IE904706A1 - Artificial promoter for the expression of proteins in yeast - Google Patents

Abstract

An artificial promoter for expressing proteins in yeast, comprising a sub-sequence upstream from the TATA element of the Saccharomyces cerevisiae gene GAL7 promoter sequence, which comprises the upstream activating sequences UAS1 and UAS2; and a sub-sequence of an ADH2 promoter sequence comprising the TATA element and the transcription initiating region. Uses include obtaining proteins, oxidase urate in particular.

Description

- 1 - IE 904706 Artificial promoter for the expression of proteins in yeast The present invention relates to a novel artificial promoter for the expression of proteins, in par-05 ticular heterologous proteins, in yeast, to a vector for the expression of said proteins which carries said promoter, to the strains of yeast, and especially of Saccharomyces cerevisiae, which are transformed by this expression vector, and to a method of producing a re-10 combinant protein with the aid of these strains.

Yeast, and in particular Saccharomvces cere-visiae, a non-pathogenic microorganism whose genetics has been studied in detail, is a preferred eukaryotic host for the expression of proteins, especially hetero-15 logous proteins. It is therefore important to discover or construct novel promoters for the expression of said proteins which are more advantageous than the known promoters.

The structure of a yeast promoter, which is a 20 DNA sequence located upstream from a gene and responsible for the transcription of said gene, is beginning to be partially known and understood. Said promoter is known to comprise a TATA component located in an AT-rich zone, a transcription initiation region 25 downstream from said component and, if appropriate, upstream from said component, sequences, called upstream activation sequences (UAS) or upstream repression sequences (URS), which regulate the strength of the promoter under the effect of an inducer or a repressor. 30 The Applicant constructed a novel hybrid promoter from two known promoters: the promoter of the GAL7 gene of Saccharomyces cerevisiae (TAJIMA et al., 1986, Molecular Cellular Biology, 6, 246-256) and a promoter with a sequence similar to that of the natural 35 ADH2 promoter (5'-flanking region of the ADH2 gene, IE 904706 - 2 - described by RUSSEL et al. (1983), J. Biol. Chem. 258, 2674-2682), which is called an ADH2 promoter in the present patent application. _ 05 10 15 The invention therefore relates to a novel artificial promoter for the expression of proteins in yeast, which comprises: 20 - a sub-sequence upstream from the TATA component of the sequence of the promoter of the GAL7 gene of Sac-charomyces cerevisiae, which comprises the upstream activation sequences UAS1 and UAS2; and - a sub-sequence of the sequence of an ADH2 promoter 25 comprising the TATA component and the transcription initiation region.

Preferably, the sub-sequence upstream from the TATA component of the promoter of the GAL7 gene of Saccharomyces cerevisiae is the following sequence or 30 a sub-sequence thereof.: 35 IE 904706 - 3 - ' M II i i;as i Cgcgictatacttcggagcactgt tgaocctoagiGc tca 1 THCnimni.i TTciGTCnj - - *.................-..................*............... 05 AGflrOTSAACCCTCGTGACnnCTCGCTTCbGflGTAATCTATrtTrWinnACnqT/i -------- ------ ^ ims? _ _ TITCC T TAACCCAAAAAT AAGGGAGAGQQ TCCAAAAnGcbcTCOGACAAC t*(Ii to’accgt' — ...........*............-................♦............— AAAGGAAT TGGGT T1 T TAT TCCCTCTCCCAGGT T T TTCGpGAGCCi gi j gacaactggca GATCCGAAGGACTGGCTATACAGTGT TCACAAAAT AGCOAAGCTGAAAATAATGTGTAGC JO *.............................*......................... jCTjiGGCT TCCTGACCGATATGTCACAAGTGT TT TATCGGT ICUAC7 T T TAT TACACATCG S P h CTT TAGCTATGTTCAGTTAGT TTGGCATG- 15 ........................*..... gaaatcgatacaagtcaatcaaacc* Tho sub-sequence of tha sequonue of an ADHa promoter comprising the TATA component and the trana-20 cription initiation region is preferably selected from the following sequence or a.sub-eequenee thereof : CCTATCACATATAAATAOA ................... 2S fiTACOOATAGTGTATATTTATCT CTGCCAOTAGCGACTTTTTTCACAC7CGA0A7AC7CTTACTACTGC7C7CTTGTT07T7T CAeCOTCATCOC7GAAAAAAOTGTOAQC7C7ATOAOAATOA70ACGAGAGAACAACAAAA TATCAC7ICT7077TC7 7C7TGG7AAn7A0AATATCAA0C7ACAAAAAGCAIACAA7CAA ...........................................................

AT AG7GAAGAAC AAAGAAG AACCAT7 7ATCT T AT AG T TCCATG T 7 7 T TCGT ATG7 T AGT T C • t CTATCAACTATTAACTATATf 35 ...................\ GATA07T0A7AATTGATA7AGC - 4 - IE 904706 A particularly advantageous promotur is that which comprises tha following sequence : M u as « COCCTCrAIACnCCOA6Cf»CTOTTCnGCO«nOOCTCftT TAGATATAT.TITCTGTCAT ............................................

ACATA7CA«GCCTCOTOACAACtCOCTTCCCAOTAATCTATATAArtrtOACA01A THCCTTAACCCAAAAArAAOCCACAGCetCCAAAAACCOCICCGACAnCIOTIOACCOT AAAGGAAITCGGTTITTATTCCC7C7CCCAGGT T7 TTCCCGA0CCTG7 TGACAACfOOCA in GATCCGAaGGAC tCOCTAt ACAGTGTTCACAAAAIAGCCAAGCTGAAAATAATGTOTAOC • --.f..............................................

CTAOGCTTCCTGA4CCAtAlO»CACAAOTGt tl tATCGGI TCCACI! 1 TATTACACA7CQ s P h I CT1TAOC7ATQ1 TCAQ1 TAOTT TOOCATGCC7A7CACATATAAA7ACA ................................................

G AAA T CCA 7ACAAGICAA TC AAACCCT ACOGA7 AG TGT A7 AT 7 7 A7CT OTOCCAOTAGCGACTIIMICACACICOAOATACTCtTACtACJOCtCtCITOilGTTTT > «ft*»···.·..···............................................. ' ) CA TA7CAC1 7CT 707 MCI 7C»TCGTAAAtACnnTATCAAGCTACnAAAAOCAT ACAA7CAA .............«..............................................

ATAGYGAAGAACAAAGAACAACCAI 1 TATCl 7ATA07 7CGA7QT77 7 7C0TA7G77AGT7 C • CTATCAACTATTAACTAtAJj GATAGTTGATAA1 TOAlAtAGC , i 3Ω * The promoter of the invention may be obtained by the assembling of the above sub-sequence hy moans of the well-known technique of DNA recombinant.

Tho promoter of the invention has important advantages over tho known promoters and in particular over the ADH? promoter 35 and the promoter of tho GAL7 gene. ' It permits a high maximum level of trenscrip- j IE 904706 - 5 - tion and hence of expression, in particular for A. flavus urate oxidase, and offers the possibility of regulating said expression at three levels: - zero level in the presence of glucose and in the 05 absence of galactose: no expression is detected, which is an identical result to that published for the promoter of the GAL7 gene in a strain of Sac-charomyces cerevisiae growing under these conditions (TAJIMA et al., 1986, Molecular Cellular Biology, 6, 10 246-256). The ADH2 promoter shows a low but detec table level of expression under these conditions. - basic level in the absence of glucose and galactose: there is weak expression, which is an intermediate result between that observed for the ADH2 promoter 15 (maximum level) and that published for the promoter of the GAL7 gene (zero level: TAJIMA et al., 1986, Molecular Cellular Biology, £, 246-256). - maximum level of expression in the absence of glucose and in the presence of galactose.

The advantage, for the expression of heterolo gous proteins in yeast, of having a promoter which shows a zero level under certain conditions is that it affords the possibility of avoiding any selection pressure which would favor the least productive cells 25 during the propagation of the strain. This is particularly important in the case where the protein is toxic to the host cell.

The advantage of a promoter with two levels of expression: the one a basic level (non-induced) and the 30 other a maximum level (induced), lies in the ability to choose an intermediate level by varying the concentration of the inducer.

The invention further relates to an expression vector for yeast which carries a gene of interest with 35 the means necessary for its expression, its replication IE 904706 - 6 - and the selection of the transformed cells, wherein the gene of interest is under the control of the promoter defined above.

This gene of interest can be an endogenous gene 05 of yeast or a eukaryotic or prokaryotic exogenous gene.

Of particular value as eukaryotic exogenous genes are a recombinant gene coding for Aspergillus flavus urate oxidase, a recombinant gene coding for a human cyto-kinin and a recombinant gene coding for hirudin.

In the case where the protein coded for by the exogenous gene is secreted naturally, the sequence coding for this protein is preferably preceded by a signal sequence. The function of this signal sequence, which is chosen according to the host cell, is to 15 permit export of the recombinant protein out of the cytoplasm, enabling the recombinant protein to adopt a configuration similar to that of the natural protein and considerably facilitating its purification. This signal sequence can be cleaved either in a single step 20 by a signal peptidase which releases the mature protein, the eliminated sequence usually being called a pre sequence or signal peptide, or in several steps when this signal sequence comprises, in addition to the sequence eliminated by the signal peptidase, called a 25 pre sequence, a sequence eliminated later in the course of one or more proteolytic events, called a pro sequence.

The invention further relates to the strains of yeast, in particular of Saccharomyces cerevisiae. which 30 are transformed by the above expression vector, and to a method of producing a protein of interest, which comprises the culture of said strains in the presence of galactose.

In particular, the invention relates to the strains 35 of Saccharomyces cerevisiae which have been deposited in the depository authority named Collection Nationale de Culture de Microorganismes -Intitut Pasteur - France under the following numbers : - 6bis - IE 904706 I - 919 on December 28, 1989 I -lQl-1 on December -27^ 1990 X _/^2Zon December 2-9, 1990 I _ \Q2!> on December t 1990 05 The invention is illustrated, without implying a limitation, by means of the Examples below : Many of the following techniques, which are well known to those skilled in the art, are described in detail in the work by Maniatis et al.: "Molecular 10 cloning: a laboratory manual" published in 1984 by Cold Spring Harbor Press in New York.

The synthesis of the oligonucleotides is carried out by means of a DNA Synthetize Biosearch 4600.

EXAMPLE 1; Determination of the sequence of the cdna of 15 A. flavus urate oxidase 1) Isolation of the messenger RNA's from Aspergillus flavus The strain of A. flavus which produces urate oxidase was cultivated under conditions appropriate for 20 the production of urate oxidase, i.e. in a medium containing uric acid and having the following composition: glucose 15 g/1, MgS04.7Ha0 1 g/1, KHaPO* 0.75 g/1, CaCOa 1.2 g/1, uric acid 1.2 g/1, KOH 0.5 g/1, soy bean oil 0.66 ml/1, FeS04.7H20 10 rag/1, CUS04.5Ha0 1 mg/1, 25 ZnSO^.7HaO 3 mg/1, Μη30Λ.ΗΛθ 1 mg/1. The medium is adjusted to pH 7 with HaS0* 1 M and sterilized at 120*C for 80 min.

In a 5 1 Erlenmeyer flask, 1.5 1 of medium are inoculated with about 1 to 3.107 spores.

The culture is incubated for about 40 h at 30*c, with agitation (120 rpm). The mycelium is recovered by filtration on gauze, washed with water and frozen in liquid nitrogen. g of mycelium (wet weight) are thawed, re-35 suspended in 45 ml of lysis buffer and then taken up in the same volume of beads (0.45 /im in diameter). The lysis buffer consists of guanidine thiocyanate 4 M, IE 904706 - 7 - Tris-HCl 10 mM pH 7.6, EDTA 10 mM, β-mercaptoethanol 50 ml/1. The mycelian suspension is ground in a Zell-miihler mill (vibrogenic) for 5 min.

The ground material is recovered and the beads 05 are decanted. The supernatant is removed (about 45 ml), brought back to a final concentration of 3 M in respect of lithium chloride and stored at 0*c.

After two days, it is centrifuged for 60 min at 10,000 rpm. The supernatant is discarded and the re-10 sidue is taken up in 40 ml of LiCl 3 M and centrifuged again at 10,000 rpm for 1 h 30 min.

The following are added: proteinase K (SIGMA) 40 Mg/ml, SDS (0.1% w/v) and EDTA 20 mM. The mixture is incubated at 37 °C for 3 h. Precipitation with 2 15 volumes of ethanol is followed by washing with 70% ethanol. The residue is taken up in 0.5 ml of TE buffer (Tris-HCl 10 mM, EDTA 1 mM pH 7.5), the mixture is extracted twice with chloroform and precipitation is carried out with ethanol. The RNA's are stored at 20 -80°C in alcohol. 2) Purification of the poly A* fraction of the RNA's About 1 mg of RNA is precipitated for 20 min at 4*C (15,000 rpm) and then washed with 70% ethanol and dried. The residue is taken up in l ml of TE buffer 25 and resuspended by agitation in a Vortex. Oligo dT- cellulose type 3 (marketed by Collaborative Research Inc., Biomedicals Product Division) is prepared according to the manufacturer's recommendations. The RNA is deposited on the oligo dT, agitated gently to resuspend 30 the beads and then heated for 1 min at 65*C.

