IE920424A1 - Method of inhibiting replication of hiv in macrophages - Google Patents

Abstract

A fusion protein comprising GM-CSF and IL-3 inhibits replicatio n of HIV in monocytes and macrophages, as measured by significant reduction in p24 antigen levels and by the elimination of mult inucleated giant cells associated with replication of HIV.

Description

The present invention relates to therapeutic uses of fusion proteins comprising GM-CSF and IL-3, and, in particular, the use of such fusion proteins to inhibit replication of HIV in macrophages.

A principal target of human immunodeficiency virus (HIV) is the mononuclear phagocyte system, which includes both monocytes and tissue macrophages. HIV is known to infect mononuclear phagocytes from blood, bone marrow, brain and lung. The mononuclear phagocyte system plays an important role in immunological and inflammatory responses to virus, bacteria, yeast and protozoa infections. Although the importance of monocytes and macrophages in the pathology of the acquired immunodeficiency syndrome has not yet been fully elucidated, these relatively longlived cells are known to serve as viral reservoirs and are believed to be involved in the immune dysfunction and senile dementia which accompanies HIV-1 infection.

Mononuclear phagocytes have surface receptors for cytokines that regulate their hematopoietic and immunologic function. The differentiation, proliferation and immunologic function of mononuclear phagocytes is regulated by secreted glycoproteins collectively known as colony-stimulating factors (CSFs). In humans, these proteins include granulocyte-macrophage CSF (GM-CSF), which promotes granulocyte and macrophage production from normal bone marrow, and which also appears to regulate the activity of mature, differentiated granulocytes and macrophages. IL-3 (also known as multi-CSF) also stimulates formation of a broad range of hematopoietic cells, including granulocytes, macrophages, eosinophils, mast cells, megakaryocytes and erythroid cells. GM-CSF and IL-3 thus have considerable overlap in their broad range of biological activities. Macrophage CSF (M-CSF or CSF-1) stimulates almost exclusively macrophage colony formation. Although GM-CSF and IL-3 have distinct amino acid sequences, preclinical studies indicate that they may both be useful to treat various cytopenias, and to potentiate immune responsiveness to certain infectious pathogens, and to assist in reconstituting normal blood cell populations following viral infection or radiation or chemotherapy-induced hematopoietic cell suppression. The genes encoding GM-CSF and IL-3 are located on the same chromosome in mouse and in man and the expression of the genes is linked in some cells, such as activated T lymphocytes (Kelso et al., J. Immunol. 136311%, 1986; Yang et al., Blood 71:95%, 1988; Barlow et al., EMBO J. 6:617, 1987).

GM-CSF has been shown to activate monocytes and macrophages to inhibit 5 intracellular replication of some pathogens, such as viruses, bacteria, yeast and protozoa (see, e.g., Broxmeyer and Williams, CRC Crit. Rev. Hematol. Oncol 8313, 1988). Because HIV infects monocytes and macrophages, however, it is believed that use of GM-CSF and IL-3 to promote proliferation of monocytes and macrophages may have the potential to also cause increased HIV production. Indeed, recent in vitro studies have indicated that CSF-1, IL-3 and GM-CSF may enhance HIV infection of macrophages (Meltzer et al., Immunology Today 77:217, 1990; Pluda et al., Blood 76:463, 1990; Koyanagi etal., Science 2413613, 1988).

The present invention provides a novel method for inhibiting replication of HIV in macrophages.

SUMMARY OF THE INVENTION The present invention relates to a method for inhibiting replication of HIV in macrophages comprising the step of contacting the macrophages with an effective amount of a fusion protein comprising GM-CSF and IL-3 (for example, pIXY 321 and pIXY 344). The present invention also relates to methods of inhibiting replication of HIV in macrophages, methods of inhibiting immune dysfunction and methods of inhibiting progression of senile dementia associated with an HIV-infected mammal comprising the step of administering to a mammal an effective amount of a fusion protein comprising GM-CSF and IL-3.

The fusion proteins comprising GM-CSF and IL-3 inhibit HIV infection in macrophages. This is in contrast to GM-CSF and IL-3 which, individually or in combination, are ineffective in inhibiting or may actually promote HIV infection in macrophages. The fusion proteins comprising GM-CSF and IL-3 disclosed herein thus have unique biological activities on HIV infected macrophages which are distinct from the biological activities of their individual component proteins GM-CSF or IL-3.

BRIEE DESCRIPTION OF THE DRAWINGS Figure 1 is a nucleotide sequence and corresponding amino acid sequence of a human GM-CSF/IL-3 fusion protein pIXY 321. The C-terminus of human GM-CSF (amino acids 1-127) is linked to the N-terminus of human IL-3 (amino acids 139-271) via a linker sequence (amino acids 128-138).

Figure 2 is a nucleotide sequence and corresponding amino acid sequence of a human IL-3/GM-CSF fusion protein pIXY 344. The C-terminus of human IL-3 (amino acids 1-133) is linked to the N-terminus of human GM-CSF (amino acids 149275 via a linker sequence (amino acids 134-148).

Figure 3 is a photograph of a multi-nucleated giant cell, which is the characteristic cytopathic result of HIV-1 infection of macrophages. This multinucleated giant cell is shown at high power 14 days after infection of the macrophages and was cultured in control medium only.

Figure 4 is a photograph of the same experimental group of cells shown in Figure 4A, shown at low power and shows the comparatively large size of the multinucleated giant cell relative to the smaller sized macrophages.

Figure 5 is a photograph of HIV-1 infected macrophages treated continuously after infection with 100 ng/ml of GM-CSF and IL-3. No apparent difference can be seen between these macrophages and those of the control group shown in Figure 4.

Figure 6 is a photograph of HIV-1 infected macrophages treated 14 days after infection with 100 ng/ml of the GM-CSF/IL-3 fusion protein pIXY 321. No multinucleated giant cells can be seen, indicating that pIXY 321 inhibited the appearance of pathological, infected macrophages.

Figure 7 is a graph illustrating the effect of treatment of cultures during the post20 infection period with either medium only (no treatment), pIXY 321 (100 ng/ml) or GMCSF and IL-3 (100 ng/ml each) on supernatant levels of p24. Treatment with GM-CSF and DL-3 is not significantly different from the medium only control, whereas treatment with pIXY 321 shows a significant reduction in p24 levels. Because the presence in supernatants of p24 correlates with HIV replication, these data indicate that pIXY 321 inhibits replication of HIV in macrophages.

Figure 8 is a graph comparing the effect of pre-infection treatment of macrophages for 24 hours with 100 ng/ml pIXY 321 versus post-infection treatment for 9 days on supernatant levels of p24. Pretreatment of HIV-1 infected macrophages with pIXY 321 does not appear to have any effect on p24 levels, whereas post30 infection treatment results in a significant decrease in p24 levels.

DETAILED DESCRIPTION QF THE INVENTION Definitions The term GM-CSF refers to proteins having amino acid sequences which are substantially similar to the native human granulocyte-macrophage colony-stimulating factor amino acid sequences (e.g., ATCC 53157) and which are biologically active in that they are capable of binding to GM-CSF receptors, transducing a biological signal initiated by binding GM-CSF receptors, or cross-reacting with anti-GM-CSF antibodies raised against GM-CSF. Such sequences are disclosed, for example, in Anderson et al. (Proc. Nat'l. Acad. Sci. USA 52:6250, 1985). The term GM-CSF also includes analogs of GM-CSF molecules which exhibit at least some biological activity in common with native human GM-CSF. Exemplary analogs of GM-CSF are disclosed in EP 0212914, which describes GM-CSF analogs having KEX2 protease cleavage sites inactivated so as to increase expression of GM-CSF in yeast hosts, and in WO 89/03881, which describes GM-CSF analogs having various glycosylation sites eliminated. Other GM-CSF analogs which are described herein may also be used to construct fusion proteins with IL-3. Furthermore, those skilled in the art of mutagenesis will appreciate that other analogs, as yet undisclosed or undiscovered, may be used to construct GM-CSF/IL-3 fusion proteins as described herein. A DNA sequence encoding a particularly preferred GM-CSF protein having potential glycosylation sites removed has been deposited with the American Type Culture Collection under accession number ATCC 67231 (GM-CSF[Leu23Asp27Glu39]). The nomenclature used herein to specify amino acid sequences designates amino acids that differ from the native form in brackets immediately following the protein name and designates the species with which the protein is associated immediately preceding the protein name. Thus, huGM-CSF[Leu23Asp27Glu29] refers to a human GM-CSF in which amino acid 23 has been changed to a leucine residue, amino acid 27 has been changed to an asparagine residue, and amino acid 29 has been changed to glutamic acid residue.

The term IL-3 refers to proteins having amino acid sequences which are substantially similar to the native human Interleukin-3 amino acid sequences and which are biologically active in that they are capable of binding to IL-3 receptors or transducing a biological signal initiated by binding to IL-3 receptors, or cross-reacting with anti-IL-3 antibodies raised against IL-3. Such sequences are disclosed, for example, in EP 275598 and EP 0282185. The term IL-3 also includes analogs of IL30 3 molecules which exhibit at least some biological activity in common with native IL-3.

