfecting the soil. Furthermore, their high effectiveness allows one to reduce the amount of the inoculating fungus and thus the cost of the process.

Other characteristics and advantages of the invention will be 25 apparent from the following examples.

By way of illustration of the invention, there is indicated hereinafter the process for the isolation of bacteria according to the invention from L. laccata and the effects observed during the course of various experiments. In these examples reference should be made to figures 1-7 which represent respectively: figures 1 and 2, the rate of mycorrhization (RM) by L. laccata after treatment with isolated strains. figures 3 to 5, the RM by T. terrestris after treatment with isolated strains, figure 6, DNA restriction fragments of strains of the invention after agarose gel electrophoresis, compared with known strains, and figure 7, the polypeptide profile for a strain according to the invention obtained by one dimensional electrophoresis.

Example 1 : Selection of auxiliary bacteria for mycorrhization.

In this example there is reported the isolation of bacteria from 15 Laccaria laccata associated with young Douglas fir plants and their selection in accordance with the criteria of the invention (stimulation of mycorrhizas by an introduced fungus and inhibition of competing fungi).

Laccaria laccata is used (Scop, ex FR) Cke, isolate S-238 of 20 USDA (Corvallis, Oregon).

The Douglas fir plants are obtained from seeds of Douglas fir Pseudotsuga menziesii (Mirb).

• Isolation The bacterial strains are isolated from carpophores and surface 25 sterilised mycorrhizas of Laccaria laccata associated with young Douglas fir plants in experiments carried out in flower pots, in a nursery and in a plantation.

The sporocarps are cleaned with a brush and are cracked to open them. Pieces of tissue from the interior of the cap are homogenised in sterile water using an UltraturaxR homogeniser.

The mycorrhizas are washed in running water, surface sterilised in NaClO 1.5%, 2 min., rinsed twenty times in sterile water and homogenised under the same conditions as for the sporocarp tissue.

The surface sterilisation is verified by spreading water from the 10 last rinsing on nutritive agar.

Serial dilutions of suspensions of the carpophores and mycorrhizas are applied on a TSA medium at 0.3% (Tryptic Soya Agar medium, DIFCO).

Distinct colonies are isolated and re-cultured on the same 15 medium.

The mycorrhizal isolates are designated by Ax and those of the carpophores by Bx, x corresponding to the number of the trial.

• Screening Isolates are screened that show rapid growth on TSA medium and 20 which stimulate the growth of Laccaria laccata in the confrontation test described by Duponnois and Garbaye in Can. J. Bot., 1990, 68, 21482152.

The morphological and physiological characteristics of the different isolates are indicated hereafter.

* Morphological characteristics of bacterial strains used in the screening.

A Gram staining was performed on 4-day old colonies. The morphology (MOR), motility (MOT) and presence of endospores (SPOR) was examined using suspensions of 4-day old colonies and a phase contrast microscope.

In order to detect fluorescent bacteria (FLU) the isolates were maintained on a King’s B medium (King et al. J. Lab. and Chim. Med. 44: 301-307, 1954).

The results obtained are set forth in table 1 below: Table 1 GRAM bacterial isolates MOR MOT SPOR FLU Al + Large rods + - - A2 + Large rods - - - A4 + Large rods - - - A5 + Chains of elongated rods - - - A10 + Large rods - + - A14 + Large rods - + - A15 + Thin rods - - - A8 - Small rods - - - A9 - Small rods + - - B4 - Small rods - - - B5 - Small rods + - - B6 - Short rods + - - B7 - Short rods - - + B8 - Short rods - - + • Study of the physiological characteristics of isolated bacteria (Gram negative) Two tests were carried out on the bacterial colonies: the action of β-galactosidase (ONPG Ref. 55601, Bio Merieux, France) and the presence of cytochrome oxidase (OX: Ref. 55922, Bio Merieux, France).

