IE903343A1 - FORMULATION FOR SOLUBLE sT4 FOR TREATMENT OF HIV INFECTION - Google Patents
FORMULATION FOR SOLUBLE sT4 FOR TREATMENT OF HIV INFECTIONInfo
- Publication number
- IE903343A1 IE903343A1 IE334390A IE334390A IE903343A1 IE 903343 A1 IE903343 A1 IE 903343A1 IE 334390 A IE334390 A IE 334390A IE 334390 A IE334390 A IE 334390A IE 903343 A1 IE903343 A1 IE 903343A1
- Authority
- IE
- Ireland
- Prior art keywords
- histidine
- pharmaceutical composition
- solution
- mannitol
- protein
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
- A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
- A61K47/183—Amino acids, e.g. glycine, EDTA or aspartame
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Dermatology (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Pharmaceutical compositions which comprise soluble sT4 in combination with an aqueous histidine buffer at a physiologically acceptable pH are disclosed. The pharmaceutical compositions may also include a non-ionic surfactant and a bulking agent. Pharmaceutical compositions comprising sT4 and histidine buffer in lyophilized and kit form are also disclosed.
Description
This invention relates to a pharmaceutical formulation for parenteral administration and more particularly to a pharmaceutical formulation for treatment of human immunodeficiency virus (HIV) infection.
Background of the Invention HIV, the etiological agent of acquired immune deficiency syndrome (AIDS), shows a marked affinity for CD-4+ lymphocytes. The human T-cell glycoprotein CD-4, sometimes previously referred to as *T4*, is one of several non-polymorphic T lymphocyte surface receptor proteins that have been implicated in the mediation of efficient interactions of lymphocytes with other cells. Analysis of these surface proteins indicates that mature T lymphocytes segregate into two classes on the basis of their predominant expression of either the T4 or T8 surface glycoprotein. The CD-4 molecule is predominantly expressed on helper T lymphocytes whereas -laIE 903343 SKLI-9 (SBC 14460) PATENT T8 is expressed on cytotoxic and suppressor T cells. The CD-4 lymphotropic character of the virus can be explained by its specific binding to the CD-4 receptor. Monoclonal antibodies directed against CD-4 block HIV infection of CD-4+ cells in vitro. Human cells lines, nonlymphoid as well as lymphoid, which lack the CD-4 receptor cannot be infected by HIV, but these cells become susceptible to infection upon introduction and expression of the cloned CD-4 (T4) gene. AIDS results in the impairment, and ultimately the depletion, of CD-4+ lymphocytes with consequent dysfunction of the cellular immune response.
Infection of cells by HIV is believed to occur following binding of the viral envelope glycoprotein, gpl20, to cellular CD4. sT4, a soluble (i.e. secreted) recombinant form of CD4, binds gpl20 and inhibits both viral infectivity and HIV-mediated syncytia formation.
A cDNA sequence of the human CD-4 (T-4) receptor has been described (Maddon, et al.. Cell 43.:93 (1985)). The complete CD-4 pre-protein sequence is 458 amino acids in length comprising the putative 23 amino acid secretory leader, 372 amino acid surface (Vj-VJ , 23 amino acid transmembrane and 40 amino acid cytoplasmic domains. The surface domains shows four regions of limited homology, 20-30%, to immunoglobulin variable (V) and joining (J) regions. Four of the five intron-exon boundaries in the surface domain occur near the junctions of these V-J regions. On the basis of partial protein sequence information for the mouse and sheep T4 -2IE 903343 SKLI-9 (SBC 14460) PATENT proteins (Classon, et al.. Immunogen. £2.:129 (1986), it appears that the 6 cysteines in the surface domain are paired sequentially to give three disulfide bonds. There are two possible sites for N-linked glycosylation based on amino acid sequence. The V-J homology, cysteine pairing and intron-exon structure suggest that CD-4(T-4) shares some structural similarities with the immunoglobulins.