The suspension is adjusted to 0.5 M NaCl and then agitated gently for 10 min. It is then centrifuged for 1 min at 1000 rpm, the supernatant is removed and the residue is washed twice with 1 ml of TE buffer 35 containing 0.5 M NaCl. The supernatants are removed. - 8 - IE 904706 The polyadenylated fraction of the RNA's (consisting of the messenger RNA's) is eluted by suspending the beads in 1 ml of TE buffer, then heating this suspension at 60*c for 1 min and subsequently agitating it for 10 min 05 on a tilting plate. It is then centrifuged for 1 min at 1000 rpm, which makes it possible to recover on the one hand the supernatant containing free mRNA's in solution, and on the other hand the residue of cellulose beads. The above series of operations (starting 10 from elution) is repeated. The supernatants obtained in this way are pooled, the excess beads are removed by centrifugation and the supernatant is precipitated with ethanol containing NaCl in accordance with the usual techniques (Maniatis: op. cit.). 3) Building of the cDNA library The messenger RNA's isolated as described in the previous section were used to build a cDNA library in vector pTZ19R (marketed by PHARMACIA). This vector is a plasmid comprising a polylinker containing unique 20 restriction sites.

The cloning technique used is the one described by Caput et al. (primer-adapter technique: Caput et al., Proc. Natl. Acad. Sci. (U.S.A.) (1986) 83, 1670-1674).

It consists firstly in digesting the vector with Pstl, adding a polydc tail to the protuberant 3' end and then digesting the resulting plasmids with BamHI. The fragment corresponding to the vector is purified on a column of Sepharose CL4B (Pharmacia). It 30 therefore comprises a polydc tail at one end, the other end being a sticky end of the BamHI type. Secondly, the messenger RNA's are subjected to reverse transcription starting from a primer having the sequence 5')<3. Thus the cDNA's have at their 35 5' end the sequence GATCC complementary to the BamHI IE 904706 - 9 - sticky end.

The RNA-DNA hybrids obtained by the action of reverse transcriptase are subjected to alkaline hydrolysis, enabling the RNA to be removed. The single-05 stranded cDNA's are then purified by 2 cycles on a column of Sepharose CL4B and subjected to a treatment with terminal transferase so as to add polydG/s at the 3' end. The cDNA's are inserted in single-stranded form into the vector prepared as described above. A 10 second oligonucleotide, the adapter, complementary to the primer, is necessary in order to generate an "open" BamHI site at the 5' end of the cDNA's. After hybridization of the vector, the cDNA and the adapter, the recombinant molecules are circularized by the action of 15 the ligase of phage T4. The single-stranded regions are then repaired by means of the DNA polymerase of phage T4.

The plasmid pool obtained in this way is used to transform the MC1061 strain for ampicillin resis-20 tance (Casabadan, Chou and Cohen, J. Bact. (1980) 143, pages 971-980). 4) Determination of the . partial_sg.gue.n_ce_of urate oxidase An A. flavus urate oxidase preparation (SIGMA) 25 was repurified by chromatography on a column of Red-agarose 120 (SIGMA), this being followed by filtration on Ultrogel Aca 44 (IBF), an acrylamide-agarose gel.

Direct amino-terminal sequencing of the protein was attempted in order to obtain information on the 30 amino acid sequence of the purified urate oxidase, making it possible to synthesize the probes necessary for cloning the cDNA. This sequencing was not successful, probably because of amino-terminal blocking of the protein.

The following strategy was therefore developed IE 904706 - 10 - to obtain the partial sequence of urate oxidase: - cleavage of the protein with proteolytic enzymes (using the enzymes trypsin and protease V8 of Staphylococcus aureus) 05 - separation of the resulting polypeptides by reversed phase HPLC - sequencing of the purified peptides. 1) Hydrolysis of the urate oxidase with trypsin, purification and sequencing of the peptides: 10 The urate oxidase, at a concentration of 9 mg/ml in an ammonium carbonate buffer 100 mM pH 8.9, was digested with trypsin (Worthington, TPCK), in a ratio urate oxidase/trypsin of 30/1 by weight, at 30°C for 24 h. After tryptic hydrolysis, 60 μg of digested 15 urate oxidase were directly injected on to a reversed phase HPLC column of Brownlee G18 grafted silica (column: 10 x 0.2 cm) equilibrated with acetonitrile 1% (v/v) and trifluoroacetic acid 0.1% (v/v) in water.

The peptides were then eluted by a linear gradient of 20 acetonitrile in a solution of trifluoroacetic acid (0.1% v/v) in water, varying from 1% to 60% of acetonitrile in 60 min, at a rate of 150 μΐ/min. The peptides leaving the column were detected by measurement of the optical density at 218 nm.

The elution profile is shown in Figure 1, in which the numbers following the letter T (trypsin) correspond to the peaks identified.

Each peak was collected and stored at -20 *C until analyzed on a protein sequencer (model 470 A from 30 Applied Biosystems) equipped with a chromatograph (model 430 A from Applied Biosystems), which continuously analyzes the phenylthiohydantoic derivatives formed, after each degradation cycle.

Table (1) below shows the peptide sequences of 35 the 9 peaks identified. - 11 - IE 904706 2) Hydrolysis of the urate oxidase with protease V8, purification and sequencing of the peptides: The urate oxidase, at a concentration of 2 mg/iul in an ammonium acetate buffer 100 mM pH 6.8, was 05 digested with the protease V8 of Staphylococcus aureus (Boehringer-Mannheim), in a ratio urate oxidase/ protease V8 of 60/1, at 30°C for 72 h. 160 μg of digested urate oxidase were then injected on to a reversed phase HPLC column of Brownlee G18 grafted silica 10 (column: 10 x 0.2 cm; particles: 7 x 0.03 Mm), equilibrated with acetonitrile 1% and trifluoroacetic acid 0.1% (v/v) in water. The peptides were then eluted by a linear gradient of acetonitrile in a solution of tri-fluoroacetic acid in water (0.1% (v/v)), varying from 15 1% to 60% of acetonitrile in 60 min, at a rate of 150 μΐ/rnin. The peptides leaving the column were detected by measurement of the optical density at 218 nm.

The elution profile is shown in Figure 2, in which the numbers following the letter V (protease V8) 20 correspond to the peaks identified.

Each peak was collected and stored at -20'C until analyzed on the protein sequencer already mentioned.

Table (1) below shows the peptide sequences of 25 the 5 peaks identified. 35 IE 904706 ο * 2, £ •β S- Or* » = to §f J2. Λ μ o> 3 £!. ® s s. --:: oo «· «5 «- «- < HI -3-3-3-3-3-9-3-3 rr. ,. . , -, (-> ojcotsjfototvjroi— o U1 w Μ ^ J2 roi-ivooo-JOJO—> •-30 t— -3 O —3 —3 «= «= J£> -3 τ* O STS 5j? £ £1 * 5 w" M -r i- _, rT> b— CD b-* *P *"·** ΓΤ JS i. ϋ; R>-< cR*i< HR H- H- Π H t= 3 0 3 H w <® M ® 3 3 II III II II II II II 1 1 1 1 1 1 1 «sc- 3» «= e- 3-00 tn -3 -3 to 03· ο» ^ -3 c- J-f =" 5 g= fu *-ς i— cu —: n hi ·— p· R to ·—- μ *3" S2 5 ^ λ βΓ 21 b— CO vO ►— CO Ό ·"! 3 R ό M *"< 33 S3 ^ C ^ ^-3 03 II || ll It tl < I I I 1 * 1 1 1 1 1 £R r- CO r-o ΕΛ *-3 3» t-· Mg? J? £ S' 3 m 3 £ Φ 2 S g ^ Sr g K· S i?3 S 3Γ 2 S? e. S a g II I I I I III I .......... . , _ ,, ^ fcj m *-i i-rj < < CO CO Η Ο H CO 1/5 Λ {Λ Φ R CO CO O H- I I I I I I I I I I I I I I I I ^ a* to 3» r- c- g* £5 e -¾ 2-¾ mm ^ a ^ ^ = to -o to-3 t=T3^ » i iiii i i i ......... __ _ 3» -e« *e t- t> -οΌ»<>><η<α -—· £2 h? 21 ϊλ 2 ·? Η: h t-3-MO 5d ^ ST S » to μ o 80)-01--00=11-3. I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 M -n< — *4 s> -r* -c Ό Ό *-3 t— 3=< O' Ο <= O J3 J? ,ΕΤ Ϊ3 ΒΓ Z — H H H n> M <5 fOO- TS STS Η -Ο Ο Μ O 8-80-0.= Cl-O- »»*έίέ·^έέέέ?έ Eg8· *1 h| Μ Φ 3 Ci C C- ^ ~ ^ ^ , IIII I I ' IIII ' "< CO OCOI-3CO 3·· Ό C- ST£SSt3 2 5" S* p: S, £< si m rr 2 OHRR-O Π> O c to Ό H I IIII I I I IIII 1 0.

E- -o e- 1— «= sx 13 3 S ST £ t? Τλ g sTc ,,,ΙΙΙΙΙ I m, /—«, /—1 —— u £c< CO CO * 3 22252^2¾ J3 »«< »«< K-* ^ ^ , 1 1 . 1 I ' ' 1 f Uf J« M f- H H O· goC-SoOtOtO M I II I 1 1 1 ' r IE 904706 - 13 - 5) Screening of the bacteria 1) Preparation of the labeled probes: Two pools of probes deduced from amino acid sequences of the protein were synthesized with the aid 05 of a Biosearch 4600 DNA synthesizer. The first pool corresponds to the sequence of residues His-Tyr-Phe-Glu-Ile-Asp (part of the sequence of T 27), i.e. from 5' to 3': 10 A T 6 G 6 TC6AT TC AA TA TG T C A A A This pool in fact consists of 24 x 3 = 48 different 15 oligonucleotides, representing all the possible combinations .

The second pool corresponds to the sequence of amino acid residues Gln-Phe-Trp-Gly-Phe-Leu (part of the sequence of V5), i.e. from 5' to 3': 20 GG A G T A AAGCCCCA AA TG AA C A C T This pool consists of 24 x 4 = 64 combinations.

The probes are labeled with terminal deoxy-nucleotide transferase (TdT) (marketed by IBI, Inc.).

The reaction is carried out on 100 ng of a 30 mixture of oligonucleotides in solution (100 mg/ml) in "Cobalt" reaction buffer (supplied as a 10-fold concentrate by IBI, Inc.): 1.4 M potassium cacodylate - pH 7.2, 300 mM dithiothreitol, 1 μΐ of the enzyme terminal deoxynucleotide transferase (IBI, Inc.) and 50 μΟί of 35 deoxycytidyl triphosphate, dCTP, labeled with P32.

IE 904706 - 14 - The reaction is carried out at 37 *C for 10 min and is then stopped by the addition of 1 μΐ of EDTA 0.5 M.

A phenol extraction is carried out and the 05 extract is dialyzed on a column of Biogel P10 polyacrylamide (Biorad: 150-1050). 2) Hybridization and detection of the colonies containing urate oxidase cDNA: About 40,000 colonies are screened by the in. 10 situ hybridization technique developed by Grunstein and Hogness (1975, Proc. Natl. Acad. Sci. (U.S.A.), 72. 3961). About 6000 bacteria are plated out in Petri dishes to give isolated colonies. After incubation for 24 h at 37°C, each dish is replicated on 2 filters, 15 each filter being intended to be treated with one of the 2 pools of probes, so that all the colonies obtained are tested with the 2 pools of probes in parallel.

The filters are hybridized with one of the 2 20 pools of probes in a buffer containing 6 x SSC, 10 x Denhardt's solution and 100 μg/v^l of sonicated and denatured salmon sperm DNA (SIGMA). The hybridization is carried out at a temperature of 42°C for 16 h. The 6 x SSC solution is obtained by diluting a 20 x SSC solu-25 tion. The preparation of the 20 x SSC buffer is described by Maniatis, Fritsch and Sambrook (op. cit.). In summary, this buffer contains 175.3 g/1 of NaCl and 88.2 g/1 of sodium citrate and is adjusted to pH 7 with a few drops of NaOH 10 N. The 10 x Denhardt's solution 30 contains 1 g of Ficoll, 1 g of polyvinylpyrrolidone and 1 g of human serum albumin per 500 ml of final volume.

After washing in the 6 x SSC solution at 42°C (3 h with 5 changes of bath), the filters are wiped with Joseph paper and subjected to autoradiography. 35 The filters are developed after 16 h. A fraction of IE 904706 - 15 - about 0.5% of the colonies was found to have hybridized with the 2 pools of probes. colonies from this fraction were taken up and purified. The plasmid DNA was prepared from each of 05 these colonies and this DNA was analyzed by digestion with either BamHI, or Hindlll, or both BamHI and Hindlll.

After analysis on agarose gel, the 5 plasmids obtained were found to have been linearized by BamHI 10 and by Hindlll. The double digestions make it possible to release a fragment corresponding to the whole of the cloned cDNA. The size of this fragment is about 1.2 kb in 3 cases and about 0.9 kb in the other 2 cases. For the following determination, one of the 0.9 kb frag-15 ments and one of the 1.2 kb fragments were selected and recloned (see section 6 below). 6) Determination of the sequence of urate oxidase cDNA On the one hand one of the 0.9 kb fragments (clone 9A) and on the other hand one of the 1.2 kb 20 fragments (clone 9C) were recloned in the DNA of the replicative form of single-stranded phage M13. The DNA of the M13 clones, containing the 0.9 kb fragment on the one hand and the 1.2 kb fragment on the other, was digested with exonuclease so as to generate a series of 25 overlapping Ml3 clones (procedure: "Cyclone I Bio- system" of IBI). Said clones were sequenced by the di-deoxyribonucleotide method (Sanger et al., PNAS-U.S.A. - 1977, 14, 5463-5467).

The nucleotide sequence of clone 9C is shown in 30 Figure 3, which also indicates, with an arrow, the start of clone 9A and, with a nucleotide symbol followed by an asterisk *, the sequenced nucleotides of clone 9A which are not identical to those of clone 9C (when matching the two sequences and the AccI and BamHI 35 restriction sites used in the subsequent constructions IE 904706 - 16 - (cf. 2)).

It is found that: - the nucleotide sequence of the longer fragment (clone 9C) overlaps that of the shorter fragment 05 (clone 9A) but for two differences (see Figure 3). One of the differences is quiescent and the other corresponds to a change from a tryptophan residue to a glycine residue. These differences may be due either to differences in the messenger RNA's isolated (cf. 2) 10 above) or to errors in the reverse transcriptase used when building the cDNA library (cf. 3) above).