The Gram negative isolates are then examined by the API ZONE system (API 2005), which involves the following typing: action of nitrate reductase (NIT); action of tryptophanase (TRP); production of acid metabolites from glucose (GLU): action of arginine dihydrolase (ADH); action of urease (URE); action of β-galactosidase (ESC) proteolysis of gelatine (GEL); action of β-galactosidase (ONPG); use of glucose (GLU), arabinose (ARA), mannose (MNE), mannitol (MAN), N-acetyl-glucosamine (NAG), maltose (MAL), gluconate (GNT), caprate (CAP), adipate (ADI), malate (MLT), citrate (CIT) and phenylacetate (PAC) as sources of carbon; presence of cytochrome oxidase (OX).

The results obtained are given in the following table 2: • Study of the physiological characteristics of isolated bacteria (Gram positive).

The Gram positive isolates were examined by the API 50 CHB System (API 5043). The following tests were carried out: production of acid metabolites from the carbohydrates glycerol (GLY), erythrol (ERY), D-arabinose (D ARA), L-arabinose (L ARA), ribose (RIB), D-xylose (D XYL), L-xylose (L XYL), adonitol (ADO), β-methyl-D xyloside (MDX), galactose (GAL), glucose (GLU), fructose (FRU), mannose (MAN), rhamnose (RHA), dulcitol (DUL), inositol (INO), mannitol (MAT), sorbitol (SOR), α-methyl-D mannoside (MDM), α-methyl-D glucoside (MDG), N acetyl glucosamine (NAG), amygdaline (AMY), arbutine (ARB), esculine (ESC), salicine (SAL), cellobiose (CEL), maltose (MAL), lactose (LAC), melibiose (MEL), sucrose (SAC), trehalose (TRE), L-sorbose (L SOR), inulin (INU), melezitose (MLZ), raffinose (RAF), amidin (AMD), glycogen (GLG), xylitol (XLT), gentiobiose (GEN), D turanose (D TUR), D lyxose (D LYX), D tagatose (D TAG), D fucose (D FUC), L fucose (L FUC), D arabitol (D AR), L arabitol (L AR), gluconate (GNT) 2 keto gluconate (2 KG) and 5 keto gluconate (5 KG).

The results obtained are set forth in table 3.

Table 3 Tests Al A2 A4 A5 A10 A14 A15 GLY + + + + + + + ERY - - - - - - - DARA - - - - - - - LARA + + + + + + + RIB + + - + + + + DXYL + + - + + + LXYL - - - - - - - ADO - - - - - - - MDX - - - - - + + GAL + - + + - + + GLU + + + + FRU + + + + + + MAN + + + + + + LSOR - - - - - - - RHA - - - - - + - DUL - - - - - - - INO + + - - + - - MAT + + + + + + + SOR + + - - - - - MDM - - - - - - - MDG + + + - - + NAG - - - + - - + AMY + + + + ARB + + + + - + + ESC -I- + + + + + + SAL + + + + + + + CEL + + + + + + + MAL + + + + + + + LAC + + + - + + MEL + + + + + + + SAC + + + + + + + TRE + + + + + + + INU - - + - + -I- - MLZ - - - - - + - RAF + + + + -I- + + AMD + + + + - + + GLG + + + - + + Table 3 contd ...

Tests Al A2 A4 A5 A10 A14 A15 XLT - - - - - - - GEN + + + + + + + DTUR + + - - + + DLYX - - - - - - + DTAG - - - - - + + DFUC - - - - - - - LFUC - - - - - - - DAR - - - - - - - LAR - - - - - - - GNT - - + - - - - 2KG - - - - - - - 5KG - - - - - - - The dominant groups are the Bacilli for the Gram positive bacteria and Pseudomonas for the Gram negative bacteria, two of which are fluorescent.

It is noted that most of the bacterial isolates deriving from sporocarps are Gram negative with a significant portion of Pseudomonas.

• Molecular characterisation of B8 and A2.

In vitro gene amplification (Polymerase Chain Reaction, PCR) followed by restriction fragment length polymorphism (RFLP) were applied to the nucleotide sequence of 16S ribosomal DNA of strains B8 and A2 deposited at the C.N.C.M. under the numbers 1-1115 and I1112, respectively. By way of comparison, two reference strains obtained from the D.S.M. (Deutsche Sammlung von Mikroorganismen) were also studied: No. 50090 (Pseudomonas fluorescens) and No. 7 (Bacillus amyloliquefaciens).