As a prophylactic, sT4 is administered to individuals at high-risk for the disease or individuals who show exposure to HIV by the presence of antibodies to virus. Administration of an effective amount of sT4 at an early stage of the disease or prior to its onset acts to inhibit infection of T4* lymphocytes by HIV. As a therapeutic, administration of sT4 to persons infected with HIV acts to inhibit extracellular spread of the virus.
Recently, a number of scientific investigators have reported their findings related to the interaction between soluble forms of CD-4 and the AIDS infection.
Deen, et al.. Nature 331:82 (1988) report the isolation and expression of sCD-4 in several cellular environments.
Capon et al. . Nature 337: 525-531, (9 Feb. 1989) reported hybrid antibody-like molecules containing the gpl20-binding domain of the receptor for HIV. These molecules block HIV-1 infection of T cells and monocytes, have a long plasma half-life and other antibody-like properties.
Watanabe et al.. Nature 337: 267-270, (19 Jan. 1989) reports -3IE 903343 8KLI-9 (SBC 14460) PATENT effects of recombinant soluble CD4 in rhesus monkeys infected with simian immunodeficiency virus of macaques. Monkeys were given a 50 day course of treatment, receiving daily 2 mg intramuscular (i.m.) inoculations of recombinant CD4. Virus was readily isolated from peripheral blood lymphocytes and bone marrow cells of the animals before starting treatment with soluble CD4, but became difficult to isolate soon after treatment began.
U.S. Patent number 4,597,966 issued July 1, 1986 to Zolton discloses histidine-stabilized immunoglobulin preparations and a method for their manufacture. The immunoglobulin preparations comprise immunoglobulin in a histidine buffer. Histidine is present in the preparations at a concentration sufficient to inhibit aggregation of the immunoglobulin.
Because sT4 proteins have shown promise in early studies as a useful agent for the prevention, treatment, and delay of progression of HIV-related disease states, there now exist needs for pharmaceutical formulations of sT4 and for methods for administering sT4 to people.
Obtainment of these and other objects of the invention are fully disclosed herein below.
Summary of th· Invention The present invention provides pharmaceutical compositions for inhibiting the onset or progression of immune disorders associated with HIV infection comprising a soluble T4 protein in combination with an aqueous histidine buffer at a physiologically acceptable -4IE 903343 8KLI-9 (BBC 14460) PATENT pH. The pharmaceutical compositions of the invention may also further comprise a non-ionic surfactant, a sugar, such as a sugar alcohol, a bulking agent and, optionally a bacteriostatic agent and a cryoprotecive agent. The invention also provides pharmaceutical compositions in lyophilized form and kit form.
It has now been discovered that soluble T4 is highly soluble when in agueous histidine buffer at a physiologically acceptable pH. Histidine reduces or eliminates precipitation of aggregated soluble T4 which occurs when soluble T4 is present in concentrations greater than about 2 mg/ml in phosphate buffer, a buffer commonly used for proteins.
It has also been discovered that sugar alcohols such as mannitol at appropriate concentrations reduce hemolysis of red blood cells which occurs when sT4 is buffered with histidine.
Although solutions of histidine without other additives reduces or eliminates precipitation of sT4 at concentrations suitable for parenteral administration, these solutions also induce hemolysis of red blood cells. The addition of the sugar alcohol to the pharmaceutical composition substantially reduces hemolysis.