In the case of the longer fragment, an ATG codon (in position 109 in Figure 3) opens an open reading frame corresponding to a polypeptide of 302 15 amino acids, with a molecular weight of about 34,240 Da, whose sequence corresponds to the partial sequence of purified A. flavus urate oxidase (cf. 4)).

Figure 4 shows the DNA sequence opened by the ATG codon and the polypeptide coded for, and, with 20 arrows opposite the polypeptide coded for, the sequenced peptides (cf. 4)) obtained by hydrolysis of A. flavus urate oxidase with trypsin and protease V8.

It is found that the sequence of the polypeptide terminates in the triplet Ser-Lys-Leu, which is 25 typical of peroxisomal location enzymes (Gould S.J. et al., J. Cell. Biology 108 (1989) 1657-1664).

EXAMPLE 2: Construction of three expression vectors for urate oxidase cDNA in veast: plasmid PEMR469 carrying an ADHS promoter. and plasmid 30 PEMR473 and plasmid PEMR515 carrying the artificial promoter of the invention The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now 35 in common use. The cloning techniques employed are IE 904706 - 17 - those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK in "Molecular Cloning, a laboratory manual" (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 05 4600 DNA synthesizer.

The following description will be understood more clearly with reference to Figures 5, 6 and 7, which respectively show restriction maps of plasmids pEMR414, pEMR469 and pEMR473. The symbols used in 10 these Figures will be specified in the description below. In the case where a site has been blunted by Klenow polymerase, it carries the index where the sites have been eliminated by ligation, they are indicated in brackets. 1) Construction of plasmid PEMR469: This plasmid was constructed from the shuttle vector E. coli-yeast pEMR414, constructed by successive ligations of the following components: - the Pstl-Hindlll" fragment - symbolized by 20 ++++ in Figure 5 - of plasmid pJDB207 (BEGGS, 1978: Gene cloning in yeast - p. 175-203 in: Genetic Engineering, vol. 2 - WILLIAMSON - Academic Press - London UK), comprising the upstream part of the ampicillin resistance gene Amp* of pBR322 (Sutcliffe, 1979, Cold 25 Spring Symp. Quart. Biol. 43, 779) and an endogenous 2μ fragment, B form, carrying the LEU2 gene of S. cere-visiae partially modified by the deletion of its promoter (called LEU2d), the locus STB (REP3) and the origin of replication of the 2μ fragment (HARTLEY and 30 DONELSON, 1980, Nature, 286, 860-865). The Hindlll end of this fragment has been blunted by the action of Klenow polymerase. It is denoted by HindHI* in Figure 5. - the Hindlll-Smal fragment - represented by 35 77777 in Figure 5 - of yeast chromosome V, containing - 18 - IE 904706 the URA3 gene with its promoter (ROSE et al., 1984, Gene, 29, p. 113-124). This Hindlll-Smal fragment originates from plasmid pFLl (CHEVALLIER et al., 1980, Gene 11, 11-19). The Hindlll end of this plasmid has 05 been blunted by the action of Klenow polymerase. - an Saml-BamHl fragment - symbolized by ' in Figure 5 - containing a synthetic version of the promoter of the ADH2 gene which differs from the natural version described by RUSSEL and SMITH (RUSSEL 10 et al. (1983) J. Biol. Chem. 258, 2674-2682) only by a few base pairs intended for introducing restriction sites. (The natural sequence could be used with only slightly different results.) The sequence of this fragment is given below: 15 20 25 30 35 IE 904706 - 19 - S M m I a u I 1 tCGGACGCGTCT cctctgccggaacaccgggcatctccaacttataagttgga 05 ............................................... " CCCTGCGCAGAGGAGACGGCCTTGTGGCCCGT AGAGGTTGAATATTCAACCT! AAATAAGAGAATTTCAGATTGAGAGAATGAAAAAAAAAAAAAAAAAAAAGGCAGAGGAG/ ---♦ ---_ + ..... ♦ - - -------4. ♦ TTTATTCTCTTAAAGTCTAACTCTCTTACTTTTTTTTTTTTTTTTTTTTCCGTCTCCTC- 10 * s P h GCATAGAAATGGGGTTCACTTTTTGGTAAAGCTATAGCATGCCTATCACATATAAATAGf --- ♦------- - - ♦------------------- ♦---------+ -------+ CGTATCTTTACCCCAAGTGAAAAACCATTTCGATATCG'TACGGATAGTGTATATTTATCl 15 gtgccagtagcgacttttttcacactcgagatactcttactactgctctcttgttgtttt ---♦ — - ------*-------♦---------♦ - — ------♦-------------— - CACGGTCATCGCTGAAAAAAGTGTGAGCTCTATGAGAATGATGACGAGAGAACAACAAAP TATCACTTCTTGTTTCTTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAATCAA — - ♦---------♦ -----------— — ♦ ---—-------------. — ATAGTGAAGAACAAAGAAGAACCATTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTT 20 · B C a 1 m a H 1 'T CTATCAACTATTAACTATATCGATACCATATGGATCCGTCGACTCTAGAi/GATCGTC ---*---------4------------------- ♦-------------------♦--- GATAGTTGATAATTGATATAGCTATGGTATACCTAGGCAGCTGAGATCTCCTAGCAG B a m H gactctagagA -------+- ctgagatctcctag 30 - the Bglll-Hindlll fragment - symbolized by mm in Figure 5 - carrying the 3' end of the yeast PGK gene. This fragment originates from complete di-35 gestion with Bglll of the Hindlll fragment of the yeast -20- IE 904706 chromosomal DNA, carrying the PGK gene described by HITZEMAN et al. (1982, Nucleic Acids Res., 10, 7791- 7808), which has only one Bglll site. This digestion makes it possible to obtain two Hindlll-Bglll fragments 05 of which the smaller, of about 0.4 kb, which carries the 3' end of the yeast PGK gene, is retained. The sequence of the latter fragment is described by HITZE-MANN et al. (op. cit.). The Bglll site is cloned in the BamHI site of the previous fragment (the BamHI and 10 Bglll sites therefore disappearing), and the Hindlll site, blunted by the action of Klenow polymerase, is cloned in the Pvull site of the PvuII-Pstl fragment of pBR322, described below. - the PvuII-Pstl fragment - symbolized by xxx 15 in Figure 5 - of pBR322, containing the origin of replication and the downstream part of the ampicillin resistance gene AmpR.

Plasmid pEMR414 formed in this way therefore contains the following components: 20 - an origin of replication and an ampicillin resistance gene AmpB permitting the replication and selection of the plasmid in E. coli cells. These components permit transformation in E. coli cells. - an origin of replication for the yeast (ARS), 25 the locus STB and the LEU 2 gene of S. cerevisiae without promoter and the URA3 gene of S. cerevisiae with its promoter. These components permit the replication and selection of the plasmid in S. cerevisiae cells and a sufficient partition efficacy in cells 30 containing the endogenous 2μ plasmid.

Plasmid pEMR414 was completely digested with the restriction enzymes Nhel and Clal. The small Nhel-Clal fragment containing the URA3 gene, hereafter called fragment A, was purified.

Plasmid pEMR414 was completely digested with - 21 - IE 904706 the enzymes Nhel and BamHI. The large Nhel-BamHI fragment containing especially the LEU2d gene and the origin of replication of plasmid pBR322, hereafter called fragment B, was purified. 05 The synthetic Clal-AccI fragment, containing the start of a gene coding for the protein deduced from the urate oxidase cDNA sequence (clone 9C), was also prepared. This fragment contains modifications, relative to clone 9C, introduced for the purpose of inser-10 ting codons which are customary in yeast (q.v. SHARP et al., 1986, Nucl. Ac. Res., vol. 14, 13, pp. 5125-5143) without changing the amino acids coded for. The sequence of this fragment, hereafter called fragment C, is as follows (the underlined nucleotides are those 15 modified relative to clone 9C): c A l c a c 1 I , 20 C G A T A T A C A C A A T G T CTG CT G T TA AjS G CTG C_TA_G_AT A C G G_T A A G G A C A kCG T TVU3AG T j --+-----——+—| TATATGTGTTACAGACGACAATTCCGACGATCTATGCCATTCCTGTTGCAATCTCAGA ! The plasmid of clone 9C (cf. Figure 3) was 25 digested with the enzymes AccI and BamHI. The Accl-BamHI fragment, which contains the end of urate oxidase cDNA, hereafter called fragment D, was purified. This fragment has the following sequence: 30 35 IE 904706 - 22 - Accl , * C7ACAAGG77CACAAGCACGAGAAG - --+--- — ---- +_---------+ (TCTTCCAAGICTTCCTCCTCTTC ACCGGTG7CCAGACGG7G7ACGAGA7GACC G7C7G7G7CC77C7GGAGGG7GAGA77GAG ---------+---------+------- — + TGGCCACAGGTCTGCCACATGCTCTACTCG CAGACACACGAAGACCTCCCACTCTAACTC 05 ACCTCTTACACCAAGGCCGACAACAGCGTC ATTG7CGCAACCCAC7CCA7TAAGAACACC TGGACAATGTGGTTCCGGCTGTTGTCGCAG 7AACAGCGTTGGCTGAGGTAA7TCT7G7GG ATTTACATCACCGCCAAGCAGAACCCCGTT ACTCCTCCCCAGCTG77CGGCTCCA7CCTG ------+ ------+-·--------+ TAAATGTAGTGGCGGTTCGTCT7GGGGCAA TGAGGAGGGCTCGACAAGCCGAGGTAGGAC GGCACACACTTCATTGAGAAGTACAACCAC ATCCA7GCCGC7CACG7CAACA77G7C7GC r--------+---------+---------+---------+---------+--------- + CCGTGTGTGAAGTAACTCTTCATGTTGGTG 7ACGTACGCCGAG7GCAG7TG7AACAGACG CACCGCTGGACCCGGATGGACATTGACGGC AAGCCACACCCTCACTCCTTCATCCGCGAC ---—-+—--------+ ---------+---------+---------+ GTCCCGACCTCGCCCTACCTGTAACTCCCG 7TCGGTGTGGGAG7GAGGAAG7AGGCGC7G AGCGAGGAGAAGCGGAA7G7GCAGG7GGAC G7GG7CCAGGGCAAGGGCA7CGA7A7CAAG ---------+-------.- +---------+--------- +---------+---------+ 7CCC7CC7C77CCCC77ACACG7CCACC7G CACCAGCTCCCGX7CCCG7AGC7A7AG7TC 7CG7C7CTGTCCGGCC7GACCGTGC7GAAG AGCACCAAC7CGCAG77C7GGGGCTTCC7G AGCAGAGACAGGCCGGAC7GGCACGAC77C 7CCTCGTTGACCG7CAACACCCCGAAGCAC CG7GACGAG7ACACCACAC7TAAGCAGACC 7GGGACCC7A7CC7GAGCACCGACG7CGAT GCAC7GCTCATG7GG7G7GAA7TCC7C7CG ACCC7CGCA7AGGAC7CG7GGC7GCAGCTA GCCACTTGGCAG7GGAAGAA7T7CAG7GGA C7CCAGCAGG7CCGC7CGCACG7GCC7AAG --------- +---------+---------+---------+---------+---------+ CGG7GAACCG7CACC77CT7AAAG7CACC7 CAGG7CCTCCAGGCGAGCG7GCACGGA7TC 77CGA7GCTACCTGGGCCACTGCTCGCGAG G7CAC7C7GAAGAC77T7GC7GAAGA7AAC ---------+---------+---------+ AAGCTACGA7GGACCCCG7GACGAGCGC7C CAGTGAGAC77C7GAAAACGACT7C7A77G AG7GCCAGCGTGCAGGCCAC7A7G7ACAAG ATGGCAGAGCAAA7CC7GGCGCGCCAGCAG ---------+------—- + ---------+---— -- — + -------— +-------—+ 7CACGGTCGCACG7CCGG7GA7ACA7G77C 7ACCG7C7CCT77AGGACCGCGCGC7CG7C CTGA7CGAGAC7GTCGAG7AC7CG77GCCT AACAACCACTA7T7CGAAATCGACC7GAGC GAC7AGCTCTGACAGCTCATGAGCAACGGA 7TG7TCGTCA7AAAGCTTTAGC7GGACTCG TGGCACAAGGGCC7CCAAAACACCGGCAAG AACGCCGAGCTCT7CGC7CC7CAG7CGGAC -------------------+---------+ ---------+---------+ --------- + ACCG7G77CCCGGAGGX77XGXGGCCG77C 77CCCGC7CCAGAACCCAGGAG7CAGCC7G CCCAACGGTC7GA7CAAG7G7ACCG7CGGC CGC7CC7C7C7GAACXCTAAAT7G7AAACC ---------+---------+--------.+ GGGT7GCCAGAC7AG77CACA7GGCAGCCG CCCAGCAGAGAC77CAGA777AACAT77GG AACA7GAXXCTCACG7TCCGGAG777CCAA CCCAAAC7G7ATATAG7C7GGGA7AGGGTA ---------+---------+---------+---------+---------+---------+ 77G7AC7AAGAG7GCAAGGCC7CAAAGG77 CCG777GACATA7A7CAGACCC7A7CCCAX 7AGCA77CA77CAC77G777777AC77CCA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ----------_ + --__-----+ + A7CG7AAG7AAG7GAACAAAAAA7GAAGG7 χτ77777777Τ7777777777777777777 AAAAAAAAAAAAAAAAAAAAAGGGCCCG·^ Ββη,ΗΙ TT77T7777TT7777TTT777CCCGGGCC7 AG IE 904706 - 23 - Fragments A, B, C and D were ligated to give plasmid pEMR469 shown in Figure 6, in which the symbols have the same meanings as in Figure 5, the novel Clal-AccI and Accl-BamHI fragments being symbolized by 05 -1¾¾¾ .