The following protocol was carried out: Culture of bacteria - The bacteria are cultivated for 48 hours in a liquid TSB (Tryptic Soya Broth) medium at 25°C.

Amplification - four μΐ of bacterial culture are placed in a 5 microcentrifuge tube containing 96 μΐ of the following amplification solution: 500 pmole of each of two oligonucleotide primers fDl (AGAGTTTGATCCTGGCTCAG) and rDl (AAGGAGGTGATCCAGCC) in dNTP (400 μΜ), Tris-HCl buffer pH 8.8 (10 mM), MgCb (1.5 mM), KC1 (50 mM), Triton-X (0.1%). The primers were synthesised and provided by Bioprobe Systems (Montreulsous-Bois, France).

The tube is then heated at 95°C for 10-20 min. so as to break open the cells and liberate the DNA, 2.5 units of Taq DNA polymerase (Bioprobe Systems, Montreuil-sous-Bois, France) are added. A drop of mineral oil (Sigma Chemicals) deposited on the surface of the solution prevents evaporation. The tube is placed in a GeneATAQ Controller thermobloc (Pharmacia-LKB) and the reaction medium is subjected to 25-30 amplification cycles. Each of the cycles consists of three phases: 2 min. at 95°C (denaturation of DNA), 25 sec. at 50°C (hybridization) and 2 min. at 72°C (polymerisation). The combined 25-30 cycles is preceded by an initial denaturation period (3 min. at 95°C) and followed by a final polymerisation period (10 min. at 72°C).

A control experiment without bacteria is carried out to verify the absence of all contaminating DNA in the reactants. The degree and specificity of amplification are evaluated by 1 % agarose gel elecrotophoresis (Sambrook et al., 1989, Molecular cloning: a laboratory manual, Cold Spring Harbor, New York).

Analysis of restriction fragment lengths - From 1 to 2 pg amplified DNA are digested for 12-14 hours with 5 units of one or other of the following restriction enzymes: Alul, Hinfl, Mbol or Rsal according to the suppliers' instructions (Pharmacia Fine Chemicals, Biolabs). The restriction fragments are subjected to 2% agarose gel electrophoresis (Sambrook et al., 1989 supra); the corresponding bands are stained with ethidium bromide and photographed under ultra-voilet light. For developing restriction fragment standards one causes ΦΧ174 DNA (Pharmacia Fine Chemicals, Biolabs) previously subjected to Haelll restriction enzyme to migrate on the same gel.

The photograph corresponding to figure 6 shows the bands obtained, characteristic of each of the four bacterial strains studied, on two gels (gel 1: with Mbol, Rsal and Alul restriction enzymes; gel 2: with Hinfl restriction enzyme). M: standard (band 1: 1358 base pairs; band 4: 603 base pairs; band 8: 194 base pairs). X: 16S bacterial DNA amplified, but not cut.

The following table 4 gives the results obtained in so far as they concern the approximate sizes in base pairs (bp) of B8 fragments: Table 4 B8 DSM No. 50090 Variable sequence V2 120 120 Variable sequence V6 100 100 V2 + intermediate sequence + V6 1000 1000 Restriction fragments 700 700 250 250 100 100 The results obtained confirming that the strain B8 belongs to the Pseudomonas fluorescens species.

Single stranded DNA for the V2 + intermediate sequence + V6 region of the B8 strain, amplified by PCR as before, was then sequenced by phage T7 DNA polymerase (according to the method of Sanger in Proc. Nat. Acad. Sci. USA, 74, 5463-5467, 1977). The following sequence, characteristic of the strain, was thereby revealed: ’-ATGTAAGGCCATGGTAAGTTCTTCGACGATTT-3' The B8 strain was also subjected to a polypeptide profile 5 characterisation by one dimensional electrophoresis under denaturating conditions on discontinuous polyacrylamide gel according to the technique of Laemmli in Nature, 227, 680-685, 1970. The bacteria were cultivated for 48 hours, homogenised, and the proteins precipitated with acetone at -20°C. After centrifugation, the protein plug was solubilised in Laemmli migration buffer. The concentration in concentrated polyacrylamide gel was from 5% and that for separation gel from 15% and the current strength from 15 then 30 mA. After development of the polypeptides by silver staining, the gel was dried and the optical density measured in a spectrophotometer at 540 nm. The molar masses corresponding to different peaks were determined from the migration of reference proteins on the same gel. Figure 7 shows the polypeptide profile obtained, with measured absorbance on the ordinate and the position of the peaks on the gel in mm on the abscissa. The indication of molecular weights is inserted in the upper part of the figure.