Detailed Description of the Invention The pharmaceutical compositions of the invention comprise an sT4 protein, in combination with histidine, and, preferably, a nonionic surfactant. The pharmaceutical compositions of the invention may also optionally include one or more of a bulking agent, a bacteriostatic agent and a cryoprotective agent. The -5IE 903343 SKLI-9 (SBC 14460) PATENT pharmaceutical compositions of the invention are provided in aqueous and lyophilized forms. The lyophilized form is preferred for storaqe and is reconstituted, such as with sterile water for injection, prior to use. An ·βΤ4 protein· is a protein or polypeptide which has substantiallly the same HIV qpl20-binding function and structure as the CD4 receptor on T4 lymphocytes. The preferred sT4 protein is sT4. sT4 can be produced by standard recombinant DNA techniques. A DNA coding sequence and amino acid sequence of sT4 are illustrated below. 50 CAAGCCCAGAGCCCTGCCATTTCTGTGGGCTCAGGTCCCTACTGCTCAGCCCCTTCCTCC 90 110 CTCGGCAAGGCCACAATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAA MetAsnArgGlyValProPheArgHisLeuLeuLeuValLeuGln 130 150 170 CTGGCGCTCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCtGGGCAAAAAAGGGGAT LeuAlaLeuLeuProAlaAlaThrGlnGlyLysLysValValLeuGlyLysLysGlyAsp -9 -1 +1 190 210 230 ACAGTGGAACTGACCTGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAAC ThrValGluLeuThrCysThrAlaSerGlnLysLysSerlleGlnPheHisTrpLysAsn 250 270 290 TCCAACCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCATCCAAG SerAsnGlnlleLysIleLeuGlyAsnGlnGlySerPheLeuThrLysGlyProSerLys 310 330 350 CTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGAAACTTCCCCCTGATC LeuAsnAspArgAlaAspSerArgArgSerLeuTrpAspGlnGlyAsnPheProLeuIle 370 390 410 ATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACCAGAAG IleLysAsnLeuLysIleGluAspSerAspThrTyrlleCysGluValGluAspGlnLys -6IE 903343 8KLI-9 (SBC 14460) PATENT 430 450 470 GAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTTCAG GluGluValGlnLeuLeuValPheGlyLeuThrAlaAsnSerAspThrHisLeuLeuGln 104 490 510 530 GGGCAGAGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGT GlyGlnSerLeuThrLeuThrLeuGluSerProProGlySerSerProSerValGlnCys 550 570 590 AGGAGTCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTGGAG ArgSerProArgGlyLysAsnlleGlnGlyGlyLysThrLeuSerValSerGlnLeuGlu 610 630 650 CTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAGAAGAAGGTGGAGTTC LeuGlnAspSerGlyThrTrpThrCysThrValLeuGlnAsnGlnLysLysValGluPhe 151 670 690 710 AAAaTAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCCAGCATAGTCTATAAGAAAGAG LysIleAspIleValValLeuAlaPheGlyLysAlaSerSerlleValTyrLysLysGlu 183 730 750 770 GGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGT GlyGluGlnValGluPheSerPheProLeuAlaPheThrValGluLysLeuThrGlySer 790 810 830 GGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGAC GlyGluLeuTrpTrpGlnAlaGluArgAlaSerSerSerLysSerTrpIleThrPheAsp 850 870 890 CTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATGGGC LeuLysAsnLysGluValSerValLysArgValThrGlnAspProLysLeuGlnMetGly 910 930 950 AAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGA LysLysLeuProLeuHisLeuThrLeuProGlnAlaLeuProGlnTyrAlaGlySerGly 970 990 1010 AACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATCAGGAAGTGAaCCTGGTG AsnLeuThrLeuAlaLeuGlyAlaLysThrGlyLysLeuHisGlnGluValAsnLeuVal 1030 1050 1070 GTGATGAGAGCCACTCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCC ValMetArgAlaThrGlnLeuGlnLysAsnLeuThrCysGluValTrpGlyProThrSer 1090 1110 1130 CCTAAGCTGATGCTGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAG ProLysLeuMetLeuSerLeuLysLeuGluAsnLysGluAlaLysValSerLysArgGlu -78KLX-9 (8BC 14460) PATENT 1150 1170 1190 AAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAgTGACTCG LysAlaValTrpValLeuAsnProGluAlaGlyMetTrpGlnCysLeuLeuSerAspSer 1210 1230 1250 GGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCCCGGtgtaa GlyGlnValLeuLeuGluSerAsnlleLysValLeuProThrTrpSerThrProValEnd 351 369 1270 tggcgcctctaga The above sT4 protein is illustrative only. For example, amino acids can be added, deleted or substituted for residues illustrated above. Such added or substituted amino acids can be homologous, i.e. derived from CD4 receptor or alleles or other naturally-occurring variants thereof, or heterologous, i.e., derived from other proteins or polypeptides. The added or substituted amino acids can, but are not required to, serve to add a function to the protein, such as molecular targeting or cell killing, or to enhance gene expression or protein stability. Amino acids can also be deleted so long as GP120 binding activity is not diminished beyond the point at which the protein ceases to be useful in preventing, treating or delaying the onset of disease states associated with HIV infection.