Plasmid pEMR469 carries a sequence coding for the protein deduced from the sequence of urate oxidase cDNA, under the control of a promoter called an ADH2 promoter, similar to the natural ADH2 promoter, com-10 prising the sequence M ] U t • tCCG7C7CC7C7GCCGGAACACCGGGCATC7CCAAC7 7A7AAGTTGGAG ............*.........................

AGAGGAGACGGCC7 TG7GGCCCGTAGACGTTGAATAT TCAACCTC A A A T AAG AGAA T.T T CAGAT T GAGAGAA7 GAAAAAAAAA AAAA AAAAAAAGGC AG AGG AG A ........................................--4...1-- 7 7 7A7 7C7CTTAAAG7CTAAC7C7C77AC77 77TT 7 7 77 7 T7TTT7 77 7CCG7C7CC7CT S P h TATA component I ,_, GCA7AGAAATGGGG7 7CAC7 7I77CG7AAAGC7A7AGCA7GCC7A7CACA7A7AAA7AGA ·-·(-.-· — .............*....................... _ CG7A7C7 7 7 ACCCCAAG7GAAAAACCA7 7 7CGA7 ATCG7 ACGGA7AG7G7A7 A7 7 7A7C7 25 * - GTGCCAGTAGCGACT777 7 7CACAC7CGACA7AC7CTTAC7AC7GCTC7C77G77G7 7 77 ...................

CACGG7CATCGC7GAAAAAAG7GTGAGC7C7ATGAGAA7GATGACGAGAGAACAACAAAA 7A7CAC7 7CT7G7 7 7C7 7C7 7GG7AAA7AGAA7A7CAAGC7ACAAAAAGCA7ACAA7CAA .......................*....................................

A 7 AG7GAAGAACAAAGAAGAACCAT 7 7A7C7 7 A7 AG 7 7CGAT G77777CG7A7G77 AGT 7 ^ 1 i ' J C Transcription j initiation region • C7 A7CAAC7A7 7AAC7A7 A7' 35 .............♦.......

GA7AG7 7GA7AA77GA7A7AGC - 24 - IE 904706 >·*· 2) Construction of plasmid PBMR4731.

Plasmid pEMK469 was completely digested with the enzymes Mlul and spin. The large Mlul-sphI fragment, containing tho urate oxidase gene, was then 05 ligated with the synthetic fragment, whose sequence is given below, corresponding to a part (ZOO bp) of the sequence upstream from the TATA component of promoter GAL7 of S. cerevlHlaa· said part comprising two high-affinity upstream activation sequences called UAS1 and 10 UAS?., which arc box ad off below (q,v. R.j. BRAH et al.. (1986) RMBO J., Vol. 5, n* 3, p. 603-608).

M i r U j IJASI CGCGreTAT^CTTCGGnOCACTOTTOAOCQAAdGC 1 cnt rndnTATAT TT TCTGTCA! AGATATCAAGCCTCGTGACAACTCGCncpGAGt AATCTATATAAAAGACAG1A C-------UAS2_____ a T1TCCTTAACCCAAAAATAAGGGAGAGOGTCCAAAAAOCBCTCOGACAACTGTTGACCGI - · . ............................,.........4..--- AAAGCAAT TGGOT T T ϊ TAT TCCC TCTCCCAGGT T T T T CG SQAGCCTQTTQACAACTGGCP g3t CCGAAGGAC TGOC TAT AC AG T G T TC AC AAAAT AGCC AAOC T GAAAA T A A TG T GT AGC ..................---..4.--------♦--------- CT f*GGCT TCCTGACCGATATGTCACAAGTGT T T TATCGGTTCGACTT T TAT TACACATCG S P h ! CTTTAGCTATGTTCAGTTAGTTTGGCATQ. ........................t----- GAAATCGA T ACAAG TCAATCAAACC Plasmid pEMR473 obtained in this way la shown in Figure 7, ih which the symbols have the same meanings as in Figure 6, the novel Hlul-Sphl fragment introduced being symbolised by AA , 3S plasmid PEMR473 therefore carries a sequence - 25 - IE 904706 coding for the protein deduced from tho sequence of urate oxidase cDNA, under the control of che artificial promoter of the invention, which comprises the sequence M ' UASI ccccrcϊοτecτ tcsfifiocrtcto< tonacon«Jocvci'>T tagatatat'i t tciutcat ........l·...........*..........l·........................ rtOATftipoficccTcOTQrtcnnCTCOcrrccono taatctatataaaaoacnuia Γ . _____________Γ _ _UAS?___ TTTCCTTAACCCAAAAATnAGOQAGAOOOtCCnAAAAGciiCTCaanCAACTUT tgaccoi" 10 .............................................................. aaaggaattooot r 11 tat rcccTCTcccAOon τ τ tcgcgaocctot tqacaactooca CAjrCCCAAOOACTeOCT AT ACAQ TC Τ TCACAAAAt AOCCAAGC TGAAAATAATGTQT AGC -.1--....-..--......................... — .....

CTpOOCT TCCTGACCOATATOTCACAAOTCIT TT TATCOQT TCGACT l 1 TATTACACATCO • 5 15 j| ΤΜΆ eenponont CTT TAOCTATOT TCAOTIAOT f TOOCAIOCCTATCeCATATAAATAOA ···>··..----......... ..........-----......... ΟΛΑΑ TCQA T ACAAQ ICrtA T C AAACCOT AC 00 A T AO 10 T AT AT Τ T AT C1 > OTOCCAOTAOCGACTt t TTTCACACTCOAOATACTCT TAC TACTOCTCTCTT01 TOT t T T CpCOOTCATCOCTOAAAAAAOTOtOeOCTCTATOAOAATOATaACOAOAOAACAACAAAA tatcacitcttotttcttcitootaaataoaatatcaaoctacaaaaaocatacaatcaa AT AO TCAAOAACAAAOAAOAACCAT T TATCTTATAQTTCOATOT Τ Τ T TC6TATGT t AQT T ® Transcription 1 Initiation region " J ctatcaactattaactaiat ....................

OATAOΤTOATAAT TOATATAQC 3) Construction of plasmid oBMRSist 30 Plasmid p&MR473 was partially digested with the enzyme Xbal and totally digested with the enzyme Mini.

The large XbaX-MluX fragment was purified. This fragment contains especially the sequences of the origin of replication and the locus STB of the 2μ fragment, the 35 LEU2d gene, the ampicillin resistance gene Amp*, the IE 904706 - 26 - origin of replication of pBR322 and the expression cassette for urate oxidase. On the other hand, it contains neither the URA3 gene nor that part of the 2μ fragment which is between the Xbal and Nhel sites. 05 The large Xbal-Mlul fragment was recircularized via the following sequence adapter containing Mlul and modified Xbal sticky ends: modified Xbal Tctaggctagcgggcccgcatgca CGATCGCCCGGGCGTACGTGCGCj Mlul Plasmid pEMR515 obtained in this way has only 15 one of the three components of the target FRT site of the recombinase coded for by the FLP gene of the 2μ fragment.

Plasmid pEMR515 therefore carries a sequence coding for the protein deduced from the sequence of 20 urate oxidase cDNA, under the control of the artificial promoter of the invention.

EXAMPLE 3: Transformation of the EMY761 yeast strain bv Plasmids pEMR469. PEMR473 and pEMR515 Transformation of the EMY500 and GRF18 yeast 25 strains by plasmid pEMR515 - Transformation with selection for the prototrophy of leucine Three non-isogenic strains of Saccharomyces cerevisiae were used as recipient strains: 30 - the EMY761 strain (Mata, leu2, ura3, his3, gal) - the EMY500 strain (Mata, leu2, ura3, pep4) - the GRF18 strain (Mata, leu2, his3) The GRF18 strain is well known to those skilled in the art (Gerry FINK, MIT, USA). The EMY761 and 35 EMY500 strains are related to the GRF18 strain. They IE 904706 - 27 - were obtained by successively crossing the GRF18 strain with a ura3 strain derived from the FLioo strain (deposited in the ATCC under ne 28 383) and with the 20B12 strain (Mata, tspl, pep4) described by E.W. JONES (E.W. 05 JONES et al. (1977) Genetics, 85, 23).

The GRF18 strain can be obtained by curing plasmid pEMR515 of the GRF18 pEMR515 (leu^) strain deposited in the CNCM under reference n° 1-920 on 28 December 1989, and the EMY500 strain can be obtained by 10 curing plasmid pEMR515 of the EMY500 pEMR515 (leu·4·) strain deposited in the CNCM under reference n° 1-919 on 28 December 1989.

These strains contain mutations (leu2 and ura3) capable of being complemented by the LEU2d defective 15 selection marker and the URA3 selection marker, which are present in each of plasmids pEMR469 and pEMR473.

The transformation technique used is a variant of that described by Beggs et al. (Beggs et al. (1978), Nature 275, 104-109). It consists in subjecting yeasts 20 to a protoplastization treatment in the presence of an osmotic stabilizer, namely sorbitol at a concentration of 1 M.

The precise transformation protocol is specified below: 25 a) 200 ml of liquid YPG medium (cf. Table I) are inoculated with about 5 x 10« cells of a culture in the stationary phase, and the culture inoculated in this way is agitated overnight at 30°C. b) When the density of the culture reaches 30 about 10-7 cells per ml, the cells are centrifuged at 4000 rpm for 5 min and the residue is washed with sorbitol 1 M. c) The cells are suspended in 5 ml of sorbitol solution 1 M containing 25 mM EDTA and 50 mM dithio- 35 threitol, and are incubated for 10 min at 30 *C.

It UU4fUO d) The cells are washed once with 10 ml of sorbitol 1 M and suspended in 20 ml of sorbitol. Zymo-lase-100T (a preparation obtained by partial purification of Arthobacter luteus culture supernatant on an 05 affinity column and containing fi-l,3-glucan laminari-pentahydrolase, marketed by SEYKAGAKU KOGYO Co. Ltd.) is added up to a final concentration of 20 μg/ml and the suspension is incubated at room temperature for about 15 min. e) The cells are resuspended in 20 ml of a medium containing sorbitol, called sorbitol YPG medium (cf. Table I below), and incubated for 20 min at 30°C, with gentle agitation. f) The cells are centrifuged for 3 min at 2500 15 rpm. g) The cells are resuspended in 9 ml of transformation buffer (sorbitol 1 M, Tris-HCl 10 mM pH 7.5 and CaCl2 10 mM). h) 0.1 ml of cells and 5 μΐ of DNA solution 20 (about 5 μg) are added and the suspension obtained is left for 10 to 15 min at room temperature. i) 1 ml of the following solution is added: polyethylene glycol PEG 4000 20%, Tris-HCl 10 mM pH 7.5 and CaCl2 10 mM. j) 0.1 ml of the suspension obtained in i) is poured into a tube containing leucine-free solid regeneration medium (cf. Table I below) which has been melted beforehand and kept liquid at about 45°c. The suspension is poured into a Petri dish containing a 30 solidified layer of 15 ml of leucine-free solid regeneration medium. k) Step j) is repeated with the remainder of the cell suspension obtained in h).

The transformed strains start to appear after 35 three days.

IE 904706 - 29 - A transformed strain EMY761 pEMR469 (leu-*-), three transformed strains EMY761 pEMR473 (leu-·-) (clones 1, 2 and 3), a transformed strain EMY761 pEMR515 (leu-*·), a transformed strain EMY500 pEMR515 (leu-*-) and 05 a transformed strain GRF18 pEMR515 (leu-·-) were thus retained.

TABLE I Principal media used in Examples 3. 4. 4bis. 6 and 7 10 - uracil-free solid medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) 5.0 g of casein hydrolyzate (Casamino acids from DIFCO) 10 g of glucose 5 20 g of agar Mix all the ingredients in distilled water and make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120°C. - uracil-free liquid medium Use the formulation of the uracil-free solid medium 20 without the agar. Autoclave for 15 min at 120°C. - leucine-free solid medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) 20 mg of adenine 20 mg of uracil 20 mg of 1-tryptophan 25 20 mg of 1-histidine 20 mg of 1-arginine 20 mg of 1-methionine 30 mg of 1-tyrosine 30 mg of 1-isoleucine 30 mg of 1-lysine 50 mg of 1-phenylalanine 30 100 mg of 1-glutamic acid 150 mg of 1-valine 400 mg of 1-leucine 20 g of glucose 20 g of agar Mix all the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120ec. After autoclaving, add 35 200 mg of 1-threonine and 100 mg of 1-aspartic acid.

IE 904706 - 30 - - leucine-free solid regeneration medium Use the formulation of the leucine-free solid medium, mixing in 30 g of agar instead of 20 g and adding 182 g of sorbitol to the mixture. - leucine-free liquid medium 05 Use the formulation of the leucine-free solid medium without the agar. Autoclave for 15 min at 120°C. After autoclaving, add 200 mg of 1-threonine and 100 mg of 1-aspartic acid. - liquid YP medium 10 g of yeast extract (Bacto-yeast extract from DIFCO) 20 g of peptone (Bacto-peptone from DIFCO) Mix the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120*0. - liquid YPG medium Use the formulation of the liquid YP medium, adding, 15 after autoclaving, glucose at a concentration of 20 g/1. - sorbitol YPG medium Use the formulation of the liquid YPG medium, adding, after autoclaving, sorbitol at a concentration of 1 M. 70 - ethanol-glycerol YP medium Use the formulation of the liquid YP medium. After autoclaving, add 10 ml of ethanol 100% (1% final concentration) and 30 g of glycerol. - ethanol-alycerol-galactose YP medium Use the formulation of the liquid YP medium. After 25 autoclaving, add 10 ml of ethanol 100%, 30 g of glycerol and 30 g of galactose.