Example 2 : Characterisation of strains according to their agonist and antagonist effects defined above. a) Tests under glass: Study of the effect of bacterial isolates on mycorrhizal infection of Douglas fir by L. laccata.

· Experimental conditions.

The three components of the system (bacterium, fungus and plant) are brought into contact in 95 ml polyethylene vessels filled with a mixture of non disinfected vermiculite and peat (1/1; vol/vol) and fungal inoculum (1/10; vol/vol). 5 ml of a concentrated bacterial suspension (greater than 10^ cells/ml) in 0.1 M MgSO4.7 I I2O is injected into each receptacle with the aid of a syringe. In a control treatment, the fungus and the buffer solution is inoculated in the absence of bacteria. Each vessel is seeded with three seeds.

When the plants have reached the cotyledonous stage, the plantlets are thinned out so that there is only one per vessel. Each treatment is represented by a tray containing forty cells.

After five weeks, a nutritive solution (14.8 mg/1 nitrate-derived nitrogen and 2 mg/1 phosphorus) previously verified to have a favourable effect on the development of the mycorrhiza is applied in excess twice a week, while water is added each day.

The trays are moved on the glasshouse staging each month so as to compensate for microclimatic gradients.

The results obtained in two experiments carried out in different climatic conditions are reported, the first in summer (at a temperature of 15 to 28°C), the second in winter (10 to 20°C).

The photoperiod (16 hours) was the same in the two experiments (daylight was complemented by artificial light).

The rate of mycorrhization was measured by determining the number of short mycorrhizal roots relative to the total number of short roots and transformed by arc sine (square root). All results are treated statistically, differences are considered as significant at a risk factor of 5%.

The mean value of the rate of mycorrhization for each treatment was compared with that of the control.

’ Summer experiment. seedlings were removed per treatment, several weeks after sowing.

The results obtained after 16 weeks with bacterial isolates are shown in figure 1.

Al to A9 (mycorrhizal samples) and Bl to B5 (sporocarp samples).

The legends for this figure are as follows: the open part corresponds to non-mycorrhizal short roots. the hatched part corresponds to infection by L. laccata in the control. the dotted part corresponds to ectomycorrhizal infection caused by bacterial inoculation.

At the sixteenth week, the percentage of short roots in this experiment is 67% in the control.

On the other hand, in the case of the isolates tested, this percentage varied from 83 to 97%, thus providing evidence of the very favourable effect of the bacteria selected.

• Winter experiment.

The results obtained after 18 weeks of treatment are represented in figure 2 and concern the bacterial isolates Al to A15 and Bl to BIO. The legends for this figure are identical to those for figure 1.

The examination of these results shows that the rate of mycorrhization which is about 70% in the control exceeded 80% for A5, A9, Al 1, A15, B2, B5, BBc3, and reaching even 93% with All.

It is noted that certain of the bacterial strains exert an auxiliary effect on mycorrhization in the two temperature conditions (summer and winter) which enables one to envisage a large field of application from a micro-climatic point of view.

Study of the effect on T. terrestris.

Screened bacterial isolates as noted above were tested under winter conditions, with or without inoculation of L. laccata, to determine their effect on infection of seeds by T. terrestris.

The results obtained at eighteen weeks are shown in figure 3. In this figure, the hatched part corresponds to the control without the bacteria of the invention and the black part corresponds to the deficiency of mycorrhizas resulting from the bacterial effect.

The isolates tested are those of the previous example i.e. Al to A15 and BI to BIO.

A significant diminution of mycorrhization rate by T. terrestris is noted in each, the inhibition being total with B2 and B9.

- The results of the greenhouse experiments on a peat/vermiculite mixture with A2, B5, B8 and A15 are shown in figure 4.