The above-illustrated sT4 Protein, or variants or derivatives thereof as discussed above, can also be modified posttranslationally, such as by chemically conjugating other polypeptides or other functional compounds to the sT4 or variant thereof. -8IE 903343 8KLI-9 (SBC 14460) PATENT Thus, this invention also encompasses sT4 variants and derivatives of sT4, including genetically-made and chemically-made variants and derivatives. It has been found that in order to preserve HIV GP120 binding, it is important to retain at least a part of the VI domain, and preferably, also a part of the Jl and/or V2 domains. Thus, an sT4 Protein which may be used in this invention preferably substantially comprises, with reference to the above-illustrated sequence, at least about amino acids 16 to at least about amino acid 104. In the .description which follows, this invention is described in terms of sT4, the preferred sT4 Protein. However, it should be understood that the invention also encompasses other sT4 proteins.
Such sT4 derivatives, and methods for their production by recombinant DNA techniques are disclosed for example in PCT WO/US87/02050; U.S. patent application Serial Number 112,800, filed October 23, 1987; and U.S. patent application Serial Number 160,463, filed February 24, 1988, all of which are specifically incorporated by reference as if fully set forth herein.
The concentration of histidine buffer in the pharmaceutical composition of the invention is selected to maintain approximately neutral pH, e.g., pH 6.7 to 7.3, preferably pH 6.8 to 7.2, and more preferably at pH 7. Typically the concentration of histidine is 20 mM to 200 mM, preferably about 30 mM to about 75 mM, and more preferably about 50 mM. Histidine buffer is prepared by standard techniques, e.g., adding hydrochloric acid to 50 mM (7.8 mg L-9IE 903343 SKLI-9 (SBC 144(0) PATENT histidine/ml) in water to a selected pH within the range useful in the invention.
Additional buffering agents, organic and inorganic, can also be employed. For example, the formulation can comprise a phosphate buffer at a concentration of about 50 mM. However, it has been found, unexpectedly, that use of histidine at the lower end of the above concentration range, in an absence of phosphate buffer, results in fewer precipitation problems than otherwise.
It is also contemplated that additional amino acids, such as basic amino acids, can also be employed in the pharmaceutical composition of the invention. Amino acids which have been used in protein formulations include, e.g., glycine, alanine, lysine, ornithine and arginine. See, e.g., U.S. 4,597,966 (histidine and glycine in immunoglobulin formulations); U.S. 4,496,537 (alanine or glycine in alpha-interferon formulations); EP-A-156,169 (lysine or ornithine in tPA formulations; JP 125,306 (Derwent 88-024381/04) (arginine in tPA formulations).
Depending on the method used to purify sT4, it may be necessary to remove buffers containing undesired components before preparing the pharmaceutical compositions. Removal of other buffers may be readily accomplished by conventional techniques such as conventional buffer exchange techniques. It may also be necessary to dilute or concentrate the sT4 before preparing the pharmaceutical compositions of the invention if the method used to prepare sT4 results in a solution of sT4 in buffer having a greater -10IE 903343 8KLI-9 (SBC 14460) PATENT or smaller concentration of ST4 than is used in the invention.
Non-ionic surfactants suitable for use in the invention preferably have little toxicity to humans and do not cause hemolysis of red blood cells to a significant extent. Suitable non-ionic surfactants include, but are not limited to, polysorbates (or polyoxyethylenesorbitans) such as polysorbate 20 (monolaurate), polysorbate 60 (monostearate) and polysorbate 80 (monoloeate). A preferred non-ionic surfactant is polysorbate 80. Polysorbate 80 is generally sold under the trade name of Tween 80® by Sigma Chemical Co., St Louis, Missouri and others. The nonionic surfactant is preferably present in the pharmaceutical composition in the amount of from about 0.01% to about 0.6%, preferably in the amount of about 0.05%. For example, use of 0.05% Tween 80 (i.e., 0.5 mg/ml) has been shown to enhance solubility of sT4 and reduces nephrotoxicity.