Exemplary analogs of IL-3 are also disclosed in EP 0282185. Particularly preferred forms of IL-3 which may be fused to GM-CSF in accordance with the present invention include huIL-3[Pro8Asp15Asp70], huIL-3[Ser8Asp15Asp70], and huILSfSer8 ]. A DNA sequence encoding another IL-3 protein suitable for incorporation into fusion proteins as described herein is on deposit with ATCC under accession number ATCC 67747.

Fusion protein refers to a C-terminal to N-terminal fusion of GM-CSF and IL-3. The fusion proteins of the present invention include constructs in which the Cterminal portion of GM-CSF is fused to the N-terminal portion of IL-3, and also constructs in which the C-terminal portion of IL-3 is fused to the N-terminal portion of GM-CSF. Specifically, the fusion proteins of the present invention have a formula selected from the group consisting of R1-R2, R2-R1, R1-L-R2 and R2-L-R1 wherein R; is GM-CSF; R2 is IL-3; and L is a linker peptide sequence. GM-CSF is linked to IL-3 in such a manner as to produce a single protein which retains the biological activity of GM-CSF and IL-3. Specific fusion protein constructs are named by listing the GM-CSF and IL-3 domains in the fusion protein in their order of occurrence (with the N terminal domain specified first, followed by the C-terminal domain). Thus, GM-CSF/IL-3 refers to a fusion protein comprising GM-CSF followed by IL-3 (i.e., the C-terminus of GM-CSF is linked to the N-terminus of IL3). Unless otherwise specified, the terms GM-CSF/IL-3 and IL-3/GM-CSF refer to fusion proteins with a linker sequence added. Similarly, huGMCSF[Leu23Asp27Glu^9]/huIL-3[Pro8Asp1^Asp'?0] refers to a fusion protein in which the N-terminal region of the fusion construct is huGM-CSF[Leu23Asp27Glu39], and the C-terminal region is huIL-3[Pro8Asp15Asp70].

Equivalent amino acid or nucleic acid sequences include those which vary from the sequence of Figures 1 or 2 by one or more substitutions, deletions, or additions, the net effect of which is to retain biological activity of the protein when derived as a GM25 CSF/IL-3 or IL-3/GM-CSF fusion protein. Alternatively, DNA analog sequences are substantially identical to the specific DNA sequences disclosed herein if: (a) the DNA analog sequence is derived from substantially the entire coding regions of the native mammalian GM-CSF and IL-3 genes; or (b) the DNA analog sequence is comparable in length with and capable of hybridization to DNA sequences of (a) under moderately stringent conditions and which encode biologically active GM-CSF or IL-3 molecules; or (c) DNA sequences which are degenerate as a result of the genetic code to the DNA analog sequences defined in (a) or (b) and which encode biologically active GM-CSF or IL-3 molecules.

Biologically active, as used throughout the specification means that a particular molecule shares sufficient amino acid sequence similarity with the embodiments of the present invention disclosed herein to be capable of binding to GMCSF receptor, IL-3 receptor or GM-CSF/IL-3 receptor (see, e.g., Park et al., J. Biol.

Chem. 264:5420, 1989), transmitting a GM-CSF and/or IL-3 stimulus to a cell, or cross-reacting with antibodies raised against GM-CSF or IL-3.

The term macrophage means mononuclear phagocytic cells derived from monocytes, which are blood-born leucocyte precursors to macrophages. HIV can infect both monocytes and macrophages. HIV-infected monocytes can migrate to tissues in the reticuloendothelial system and differentiate into macrophages. The methods of the present invention are thus equally applicable to macrophages and monocytes. As used herein, the term macrophage shall be understood to include macrophage precursors, such as monocytes.

Construction of cDNA Sequences Encoding Fusion Proteins Comprising GM-CSF and IL-3 A DNA sequence encoding a fusion protein is constructed using recombinant DNA techniques to assemble separate DNA fragments encoding GM-CSF and IL-3 into an appropriate expression vector. The 3' end of a DNA fragment encoding GM-CSF is ligated to the 5' end of the DNA fragment encoding IL-3, with the reading frames of the sequences in phase to permit mRNA translation of the sequences into a single biologically active fusion protein. The resulting protein is huGMCSF[Leu23Asp27Glu39]/huEL-3[Pro8Asp15Asp70]. Alternatively, the 3' end of a DNA fragment encoding IL-3 may be ligated to the 5' end of the DNA fragment encoding GM-CSF, with the reading frames of the sequences in phase to permit mRNA translation of the sequences into a single biologically active fusion protein, yielding the protein huIL-3[Pro8Asp15Asp70]/huGM-CSF[Leu23Asp27Glu39]. The regulatory elements responsible for transcription of DNA into mRNA are retained on the first of the two DNA sequences, while binding signals or stop codons, which would prevent read-through to the second DNA sequence, are eliminated. Conversely, regulatory elements are removed from the second DNA sequence while stop codons required to end translation are retained. Exemplary sequences for fusion proteins comprising GMCSF and IL-3 are shown in Figures 1 and 2.

In preferred aspects of the present invention, means are provided for linking the GM-CSF and IL-3 domains, preferably via a linker sequence. The linker sequence separates GM-CSF and IL-3 domains by a distance sufficient to ensure that each domain properly folds into its secondary and tertiary structures. Suitable linker sequences (1) will adopt a flexible extended conformation, (2) will not exhibit a propensity for developing an ordered secondary structure which could interact with the functional GM-CSF and IL-3 domains, and (3) will have minimal hydrophobic or charged character which could promote interaction with the functional protein domains. Typical surface amino acids in flexible protein regions include Gly, Asn and Ser. Virtually any permutation of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence. Other near neutral amino acids, such as Thr and Ala, may also be used in the linker sequence.

The length of the linker sequence may vary without significantly affecting the biological activity of the fusion protein. For example, the GM-CSF and IL-3 proteins may be directly fused without a linker sequence. Linker sequences are unnecessary where the proteins being fused have non-essential N- or C-terminal amino acid regions which can be used to separate the functional domains and prevent steric interference. In one preferred embodiment of the present invention, the C-terminus of GM-CSF may be directly fused to the N-terminus of IL-3. GM-CSF has six amino acids following the C-terminal cysteine residue, which is involved in disulfide bonding and is essential for proper folding of the protein. IL-3 has 15 amino acids preceding its N-terminal cysteine residue. The combined terminal regions thus may provide sufficient separation to render the use of a linker sequence unnecessary.

Generally, the two protein domains will be separated by a distance approximately equal to the small unit dimension of GM-CSF or IL-3 (i.e., approximately 0.38 nm, as determined by analogy with similar four-helix hormones).

In a preferred aspect of the invention, a linker sequence length of about 11 amino acids is used to provide a suitable separation of functional protein domains, although longer linker sequences may also be used. The length of the linker sequence separating GMCSF and IL-3 is from 1 to 500 amino acids in length, or more preferably from 1 to 100 amino acids in length. In the most preferred aspects of the present invention, the linker sequence is from about 1-20 amino acids in length. In the specific embodiments disclosed herein, the linker sequence is from about 5 to about 15 amino acids, and is advantageously from about 10 to about 15 amino acids. Amino acid sequences useful as linkers of GM-CSF and IL-3 include, by way of example, (Gly4Ser)3 and Gly4SerGly5Ser.

The linker sequence is incorporated into the fusion protein construct by well known standard methods of mutagenesis as described below.

Equivalent Fusion Protein Analogs Comprising GM-CSF and IL-3 The methods of the present invention utilize a fusion protein comprising human GM-CSF and human IL-3. Derivatives of such fusion proteins also include various structural forms of the primary protein which retain biological activity. Due to the presence of ionizable amino and carboxyl groups, for example, a fusion protein may be in the form of acidic or basic salts, or may be in neutral form. Individual amino acid residues may also be modified by oxidation or reduction.

The primary amino acid structure of fusion proteins may be modified by 5 forming covalent or aggregative conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like, or by creating amino acid sequence mutants. Covalent derivatives are prepared by linking particular functional groups to amino acid side chains or at the N- or C-termini. Other derivatives of the fusion protein within the scope of this invention include covalent or aggregative conjugates of the fusion protein with other proteins or polypeptides, such as by synthesis in recombinant culture as N- or C-terminal fusions. For example, the conjugated peptide may be a signal (or leader) polypeptide sequence at the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function inside or outside of the cell membrane or wall (e.g., the yeast a-factor leader). Peptides may also be added to facilitate purification or identification of GM-CSF/IL-3 fusion proteins (e.g., polyHis). The amino acid sequence of the fusion protein can also be linked to the peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., Bio/Technology 6:1204, 1988). The latter sequence is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody, enabling rapid assay and facile purification of expressed recombinant protein. This sequence is also specifically cleaved by bovine mucosal enterokinase at the residue immediately following the AspLys pairing. Fusion proteins capped with this peptide may also be resistant to intracellular degradation in E. coli.

Fusion protein derivatives may also be used as immunogens, reagents in receptor-based immunoassays, or as binding agents for affinity purification procedures of binding ligands. Derivatives may also be obtained by cross-linking agents, such as M-maleimidobenzoyl succinimide ester and N-hydroxysuccinimide, at cysteine and lysine residues. Fusion proteins may also be covalently bound through reactive side groups to various insoluble substrates, such as cyanogen bromide-activated, bisoxirane-activated, carbonyldiimidazole-activated or tosyl-activated agarose structures, or by adsorbing to polyolefin surfaces (with or without glutaraldehyde cross-linking).