The legends are the same as for figure 3. A strong diminution of mycorrhization by T. terrestris is also observed due to the effect of the application of the bacteria according to the invention. b) Experiments on nursery soil: The results of greenhouse experiments on nursery soil are shown in figure 5.

This figure indicates the rate of mycorrhization (in %) by T. terrestris in five treatments effected respectively on the following types of soil: disinfected (Dis) disinfected and treated by L. laccata (Dis + L.l) not disinfected (N Dis), not disinfected and treated with L. laccata (N Dis + L.l). - treated with an isolate such as one obtained from the outcome of screening, namely Bl, B2, B3, B5, Al, A2 and A10.

The results are given for the following situations, after 12 weeks of treatment (open part), at 16 weeks (hatched part) and at 21 weeks (dotted part).

The results confirm the efficacy of the bacteria according to the invention on the inhibition of development of T. terrestris. c) In vitro experiments on L. laccata·.

The results for the bacterial isolates B5 and B8, A2, A4, A8, B6 and A15, selected from those giving rise to the greatest stimulation of mycorrhizal infection in the summer greenhouse experiment are reported.

The three components of the system (bacterium, fungus, plant) are brought into contact under aseptic conditions in glass test tubes (3 x 15 cm) filled with a vermiculite-peat mixture (1/1; vol/vol) treated in an autoclave (120°C, 20 min.), humidified with the nutritive solution used in the greenhouse and mixed with fungal inoculum 1:10 (vokvol). o ml of concentrated bacterial suspension (greater than 10° cells/ml) in 0.1 M sterile MgSO4.7 H2O is injected into each tube with the aid of a syringe. Only the buffer solution is used in the control treatment. The tubes are covered with aluminium foil and autoclaved. A small root of an aseptically germinated seed is introduced through a hole in the foil. After having been sealed to the level of the neck with a seal, the tubes are placed in a growing chamber.

Thus the roots are maintained in axenic conditions, whereas the aerial part of the plant is allowed to develop freely outside of the tube.

The plants are left to grow for four weeks in a room having a controlled climate (23°C in daytime, 17°C at night, photoperiod of 16 hours with 400 gE.m'^S'^, 80% humidity). The determination of mycorrhization rate, carried out as in the previous experiments, shows in each case a great improvement relative to the control.

These results obtained axenically prove without doubt that the effect of stimulation of mycorrhizal infection is due to the introduced strain.

Example 3 : effects of bacteria of the invention on the 10 mycorrhization of Douglas fir by different ectomycorrhizal fungi in the nursery.

Different ectomycorrhizal fungi were used in this experiment: Laccaria laccata S238 (positive control), Laccaria bicolor D-101 (positive control), Hebeloma cylindrosporum D-15, Laccaria proximo 415 and Paxillus involutus QBC.

The fungal inoculum was prepared by using the technique indicated above in example 1.

Bacterial isolates B5 and B8 were cultivated for 8 days with agitation in 300 ml Erlenmeyer tubes containing 100 ml of 0.3% TSB medium in a culture chamber (25°C, in the dark). These suspensions were then centrifuged (2,400 g, 10 min.), the supernatant was discarded and the bacterial cells were resuspended in 100 ml of 0.1 M magnesium sulphate. This bacterial suspension was then diluted in 7.5 litres of demineralised water. The final suspension contained about 1012 bacterial cells. For the control treatment (without bacteria), 100 ml of 0.1M MgSCU were diluted in 7.5 litres of water.

The fungal inoculation was carried out at a rate of 2 litres of inoculum per m2. A non-inoculating treatment was carried out.

The bacteria diluted in water were inoculated with the aid of a watering can at a rate of 2.5 litres per tray (1012 cfu. m‘2).

These two applications having been carried out, the two inocula were mixed with soil to a depth of about 10 cm.

After 4 months of culture, 10 seedlings were removed at random from each tray. The mycorrhization rate (number of short mycorrhizal roots/number of total short roots) was determined in a sample of 100 short roots.

The results obtained show the effect of the stimulation of 10 mycorrhization by L. laccata and L. bicolor exerted by B5 and B8 in the nursery. These results are confirmed in axenic conditions.