Sugars useful in the pharmaceutical compositions of the invention serve as bulking agents and tonicity modifiers. Suitable sugars include sugars such as mannitol, sucrose, trehalose and sorbitol. A preferred sugar is the sugar alcohol mannitol. It has been found that mannitol produces an isotonic formulation and protects against heaolysis. The sugar is present in the pharmaceutical composition in an amount of about 3% to about 7% w/w, preferably in the amount of about 4.5% w/w.
In addition to sT4 and buffer, the pharmaceutical compositions of the invention may optionally contain other agents suitable for -llIE 903343 8KLI-9 (SBC 14460) PATENT parenteral administration, such as bacteriostatic agents, tonicity modifiers, and cryoprotective agents. Suitable bacteriostatic include benzyl alcohol and methyl and propyl parabens. Sodium chloride, which has in the part been used to modify tonicity, has been shown to adversely affect the solubility of sT4.
A hydrophilic polymeric cryoprotective agent such as hydroxyalkyl cellulose, gelatin, acacia gum, polyvinylpyrrolidone (e.g. molecular weight 10,000 to 60,000) and polyalkylene glycols, such as polyethylene glycols (e.g. molecular weight 4,000 to 40,000) may be included in the pharmaceutical compositions of the invention. Use of such agent increases stability (that is, minimizes loss of activity and protein degradation) in solution, on lyophilization and upon reconstitution following lyophilization.
The stability of the pharmaceutical composition of the invention is increased at low temperature. Thus, they are preferably stored at temperatures in the range of -70’C to 15C, preferably at about -4O’C or at about 4’C to about 8’C, more preferably at about 4’C to about 8’C. The lyophilized compositions are preferably administered within eight hours after reconstitution and are preferably kept at 4’C to 8’C as described above after reconstitution.
The pharmaceutical composition of the invention can be contained within a pharmaceutical dosage unit, i.e. a sterile container, such as an ampoule, syringe, vial, bottle or bag, prepared so as to deliver to a patient, especially a human patient, -12IE 903343 SKLI-9 (SBC 14460) PATENT in need of treatment or prevention for human immunodeficiency virus infection an effective amount of sT4 parenterally, especially intravenously, subcutaneously, and intramuscularly. The precise concentration of sT4 in the pharmaceutical dosage unit as well as the precise dose volume of a given dose will depend on the such factors as the severity of symptoms of HIV infection and weight of the patient. Optimization of a given dose of the pharmaceutical compositions of the invention can be carried out in accordance with standard pharmaceutical and medical practice. The concentration of sT4 in each pharmaceutical dosage unit can exceed 100 mg/ml. Preferably the concentration of sT4 is in the range of about 5 to about 50 mg/ml, more preferably, 10 to 40 mg/ml. A patient will typically receive a dosage of 0.1 to 3.0 mg/kg/day of sT4, preferably a dosage of about 0.1 to about 1.0 mg/kg/day. Such treatment can be continued indefinitely, as indicated by monitoring of clinical parameters, e.g., T4 and T8 cell counts and T4:T8 cell ratios.. For intramuscular administration, the pharmaceutical composition of the invention is administered by injection into a large muscle, such as the anterior thigh. If the total volume of the dose exceeds about 5 ml, the dose may be divided into portions and injected into two or more sites. For subcutaneous administration the pharmaceutical compositions may be injected into the anterior abdominal wall. If the total amount of the dose exceeds about 1.3 to 1.5 ml, the dose may be divided into two or more portions and injected into separate sites. It may be -13IE 903343 8KLI-9 (SBC 14460) PATENT necessary to use multiple pharmaceutical dosage units of the invention for each administration of an sT4 protein.