EXAMPLE 4; Expression of urate oxidase bv the EMY761 pEMR469 rieu-> and EMY761 PEMR473 (leu-'l 30 (clones 1. 2 and 3) strains - Immunodetec tion bv Western blot - Assay of the urate oxidase activity and the soluble proteins 1) Expression of urate oxidase: a) Transformed strains 35 In a first stage, a colony of each of the IE 904706 - 31 - EMY761 pEMR469 (leu-) and EMY761 pEMR473 (leu-) (clones 1, 2 and 3) strains was cultured in 25 ml of leucine-free liquid medium (cf. Table I, Example 3). This made it possible to obtain and maintain a large number of 05 copies of plasmids by carrying out the selection for complementation of the leu2 mutation by the LEU2 gene carried by plasmids pEMR469 and pEMR473.

After 22 h at 30 °C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The 10 residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium for the EMY761 pEMR469 (leu-) strain and in 20 ml of 15 ethanol-glycerol-galactose YP medium (cf. Table I, Example 3) for the EMY761 pEMR473 (leu-) strain. The cultures were incubated again at 30°c for 27 h, with agitation. c) Control strain 20 The non-transformed EMY761 strain, i.e. the EMY761 strain without plasmid, was cultivated as above except that the first culture was carried out in liquid YPG medium. It was subjected on the one hand to induc tion in 10 ml of ethanol-glycerol liquid YP medium and 25 on the other hand to induction in 10 ml of ethanol-glycerol-galactose YP medium. 2) Preparation of the samples: a) The cells cultivated in la), lb) and lc) were centrifuged and the supernatant was removed. The 30 residues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of tri-ethyleneamine buffer, TEA, of pH 8.9. About 300 μΐ of cells taken up in said buffer were lyzed in the pre-35 sence of glass beads (from 400 to 500 μιη in diameter), IE 904706 - 32 - representing about half the final volume. This mixture was agitated vigorously in a Vortex 4 times for 1 min, the samples being placed in ice for 30 s between grinding operations. The liquid was withdrawn from the 05 tubes with a Pasteur pipette and transferred to a microtube. The glass beads were washed once with about 200 μΐ of TEA buffer of pH 8.9. The beads were agitated in a Vortex once for 1 min and the liquid was withdrawn with a Pasteur pipette and added to the above 10 lyzate. The lyzate was then centrifuged in a microtube for 5 min at 7000 rpm. The supernatant was cautiously withdrawn and stored at -20°C for Western blot, assay of the urate oxidase activity and assay of the total soluble proteins. The residue of the lyzed cells was 15 stored separately at -20 °C for Western blot (cf. 3) below).

Furthermore, samples of the cultures prepared in la) and lb) were taken in the following manner before induction: 2 ml of culture were centrifuged for 20 10 min at 7000 rpm. The residues were taken up in 500 μΐ of distilled water and centrifuged again for 5 min at 7000 rpm. The residues were taken up in about 200 μΐ of TEA buffer of pH 8.9 and lyzed as above in the presence of glass beads. The supernatants and the 25 residues of the lyzed cells were stored separately at -20°C. Assay of the oxidase activity and assay of the total soluble proteins were performed on the supernatants. 3) Immunodetection of the urate oxidase bv Western 30 blot: a) Procedure The residues and the supernatants of the different samples were subjected to a Western blot - a technique well known to those skilled in the art -35 which comprises the following steps: IE 904706 - 33 - - solubilization of the residue by boiling for 10 min in a buffer, called a loading buffer, consisting of Tris-HCl 0.125 M pH 6.8, SDS 4%, bromophenol blue 0.002%, glycerol 20%, β-mercaptoethanol 10% (accor- 05 ding to the protocol described by LAEMMLI (U.K.

LAEMMLI, Nature, 227 (1970), 680-685)) (step performed solely for the residues); - electrophoretic separation of the different proteins contained in the solubilizate, according to the 10 protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970), 680-685); and - transfer of said proteins contained in the gel on to a nitrocellulose filter (according to the technique of H. TOWBIN et al., Proc. Natl. Acad. Sci. USA 76 15 (1979) 4350-4354).

Immunodetection, performed according to the technique of BURNETTE (W.W. BURNETTE, Ana. Biochem. 112 (1981) 195-203), involves the following successive operations: 20 rinsing the nitrocellulose filter for 10 min with a buffer A (Tris-HCl 10 mM, NaCl 170 mM, KC1 1 mM); • bringing the nitrocellulose filter into contact with a buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml) for 30 min at 37*C; 25 · bringing the nitrocellulose filter into contact with an immune serum (polyclonal antibodies recognizing A. flavus urate oxidase) for 1 h at 37eC; • rinsing the nitrocellulose filter with buffer B; bringing the nitrocellulose filter into contact with 30 a solution of protein G, labeled with iodine 125 at a rate of 0.1 microcurie/ml, for 1 h at 37*C; • rinsing the filter with buffer A; • drying the filter between two absorbent sheets; • bringing the filter into contact with an X-ray film; 35 and IE 904706 - 34 - • developing the film. b) Results It is found that the EMY761 pEMR469 (leu-*) and EMY761 pEMR473 (leu-*) (clone 1) strains produce a pro-05 tein with an apparent molecular weight of about 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase (prepared in rabbits by techniques well known to those skilled in the art: q.v. VAITU- KAITIS et al. (1981) "Methods in enzymology", Academic 10 Press, New York, vol. 73, p. 46) and which is absent from the control strain.

Comparison between the amounts of this protein for the residues and the supernatants makes it possible to deduce that about 80% of said protein is in soluble 15 form in the lyzate. 4) Assay of the urate oxidase activity: The urate oxidase activity was measured on the supernatants of the lyzed cells. a) Principle 20 The conversion of uric acid to allantoin is followed by the decrease in absorbance at 292 nm. The reaction is as follows: o H NCONH^N^O c 7Urate oxydase | | L3>L_i L -> J—L ° N S-----°" H20 + 02 H20 + co2 Uric acid Allantoin 30 (absorbs at 292 nm) b) Reagents a) TEA 0.05 M pH 8.9/EDTA buffer - 7.5 g of TEA (reagent for analysis - Prolabo ref. 35 287.46.266) are dissolved in 400 ml of distilled water; IE 904706 - 35 - - 0.372 g of Complexon III (Merck - ref. 8418) is dissolved in 50 ml of distilled water; - the two solutions are combined and made up to 500 ml (solution 1); 05 - the pH of this solution is adjusted to 8.9 with HC1 0.2 N; and - the volume is made up to 1000 ml with distilled water (solution 2). b) Uric acid stock solution 10 - 100 mg of uric acid (Carbiochem - ref. 6671) are dis solved in 50 ml of solution 1; - the pH is adjusted to 8.9 with HCl 0.2 N; and - the volume is made up to 100 ml with distilled water.

The solution obtained can be stored for one 15 week at 4°C. c) Uric acid substrate solution - 1.5 ml of uric acid stock solution (Carbiochem - ref. 6671) are taken and diluted to 100 ml with TEA buffer (reagent for analysis - Prolabo ref. 287.46.266).

This solution must be used the same day. c) Procedure The following volumes are introduced into the quartz cell of a spectrophotometer set to 292 nm and thermostated at 30 "C: 25 - 600 μΐ of uric acid substrate solution (preheated to 30°C); and - 100 μΐ of the above supernatants to which 200 μΐ of TEA pH 8.9 have been added (preheated to 30*C).

After mixing, the change in optical density 30 (sometimes abbreviated to OD hereafter) is read off every 30 s for 5 min. &E, the variation in optical density per minute, is deduced from these readings. d) Expression of the results The urate oxidase enzymic activity A, expressed 35 in U/ml, is calculated from the ^E measurement with the IE 904706 - 36 - aid of the formula . ΔΕ x Vr x d A -- I x V x PE 05 in which the symbols Vr, d, I and VPE respectively represent the reaction volume (0.9 ml), the dilution factor (2), the extinction coefficient of uric acid at 292 nm (12.5) and the volume of the test sample (0.1 10 ml).

) Assay of the total soluble proteins in the lyzates: The protein assay kit from BIORAD was used for assaying the total proteins present in the supernatant of the lyzed cells. It is based on the observation 15 that the maximum absorbance of an acid solution of Coo-massie brilliant blue g-250 changes from 465 nm to 595 nm when proteins become attached thereto (q.v. Reisner et al., Anal. Biochem., 64, 509 (1975)).

Procedure 20 The following volumes are introduced into the cell of a spectrophotometer set to 595 nm: - 10 fil of sample to which 790 μΐ of distilled water have been added; and - 200 μΐ of concentrated Dye reagent (Biorad).

The ingredients are mixed and the optical den sity is read off at 595 nm. A calibration range with increasing concentrations of BSA (bovine serum albumin) was prepared in this way. The unknown concentration of the total proteins in the lyzates is read off on the 30 calibration curve obtained. 6) Results: The results obtained are collated in Table (II) below, which specifies, for each strain, the culture medium, the carbon and energy source of the culture, 35 the urate oxidase activity in U/ml, the amount of total - 37 - IE 904706 soluble proteins in mg/ml and the percentage of urate oxidase in the total soluble proteins. This last parameter is calculated by assuming that the specific activity of the recombinant protein is identical to 05 that of the urate oxidase obtained from A. flavus: 30 U/mg. 15 20 25 30 35 IE 904706 sissil i i | | iI iiiiil _ » ^ -, 1 — | I N—J -—o '"Ο I I '"J CT* Cn CT^ CT\ rf cr· CT) 22 22 £j* 2 2 2 2 » H-i )_-k H' t—‘ t—* t—* »—' M +I-* --. —_« 1¾ **-* *ra Ό *T3 3 3 *ry *Ό T3 *O 1 I i 1 a I i g s §. as||| - 2 I 2 2 g I 2 I 2 § §2222 $ s a a a a a a s §. §. a a a s g· S' S' S* S’ S ® ? i ? ^ §SSSc ,1.1.1.1s 1111s sllll non o n o p p. P. g g g g g § § § § CD Ct> (D CD O Ο O CD u> fo >-* ro «:η>^:(Τ)«:(θ-=π>·<Φ o ® ® 2. 2 IT! S' S S' S' 3 S' f | f f ·§. O g. g £. 0 &||s||.|||b II I II M f π |„g S Sr § 2r i Sr § 2? § Sr ^ ΐ. S' ST 6 . 1 ._. ^ . >i^ - _ Φ CD CD CD CD ^n S> o ^n ^ OOQOJ2 3 (0 (Ο o i'Ort 22222 g g § g § o-h-t-H-i-Saf 33233 33333 g· £' £· S' .S' *8 * S *8 *8 *8 *8 *8 3 § § g § ε ε ε ε a-® sr sr ετ ετ sr !?!?"!? £.£.0.0.0. 1 g ! s 1 S.2.2.S.3 ο ο ο ο o 0-0-0-0-9-. S’ S' S' S’ σ> w w w m 9-9-9-9 9 S g S S CD CD ΛΛ^ίΟ'ΠΛΜΰηΐ'αΦ o £. £. m2 S airt^r+^r+Cur+l^r*· q rr fed s g sf sis |s! § § § § § *a ·& *& *& *& K o S2-S2-S2-S&S2. 11111 g g § § § &s§ a ISS;!SS;S^iSS;(iiS; *9. 'p. fi. "p. § ° § § § 1 £ ~ S5 £ *3 % 2 2 S % ^ " Φ «, | gggggggggg 3.0P.9.9.00000 ^ c: *-» a> ^ /S Λ /N /N. ___ CU eg- S K S a <= pppoop p p P P p p ", o L*><=> o c=> <=> gji <=> <=> <=> Q <=> ►-* t_n c_n lji *—* ►—*'—*'—*►—* ·** ^ ^ *-< CLi m CD •-e o Π3 <-f -—- *-s a> 3 o y—" ro rf*. lj> oj c_n u>cou>to«pfc ^71 ST go ^ O Li Co Ot !_* 1» ►_* CD ro cji^JCD^voS^g-O^ — M g- CD* O *ry X CD w ·-· M O CL· o )—· Q; CD G W =3 & (D ft £ £ £ S o P P P £ F P P P P p o s-.S g S S LTI <=» C5<=>oou>qr£0 r*· CD CD Cl t— r-t H =3 O 0> GO c-t <-t CD CD IE 90470b - 39 - This Table shows that: a) in the presence of glucose, the ("repressed") level of urate oxidase is not detectable in the case of the artificial promoter of the invention 05 (strain EMY761 pEMR473 (leu-*) (clone 1, 2 or 3)), whereas it is detectable in the case of the ADH_, promoter (strain EMY761 pEMR469 (leu**·)). In the presence of glucose, therefore, the artificial promoter permits better repression than the ADHa promoter. b) in the absence of glucose but in the pre sence of ethanol/glycerol, the level of urate oxidase is high for the ADH2 promoter (about 14% of the total soluble proteins) and low but detectable for the artificial promoter. c) in the absence of glucose but in the pre sence of ethanol/glycerol/galactose, the level of urate oxidase retains a value little different from that of the previous case for the ADH2 promoter (about 13.5% of the total soluble proteins), but reaches a high value 20 (about 18% of the total soluble proteins) for the artificial promoter.

The artificial promoter of the invention therefore permits a high level of production of recombinant protein and has three levels of expression: 25 - zero level a) - basic level b) - maximum level c) EXAMPLE 4bis: Expression, in an Erlenmeyer flask, of urate oxidase cDNA by the EMY761 pEMR515 30 (leu-M . EMY500 PEMR515 ileu-M and GRF18 PEMR515 (leu-1-) strains A colony of each of the above three strains was cultured in 20 ml of leucine-free liquid medium.

After one night at 30eC, with agitation, the 35 three cultures were centrifuged for 10 min at 7000 rpm. - 40 - IE 904706 The cell residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol-galactose YP 05 medium (cf. Table I, Example 3). The cultures were incubated again at 30*C for about 20 h, with agitation. As a control, a culture of each non-transformed host strain was prepared.