The methods of the present invention may also utilize proteins with or without associated native-pattern glycosylation. Expression of DNAs encoding the fusion proteins in bacteria such as E. coli provides non-glycosylated molecules. Functional mutant analogs having inactivated N-glycosylation sites can be produced by oligonucleotide synthesis and ligation or by site-specific mutagenesis techniques. These analog proteins can be produced in a homogeneous, reduced-carbohydrate form in good yield using yeast expression systems. N-glycosylation sites in eukaryotic proteins are characterized by the amino acid triplet Asn-Aj-Z, where Aj is any amino acid except Pro, and Z is Ser or Thr. In this sequence, asparagine provides a side chain amino group for covalent attachment of carbohydrate. Such a site can be eliminated by substituting another amino acid for Asn or for residue Z, deleting Asn or Z, or inserting a non-Z amino acid between Aj and Z, or an amino acid other than Asn between Asn and Aj. Examples of human GM-CSF analogs in which glycosylation sites have been removed include huGM-CSF[Leu23Asp27Glu39], huGM-CSF[Leu23], huGMCSF[Leu23Asp27], huGM-CSF[Glu39], huGM-CSF[Asp27Glu39], huGMCSFfLeu^Glu39] and huGM-CSF[Asp27]. Examples of human IL-3 analogs in which glycosylation sites have been removed include huIL-3[Pro8Asp15Asp70], huIL15 3[Asp70], huIL-3[Asp15Asp70], huIL-3[Pro8Asp15], huIL-3[Pro8Asp70], and huIL3[Asp15].

Derivatives and analog fusion proteins may also be obtained by mutations of the fusion proteins expressly disclosed herein. A derivative or analog, as referred to herein, is a polypeptide in which the GM-CSF and IL-3 domains are substantially homologous to full-length GM-CSF and IL-3 domains of the sequences disclosed in Figures 1 and 2 but which has an amino acid sequence difference attributable to a deletion, insertion or substitution.

Bioequivalent analogs of fusion proteins may be constructed by, for example, making various substitutions of residues or sequences. For example, cysteine residues can be deleted or replaced with other amino acids to prevent formation of incorrect intramolecular disulfide bridges upon renaturation. Other approaches to mutagenesis involve modification of adjacent dibasic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present. Generally, substitutions should be made conservatively; i.e., the most preferred substitute amino acids are those having physicochemical characteristics resembling those of the residue to be replaced. Similarly, when a deletion or insertion strategy is adopted, the potential effect of the deletion or insertion on biological activity should be considered.

Mutations in nucleotide sequences constructed for expression of analogs must, of course, preserve the reading frame phase of the coding sequences and preferably will not create complementary regions that could hybridize to produce secondary mRNA structures such as loops or hairpins which would adversely affect translation of the GM-CSF/IL-3 receptor mRNA. Although a mutation site may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select for optimum characteristics of mutants at a given site, random mutagenesis may be conducted at the target codon and the expressed mutants screened for the desired activity.

Not all mutations in nucleotide sequences which encode fusion proteins comprising GM-CSF and IL-3 will be expressed in the final product, for example, nucleotide substitutions may be made to enhance expression, primarily to avoid secondary structure loops in the transcribed mRNA (see EP 75.444A, incorporated herein by reference), or to provide codons that are more readily translated by the selected host, e.g., the well-known E. coli preference codons for E. coli expression.

Mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.

Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Exemplary methods of making the alterations set forth above are disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:13, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Patent Nos. 4,518,584 and 4,737,462, and are incorporated by reference herein.

Expression of Recombinant Fusion Proteins Comprising GM-CSF and IL-3 The methods of the present invention preferably utilize fusion proteins made using recombinant expression vectors which include synthetic or cDNA-derived DNA fragments encoding human fusion proteins comprising GM-CSF and IL-3 or bioequivalent analogs operably linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral or insect genes. Such regulatory elements include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation, as described in detail below. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated. DNA regions are operably linked when they are functionally related to each other. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.

Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous and in reading frame.

Due to code degeneracy, there can be considerable variation in nucleotide sequences encoding the same amino acid sequence; exemplary DNA embodiments are those corresponding to the nucleotide sequences shown in Figures 1 or 2. Other embodiments include sequences commensurate in length with and capable of hybridizing to the sequences of Figures 1 or 2 under moderately stringent conditions (50°C, 2 X SSC) and which encode biologically active fusion proteins.

Transformed host cells are cells which have been transformed or transfected with fusion protein vectors constructed using recombinant DNA techniques.

Transformed host cells ordinarily express the desired fusion protein, but host cells transformed for purposes of cloning or amplifying DNA do not need to express the protein. Expressed fusion protein will generally be secreted into the culture supernatant. Suitable host cells for expression of fusion protein include prokaryotes, yeast or higher eukaryotic cells under the control of appropriate promoters.

Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells include established cell lines of mammalian origin as described below. Cell-free translation systems could also be employed to produce fusion protein using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New York, 1985), the relevant disclosure of which is hereby incorporated by reference.

Recombinant fusion proteins are preferably expressed in yeast hosts, preferably from the Saccharomyces species, such as S. cerevisiae. Yeast of other genera such as Pichia or Kluyveromyces may also be employed. Yeast vectors will generally contain an origin of replication from the 2μ yeast plasmid or an autonomously replicating sequence (ARS), promoter, DNA encoding the fusion protein, sequences for polyadenylation and transcription termination and a selection gene. Preferably, yeast vectors will include an origin of replication and selectable marker permitting transformation of both yeast and E. coli, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae trpl gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, and a promoter derived from a highly expressed yeast gene to induce transcription of a structural sequence downstream. The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoter sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255:2073, 1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149, 1968; and Holland et al., Biochem. 17:4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-610 phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPA 73,657.

Preferred yeast vectors can be assembled using DNA sequences from pBR322 for selection and replication in E. coli (Ampr gene and origin of replication) and yeast DNA sequences including a glucose-repressible ADH2 promoter and α-factor secretion leader. The ADH2 promoter has been described by Russell et al. (/. Biol. Chem. 258:2614, 1982) and Beier et al. (Nature 300:124, 1982). The yeast α-factor leader, which directs secretion of heterologous proteins, can be inserted between the promoter and the structural gene to be expressed. See, e.g., Kurjan et al., Cell 30:933, 1982; and Bitter et al., Proc. Natl. Acad. Sci. USA 57:5330, 1984. The leader sequence may be modified to contain, near its 3' end, one or more useful restriction sites to facilitate fusion of the leader sequence to foreign genes.

Suitable yeast transformation protocols are known to those of skill in the art; an exemplary technique is described by Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929, 1978, selecting for Trp+ transformants in a selective medium consisting of 0.67% yeast nitrogen base, 0.5% casamino acids, 2% glucose, 10 pg/ml adenine and 20 pg/ml uracil.

Host strains transformed by vectors comprising the ADH2 promoter may be grown for expression in a rich medium consisting of 1 % yeast extract, 2% peptone, and 1% glucose supplemented with 80 pg/ml adenine and 80 pg/ml uracil. Derepression of the ADH2 promoter occurs upon exhaustion of medium glucose. Crude yeast supernatants are harvested by filtration and held at 4°C prior to further purification.

Various mammalian or insect cell culture systems can also be employed to express recombinant fusion proteins. Baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio/Technology 6:47 (1988). Examples of suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, described by Gluzman (Cell 23ΛΊ5, 1981), and other cell lines capable of expressing an appropriate vector including, for example, L cells, Cl27, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a poly-adenylation site, splice donor and acceptor sites, and transcriptional termination sequences.

The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites may be used to provide the other genetic elements required for expression of a heterologous DNA sequence. The early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature 273:113, 1978). Smaller or larger SV40 fragments may also be used, provided the approximately 250 bp sequence extending from the Hind III site toward the BgR site located in the viral origin of replication is included. Exemplary vectors can be constructed as disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280, 1983).

Particularly preferred eukaryotic vectors for expression of GM-CSF/IL-3 DNA include pIXY321 and pIXY344, both of which are yeast expression vectors derived from pBC102.K22 (ATCC 67,255) and contain DNA sequences from pBR322 for selection and replication in E. coli (Apr gene and origin of replication) and yeast, as described below in Examples 1 and 7.

Purification of Fusion Proteins Comprising GM-CSF and IL-3 Purified mammalian fusion proteins or analogs are prepared by culturing suitable host/vector systems to express the recombinant translation products of DNA encoding the fusion proteins disclosed herein, which are then purified from culture media or cell extracts.

For example, supernatants from systems which secrete recombinant protein into culture media can be first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable purification matrix. For example, a suitable affinity matrix can comprise a GM-CSF or IL-3 receptor or lectin or antibody molecule bound to a suitable support. Alternatively, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups.

Sulfopropyl groups are preferred.

Finally, one or more re versed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify a fusion protein composition. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein.

Recombinant protein produced in bacterial culture is usually isolated by initial extraction from cell pellets, followed by one or more concentration, salting-out, aqueous ion exchange or size exclusion chromatography steps. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps. Microbial cells employed in expression of recombinant fusion proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.