In a preferred embodiment of the invention, the pharmaceutical compositions are stored in lyophilized form for eventual reconstitution with a reconstitution solution such as sterile water or 5% dextrose in sterile water. The lyophilized pharmaceutical compositions are prepared by lyophilizing the aqueous form of the pharmaceutical composition using conventional techniques. The lyophilized pharmaceutical compositions are preferably stored in single dose units for convenience of administration, however, it may be stored in larger quantities in the lyophilized form. The lyophilized composition can be stored in a sterile vial or other container for dispensation with a sterile container of a solution for reconstitution and eventual or immediate parenteral administration. In preparing the pharmaceutical formulation for lyophylization, the aqueous solution can be dilute than the final reconstituted pharmaceutical compositions. For example, 1 ml of an aqueous solution having 12.5 mg/ml of sT4 is lyophilized, and later reconstituted with 0.5 ml sterile water to provide a solution having 25 mg/ml sT4.
In another preferred embodiment of the invention, the invention is a kit comprising one or more sterile containers of the pharmaceutical composition in lyophilized form and one or more separate sterile containers of solution for reconstitution. The reconstitution solution may also be contained within a different -14IE 903343 SKIiI-9 (SBC 14460) PATENT compartment of a multicompartment container, e.g., a dual compartment syringe designed for convenient mixing and administration. In such syringe or other dual compartment container, the lyophilized sT4 and the solution for reconstitution are separated by a membranous barrier which can be ruptured, e.g., by squeezing the syringe or container, thereby mixing the sT4 and the solution for reconstitution. The solution for reconstitution, the amount of sT4 and the amount of solution for reconstitution in a single kit are selected so as to provide a final reconstituted product having from about 5 to about 50 mg/ml of sT4, preferably 10 to 45 mg/ml of sT4 at a pH selected in accordance with this invention. A preferred solution for reconstitution is sterile water. The solution for reconstitution may also contain bacteriostatic agents or other substances suitable for parenteral administration.
Examples Examples 1-4 below illustrate pharmaceutical dosage units of the invention.
Example 1 A sterile syringe is filled with a sterile solution of: ST4 5.0 mg 10/mg/ml L-histidine 3.9 mg 50 mM mannitol 22.5 mg 4.5% w/w polysorbate 80 0.25 mg 0.05% water 0.5 ml hydrochloric acid (to pH 7) Example 2 -15IE 903343 SXLZ-9 (SBC 14460) PATENT A sterile vial is filled with a sterile solution of: ST4 12.5 mg 25 mg/ml L-histidine 3.9 mg 50 mM mannitol 22.5 mg 4.5% w/w polysorbate 80 0.25 mg 0.05% water 0.5 ml hydrochloric acid (to pH 6.7) Example 3 A sterile syringe solution of: is filled with a sterile sT4 12.5 mg 25 mg/ml L-histidine 3.9 mg 50 mM water 0.5 ml hydrochloric acid (to pH 7.3) Example 4 A sterile vial is filled with a sterile solution of: sT4 5.0 mg 10/mg/ml L-histidine 3.9 mg 50 mM water 0.5 ml hydrochloric acid (to pH 6.8) Example 5 - Lyophilization A bulk, sterile solution is prepared containing sT4 (10 mg/ml), L-histidine (7.8 mg/ml), mannitol (45 mg/ml), polysorbate 80 (0.5 mg/ml), hydrochloric acid (to pH 7) and water. 0.5 ml of the bulk solution is placed into a 3ml glass vial. The bulk solution is then lyophilized. Vials containing the bulk solution are placed into a freeze dryer (Hull, Hatboro, Pennsylvania) and frozen overnight on a -40*C shelf and then dried according to the appropriate cycle. The vials were then sealed. For reconstitution, 0.5 ml of sterile water is added to the vial to provide sT4 at 10 mg/ml in 50 mM histidine buffer with mannitol -16IE 903343 SKLI-9 (SBC 14460) PATENT 4.5% w/w and 0.05% polysorbate 80.