Example 4 : effects of bacteria of the invention on L laccata mycorrhizas with pedunculate oak (sequential inoculation).

The following is a report of experiments carried out in two 15 nurseries situated in different locations with the bacterial strains B2 and B8 of example 1.

Seeds of pedunculate oaks (Quercus robur L) obtained from acorns collected in autumn are used, which are soaked in water at 41 °C for two hours (to prevent cotyledon necrosis provoked by Ciboria batschiana, powdered with 1 gram per kilo of iprodione (against Penicillium species) and other conservation moulds) and maintained at 4°C.

L. lacatta is mixed into peat beds in the nursery at a dosage of 1.1 litres of inoculum/m2, then the acorns are sown.

The strain of L. lacatta is that used in the other examples carried out on Douglas fir.

The seeds are caused to grow under a large polyethylene tunnel (6 x 42 m) in a bed of peat 20 cm in thickness, watered with a mist system. The same peat in the same tunnel had previously been used for the growth of oaks or beech alternatively, so as to avoid the appearance of root diseases such as Pythium ultimum.

The bacteria are inoculated using a suspension thereof in 0.1 M MgSO4.

The growth of bacteria is carried out for a week in 500 ml of a TSB medium (Tryptic Soya Broth) on a shaking table at 25°C.

The cultures which are then in a stationary phase are centrifuged in 300 ml tubes at 2400 g for 15 minutes and the plug resuspended in 600 ml of 0.1 M MgSO4.

In the nursery, 200 ml of this suspension are diluted in 10 litres of water and applied to the soil, the control treatment being carried out with the same quantity of magnesium sulphate.

An improvement in the rate of mycorrhization from 30 to 53% is observed. These results providing evidence that the stimulation by the bacteria of the invention on the formation of mycorrhizas by fungi holds good in a large range of conditions. These effects are observed whether in in vitro axenic synthesis, in the greenhouse on seeds in containers or in nurseries. Furthermore, these results show that the effects of the bacteria according to the invention hold true for plant hosts belonging to very different taxonomic groups.

Example 5 : effect of the inoculation of Douglas fir with L. laccata in conjunction with bacteria according to the invention (mixed inoculation).

There is reported hereinafter experiments carried out in forestry nurseries.

Bacteria: five bacterial strains obtained according to example 1 are used, namely: A2 (Bacillus subtilis) B6 (Pseudomonas sp.) B8 (Pseudomonasfluorescens) B5 (Pseudomonas sp.) A15 (Bacillus sp.) These strains are cultivated for 8 days at 25°C in glass flasks containing liquid TSB medium at a concentration of 3 g/1. Concentrated bacterial suspensions (greater than 1010 cells/ml) are centrifuged (2,400 g, 10 min) the supernatant is eliminated and the plug resulting from centrifugation is resuspended in 200 ml of 0.1 M MgSCM or in 500 ml of sterile water (in the case of an alginate inoculum).

Concentrations are determined by measuring the absorbance (a = 520 nm) of the suspensions, correlations between absorbance and the concentration of living cells having been previously established.

Preparation of alginate inoculum with mycelium and bacteria.

The mycelium of mixed Laccaria laccata and the bacteria are suspended in a solution of sodium alginate (10 g/litre) containing milled peat (50 g/litre). Small 4 mm beads of mycelium and bacteria are obtained by adding the suspension dropwise into calcium chloride (100 g/D.

Experiments in nurseries at two different locations : Experiment A The nursery soil is disinfected with cold methyl bromide.

The Laccaria laccata is inoculated at a rate of 2 litres of inoculum per m2 of peat-vermiculite. Five bacterial treatments are carried out with each of the above bacteria, inoculated at three different doses: 105, 107 and 109 cfu per m2 for B6 and 106, 108 and IO10 cfu per m2 for the other four.

Five litres (200 ml of bacterial suspension in 0.1 M MgSCU and 4.8 litres of water) of bacterial inoculum are applied with a watering can on the surface of each of the treated patches, after mixing the solid fungal inoculum in the 10 upper centimetres of soil. The solution for the control treatment contains 200 ml of 0.1 M MgSO4 and 4.8 litres of water. No watering was carried out during the growth season, which was particularly dry· The rate of mycorrhization was evaluated as indicated above. The dry weight of the young shoots and roots was also determined.