Fermentation of yeast which express fusion proteins as a secreted protein greatly simplifies purification. Secreted recombinant protein resulting from a large25 scale fermentation can be purified by methods analogous to those disclosed by Urdal et al. (7. Chromatog. 296:Y1\, 1984). This reference describes two sequential, reversedphase HPLC steps for purification of recombinant murine GM-CSF on a preparative HPLC column.

Fusion protein synthesized in recombinant culture is characterized by the presence of non-human cell components, including proteins, in amounts and of a character which depend upon the purification steps taken to recover the fusion protein from the culture. These components ordinarily will be of yeast, prokaryotic or nonhuman higher eukaryotic origin and preferably are present in innocuous contaminant quantities, on the order of less than about 5 percent by scanning densitometry or chromatography. Further, recombinant cell culture enables the production of the fusion protein free of proteins which may be normally associated with GM-CSF or IL-3 as they are found in nature in their respective species of origin, e.g., in cells, cell exudates or body fluids.

Therapeutic Uses of Fusion Proteins Comprising GM-CSF and IL-3 5 The compositions containing fusion proteins comprising GM-CSF and IL-3, such as pIXY 321 and pIXY 344, may be used to inhibit HIV replication in macrophages. In particular, such fusion protein compositions may be used to inhibit HIV-induced immune dysfunctions in mammals, in particular humans, infected with HIV. HIV-induced immune dysfunctions are those dysfunctions caused by or dependent upon infection of T cells by HIV derived from macrophages or dependent upon infection of macrophages by HIV, for example, indications associated with acquired immune deficiency syndrome (AIDS) and AIDS related complex (ARC). Macrophages can be infected by HIV in the central nervous system and may be associated with the onset of senile dementia in AIDS patients. Accordingly, fusion proteins comprising GM-CSF and IL-3 may be used to inhibit HIV replication in macrophages in the central nervous system to inhibit progression of senile dementia associated with HIV infection of the central nervous system.

In addition to treating immune dysfunctions directly associated with HIVinfection, the fusion proteins comprising GM-CSF and IL-3 may also be used to treat secondary indications associated with traditional treatment of HIV infections. Patients with advanced HIV disease, for example, develop life-threatening cytopenias caused by suppression of blood cell production, opportunistic infections, neoplasms that directly involve the marrow cavity, toxicity of antiviral, antiinfective, and antineoplastic therapy. Since pIXY 321 has both the potential of an hematopoietic growth factor and also the ability to inhibit HIV replication in macrophages, one important clinical application of pIXY 321 will be the treatment of patients with AIDS requiring antineoplastic chemotherapy for AIDS associated malignancy.

Compositions containing fusion proteins comprising GM-CSF and IL-3 may be used in combination with other therapeutic compounds such as AZT or DDI which also effect HIV infection of T lymphocytes, and possibly monocytes/macrophages.

Fusion protein compositions comprising GM-CSF and IL-3 are prepared for administration by mixing the fusion protein having the desired degree of purity with physiologically acceptable carriers. Such carriers will be nontoxic to recipients at the dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the fusion protein with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about ten residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients.

To treat mammals having HIV-infected macrophages or HIV-induced immune dysfunctions, a therapeutically effective quantity of a fusion protein composition is administered to a mammal, preferably a human, in association with a pharmaceutical carrier or diluent. Compositions containing pIXY321 may be administered by direct intravenous administration, subcutaneous injection, or by intrathecal administration to provide adequate concentrations of this drug to infected macrophages in the central nervous system.

Based on established dosages of GM-CSF and IL-3 used in pre-clinical and human clinical studies, and on dosages of pIXY 321 used in primate pre-clinical studies, therapeutically effective quantities of fusion proteins comprising GM-CSF and IL-3 will be less than about 2000 pg/m2 body area of a patient, and preferably from about 250 pg/m2 to about 1000 pg/m2.

The following examples are offered by way of illustration, and not by way of limitation.

EXAMPLES Example 1 Synthesis of cDNAs Encoding GM-CSF/IL-3 Fusion Protein A. Isolation of cDNA encoding huIL-3. Peripheral blood lymphocytes were isolated from buffy coats prepared from whole blood (Portland Red Cross, Portland, Oregon, USA) by Ficoll hypaque density centrifugation. T cells were isolated by rosetting with 2-amino-ethylthiouronium bromide-treated sheep red blood cells. Cells were cultured in 175 cm2 flasks at 5 X 106 cells/ml for 18 hour in 100 ml RPMI, 10% fetal calf serum, 50 pM b-mercaptoethanol, 1% phytohemagglutinin (PHA) and 10 ng/ml phorbol 12-myristate 13-acetate (PMA). RNA was extracted by the guanidinium CsCl method and poly A+ RNA prepared by oligo-dT cellulose chromatography (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1982). cDNA was prepared from poly A+ RNA essentially as described by Gubler and Hoffman, Gene 25:263-269 (1983). The cDNA was rendered double-stranded using DNA polymerase I, blunt-ended with T4 DNA polymerase, methylated with EcoRI methylase to protect EcoRI cleavage sites within the cDNA, and ligated to EcoRI linkers. These constructs were digested with EcoRI to remove all but one copy of the linkers at each end of the cDNA, ligated to EcoRI-cut and dephosphorylated arms of phage XgtlO (Huynh et al., DNA Cloning: A Practical Approach, Glover, ed., IRL Press, pp. 49-78) and packaged into λ phage extracts (Stratagene, San Diego, CA, USA) according to the manufacturer's instructions. 500,000 recombinants were plated on E. coli strain C600hfl' and screened by standard plaque hybridization techniques using the following probes.

Two oligonucleotides were synthesized, with sequences complementary to selected 5' and 3' sequences of the huIL-3 gene. The 5' probe, complementary to a sequence encoding part of the huIL-3 leader, had the sequence 5'10 GAGTTGGAGCAGGAGCAGGAC-3'. The 3' probe, corresponding to a region encoding amino acids 123-130 of the mature protein, had the sequence 5'GATCGCGAGGCTCAAAGTCGT-3'. The method of synthesis was a standard automated triester method substantially similar to that disclosed by Sood et al., Nucl. Acids Res. 4:2557 (1977) and Hirose et al., Tet. Lett. 28:2449 (1978). Following synthesis, oligonucleotides were deblocked and purified by preparative gel electrophoresis. For use as screening probes, the oligonucleotides were terminally radiolabeled with 32P-ATP and T4 polynucleotide kinase using techniques similar to those disclosed by Maniatis et al. The E. coli strain used for library screening was C600hfl· (Huynh et al., 1985, supra).

Thirteen positive plaques were purified and re-probed separately with the two hybridization probes. Eleven clones hybridized to both oligonucleotides. The cDNA inserts from several positive recombinant phage were subcloned into an EcoRI-cut derivative (pGEMBL18) of the standard cloning vector pBR322 containing a polylinker having a unique EcoRI site, a BamHI site and numerous other unique restriction sites.

An exemplary vector of this type, pGEMBL, is described by Dente et al., Nucl. Acids Res. 77:1645 (1983), in which the promoters for SP6 and T7 polymerases flank the multiple cloning sites. The nucleotide sequences of selected clones were determined by the chain termination method. Specifically, partial EcoRI digestion of XGT10:IL-3 clones 2, 3, 4 and 5 yielded fragments ranging from 850 bp to 1,000 bp in size which were separately subcloned into the EcoRI site of pGEMBL18. The inserts of the pGEMBL:rhuIL-3 subclones were sequenced using a universal primer that binds adjacent to the multiple cloning site of pGEMBL 18, and synthetic oligonucleotide primers derived from the huIL-3 sequence.

B. Modification of Ν-Glycosylation Sites Encoded by huIL-3 cDNA and Assembly of Expression Vector for rhuIL-3 (Pro8 Asp15 Asp70). The two asparagineIE 920424 linked glycosylation sites present in the natural protein (Asn15 and Asn70) were altered by changing the codons at these positions to ones that encode aspartic acid. This prevents N-linked glycosylation (often hyperglycosylation) of the secreted protein by the yeast cells, and a more homogeneous product is obtained. These changes were made as described below upon subcloning the huIL-3 cDNA into the yeast expression vector pIXY 120.

The yeast expression vector pIXY120 is substantially identical to pBC102-K22, described in EPA 243,153, except that the following synthetic oligonucleotide containing multiple cloning sites was inserted from the Asp718 site (amino acid 79) near the 3' end of the a-factor signal peptide to the Spel site contained in the 2μ sequences: Asp718 /Ncol GTACCTTTGGATAAAAGAGACTACAAGGACGACGATGACAAGAGGCCTCCATGGATCCCCCGGGACA GAAACCTATTTTCTCTGATGTTCCTGCTGCTACTGTTCTCCGGAGGTACCTAGGGGGCCCTGTGATC /BamHI Spel In addition, a 514-bp DNA fragment derived from the single-stranded bacteriophage f 1 containing the origin of replication and intergenic region was inserted at the Nrul site in the pBR322 DNA sequences. The presence of the fl origin of replication enables generation of single-stranded copies of the vector when transformed into appropriate (male) strains of E. coli and superinfected with bacteriophage fl. This capability facilitates DNA sequencing of the vector and allows the possibility of in vitro mutagenesis.