The cells of each of the six cultures are re-10 deposited by centrifugation and the supernatant is removed. The residues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of TEA buffer of pH 8.9 and the grinding and re-15 moval of the particles by centrifugation were carried out in the manner described in Example 4, 2). The supernatant of each culture is used, as before, for assay of the urate oxidase and the total proteins. The principal results obtained are collated in Table III. 20 below: 25 30 35 IE 9047Uo - 41 - TABLE III Strain/culture conditions Orate oxidase Total soluble % of urate oxidase activity proteins in the soluble (ϋ/ml) (mq/ffll) proteins 05---- GRF18 pEMR515 (leu+)/a) < 0.1 2.2 < 0.05 EHY500 pEMR515 (leu*)/a) < 0.1 0.9 < 0.05 EHY761 pEMR515 (leu*)/a) < 0.1 1.8 < 0.05 10 GRF18 pEHR515 (leu*)/b) 38 5.4 23 EMY500 pEHR515 (leu*)/b) 20 2.5 26 EHY761 pEMR515 (leu*)/b) 33 4.2 26 a): the strains are cultivated in the presence of glucose (non-induction conditions) 15 b): the strains are cultivated in the absence of glucose and in the presence of galactose (induction) The promoter according to the invention therefore permits a high level of expression of urate oxidase in three non-isogenic strains.

EXAMPLE 5: Construction of two expression vectors for β-aalactosidase in yeast: plasmid pEMR429 carrying an ADH_ promoter. and plasmid pEMR437 carrying the artificial promoter of the invention 25 The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J.

SAMBROOK m "Molecular Cloning, a laboratory manual" (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer. 1) Construction of plasmid pEMR429: 35 Plasmid pEMR414 (cf. Figure 5) was completely IE 904706 - 42 - digested with the restriction enzyme BamHI. The BamHI site, located between the promoter sequences (ADH2) and terminator sequences (PGK), is unique. The linear DNA of the plasmid is purified by elution from an agarose 05 gel after electrophoresis. Plasmid pMC1403 (ref. Casa-daban et al. (1980), J. Bacteriol., 143, 971-980) was completely digested with the enzymes BamHI and EcoRI, which made it possible to release a BamHI-EcoRI DNA fragment of about 3 kb containing the essential part 10 (upstream part) of the sequence coding for E. coli β-galactosidase. The complete sequence was reconstituted with the aid of the synthetic fragment of the following sequence: , c EcoR I. 5' aATTTCAGCTGAGCGCCGGTCG AGTCGACTCGCGGCCAGC CTACCATTACCAGTTGGTCTGGT GATGGT AATGGTCAACCAGACCA GTCAAAAATAATAATAAG CAGTTTTTATTATTATTCCTAGa BamHI The BamHI-EcoRI fragment originating from the double digestion of pMC1403 is ligated at EcoRI with the above synthetic fragment.

The BamHI-BamHI fragment obtained is then 30 ligated with the linear DNA of plasmid pEMR414 digested with BamHI, to give plasmid pEMR429 shown in Figure 8, in which the symbols have the same meanings as in Figure 5, the BamHI-EcoRI and IcoRI-BamHI fragments introduced being represented by .

In this plasmid, the sequence coding for β- IE 904706 - 43 - galactosidase is under the control of the ADH2 promoter described in Example 2. 2) Construction of plasmid pEMR461: Plasmid pEMR429 was completely digested with 05 the enzymes Mlul and Sphl. The large MluI-SphI fragment, containing the β-galactosidase gene, was then ligated with the synthetic fragment whose seguence, given below, comprises the upstream activation sequences (UAS) of the promoter of the GAL7 gene of §_s_ 10 cerevisiae and Mlul and Sphl sticky ends.

M u is cgcgtctatacttcggagcactgttgagcgaaggctcat t ac A ΓΑΤΑ t tttctgtcat ....................(....... — .............. — ......____ AGATATGAAGCCTCGTGACAACTCGC7TCCGAGTAATCTATATAAAAGACAGTA TTTCCTTAACCCAAAAATAAGGGAGAGGGTCCAAAAAGCGCTCCGACAACTGTTGACCGT AAAGCAATTGGGTT7 TTATTCCCTCTCCCAGGT TTTTCGCCAGCCTC7 TCACAACTGGCA t GATCCCAAGCACTGGCTATACAGTGTTCACAAAATACCCAACCTCAAAATAATGTGTACC CT AGGCT TCCTGACCGATATGTCACAAGTGT T 7 TATCGGT TCGACT T T TAT TACACATCG • s P h 25 C7TTAGCTA7GT7CAGTTAGTTTGGCATG· GAAATCGATACAACTCAATCAAACC» Plasmid pEMR461 obtained in this way is shown 30 in Figure 9, in which the symbols have the same meanings as in Figure 8, the novel MluI-SphI fragment introduced being symbolized by OIL * In this plasmid, the sequence coding for β-galactosidase is under the control of the artificial 35 promoter of the invention, described in Example 2.

IE 904706 - 44 - EXAMPLE 6: Transformation of the DBY746 S. cerevisiae strain by plasmids pEMR429 and pEMR46l Transformation with selection for the proto-05 trophy of uracil: A colony of the DBY746 strain, which is (Mata, his3, leu2, ura3, trpl, cyhR) (ROSE et al. (1981), PNAS USA, 78, 2460-2464), was used to inoculate 100 ml of a medium called liquid YPG medium (cf. Table I of Example 10 3). When the cell density had reached 10-7 cells per ml, the cells were treated with lithium acetate 0.2 M for transformation by a technique well known to those skilled in the art and described by ITO et al. (ITO et al., 1983, J. Bacterioloqy 153, 163-168).

The DBY746 cells were transformed in parallel with about 1 μg of each of plasmids pEMR429 and pEMR461. The transformed cells are selected for the auxotrophic character of uracil (ura+) on a medium called uracil-free solid medium (cf. Table I of Example 20 3). A transformed strain DBY746 pEMR429 (ura*) and a transformed strain DBY746 pEMR461 (ura+) were thus retained.

EXAMPLE 7: Production of B-oalactosidase with the aid of the DBY746 PEMR429 fura-*-) and DBY746 25 PEMR461 (ura~*~) strains 1) Expression of B-galactosidase: A transformed colony DBY746 pEMR429 (ura^) and a transformed colony DBY746 pEMR461 (ura-*-) were each used to inoculate 20 ml of uracil-free liquid medium to 30 which tryptophan (10 mg/1) had been added beforehand. After one night at 30*C, with agitation, 1% of glucose is added and culture is allowed to continue for 4 h. A check is then made to see that there is still some glucose in the cultures. An aliquot is taken in order 35 to assay the B-galactosidase.

IE 904706 - 45 - After one night at 30°C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. 05 Expression of β-galactosidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium (cf. Table I, Example 3) for the DBY746 pEMR429 (ura-4-) strain and in 20 ml of ethanol-glycerol-galactose YP medium (cf. Table I, Example 3) for the DBY746 pEMR461 10 (ura-*-) strain. The cultures were incubated again at 30’c overnight, with agitation. 2) Preparation of the samples and assay; The cells cultivated above were centrifuged and the supernatant was removed. The residues were taken 15 up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of β-galactosidase assay buffer (EDTA 2 x 10-3 M; Na2HP04 7 x 10~2 M; NaH2P04 3 x 10-2 M; MgSO* 10-3 M; MnS0A 2 x 10"3 M). About 300 μΐ 20 of cells taken up in said buffer were lyzed in the presence of glass beads (from 400 to 500 μιιι in diameter), representing about half the final volume. This mixture was agitated vigorously in a Vortex 4 times for l min, the samples being placed in ice for 30 s between grin-25 ding operations. The liquid was withdrawn from the tubes with a Pasteur pipette and transferred to a microtube. The glass beads were washed once with about 200 μΐ of TEA buffer of pH 8.9. The beads were agitated in a Vortex once for 1 min and the liquid was with-3 0 drawn with a Pasteur pipette and added to the above lyzate. The lyzate was then centrifuged in a microtube for 5 min at 7000 rpm. The supernatant was cautiously withdrawn and stored at -20°C for Western blot, assay of the urate oxidase activity and assay of the total 35 soluble proteins. The residue of the lyzed cells was IE 904706 - 46 - stored separately at -20°C.

The β-galactosidase activity was assayed by the technique of PARDEE (PARDEE et al.# J. Mol. B. (1959), 1, 1656-178). 05 Furthermore, the total soluble proteins were assayed using the BIORAD protein assay kit, as described in Example 4.

The results obtained are collated in Table IV below: 10 ΤλΒίΕ IV Strain Carbon and energy β-Galactosidase Total soluble Culture medium source of the activity proteins culture U/ml j:g/ml 15----- DBY746 pEMR429 glucose 59 375 liquid uediui (ura*) without uracil + tryptophan (10 mg/1) + glucose (U) DBY746 pEHR429 ethanol/glycerol 6500 1700 ethanol-glycerol (ura*) YP medium DBY746 pEMR461 glucose 0 350 liquid medium (ura*) without uracil + tryptophan (10 mg/1) + glucose (1¾) 25----- DBY746 pEMR461 ethanol/glycerol/ 480 520 ethanol-glycerol- (ura*) galactose galactose YP medium This Table shows that: 30 - m the presence of glucose, the EMY746 pEMR429 (ura+) strain produces a small amount of β-galactosidase, whereas this protein is not detected for the DBY746 pEMR461 (ura-4-) strain. The artificial promoter of the invention therefore permits better repression than the 35 ADH2 promoter.

IE 904706 * - 47 - - under induction conditions, the artificial promoter leads to a high level of expression of β-galactosldase, although under these conditions it is lower than the level obtained with the ADHa promoter. 05 EXAMPLE 8; Construction of two vectors for the expression and secretion of the human cytoklnln crro-ft in veastt Plasmids PEMR575 and PEMR583 carrying the artificial promoter of fchS. invention 10 The Examples described above concern proteins whose localisation is intracellular. Now, it is known that yeast can secrete recombinant proteins in the culture medium. The use of the metabolic pathway leading to secretion of the protein has several irapor-15 tant advantages: 1 - It enables a reasonably pure and correctly matured product to be recovered from the culture supernatant. 2 - It enables the protein to benefit from the modifi- 20 cations associated with the secretion pathway, such as the formation of disulfide bridges, glycosyla-tion etc.

There are several proteins or polypeptides naturally secreted by yeast. In the majority of known 25 eases, these proteins are synthesized in the form of a longer precursor whose NHa-terminal sequence is decisive for entry into the metabolic pathway leading to secretion. In certain cases, these NHa-terminal sequences can be used for the secretion of heterologous 30 proteins. Among these sequences, it is known to use the pre-pro system of the alpha pheromone. The alpha sex pheromone of yeast is a peptide of 13 amino acids which is secreted in the culture medium by S. cere-visiae yeasts of the Mata sex type.

The alpha factor arrests the cells of the oppo- IE 9047UO - 48 - site sex type (Mata) in tne G 1 phase and induces the biochemical and morphological change# necessary for conjugation of the 2 types of cells. Kurjan, J, and Morskowitt, I. (3082), Cell, 30, 933-943, cloned the OS atiuctural gene of the alpha factor and deduced from the sequence of this gerte that this factor of 13 amino acid» i« nynthttsitiid in the form of a pre-pro precursor protein of 16b amino acids. Tha precursor contain» a hydrophobic amino-torrainnl sequence of 22 amino acids 10 foiiowud by λ sequence of 61 amino ucid» containing 3 glycosylation nitan, followed finally by 4 copies of the a factor, These 4 copies are «operated by spacer Goquoncon and the mature protein in rnleased from the precursor by virtue of the following enzymic activi-15 ties: 1 - an ondopoptidase of the cathepain D typo (product of the KEX2 gene, called yscF) which cleaves Lys-Arg dipeptides at the car boxy terminal and. 2 - on exopeptidaea of the oarboxypeptidase type 20 (product of tha KEX1 gene) which cleaves the basic residues at the carboxy terminal ond of the axcised peptides. 3 - a dipeptidylaminopeptidase (called A) (product of tha STE13 gens) which removes the Olu-Ala and Asp-Ala doublets, 25 λ first example of a protein which ie secreted by this system and uses the promoter of the invention is the human cytokinin gro-ft. The cDMA of this protein, which la called either gro-i3 (fl. HaaKill et al., 1990, Proc. Natl. Acad. 3ci. USA, 87, 7732-7736) or 30 MXP-2& (p. Tekamp-Olson et al., 1990, J. Exp. Had,, 172, 911-919) was recently cloned and sequenced, gro-β belongs to a family of cytokinins whose members appear to be involved in modulation of the inflammatory response and in activities of the growth factor type.

The Applicant, tested the use of the promoter - 49 - IE 904706 for the secretion of gro-β by S. cerevislae. To do this, it replaced the natural signal sequence of gro-β with the pre-pro sequence of the alpha pheromone and placed the precursor of gro-β behind the promoter of 05 the invention. 1 - Construction of plasmid pEMR530 (cloning vector): Plasmid PEMR473 described above (Example 2 2) -Figure 7) was digested with the enzymes Xhoi and Sail and the large fragment, hereafter called fragment E, 10 was isolated. This large fragment comprises the sequences of the URA3 gene, the origin of replication and the locus STB of the 2μ fragment, the ampicillin resistance gene Amp", the origin of replication of plasmid pBR322 and the UAS of the promoter of the GAL7 15 gene of s. cerevislae. as well as the terminator of the PGK gene.