Example 6 A bulk solution of the formulation of Example 2 is prepared containing 12.5 mg/ml sT4, L-histidine 3.9 mg/ml, mannitol 22.5 mg/ml, polysorbate 80 0.25 mg/ml, hydrochloric acid (to adjust pH) and water. 1 ml of the bulk solution is placed into a 3ml glass vial. The bulk Solution is then lyophilized. Vials containing the bulk solution are placed into a freeze dryer (Hull, Hatboro, Pennsylvania) and frozen overnight on a -40 *C shelf and then dried according to the appropriate cycle. The vials were then sealed. For reconstitution, 0.5 ml of sterile water is added to the vial to provide sT4 (25 mg/ml) in 50 mM histidine buffer with mannitol (4.5% w/w) and 0.05% polysorbate 80.
Example 7 - Stability Studies The chemical stability of the lyophilized formulation of sT4 in Example 5 at temperatures ranging from -70C to 40C is shown in Table 1. Chemical stability was tested by a binding assay (OKT4a ELISA) and a cellular assay (inhibition of synctyia formation). The chemical stability of an injectable solution of sT4 was also subjected to storage at various temperatures and tested by the same assays for activity at different times. At -70*C, and at 5*C no deterioration in activity of sT4 was noted after 9 months of storage. At -15*C, one third of the initial activity was lost after 9 months storage. At 25* C, over one third of the initial activity was lost after 9 months of storage. At 30*C, half the -17IE 903343 8KLI-9 (SBC 14460) PATENT initial activity was lost after 6 months of storage, and nearly two thirds of the initial activity was lost after 9 months of storage. At 40*C, only a small amount of activity was detectable after two months and six days of storage. In diffused light, over two thirds of the initial activity was lost after fourteen days of storage.
Table 1 The Chemical stability of sT4 Injectable Solution STORAGE CONDITIONS RESULTS OF ANALYSES Temperature Time (C) Specific Activity Binding Assay Cellular Assay (OKT4a ELISA) (Syncytia) Initial 1.04 0.81 2 days 1.03 6 * 1.07 10 tt 1.10 14 tt 1.03 21 * 1.10 28 tr 1.18 40 0.98 2 months 1.16 2 months 6 days 1.04 3 months 0.918 1.16 6 tt 1.10 0.8 9 tr 1.18 28 days months 1.11 0.956 2 3 rt 0.910 1.07 6 tt 0.393 0.14 9 tr 0.700 6 days 1.12 14 * 1.10 21 1.11 28 * 1.24 40 * 1.02 2 months 1.12 2 months 6 days 0.829 -18IE 903343 PATENT SKLI-9 (SBC 14460) 3 months € * 9 · € days 1.03 1.10 1.00 1.01 5 14 0.996 21 * 1.08 28 w 1.21 40 2 months 1.00 10 2 months 6 days —--- 3 months 0.782 6 * 0.700 9 0.630 1.05 0.7 0.87 0.637 0.687 0.22 2 clays 1.04 15 6 1.06 14 » 1.10 21 * 1.07 28 * 1.19 40 * — 20 2 months 0.881 2 months 6 days 3 months 0.733 6 * 0.515 9 * 0.382 0.780 0.334 0.426 0.12 40 2 days 0.990 6 * 0.759 10 * 0.626 14 * 0.440 21 * 0.377 30 28 * 0.339 40 * 2 months 0.269 2 months 6 days 0.16 0.083 Diffused 2 days 0.900 35 Light 6 * 0.725 10 * 0.667 14 * 0.314 -19IE 903343 8KLI-9 (SBC 14460) PATENT Table 2 The Chemical Stability of sT4 Lyophilized Product (sT4 in 50 mM histidine, mannitol (4.5% w/w) and Tween 80 (0.05%) STORAGE CONDITIONS RESULTS OF ANALYSES Temperature Time (C) Binding Assay (mg/vial by OKT4a) Cellular Assay (mg/vial by Syncytia) Initial 5.6 6.7 -70 14 days . 5.1 28 4.9 35 6.0 3 months 5.8 7 5 14 days 5.1 — 28 5.1 — ——— 35 5.1 3 months 6.0 7 30 14 days 5.2 28 5.2 35 5.7 3 months 5.8 6 40 14 days 5.5 28 5.1 35 5.9 3 months 5.57 8 Example 8 - Solubility of sT4 in phosphate buffer with excipients added Excipients were added to sT4 (2.16mg/ml) in 50mM Na3P0* (pH 7.0). The initial solution appeared hazy with particulates visible. The initial solution was divided into two portions for the purpose of adding selected additional excipients -20IE 903343 8KLI-9 (SBC 14460) PATENT in order to determine the effect of the additional excipients on the solubility of sT4.. To one portion, the additional excipients were added after filtering out of the initial precipitate. The other portion was not filtered prior to adding of the additional excipients. The filtered portion was filtered through a . 22μ filter. Each excipient was added to ampoules of the unfiltered or filtered initial solution and the ampoules were shaken for 16 hours at 5C. At the end of 16 hours, each ampoule was visually inspected for precipitate and was given a score according to the amount of precipitate present, with 0 being clear and +4 being milky with precipitate.