The yeast expression vector pIXY 120 was digested with the restriction enzymes Asp718, which cleaves near the 3' end of the α-factor leader peptide (nucleotide 237), and BamH 1, which cleaves in the polylinker. The large vector fragment was purified and ligated to the following DNA fragments: (1) a huIL-3 cDNA fragment derived from plasmid GEMBL18:huIL-3 from the Clal site (nucleotide 58 of mature huIL-3) to the BamHI site (3' to the huIL-3 cDNA in a polylinker); and (2) the following synthetic oligonucleotide linker A: GTA CCT TTG GAT AAA AGA GAC TAC AAG GAC GAC GAT GAC AAG GCT CCC ATG ACC CAG GA AAC CTA TTT TCT GTG ATG TTC CTG CTG CTA CTG TTC CGA GGG TAC TGG GTC ACfi ACG CCC TTG AAG AC£ AGC TGG GTT £AI TGC TCT AAC ATG AT TGC TGC GGG AAC TTC TGG TCG ACC CAA CTA ACG AGA TTG TAC TAG C Oligonucleotide A regenerates the sequence encoding the C-terminus of the a-factor leader peptide and fusing it in-frame to the octapeptide DYKDDDDK, which is, in turn, fused to the N-terminus of mature rhuIL-3. This fusion to the rhuIL-3 protein allows detection with antibody specific for the octapeptide and was used initially for monitoring the expression and purification of rhuIL-3. This oligonucleotide also encodes an amino acid change at position 15 (Asn15 to Asp15) to alter this N-linked glycosylation site. The underlined nucleotides in oligonucleotide A represent changes from the wild type cDNA sequence. Only the A to G and C to T changes at nucleotides 43 and 45, respectively (counting from the codon corresponding to the N-terminal alanine of the mature huIL-3 molecule), result in an amino acid change (Asp15). The other base changes introduce convenient restriction sites (Ahall and PvuII) without altering the amino acid sequence. The resulting plasmid was designated pIXY 139 and contains a rhuIL-3 cDNA with one remaining N-linked glycosylation consensus sequence (Asn70).

Plasmid pIXY 139 was used to perform oligonucleotide-directed mutagenesis to remove the second N-linked glycosylation consensus sequence by changing Asn70 to Asp70. The in vitro mutagenesis was conducted by a method similar to that described by Walder and Walder, Gene 42:133 (1986). The yeast vector, pIXY139, contains the origin of replication for the single-stranded bacteriophage fl and is capable of generating single-stranded DNA when present in a suitable (male) strain of E. coli and superinfected with helper phage.

Single-stranded DNA was generated by transforming E. coli strain JM107 and superinfecting with helper phage IR1. Single-stranded DNA was isolated and annealed to the following mutagenic oligonucleotide B, GTC AAG AGT TTA CAG GAC GCA TCA GCA AAT G, which provides a codon switch substituting Asp for Asn at position 70 of mature huIL-3. Annealing and yeast transformation conditions were done as described by Walder and Walder, supra. Yeast transformants were selected by growth on medium lacking tryptophan, pooled, and DNA extracted as described by Holm et al., Gene 42:169 (1986). This DNA, containing a mixture of wild type and mutant plasmid DNA, was used to transform E. coli RR1 to ampicillin resistance. The resulting colonies were screened by hybridization to radiolabeled oligonucleotide B using standard techniques. Plasmids comprising DNA encoding huIL-3 Asp70 were identified by the hybridization to radiolabeled oligonucleotide B under stringent conditions and verified by nucleotide sequencing.

The resulting yeast expression plasmid was designated pIXY138, and contained the huIL-3 gene encoding the Asp15 Asp70 amino acid changes and the octapeptide DYKDDDDK at the N-terminus. The final yeast expression plasmid is identical to pIXY138 except that it lacks the nucleotide sequences coding for the octapeptide, thus generating mature rhuIL-3 as the product.

The final yeast expression plasmid was constructed as described below. The 5 yeast expression vector pIXY 120 was cleaved with the restriction enzymes Asp718 and BamHl as described above. The large vector fragment was ligated together with (1) a huIL-3 cDNA fragment derived from plasmid pIXY138 that extended from the Aha2 site (which cleaves a nucleotide 19 of mature huIL-3) to the BamHl site 3' to the cDNA, and (2) the following synthetic oligonucleotide C: GTA CCT TTG GAT AAA AGA GCT CCC ATG ACC CAG ACG A GA AAC CTA TTT TCT CGT GGG TAC TGG GTC TGC TGC Pro Leu Asp Lys Arg Ala Pro Met Thr Gin Thr Thr Oligonucleotide C regenerates the 3' end of the α-factor leader peptide from the Asp718 site (the amino acids Pro-Leu-Asp-Lys-Arg) and the N-terminal seven amino acids of huIL-3 to the Ahall site. The resulting plasmid was designated pIXY151. This vector, when present in yeast, allows glucose-regulated expression and secretion of rhuIL-3 (Pro8 Asp15 Asp70).

C. Expression Vector for rhuGM-CSF (Leu23, Asp27, Glu39) Containing Modified N-Glycosvlation Sites. The wild-type gene coding for human GM-CSF, resident on plasmid pHG23, has been deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, USA, under accession number 39900. The wild-type gene inserted in a yeast expression vector, pYafHuGM, has also been deposited with the ATCC under accession number 53157. In order to provide a non-glycosylated analog of human GM-CSF, oligonucleotidedirected site-specific mutagenesis procedures were employed to eliminate potential Nglycosylation sites, as described in PCT publication WO 89/03881. A plasmid encoding this analog, huGM-CSF (Leu23 Asp27 Glu39), was deposited with the ATCC as plasmid L207-3 in E. coli strain RR1 under accession number 67231.

Example 2 Construction of Expression Vector for GM-CSF/IL-3 Fusion Protein In order to create a secretion vector for expressing a fusion construct having human GM-CSF and human IL-3 separated by a linker sequence, a precursor plasmid was first constructed by directly fusing DNAs encoding GM-CSF and IL-3 together without regard to reading frame or intervening sequences. A cDNA fragment encoding nonglycosylated human GM-CSF was excised from plasmid L207-3 as a 977bp restriction fragment (Sphl to Sspl). The IL-3 cDNA was excised from pIXY151 by digestion with Asp718, which was then blunt ended using the T4 polymerase reaction of Maniatas et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1982, p. 118) and further digested with Xhol giving an 803 bp fragment. These two fragments were then directly ligated to a pIXY 151 vector fragment cut with Sphl and Xhol. This plasmid was called GM/IL-3 direct fusion.

The GM/IL-3 direct fusion plasmid was used as a template in oligonucleotidedirected mutagenesis using methods similar to those described by Walder and Walder, supra. The following oligonucleotide was then synthesized GCCAGTCCAGGAGGGTGGCGGTGGATCCGGCGGTGGTGGATCTGGTGGCGGCGGCTCAGCTCCCATGAC cc ProValGlnGluGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerAlaProMetThr ---GM-CSF---><--------------Linker-----------------------><---IL-3--20 This oligonucleotide overlaps the 3' end of GM-CSF by 13 bp but does not include the stop codon, contains the Gly Ser linker, and overlaps the 5' end of IL-3 by 13 bp. The linker sequence was a modified version of the linker described by Huston et al. (Proc.

Natl. Acad. Sci. USA 85:5879-5883, 1988) but was optimized for codon usage in yeast as per Bennetzen et al. (J. Biol. Chem. 257:3026, 1982).

Single stranded plasmid DNA was made from the GM/IL-3 direct fusion using R408 helper phage (Stratagene) and the methods of Russel et al. (Gene 45:333-338, 1986). Oligonucleotide directed mutagenesis was then carried out by annealing the above oligonucleotide to the single stranded plasmid DNA and transforming yeast strain XV2181 with annealed DNA as described by Walder and Walder, supra. The yeast vector contains the origin of replication for the single stranded bacteriophage f 1 and is capable of sponsoring single stranded DNA production when present in a suitable (male) strain of E. coli and superinfected with helper phage. Yeast transformants were selected by growth on medium lacking tryptophan, pooled, and DNA was extracted as described by Holm et al. (Gene 42Λ&), 1986). This DNA, containing a mixture of mutant and wild type plasmid DNA, was used to transform E. coli RR1 to ampicillin resistance. The resulting colonies were screened by hybridization to radiolabeled oligonucleotide using standard techniques. Plasmids comprising DNA encoding GMIE 920424 CSF/linker/IL-3 were identified by their hybridization to radiolabeled oligonucleotide containing the linker under stringent conditions and verified by nucleotide sequencing.

During nucleotide sequencing it was discovered that a mutation had occurred within the linker region. The nucleotide sequence TGGTGGATCTGG was deleted (see sequence), resulting in the expression of a protein in which the sequence of amino acids GlyGlySerGly were deleted. This mutation did not change the reading frame or prevent expression of a biologically active protein. The resulting plasmid was designated pIXY321 and expressed the fusion protein huGMCSF[Leu23Asp27Glu^9]/Gly4SerGly5Ser/huIL-3[Pro8Asp15Asp7^].