After four months, a rate of mycorrhization in the control of 60% was observed. It is noted that the bacterial treatments with A2, A15 and B8 significantly improve the establishment of ectomycorhizal symbiosis. The rates of mycorrhization with the bacteria are respectively 88%, 85% and 83%.

In each case an improvement in the biomass is noted.

Experiment B An empty plot of an experimental nursery was filled with soil collected from a depth of 0 to 20 cm in the aforementioned experimental nursery.

The soil was disinfected as described above. The plot of land was divided into patches, separated from each other by non-inoculated and non-seeded zones. The patches were inoculated wth L. laccata (1 litre of alginate beads per m2, containing the fungus and the bacteria).

An inoculation treatment was carried out: grams (dry weight) per m2 and 10*2 bacteria cfu per m2. Three bacterial treatments were carried out (A 15, A2 and B5). The alginate beads in the controls were without bacteria. The culture was maintained well-watered throughout the growing season.

After 3 and 5 months of culture, the rates of mycorrhization in the controls are respectively 26% and 83%.

After 3 months, the three bacterial isolates significantly improve mycorrhizal infection, the rate of mycorrhization going from 68% to 82%. At the fifth month, a similar effect is noted with the rate of mycorrhization going from 97% to 99%.

The biomass equally appeared to improve when the bacteria of the invention encapsulated with L. laccata are applied.

After 3 months of culture, the mean biomasse above the soil is 15 significantly increased in the case of treatment with B5 (108 mg per seed bed) relative to the control (62 mg per seed bed).

After 5 months of culture, the dry matter of the young shoots and roots in the control is 320 mg and 115 mg per sowing, respectively. The three bacterial treatments significantly increase the growth of the seeds: weight of young shoots from 493 to 546 mg per sowing and weight of roots from 174 to 201 mg per sowing.

In the two nurseries it is observed that the growth of the aerial parts of the plants correlates directly with the speed of mycorrhizal infection of their root system.

Experiments carried out by using alginate beads containing the bacteria and the fungus, by supplying different quantities of inoculum to the soil, show that the rates of mycorrhization obtained are practically identical whatever the amount of inoculum supplied. Therefore, by availing of the action of the bacteria of the invention one will be able to reduce to advantage the quantity of the inoculating fungus.

Generally, the results obtained with the bacterial strains of the invention show that they act in a specific manner on fungal symbionts and stimulate by this action the mycorrhization of the plant host.

This phenomenon of specificity was found again in the level of the effect of the bacteria by the gaseous and aqueous routes on saprophytic growth of the different fungal symbionts. Thus, experiments carried out have shown that citric acid produced by a bacterium intervenes in the stimulation of growth of a given ectomycorrhizal fungus.

These bacteria are particularly useful in the techniques of controlled mycorrhization in the forestry nursery on disinfected soils as well as in an advantageous manner on non-disinfected soil, which enables one to avoid the use of disinfectants such as methyl bromide.

Claims

1/ Bacterial strains, characterised in that they are capable of specifically stimulating the formation of mycorrhizas by inoculated mycorrhizal fungi, said strains exerting an antagonist effect vis a vis 5 contaminating fungi, competitors of the inoculating fungus.

2. / Strains according to claim 1, characterised in that they are capable of significantly increasing the rate of mycorrhization by the inoculating fungus by at least about 10% relative to the system without the benefit of bacteria and of inhibiting the development of all 10 competing fungi, such that the rate of mycorrhizal roots formed by such fungi is significantly reduced to a value of less than about 10%.

3. / Strains according to claim 1 or 2, characterised in that they are Gram positive bacteria of the genus Bacillus, such as B. subtilis.

4. / Strains according to claim 1 or 2, characterised in that they 15 are Gram negative bacteria of the genus Peudomonas, such as P. fluorcscens.

5. / Bacterial strains deposited at the C.N.C.M. on June 11, 1991, under the number 1-1112 (Bacillus subtilis strain), 1-1113 (Bacillus sp. strain), 1-1114 (Pseudomonas sp. strain) and 1-1115 20 (Pseudomonas fluorcscens strain).