A double-stranded oligonucleotide sequence of about 400 base pairs, called fragment F, was synthesized in the form of an Xhol-Sall fragment. This 20 sequence brings the TATA region and the initiation region of the ADH2 promoter, which is extended by a synthetic sequence preceding the start of the pre-pro region of the alpha pheromone. The sequence of this pre-pro region of the alpha pheromone differs from that 25 described by Kurjan and Herskowitz, 1982, Cell, 30, 933-943, in the introduction of a Hindlll site by the silent mutation of the TCT codon - corresponding to serine 81 of the precursor of the pheromone - to AGC. The whole sequence of the fragment is given below: 30 35 IE 904706 - 50 - X h 0 tTCGAGATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTC - +·---[-----------------4·---------*---------♦--------- lTATGAGAATGArGACGAGAGAACAACAAAAATAGTGAAGAACAAAG 05 ‘ TTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTATCAATCAGATCTA AAGAACCATTTArCTTATAGTTCGATGTTTTTCGTATGTTAGTIGATAGTTAGTCTAGAT ATATTAATAAAAAATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTC - — — — — — — - — — - — — — - — — — — — ♦ — — - — - - * — — — - - - - TATAATTATTTTTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCGTAGGAG cgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctga *---------------------------------*---------*--------- GCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGGCCGACT AGCTGTCATCGGTTACTTAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATT7TC ---- - - - — is tcgacagtagccaatgaatctaaatcttcccctaaagctacaacgacaaaacggtaaaag caacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaa ----------------♦ - - *---------*--------- gttgtcgtgtttattgcccaataacaaatatttatgatgataacggtcgtaacgacgatt H i n d S I a I l I I AGAAGAAGGGGTAAG C rTGCATGCCTGCAGG1_ TCTTCTTCCCCAT TC GAACGTACGGACGTCCAGCTf Fragments E and F were ligated to give plasmid 30 pEMR530 shown in Figure 10, in which the symbols have the same meanings as in Figure 7, the novel Xhoi-sall fragment (fragment F) introduced being represented by: This plasmid comprises the artificial promoter 35 of the invention, the sequence of which was given in IE 904706 - 51 - Example 2. 2 - Construction of plasmid pEMR583 (expression plasmid for the human cytokinin gro-B) Plasmid pEMR530 was completely digested with 05 the enzymes Nhel and Hindlll. The small Nhel-Hindlll fragment, containing the artificial promoter and the pre-pro region of the a pheromone, as well as the URA3 gene, was purified (hereafter called fragment G).

Plasmid pEMR473 was completely digested with 10 the restriction enzymes Nhel and BamHI. The large fragment (hereafter called fragment H), comprising the origin of replication and the locus STB of the 2μ fragment, the LEU2d gene, the ampiciilin resistance gene, the origin of pBR322 and the terminator of the pgk 15 gene, was purified.

The cDNA of gro-β was cloned and sequenced according to the method described by Tekamp-Olson et al., op. cit. The sequence of the cDNA of gro-β (described in detail in said reference - in particular 20 Figure 2) has an EcoRl site (sequence: 5'-gaattc) which covers the ATT codon (isoleucine in position +18 of the mature sequence of gro-β, Tekamp-Olson et al., op. cit.) and overlaps the two flanking codons GGA and CAC. The cloned cDNA of gro-β terminates at the 3' end in a 25 polyA tail flanked by a BamHI restriction site.

The EcoRI-BamHI fragment, comprising the major part of the coding sequence of gro-β, followed by the 3' sequence corresponding to the non-translated end of the mRNA flanked by the polyadenylated tail, was iso-30 lated by the customary techniques described in Maniatis et al. (op. cit.). The fragment is hereafter called fragment I.

A synthetic Hindlll-EcoRI fragment, containing the end of the pre-pro region of the a pheromone (cor-35 responding to the residues Ser Leu Asp Lys Arg) and the - 52 - IE 904706 start of the sequence coding for the mature protein of gro-β, was also prepared. The sequence of this fragment, called fragment J, is given below. It will be noted that the sequence corresponding to the start of 05 the cDNA of gro-β has been modified relative to the sequence of the cDNA described by Tekamp-Olson et al., op. cit., so that the codons used are among those most frequently used by S. cerevisiae (q.v. Sharp et al., 1986, Nucleic Acids Research, vol. 14, 13, 5125-5143).

Hind III AGCTTGGATAAAAGAGCGCCTTTGGCTACTGAATTGAGATGTCAATGTTTGCAAACCTTGCAAGG λ 5 ACCTATTTTCTCGCGGAAACCGATGACTTAACTCTACAGTTACAAACGTTTGGAACGTTCCTTAA EcoRI Fragments G, Η, I and J were ligated to give plasmid pEMR583 shown in Figure 11, in which the 20 symbols have the same meanings as in Figures 7 and lo, fragment E being represented by and fragment F by HU The nucleotide and peptide sequences of the start of the mature protein of gro-β, and of the end of 25 the pre-pro region of the a pheromone, are as follows: 30 35 - 53 - it yu4/U6 G T A.A G C.T T G.G A T.A A A.A G A.|G C G.C C T.T T G. i Val. Ser. Leu. Asp. Lys. Arg. |Ala. Pro. Leu. 05 End of the pre-pro region of the |Start of the a pheromone jmature protein Cleavage site of the endopeptidase of cathep- 10 sin B type: yscF (product of the KEX2 gene) EXAMPLE 9: Secretion of the cytokinin aro-β by yeast 1 Transformation of the EMY761 yeast strain by plasmid 15 pEMR583 and expression of gro-B by the transformed strain. The EMY761 strain (Mata, leu2, ura3, his3) described in Example 3 was transformed by plasmid pEMR583 for the prototrophy of leucine by the technique already described in Example 3). Two trans-20 formed strains, hereafter called EMY761 pEMR583 (1) and EMY761 pEMR583 (2), were retained. 2 Expression, in an Erlenmeyer flask, of the cDNA of gro-B by the EMY761 PEMR583 (1) and EMY761 pEMR583 (2) strains. Detection of the protein in the culture 25 medium on polyacrylamide gel/sodlum dodecylsulfate (SDS) according to the protocol described by laemmli (U.K. LAEMMLI, Nature, 227 [1970] 680-685). culture a/ A colony of each of the EMY761 pEMR583 (1) and 30 EMY761 pEMR583 (2) strains was cultured in 50 ml of uracil-free liquid medium. This medium contains the following per liter: 6.7 g of Yeast Nitrogen base without amino acids (from DIFCO) 35 5.0 g of casein hydrolyzate (Casamino acids from — 54 - IE 904706 DIPCO) 10 g of glucose.

After one night at 30 *C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. 05 The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of gro-β was induced by taking up the cells in 50 ml of ethanol-glycerol-galactose YNB medium. The ethanol-glycerol-10 galactose YNB medium contains the following per liter: 6.7 g of Yeast Nitrogen base without Amino acids (from DIFCO) 5.0 g of casein hydrolyzate (casamino acids from 15 DIFCO) 30 g of glycerol 30 g of galactose 10 ml of ethanol The cultures were incubated again at 30"C for 24 h, 20 with agitation. £>/ control strain: The non-transformed EMY761 strain, i.e. the EMY761 strain without plasmid, was cultivated as above. It was subjected on the one hand to preculture in 25 50 ml of uracil-free liquid medium to which uracil had been added (20 Mg/ml), and on the other hand to induction in 50 ml of ethanol-glycerol-galactose YNB medium to which uracil had been added (20 pg/ml).

Preparation of the samples: The cells cultivated in 1 a/ and 1 b/ were centrifuged for 20 min at 10,000 rpm and the supernatant was collected. 5 ml of 50% trichloroacetic acid containing 2 mg/ml of deoxycholate were added to 35 10 ml of supernatant. - 55 - IE 904706 The mixture was cooled at +4*C for 30 min and then centrifuged for 30 min at 10,000 rpm. The residue was taken up in about 1 ml of cold acetone (+4*C) and centrifuged again for 30 min at 10,000 rpm. 05 After having been dried, the residue is taken up in about 20 μΐ of a so-called loading buffer consisting of Tris-HCl 0.125 M pH 6.8, SDS 4%, bromo-phenol blue 0.002%, glycerol 20%, β-mercapto- ethanol 10% (according to the protocol described 10 by LAEMMLI [1970]). The residue is solubilized by boiling for 15 min and then neutralized by the addition of 10 N sodium hydroxide solution until the bromophenol blue turns blue.

The samples are deposited on polyacrylamide gel/ 15 SDS: 1/ Size marker 2/ Non-induced non-transformed EMY761 : 20 μΐ deposited 20 3/ Non-induced EMY761 pEMR583 (1) : 20 μΐ deposited 4/ EMY761 PEMR583 (1) induced for 24 h : 15 μΐ deposited 5/ EMY761 PEMR583 (1) induced 25 for 24 h : 5 Ml deposited 6/ Size marker 7/ EMY761 pEMR583 (2) induced for 24 h : 5 μΐ deposited 8/ EMY761 PEMR583 (2) induced 30 for 24 h : 15 μΐ deposited 9/ Non-induced EMY761 pEMR583 (2) : 20 μΐ 10/ Induced non-transformed EMY761 : 20 μΐ deposited 35 IE 904706 - 56 - After electrophoresis, the proteins are stained with coomassie blue.

RESULTS; Analysis of the gel obtained shows that a 05 supernumerary protein with an apparent molecular weight of about 8 kDa is produced by the EMY761 pEMR583 (1) strain (lanes 4 and 5) and EMY761 pEMR583 (2) strain (lanes 7 and' 8) and is not produced in the culture supernatants of the non-transformed EMY761 strain 10 (lanes 2 and 10). It is also apparent that the synthesis of this supernumerary protein is associated with induction of the promoter by growth on ethanol-glycerol-galactose (bands absent in lanes 3 and 9).

Analysis of the amino-terminal sequence of this 15 protein purified by HPLC made it possible to verify that it was the mature gro-β protein described by Tekamp-Olson et al., op. cit.

It is therefore apparent that the cytokinin gro-β can be secreted under the control of the promoter 20 of the invention.

The EMY761 pEMR583 (1) strain has been deposited at the C.N.C.M. - Institut Pasteur - France under n° 1-10 EXAMPLE 10; Construction of a vector for the expression and secretion of IL-8 in veast: plasmid 25 PEMR611 carrying the artificial promoter of the invention A second example of a secreted protein whose expression can be regulated by the promoter of the invention is the human cytokinin IL-8. This cytokinin of 30 about 8000 Da, produced by monocytes, has been described by several teams; Yoshimura et al. (1987), J. Immunol., 139, 788-793, ShrOder et al. (1987), J.

Immunol., 139, 3474-3483, and Walz et al. (1987), Bio-chem-Biophys. Res. Commun., 149, 755-761. IL-8 acts as 35 a chemical attractant of neutrophils. IL-8 has remar- IE 904706 - 57 - kable structural similarities with β-thromboglobin (Van Damme et al. (1989), Eur. J. Biochem. 181, 337-344).

The cytokinin IL-8 exists in several forms which differ from one another in their NHa-terminal end. The major 05 form is composed of 72 amino acids but 5 other minor forms are also produced, 3 of which have a truncated NHa-terminal end compared with the major form, and 2 of which have respective extensions of 5 and 1 amino acids compared with this major form.

The CDNA of IL-8 was cloned and sequenced according to the method described by Matsushima et al., 1988, J. Exp. Med. 167, 1883-1993. The sequence of this cDNA contains a single Hindlll site (5'—AAGCTT) which covers the 42nd and 43rd codons of the mature 15 part (form 72 aa: q.v. Matsushima et al., op. cit.).

Furthermore, the clone of the cDNA of IL-8 used in this cloning has a single BamHI site directly flanking the end (3') of the polyA tail. The BamHI-Hindlll fragment, carrying the 3' end of the cDNA of 20 IL-8, was purified.

A cloning vector was prepared in the following manner: Plasmid pEMR583, described in Example 8, was digested with Hindlll and BamHI.

This double digestion releases 5 fragments: the heaviest fragment, Ilindlll-BamHI, corresponds to the cloning vector (about 7760 base pairs). The other 4, Hindlll-Hindlll (with sizes of 169 base pairs, 92 base pairs, 529 base pairs and 187 base pairs), correspond 30 to the sequence of the cDNA of gro-β. The Hindlll site of the cloning vector is located slightly upstream from the insertion site at the end of the pro sequence of the alpha pheromone (and covers the sequence of the codon - serine 81 - of the precursor). The BamHI site 35 is located upstream from the terminator of the PGK.

IE 904706 - 58 - The DNA of the Hindlll-BamHI fragment was purified. The Hindlll-BamHI fragment, containing the 3' part of the sequence of the cDNA, was ligated with a synthetic Hindlll-Hindlll DNA fragment. The sequence 05 of this fragment, which is given below, is intended for reconstituting the sequence of the major mature form of IL-8 (72 amino acids), preceded by the sequence of the cleavage site (Ser-Leu-Asp-Lys-Arg). The novel Hindlll-BamHI fragment was ligated with the Hindlll-10 BamHI fragment corresponding to the cloning vector.

The sequence of the synthetic Hindlll-Hindlll fragment is as follows: '-AGCTTGGATAAAAGATCTGCTAAGGAATTGAGATGTCAATGTATCAAGACTTACTCTAAGCCATTCC 15 ACCTATTTTCTAGACGATTCCTTAACTCTACAGTTACATAGTTCTGAATGAGATTCGGTAAGG ACCCAAAGTTCATCAAGGAATTGAGAGTTATCGAATCTGGTCCACACTGTGCTAACACTGAAATTAT TGGGTTTCAAGTAGTTCCTTAACTCTCAATAGCTTAGACCAGGTGTGACACGATTGTGACTTTAATA CGTTA GCAATTCGA-5' The plasmid obtained in this way, carrying the cDNA of IL-8 preceded by the pre-pro sequence of the a 25 pheromone and the promoter of the invention, whose sequence was specified in Example 2, is called pEMRGll. EXAMPLE 11: Transformation of the EMY761 veast strain bv plasmid PEMR611. and secretion of IL-8 The EMY761 strain (Mata, ura3, leu2, his3), 30 described in Example 3, was transformed into the (leu+) strain by the DNA of plasmid pEMRGll according to the technique already described. of the (leu-·-) colonies obtained, one was removed at random and cultivated in order to study the secretion of IL-8. This strain is 35 hereafter called EMY761 pEMR61l.