Example 3 Expression and Purification of GM-CSF/IL-3 Fusion Protein The host strain, XV2181, a diploid 5. cerevisiae strain, was formed by mating XV617-1-3B [a, his6, leu2-l, trpl-1, ura 3, Jfe5], obtained from the University of Washington, Department of Genetics Yeast Strain Bank, Seattle, WA, USA, and X2181-1B [a, trpl-1, gall, adel, his2], obtained from the Yeast Genetic Stock Center, University of California, Berkeley, CA, USA. The host strain was transformed with the expression plasmid by the method of Sherman et al., Laboratory Course Manual for Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 1986.

Yeast containing the expression plasmid pIXY321 (see ID, above) was maintained on YNB-trp agar plates stored at 4°C. A preculture was started by inoculating several isolated recombinant yeast colonies into one liter of YNB-trp medium (6.7 g/L Yeast Nitrogen Base, 5 g/L casamino acids, 40 mg/L adenine, 160 mg/L uracil, and 200 mg/L tyrosine), and was grown overnight in two 2-liter flasks at 30°C with vigorous shaking. By morning the culture was saturated, in stationary phase, at an OD600 of 2 to 7. The fermenters (three machines of 10 liter working volume), previously cleaned and sterilized, were filled to 80% of their working capacity with SD-2 medium (4.0 g/L ammonium sulfate, 3.2 g/L monobasic potassium phosphate, 3.0 g/L yeast extract, 1.0 g/L citric acid, 0.1 g/L sodium chloride, 5 ml/L 2% calcium chloride, 2.5 ml/L vitamin 101 solution, 0.5 ml/L trace elements solution, 0.5 ml/L 20% magnesium sulfate, 2.0 ml/L glucose) and maintained at 30°C with 500600 rpm agitation and 10-161pm aeration. The inoculum was added. After two hours of growth a nutrient feed of 50% glucose was begun at a rate such that 50 g/L is added over a period of 10-12 hours. The nutrient feed was then shifted to 50% ethanol added at 30-40 ml/hr until harvest.

Total elapsed time of fermentation was approximately 20 hours, after which optical density (600 nm) ranged from 30 to 45. The fermenters were then cooled to 20°C, pH of the yeast beer was adjusted to 8.0 by the addition of 5 M NaOH, and the resulting material filtered through a Millipore Pellicon filter system equipped with a 0.45 pm filter cassette, and collected in a sterile 10 L carboy.

One liter of yeast supernatant containing GM-CSF/IL-3 fusion protein was concentrated to 50 ml on an Amicon YM-10 membrane. The yeast broth concentrate was then further purified by preparative HPLC by applying to a 1 cm X 25 cm column packed with 5p C-18 silica (Vydac, Separations Group, Hesperia, CA, USA) that was equilibrated in 0.1 % trifluoroacetic acid in water (Solvent A) prior to application of the yeast concentrate. Alternatively, the crude yeast broth can be pumped directly on to the C-18 column. Following application of the material, the column was flushed with Solvent A until the optical absorbance of the effluent approached base line values. At this time a gradient of 0.1% trifluoroacetic acid in acetonitrile (Solvent B) was established from 0% B to 100% B at a rate of change of 1-2% B per minute and at a flow rate of 2 ml/minute. One minute fractions were collected. Aliquots of the fractions were analyzed for protein content by dot blot with a rabbit polyclonal antisera to IL-3. GM-CSF/IL-3 eluted in fraction 50 at approximately 50% acetonitrile.

HPLC fractions which were positive for GM-CSF/IL-3 fusion protein by dot blot were pooled and bound to SP-Sepharose in 20 mM β-alanine, pH 4. Fusion protein was eluted with 0.5 M NaCl, 100 mM Tris-HCl, pH 8. Fractions containing fusion protein were identified by SDS-PAGE.

The ion exchange fractions containing protein having a molecular weight of 35,000 were pooled, concentrated to 100 pi and further purified by FPLC gel filtration on a Superose 12 column. The column was eluted with PBS. Fractions containing only the purified 35,000 MW fusion protein were identified by SDS-PAGE.

The biological activities (units/mg) and binding affinities of the GM-CSF/IL-3 fusion protein prepared substantially as described above were determined as set forth in Examples 4 and 5.

Example 4 Biological Activity of GM-CSF/IL-3 Fusion Protein in Thymidine Incorporation Assay In order to determine its level of biological activity, the GM-CSF/IL-3 fusion 35 protein prepared as described in Example 3 was assayed for ability to stimulate proliferation of AML-193 cells in a thymidine incorporation assay. The AML-193 cell line is a GM-CSF dependent human monocytic leukemia cell line originally described by Santoli et al. (7. Immunol. 759:3348, 1987). The cells were grown in Iscove's Modified Dulbecco's Media (IMDM) with 25 mM HEPES, 200 nM L-glutamine, 5 pg/ml insulin, 5 pg/ml transferrin, 5 ng/ml sodium selenite, 2.5% heat inactivated fetal bovine serum, antibiotics, and 5 ng/ml of purified recombinant human GM-CSF. The cells were split twice weekly and were seeded into fresh medium at a density of 300,000/ml.

A thymidine incorporation assay was employed to examine the capacity of known growth factors and unknown supernatants to stimulate proliferation of AML10 193. AML-193 cells were washed by centrifugation and resuspended in assay medium composed of IMDM as above except that fetal calf serum and/or GM-CSF was not included. Pure GM-CSF, IL-3 or GM-CSF/IL-3 fusion protein was added to the first well of a 96 well flat bottom tissue culture plate at a final concentration of 40 ng/ml in 50 pi of medium. These samples were then serially diluted by 3-fold through the additional 11 wells of the microtitre plate. Fifty pi of medium containing 3750 AML193 cells was added to each well and plates were incubated at 37°C for 138 hours in a fully humidified atmosphere of 6% CO2 in air. Tritiated thymidine (0.5 mCi/well) was added to each well for an additional 6 hours of incubation and the samples were harvested with an automated sample harvester and counted by liquid scintillation. One unit of activity is defined as the amount of growth factor required to stimulate halfmaximal thymidine incorporation.

Simultaneous titration of IL-3, GM-CSF or GM-CSF/IL-3 fusion protein at identical concentrations revealed that the fusion protein was a more potent proliferation stimulus than either factor alone or IL-3 and GM-CSF combined. The specific activity of the IL-3, GM-CSF and GM-CSF/IL-3 fusion protein is set forth in Table A, below.

TABLE A Molecule_Specific Activity IL-3 1.65 x 105 GM-CSF 9.74 x 104 IL-3 + GM-CSF 1.39 x 105 GM-CSF/IL-3 1.81 x 106 The specific activity of GM-CSF/IL-3 fusion protein is approximately 10-fold higher than IL-3 or GM-CSF alone or GM-CSF plus IL-3 combined.

Example 5 Binding Activity of GM-CSF/IL-3 Fusion Protein in Equilibrium Binding Assay Binding affinities of human IL-3, GM-CSF and fusion protein for receptors on human cells lines were determined by inhibition of 125I-labeled IL-3 or GM-CSF binding.

A. Radiolabeling of GM-CSF and IL-3. Recombinant human GM-CSF/IL-3 fusion protein was expressed in yeast cells and purified substantially as described above. Recombinant human IL-3 and GM-CSF, engineered to contain the octapeptide DYKDDDDK were expressed in yeast and purified using a monoclonal antibody specific to the octapeptide substantially as described in Hopp et al. (Bio/Technology 6:1204, 1988). The purified GM-CSF and IL-3 proteins were radiolabeled using a commercially available enzymobead radioiodination reagent (BioRad), substantially as described by Park et al. (J. Biol. Chem. 261:4177, 1986). Briefly, 2-10 gg of recombinant protein in 50 μΐ 0.2 M sodium phosphate, pH 7.2, was combined with 50 μΐ enzymobead reagent, 2 mCi of sodium iodide in 20 μΐ of 0.05 M sodium phosphate pH 7 and 10 μΐ of 2.5% β-D-glucose. After 10 min at 25°C, sodium azide (10 μΐ of 50 mM) and sodium metabisulfite (10 μΐ of 5 mg/ml) were added sequentially and incubation continued for 5 minutes at 25°C. The reaction mixture was fractionated by gel filtration on a 2 ml bed volume of Sephadex G-25 (Sigma) equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium containing 2.5% (w/v) bovine serum albumin (BSA), 0.2% (w/v) sodium azide and 20 mM Hepes, pH 7.4 (binding medium). The final pools of 125I-IL-3 and 125I-GM-CSF were diluted to a working stock solution of 1 x IO’7 M in binding medium and stored for up to one month at 4°C without detectable loss of receptor binding activity. The specific activity of radiolabeled preparation of GM-CSF is routinely in the range of 1-5 x 1015 cpm/mmole. The specific activity of IL-3 is in the range of 3-6 x 1015 cpm/mmole.