6. / Strains according to any one of the preceding claims, characterised in that they are obtained from the rhizosphere of forestry trees.

7. / Strains according to any one of the preceding claims, 25 characterised in that they are obtained from the mantle of mycorrhizas and the carpophors of ectomychorizal fungi.

8. / Strains according to one of claims 6 or 7, characterised in that they are obtained from the rhizosphere of forestry varieties with ectomycorhizae of confers such as Douglas fir, spruce, pines, larch, tsugas or leafy species such as oaks, beech and eucalyptus.

9. / Strains according to any one of the preceding claims, characterised in that they are auxiliaries of mycorrhization of 5 ectomycorrhizal fungi of forestry varieties, such as L. laccata, Hebeloma sp, Paxillus involutus, Rhizopogon sp., Suillus sp. and Sclerodorma sp. selected for their symbiotic effectiveness and which one desires to introduce by inoculation.

10. / Strains according to any one of the preceding claims, 10 characterised in that they exert an antagonistic effect relative to T. terrestris or undesirable strains of Rhizopogon sp., Suillus sp. and Sclerodorma sp.

11. / Bacterial strains, characterised in that they are obtained by: suspending carpophors and mantles of mycorrhizas taken 15 from Laccaria laccata in symbiosis with Douglas fir, culture in an appropriate medium, such as TSA, according to standard techniques, addition to an inoculum of L. laccata, seeding with seeds of Douglas, 20 - selection in vitro, in the greenhouse or in the nursery, of bacterial isolates capable of giving rise to a rate of mycorrhization of at least about 80% by the introduced fungus and practically totally inhibiting the formation of mycorrhizas by competing fungi such as T. terrestris. 25

12. / Process for obtaining bacterial strains according to claim 1, characterised in that it comprises suspending carpophores and mycorrhizal mantles taken from mycorrhizal fungi associated with plant hosts, serial dilution of these suspensions and the application thereof on a medium suitable for the growth thereof, 5 - the selection of isolates capable of giving rise to a rate of mycorrhization, on a mycorrhizal fungus inoculated in a plant host, which is significantly enhanced by about 10% relative to the system without the benefit of bacteria and of practically totally inhibiting the establishment of competing fungi, competitors of the inoculating fungus. 10

13. / Process for the controlled mycorrhization of plants, characterised in that it comprises the use of an effective quantity of a strain according to any one of claims 1 to 11.

14. / Process according to claim 13, characterised in that it is carried out on varieties of forestry trees with ectomycorhizae such as

15. Conifers, including Douglas fir, spruce, pines, larches, and tsugas or leafy species such as oaks, beech and eucalyptus. 15/ Compositions for use in the controlled mycorrhization of plants, characterised in that they comprise a bacterial strain according to any one of claims 1 to 11, in association with an inert vehicle, 20 preferably in the form of a suspension, advantageously including from 10 7 to 10 12 , preferably 10 8 to 10 10 , bacteria/1 and containing necessary preserving adjuvants such as MgSO4, polyethylene glycol or glycerol, or in the form of a mixed inoculum with the fungus, the strain being present at a rate of 10 6 to 10 9 bacteria per/g of dry weight of 25 mycelium.

16. / Composition according to claim 15, characterised in that it comprises L. laccata associated with bacteria according to any one of claims 1 to 11, in particular with bacteria according to claim 5.

17. / Method for the application of bacterial strains according to any one of claims 1 to 11, characterised in that it comprises: the spreading of a bacterial inoculum before or after seeding, or 5 - the bacterial treatment of seeds, in combination with any mycorrhizal inoculation technique, or the addition of bacteria to the mycelial inoculum at the time of preparation thereof.

18. / Bacterial strains according to Claim 1, substantially as 10 hereinbefore described.

19. / A process according to Claim 12 for obtaining bacterial strains, substantially as hereinbefore described and exemplified.

20. / A process according to Claim 13 for the controlled mycorrhization of plants, substantially as hereinbefore described and 15 exemplified.

21. / A composition according to Claim 15 for use in the controlled mycorrhization of plants, substantially as hereinbefore described.

22. / A method according to Claim 17, substantially as 20 hereinbefore described.