IE 904706 - 59 - The protocol for analysis of the proteins secreted by the yeast is that described in Example 9. The proteins secreted by EMY761 pEMR611 were compared with those secreted by EMY761. This revealed a supernu-05 merary major band corresponding to a protein of 8000 Da secreted by the EMY761 pEMR611 cells induced by galactose. This protein is specifically recognized by rabbit antibodies directed against human IL-8 (supplied by Endogen: Anti human IL-S polyvalent P801) according 10 to the results of analysis by Western blot - a method which is well known to those skilled in the art and whose protocol is given in detail in Example 4.

Expression plasmid pEMR6ll therefore permits a high level of expression of il-8 in transformed yeasts.

This expression is under the control of the artificial promoter of the invention.

The EMY761 pEMR611 strain has been deposited at the C.N.C.M. - Institut Pasteur - France under n° I - 1023.

EXAMPLE 12: Construction of a vector for the expression 20 and secretion of hirudin: plasmid PEMR576 carrying_the artificial_ggoagt or_of the invention Naturally produced by the Hirudo leech, hirudin is a very specific and very effective inhibitor of 25 thrombin. A number of variants have been identified and designated by Ηνχ , HV3 and HV3 (Dodt J. et al. (1986), FEBS Lett. 202., 373, 377). Some of these natural variants and other analogs have subsequently been prepared by genetic engineering in a variety of 30 host cells. The present Example concerns the variant rHVa-Lys47 described in the patent publication EP-A-0273800. More particularly, the expressed sequence codes for a precursor of this variant rHVa-Lys47, which contains a signal sequence: Met - Arg - Phe - ser - 35 Thr - Thr - Val - Ala - Thr - Ala - Ala - Tyr - Ala - IE 904706 - 60 - Leu - Phe - Phe - Thr - Ala - Ser - Gin - vai - ser -Ala, directly preceding the start of the sequence of mature hirudin.

The construction and the structure of this pre-05 cursor are described in the patent publication FR 2646437. The expression of this precursor permits the release of the variant rHVa-Lys47 in the culture supernatant of the transformed cells.

Plasmid pTG3867, whose construction and 10 description are given in detail in the patent application FR 2 646 437, is a secretion vector for hirudin. In this construction, the hirudin is synthesized in the form of a precursor containing a signal sequence. The hirudin is placed behind the lb promoter of the MFal gene, which is a constitutive promoter in yeast strains of the a conjugation type. Construction of plasmid PEMR547 Plasmid pEMR547 is derived from plasmid PEMR515 (cf. Example 2) by deletion of the small sequence ori-20 ginating from plasmid 2μ and located between the end of the LEU2d gene and the EcoRI site bordering the sequence of plasmid pBR322. Plasmid pEMR515 was digested partially with BspMI and totally with EcoRI. The large BspMI-EcoRI fragment, corresponding to plasmid pEMR5i5 25 from which the 3# part of LEU2 and the small adjoining sequence of the 2/i fragment have been deleted, was ligated with a synthetic BspMI-EcoRI* sequence intended for reconstituting the 3' region of the LEU2d gene.

This synthetic sequence is as follows: 30 35 IE 904706 - 61 - EcoRl° AATTGCCCGGGACGTCTTATGTACAAATATCATAAAAAAAGAGAATCTTT +--------— +-----------------------—-----+------- iCGGGCCCTGCAGAATACATGTTTATAGTATTTTTTTCTCTT AGAAA AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGTACTGTT +---------+----------).---------+---------+---------+-----— 05 TTCGTTCCT AAAAGAATTGFiAGAAGCCGCTGT CGT AGTGGCTGAAGCCACCAT GACAA B s P M AACCACCT AAATCACCAGTTCTGAT ACCTGCATCC +---------+------- — +---------+-------- TTGGTGGATTTAGTGGTCAAGACTATGGACGTAGGTTTT The reconstituted plasmid is called pEMR547.

Construction of plasmid PEMR568 Plasmid pEMR568 is derived from pEMR547 in the following manner: The DNA of plasmid pEMR547 was digested with Hlul and Nhel. This double digestion makes it possible 20 to linearize plasmid pEMR547 (6.6 kb), the 2 sites Mlul and Nhel being situated within a few base pairs of one another. A double-stranded synthetic oligonucleotide of the sequence CTAG C GAGCT CAAG CTTA GCTCGAGTTCGAATCCGC was inserted between these 2 sites.

The resulting plasmid is called pEMR566.

Construction of Plasmid pEMR576. an expression plasmid for hirudin The sequence of the variant rHVa-Lys47 of hirudin was obtained from plasmid pTG3867, whose construction and description are given in detail in the 35 patent application FR 2 646 437. in this construction, - 62 - IE 904706 the hirudin is synthesized in the form of a precursor composed of a signal peptide of 23 amino acids (including the methionine corresponding to the initiation codon). The messenger RNA coding for the precursor is 05 transcribed with the aid of the MFal promoter, which is a constitutive promoter in yeast strains of the alpha conjugation type.

Accl-Sall double digestion of plasmid pTG3867 releases several fragments, the shortest of which, 10 numbering about 200 base pairs, is readily purifiable on 2% agarose gel. The AccI site which borders this fragment is located a few base pairs from the start of the mature sequence, according to the sequence 15 4££l ATTACG|TA TACAGAC... *""Ί TAATGC AT|ATGTCTG Mature sequence The Sail site is located downstream from the stop codon of the coding sequence of hirudin.

The Accl-Sall fragment of 200 base pairs carries the information for the greater part of the mature sequence of hirudin. The complementary information (signal sequence and start of the mature sequence) is provided by a synthetic sequence of about 30 90 nucleotides, which is specified below: 35 IE 904706 - 63 - CGATATACACAATGCGTTTCTCTACTACAGTCCCTACTCCAGCTACTCCGCTATTTTTCACAGCC TATATGTGTTACGCAAAGAGATGATGTCAGCGATGACGTCGATGACGCGATAAAAAGTGTCGG, CCAAGTTTCAGCTATTACGT 05 GGTTCAAAGTCGATAATGCATA Vector pEMR468 was linearized with Sail and partially digested with Clal. The Clai-Sall fragment of about 5.6 kb, corresponding to this vector from 10 which the sequence of urate oxidase has been deleted, was ligated with the AccI-SalT fragment of about 200 base pairs, which carries the information for the sequence of mature hirudin, and with the small synthetic Clal-AccI sequence intended for reconstituting 15 the sequence of the precursor of hirudin. The resulting plasmid is called pEMR576.

EXAMPLE 13; Secretion of hirudin 1) Transformation of the EMY761 strain by plasmid pEMR576 20 The EMY761 strain (Mata, ura3, his3, leu2) was transformed into the (leu*) strain by plasmid pEMR576 according to the technique already described.

A transformed strain, hereafter called EMY761 pEMR576, was isolated. 2) Expression of hirudin As a negative control, a (leu*) strain derived from EMY761, hereafter called EMY761 (leu*), was constructed. The technique used is described in detail in the patent application FR 2 646 437. The EMY761 30 pEMR576 and EMY761 (leu-*-) strains were cultivated in parallel in the manner described below: The precultures take place in medium of the following composition: Yeast Nitrogen Dase (Difco) 0.7%, histidine 50 μς/ml and uracil 50 Mg/nl. After 35 24 h, the cultures are inoculated with 10" cells in - 64 - IE 904706 medium having the following composition: Yeast Nitrogen Base (Difco) 0.7%, ethanol 1%, casamino acids 0.5%, uracil 100 μg/ml, glycerol 3% and galactose 1%. After culture for 72 h in the latter medium, the supernatant 05 is separated from the cells by filtration on 0.2 μ. The inhibitory activity of the supernatant on thrombin is measured by using the colorimetric test described in FR 2 646 437 (proteolytic activity of thrombin on a synthetic substrate: chromozyme TH marketed by 10 Boehringer Mannheim).

The Table below shows the results of the assays in μg of hirudin per ml of supernatant, at an optical density of 1, i.e. 0.3 x 107 cells/ml. lb ------- Strain ug/ml EMY761 (leu·*) non-detectable EMY761 PEMR576 0.5 20 It is therefore apparent that hirudin can be secreted under the control of the promoter of the invention.

The EMY761 pEMR576 strain has been deposited in 25 the CNCM under the number 1-1022. -ti 35

Claims (13)

1. An artificial promoter for the expression of proteins in yeast, which comprises: - a sub-sequence upstream from the TATA component of the sequence of the promoter of the GAL7 gene of Sac-charomyces cerevisiaer which comprises the upstream activation ‘sequences UAS1 and UAS2; and - a sub-sequence of the sequence of an ADH2 promoter comprising the TATA component and the transcription initiation region.

2. A promoter according to claim 1, wherein the subsequence of the sequence of the GAL7 promoter of Sac-charomyces cerevisiae is the following sequence or a sub-sequence thereof : H l u CGCG7C7A7AC7 7CGGAOCAC7C7 7CApCCAAGCCICA7 7AGA7A7A7J7 7C7G7CA7 AGA7A7GAAGCC7CG7GACAAC7CGC7 7CCGAG7AATC7A7A7AAAAGACAG7A T7 7CC7 7AACCCAAAAA7AAGCGAGACGGTCCAAAAAGCGCTCCGACAAC707 7GACCG7 .................... AAACGAA7TGGG7T7T7ATTCCC7C7CCCAGG7 7 7TTCGCGAOCCTOTTGACAACTGGCA GA7CCGAACGAC7GGC7ATACAG7G7TCACAAAA7AGCCAAGC7GAAAA7AA7G7G7AGC ............................................................ CTACGC7 7CC7GACCGA7A7C7CACAAG7G7 T7 7A7CGG7 TCGACT 7 7 TA7 7 ACACA7C0 S P h C 7 7 7AGC7ATGI7CAG7 7AG7 7 7GGCA7Q .............................. GAAA7CGA7ACAAG7CAATCAAACC

3. A promoter according to claim 1 or claim 2, wherein the sub-sequence of the sequence of an ADHa promoter comprising the TATA component and the initiation region IE 904706 - 66 - is the following sequence or a sub-sequence thereof : cc7A7caca7A7aaa7aga ^»TACCCATAGT0TATATI7ATC7 G7GCCAG7AGCGACI777 7 7CACAC7CGAGA7AC7C7 7AC7AC7GCTC7C7 7G7 7G7 7 77 .......................I··.................................. CACGG7CA7CGCTGAAAAAAGTG7GAGC7C7A7GAGAATGA7GACGAGAGAACAACAAAA 7A7CAC7 7C77G777C77C77GG7AAA7AGAA7A7CAAGC7ACAAAAAGCA7ACAA7CAA ...........................................I................ A7 AG7 GAAGAACAAAGAAGAACCAI77ATC77A7 AG7 7 C GA7G 7 7 7 7*7 CG7 A7G7 T AG7 T C • C7 A7CAAC7A7 7AAC7A7A7* GATAG7 7GA7AA7TGATA7ACC

4. A promoter according to any one of claims l to 3, which comprises the following sequence: _ 67- It 904706 H 0 CCCGTCIATACT ICCGflCCACTCI IGAGCCAAGGCTCAT TAGATATATT T TCTGTCAT .......................................................... AGATATGAAGCCTCGTGACAACTCGCTTCCGAGTAATCTATATAAAAGACAGTA TTTCCTTAACCCAAAAATAAGGGAGAGGGTCCAAAAAGCGCTCGGACAACTGTTGACCGT ............................................................ AflflCCflATTCOOUmftT TCCCICICCCAGCIT T T TCCCOftGCCTGT TCflCftftCTCOCA GATCCGAAGGACTCGCTATACAGTGTTCACAAAATACCCAAGCTGAAAATAATGTGTAGC ............................................................ CTACCCnCCTGACCCfttATCTCACAACIGI IΤ TATCGGT TCGACT T T TAT TACACATCO s P h t CTTTAGCTATGITCAGTTAGTTTGGCATGCCTATCACATATAAATAGA ................................................ GAAATCGATACAAGTCAATCAAACCG'TACGGATAGTGTATATTTATCT gtgccagtagcgacttttttcacactcgagatactcttactactgctctcttgitgt TTT —..................................................*...... cacggtcatcgctgaaaaaagtgtgagctctatgagaatgatgacgagagaacaacaaaa tatcact icttgtttcttcttggtaaatagaatatcaagctacaaaaagcatacaaicaa atag tcaagaacaaagaagaaccat t tatct t at agt t cgatgt t t t tcgtatgt tagt t c ctatcaactattaactatajJ .................... catagttgataattgatatagc

5. An expression vector for yeast, carrying a gene of interest with the means necessary for its expression, its replication and the selection of the transformed cells, wherein this gene of interest is under the control of the promoter according to any one of claims 1 to 4.

6. An expression vector according to claim 5, wherein the gene of interest is a recombinant gene coding for a protein which is toxic to yeast.

7. An expression vector according to claim 5, wherein IE 904706 - 68 - the gene of interest is a recombinant gene coding for urate oxidase.

8. A strain of yeast which is transformed by an expression vector according to claim 6 or claim 7.

9. A strain of Saccharomyces cerevisiae which is transformed by an expression vector according to any one of claims 5 to 7.

10. A method of producing a protein of interest, which comprises culturing a strain of Saccharomyces cerevisiae according to claim 9, in the presence of galactose. - 69 - IE 904706

11. An artificial promoter for the expression of proteins in yeast according to Claim 1 substantially as described in the Examples.

12. A method of producing a protein of interest according 5 to Claim 10 substantially as herein described.

13. The features described in the foregoing specification, or any obvious equivalent thereof, in any novel selection.