B. Binding Assays. Binding assays were performed using JM-1, KG-1, HL60 and AML-193 cells. JM-1, HL-60 and KG-1 cells were obtained and prepared as described by Park et al. (/. Biol. Chem. 264:5420, 1989). AML-193 cells were obtained and prepared as described above in Example 4. As described by Park et al. (supra), 125I-GM-CSF does not bind to JM-1 cells nor does GM-CSF inhibit binding of 125I-IL-3 to JM-1 cells, indicating that these cells possess receptors capable of binding only IL-3. Conversely, 125I-IL-3 does not bind to HL-60 cells nor does IL-3 inhibit binding of 125I-GM-CSF to HL-60 cells, indicating that these cells possess receptors capable of binding only GM-CSF. In contrast, both KG-1 and AML-193 cells bind 125I-GM-CSF and 125I-IL-3 and, in addition, both IL-3 and GM-CSF are able to partially compete specific binding of the heterologous radiolabeled ligand, with approximately equivalent capacities. This suggests that these cell lines possess receptors that bind only IL-3, receptors that bind only GM-CSF, and receptors that bind both GM-CSF and IL-3, all with high affinity.

In order to determine the affinity of binding (Kj) of IL-3, GM-CSF and GM10 CSF/IL-3 fusion protein, inhibition assays were performed in which the ability of varying concentrations of these unlabeled proteins to inhibit binding of 125I-IL-3 to JM1 cells, 125I-GM-CSF to HL-60 cells and 125I-IL-3 and 125I-GM-CSF to KG-1 and AML-193 cells were measured. Assays were performed by incubating cells (3.3 x 107/ml) with 3 x IO'10 M 125I-GM-CSF or 125I-IL-3 and varying concentrations of unlabeled IL-3, GM-CSF or GM-CSF/IL-3 fusion protein for 30-60 minutes at 37°C. Binding was assayed using the phthalate oil separation method disclosed by Dower et al. (7. Immunol. 752:751, 1984), essentially as described by Park et al. (7. Biol. Chem 261ΆΥΠ, 1986). Data was analyzed as described by Park et al. (Blood. 74:56, 1989). Binding affinities were determined for IL-3, GM-CSF and GM-CSF/IL-3, as shown in Table B, below.

TABLE B Labeled Lieand Unlabeled Conwetitor Kt Values (M-d.)_ JM-1 HL60 KG-1 AML-193125I-IL-3 IL-3 1.8xl010 2.0xl010 4. lx 109 GM-CSF/IL-3 6. lx 109 - 2.8x1ο11 1.5χ101θ125i-gm-csf GM-CSF - 1.2xl010 3.2χ101θ 1.6xl010 GM-CSF/IL-3 6.8xl09 1.9χ101θ 1.5xl010 The experiments used to obtain the data in Table B were conducted using different cell lines in different experiments and accordingly show some variation, making direct comparison difficult. In order to enable direct comparison of this data, the Kj values of both the controls and the fusion proteins were normalized to the Kj value for the control on one cell line. IL-3 data were normalized to a Κι=1.8χ101θ M'1 on JM-1 cells, and GM-CSF data were normalized to a Κι=1.2χ101θ M’1 on HL-60 cells to give the values as set forth below in Table C.

TABLE C 30 * * * * 35 Labeled Lieand Unlabeled ComDetitor Normalized Kt Values (M^.)_ JM-1 HL60 KG-1 AML-193125I-IL-3 IL-3 1.8xl010 1.8xl010 1.8xl010 GM-CSF/IL-3 6.1xl09 - 2.5x1ο11 6.8xl010125i-gm-csf GM-CSF - 1.2xl010 1.2χ101θ 1.2xl010 GM-CSF/IL-3 6.8xl09 7.1xl09 l.lxlO10 Comparison of the normalized data indicates that the GM-CSF/IL-3 fusion protein and GM-CSF bind with approximately the same affinity to receptors for GM-CSF on HL60, KG-1 and AML-193 cells. In contrast, the GM-CSF/IL-3 fusion protein and IL-3 bind with different affinities: GM-CSF/IL-3 fusion protein binds with lower affinity than IL-3 to receptors on JM-1 cells (which have only IL-3 binding receptors); in contrast, the GM-CSF/IL-3 fusion protein binds with a significantly higher affinity than IL-3 to receptors on KG-1 and AML-193 cells (both of which have GM-CSF/IL-3 receptors). Using the JM-1 cell line as a standard for normal binding affinity of the GM-CSF/IL-3 fusion protein to a receptor (i.e., for binding to a receptor which is capable of binding only a single ligand), the GM-CSF/IL-3 fusion protein binds to KG1 cells with a 41.0-fold higher binding affinity, and to AML-193 cells with an 11.15 fold higher binding affinity.

Not wishing to be bound by any particular theory, it is believed that the higher binding affinity of GM-CSF/IL-3 fusion protein to KG-1 and AML-193 cells is related to the presence in both of these cell lines of the GM-CSF/IL-3 receptor. In particular, the higher binding affinity of the GM-CSF/IL-3 fusion protein to the AML-193 cell line may explain the higher biological activity of the GM-CSF/IL-3 fusion protein in the thymidine incorporation assay of Example 4 which utilized the AML-193 cell line.

Example 6 Effect of GM-CSF/IL-3 on Proliferation of Human Bone Marrow 15 The biological effect of GM-CSF/IL-3 on the proliferation of human bone marrow progenitor cells was compared with that of GM-CSF and/or IL-3. Nonadherent, low density, T cell depleted cultures of human bone marrow were plated in methylcellulose (BFU-E, CFU-GEMM, 40,000 cells per plate) or agar (CFU-GM; 40,000 cells per culture) as described by Lu et al., Blood 61:250 (1983).

Methylcellulose cultures contained 1 unit per plate erythropoietin and accounts for the background of 48±2 BFU-E in the absence of cytokine. Cultures were incubated in a 5% O2, 5% CO2, 90% N2 atmosphere for 14 days and counted with an inverted microscope. These values represent the mean ±1 standard deviation of duplicate or triplicate data points in one of two representative experiments.

TABLE D _Colonies (Mean±S.D.)5 Cvtokine_Dose (pg/ml) CFU-GEMM CFU-GM BFU-E None 0+ 3±1+ 48±2+ GM-CSF/IL-3 5000 l0.3±l 97±2 107±5 10 2500 10.3±0.9 74±1 119±5 1250 6.8±0.5 59+2 125±8 625 4.3±0.5 52±6 83±5 312 2.5±0.7 35±2 70±4 156 1.0±0.4 24±3 49±6+ 15 78 0+ 16±2 5ftt3+ GM-CSF+IL-3 5000+5000 10.0±0.7 54±3 94±6 2500+2500 8.5±0.5 52+3 81±3 1250+1250 5.0+0.4 47±4 56±3+ 20 625+625 2.5±0.3 27±2 44±3+ 312+312 1.0±0 14±1 42±3+ 156±156+ 0.3±0.3 10±l 44±3+ GM-CSF 5000 6.8±0.6 42±4 63±3 25 2500 3.5±0.7 42±2 61±1 1250 1.5±0.3 33±2 47±4+ 625 0.3±0.3+ 21±2 46±3+ 312 0+ 16±1 t 30 EL-3 5000 4.0±0.7 16±0.3 67±2 2500 4.0±0.4 9±1 66±2 1250 1.3+0.3 4+1 + 49+2+ 625 0+ t 45±3+ 312 ot t t + = value equal to media control * p<0.05 compared to media control TABLE E Colonies (Mean+S.DO Cvtokine Dose fDe/ml) CFU-GEMM CFU-GM BFU-E None 2±0+ o+ 44±4+ GM-CSF/IL-3 5000 43±5 — 10 2500 10.0±l* 45±5 125±10’ 1250 9.0±0* 23±2 127±7* 625 6.0±l* 15±2 97±2* 312 5.5±0.5 8±1 71±Γ 156 2.0±l+ 5+1 47±3+ 15 78 2.0±0+ 2±0.3 44±1 + GM-CSF+IL-3 5000+5000 6.5+1.5* 32±2 93+3* 2500+2500 5.0±l* 21±2 71±8* 1250+1250 1.5±0.5+ 13±0.3 44±2+ 20 625+625 2.0±0+ 7±2 45±5+ 312+312 t 3±1 t 156+156 + 1+0.9+ t t = value equal to media control * p<0.05 compared to media control Tables D and E indicate that GM-CSF plus IL-3 is approximately 10-20 fold more potent than either GM-CSF or IL-3 alone, or in combination, in enhancing proliferation of human bone marrow progenitor cells.

Example 7 Synthesis of cDNA Encoding IL-3/GM-CSF Fusion Protein A cDNA encoding a fusion protein comprising an N-terminal IL-3 and a C35 terminal GM-CSF was constructed as follows. The yeast expression vector pIXY 120 (described in Example IB) was digested with the restriction enzymes Asp718, which cleaves near the 3' end of the α-factor leader peptide (nucleotide 237), and Ncol, which cleaves in the polylinker. The large vector fragment was purified and ligated to an approximately 500bp Asp718-Ncol fragment (encoding GM40 CSF(Leu23Asp27Glu* 35 * * * 39 40)) from a partial digest of L207-3 (ATCC 67231), to yield pIXY273. A 9kb Asp718-Bgl2 fragment of pIXY273 (still containing the GMCSF(Leu23Asp27Glu39) cDNA) was then ligated to an Asp718-Nrul fragment encoding human IL-3 (Pro^Asp^Asp7^) from pIXY 151 (described in Example IB) and the following double stranded oligonucloetide: ' CGATCTTTGGTGGCGGTGGATCCGGCGGTGGTGGTGGATCTGGTGGCGGATCTGCTCCAGCTA 3' 3' GCTAGAAACCACCGCCACCTAGGCCGCCACCACCACCTAGACCACCGCCTAGACGAGGTCGATCTAG 5 -IL-3—><---------LINKER----------------------------><---GMCSF— This oligonucleotide overlaps the 3' end of IL-3 by 8bp but does not include the stop 10 codon, contains the Gly-Ser linker, and overlaps the 5' end of GM-CSF by lObp. The resulting vector was termed pIXY344 and was used to express an IL-3/GM-CSF fusion protein essentially as described above in Example 3.

Example 8 Binding Activity of IL-3/GM-CSF Fusion Protein in Equilibrium Binding Assay Binding affinities of human IL-3, GM-CSF and the IL-3/GM-CSF fusion protein pIXY344, (produced as described above in Example 7) for receptors on human cells lines were determined by inhibition of 125I-labeled IL-3 or GM-CSF binding as described in Example 5 above.

Binding assays were performed using JM-1, HL-60 and KG-1 cells, which were obtained and prepared as described by Park et al. (J. Biol. Chem. 264:5420, 1989). JM-1 cells possess receptors capable of binding IL-3, but not GM-CSF. Conversely, HL-60 cells possess receptors capable of binding GM-CSF, but not IL-3.

KG-1 cells possess receptors for both GM-CSF and EL-3.

Binding affinities (Ki)were determined for IL-3, GM-CSF and GM-CSF/EL-3, as shown in Table F, below.

TABLE F Labeled Lieand Unlabeled ComDetitor JM-1 Kt Values IM1) HL60 KG-1125I-IL-3 IL-3 6.0xl09 5.7xl09 GM-CSF/IL-3 2.5xl09 — 3.0xl010 IL-3/GM-CSF 1.2xl09 2.2xl010125i-gm-csf GM-CSF - 1.5xl010 N.D. GM-CSF/IL-3 - 5.4xl09 N.D. IL-3/GM-CSF - 3.0xl09 N.D.

N.D. = no data available The above data indicate that the GM-CSF/IL-3 and IL-3/GM-CSF fusion proteins bind to JM-1 cells with an affinity lower than that of IL-3 alone. In contrast, the GMCSF/IL-3 and IL-3/GM-CSF fusion proteins bind to KG-1 cells with a significantly higher affinity than that of IL-3 alone. The Kj value for both GM-CSF/IL-3 and IL5 3/GM-CSF fusion proteins on KG-1 cells is 10-20 fold higher than on JM-1 cells. Similarly, the Kj values determined for GM-CSF/IL-3 and IL-3/GM-CSF on HL-60 cells are similar.

In view of the data shown in Examples 4-6 (which show a correlation between binding affinity and enhanced biological activity), the above binding data suggest that the IL-3/GM-CSF fusion protein will have increased biological activity.

Example 9 Inhibition of HIV-1 Replication in Macrophages The effect of pIXY 321 (the GM-CSF/IL-3 fusion protein) on inhibition of HIV-1 infection of macrophages was determined by adding pIXY 321, GM-CSF plus IL-3, or medium only, to macrophages infected with HIV-1 and measuring levels of p24 (an HIV-1 nucleocapsid protein antigen) in culture supernatants, as described in detail below. GM-CSF plus IL-3 did not reduce the concentration of viral p24 antigen in the culture supernatants. In contrast, pIXY 321 decreased p24 levels significantly.

Macrophages were cultured as follows. Human peripheral blood mononuclear cells were isolated from the blood from normal healthy volunteers by Ficoll-hypaque density separation. Mononuclear cells isolated in this way were further fractionated by a continuous Percoll gradient, essentially as described by Gmelig-Meyling and Waldmann (J. Immunol. Meth. 33:1, 1980). Monocytes isolated in this manner were approximately 90% pure and were further enriched by an 18 hour incubation to glass coverslips in tissue culture medium. Non-adherent cells were removed by washing with fresh medium and adherent cells were cultured for an additional 5 days in RPMI medium supplemented with 5% human AB serum in 1.0 ml volumes in 24 well cluster dishes. This procedure yielded a pure population of macrophages.

The macrophage cultures were then infected with 1,000 TCID of HIV- lfia-L for hours at 37°C. This virus infected the macrophages and gave rise to the characteristic cytopathic effects of HIV-1 infection, i.e. fusion of infected macrophages to form multi-nucleated giant cells (Meltzer et al., Immunol. Today //:216, 1990). Excess virus was then removed by washing with medium. For cytopathologic examination of cultures, incubation was carried out for 14 days. For examination of p24 viral antigen in culture supernatants, samples were harvested at 7 or 9 days and analyzed by a p24 specific ELISA (Abbott Laboratories).

Macrophages were either pre-treated with cytokines at 100 ng/ml for 24 hours prior to infection and then cultured in their absence for the remainder of the time, or were cultured with cytokines only after infection.

Figures 3-6 show the cytopathologic results of this experiment. Figure 3 is a photograph of a multi-nucleate giant cell, which is the characteristic cytopathic effect of HIV-1 infection of macrophages. This multi-nucleated giant cell is shown at high power 14 days after infection of the macrophages and was cultured in control medium only. The same experimental group is shown at low power in the photograph of Figure 4. HIV-1 infected macrophages treated 14 days after infection with 100 ng/ml of GMCSF and IL-3 are shown in the photograph of Figure 5. In this photograph, no apparent difference can be seen between the macrophages treated with GM-CSF and IL-3 combined and those of the control group shown in Figures 3 and 4. In contrast, the photograph of Figure 6 shows that no multinucleated giant cells were present after treatment of HIV-1 infected macrophages with 100 ng/ml of the GM-CSF/IL-3 fusion protein pIXY 321, indicating that pIXY 321 eliminated or prevented the formation of multinucleated giant cells.

The results of assays measuring p24 viral antigen levels are shown in Figures 7 and 8. The graph of Figure 7 illustrates the effect of treatment of cultures during the post-infection period with either medium only (no treatment), pIXY 321 (100 ng/ml) or GM-CSF and IL-3 (100 ng/ml each) on supernatant levels of p24. Treatment with GM-CSF and IL-3 is not significantly different from the medium only control, whereas treatment with pIXY 321 shows a significant reduction in p24 levels. The reduction of p24 levels indicates that the level of HIV-1 infection is reduced.

The effect of pre-infection treatment of macrophages for 24 hours with 100 ng/ml pIXY 321 versus post-infection treatment for 9 days on supernatant levels of p24 is shown in Figure 8. Pretreatment of HIV-1 infected macrophages with pIXY 321 does not appear to have any effect on p24 levels, whereas post-infection treatment results in a significant decrease in p24 levels.

The mechanism by which pIXY 321 inhibits replication of HIV in macrophages and eliminates multinucleated giant cells is not known. It is not known, for example, whether pIXY 321 actually prevents the macrophage from becoming infected with HIV or whether pIXY 321 prevents viral replication in macrophages already infected with HIV. Regardless of the precise mechanisms, the above data indicate that pIXY 321 significantly reduced p24 levels and eliminates multinucleated giant cells, clearly demonstrating that pIXY 321 prevents HIV-mediated cytopathic changes in macrophage morphology and sitgnificantly reduces HIV production.

Claims (13)

1. A method of inhibiting replication of HIV in macrophages comprising the step of contacting the HIV-infected macrophages with an effective amount of a 5 fusion protein comprising GM-CSF and IL-3.

2. A method of inhibiting replication of HIV in macrophages, according to claim 1, wherein the fusion protein comprising GM-CSF and IL-

3. Is pIXY 321. 10 3. A method of inhibiting replication of HIV in macrophages, according to claim 1, wherein the macrophage is a human macrophage.

4. A method of inhibiting replication of HIV in macrophages of an HIVinfected mammal, comprising the step of administering to a mammal an effective 15 amount of a fusion protein comprising GM-CSF and IL-3.

5. A method of inhibiting replication of HIV in macrophages of an HIVinfected mammal, according to claim 4, wherein the fusion protein comprising GMCSF and IL-3 is pIXY 321.

6. A method of inhibiting replication of HIV in macrophages of an HIVinfected mammal, according to claim 4, wherein the HTV-infected mammal is a human.

7. A method of inhibiting progression of senile dementia associated with 25 an HIV-infected mammal in the central nervous system, comprising the step of administering an effective amount of a fusion protein comprising GM-CSF and IL-3.

8. A method of inhibiting progression of senile dementia associated with an HIV-infected macrophages in the central nervous system, according to claim 7, 30 wherein the fusion protein comprising GM-CSF and EL-3 is pIXY 321.

9. A method of inhibiting progression of senile dementia associated with an HIV-infected macrophages in the central nervous system, according to claim 7, wherein the HIV-infected mammal is a human.

10. A method of eliminating or preventing the formation of multinucleated giant cells associated with HIV infection in an HIV-infected mammal, comprising the step of administering an effective amount of a fusion protein comprising GM-CSF and IL-3.

11. A method of eliminating or preventing the formation of multinucleated giant cells associated with HIV infection, according to claim 10, wherein the fusion protein comprising GM-CSF and IL-3 is pIXY 321. 10

12. A method of eliminating or preventing the formation of HIV-infected multinucleated giant cells associated with HIV infection, according to claim 10, wherein the HIV-infected mammal is a human.

13. A method according to claim 1, substantially as hereinbefore described.