SAMPLE UNFILTERED + 1 ZILIERED 0 NO ADDITIONS +4 + 4 1% MANNITOL + 1 0 1% ARGININE + 1 + 1 1% GLYCINE + 1 + 1 0.05% TWEEN 80 + 1 0 0.4% HSA* + 2 + 3 0.5% PVP* +2 +2 2% [NHJ2S0* +4 +4 *HSA is human serum albumin, PVP is polyvinylpyrrolidone These data show that Tween 80 and mannitol (1%) are effective in reducing precipitation of aggregated sT4.
Example 9 Solubility of sT4 in phosphate buffer and histidine buffer with excipients added.
An initial solution of sT4 (7.9 mg/ml) in 50 mM phosphate -21IE 903343 SKLI-9 (SBC 14460) PATENT buffer (pH7.0) was filtered through a 0.22μ filter prior to addition of excipients. The filtered initial solution was clear prior to addition of excipients. The filtered initial solution was then divided into portions. Histidine was added to aliquots of one portion to provide concentrations of 50, 100, 150 and 200 mM histidine. Aliquots of another portion of the initial filtered solution was dialysed against the appropriate concentration of histidine buffer to give sT4 in 50, 100, 200 and 250 mM histidine buffer. A third portion was dialyzed against 50 mM histidine buffer to give sT4 in histidine buffer and excipients were added to aliquots of this portion. Excipients were added to samples of the initial solution (as treated above) in ampoules and the ampoules were shaken for 16 hours at 5*C.
The ampoules were then visually inspected and the presence of precipitate was noted and scored with 0 being clear and +4 being milky with precipitate.
BUFFER and EXCIPIENT APPEARANCE mM Phosphate +4 50 mM Phosphate and 50 mM Histidine +3 50 mM Phosphate and 100 mM Histidine +3 50 mM Phosphate and 150 mM Histidine +3 50 mM Phosphate and 200 mM Histidine +3 50 mM Histidine +2 100 mM Histidine 0 200 mM Histidine 0 250 mM Histidine 0 50 mM Histidine and 1% Mannitol +1 50 mM Histidine and 5% Mannitol +1 50 mM Histidine and 5% Sorbitol 0 50 mM Histidine and 1% Tween 80 0 50 mM Histidine and 1% Glutamic Acid +4 -22IE 903343 SKLI-9 (SBC 14460) PATENT These data show that histidine buffer, and histidine buffer with sorbitol or Tween 80 are effective in reducing precipitation of aggregated sT4.
Example 10 - Hemolysis of red blood cells by sT4 in combination 5 with various buffer systems.
Approximately 12 ml fresh venous blood was drawn from a volunteer. The blood was defibrinated by slowly swirling in an Erlenmeyer flask containing glass donuts. After allowing the fibrin to clot on the galss beads 3 x 600 ul aliquots of blood were drawn and combined with 500 ul of dextrose (D5W). The 50:50 mixture was gently mixed and then centrifuged for ten minutes.
The supernatant was discarded and this process was repeated two more times. 600 ul D5W was added to each vial containing the isolated RBC's and inverted to mix. 25 ul of the RBC-D5W solution was pipetted into tubes each containing 1000 uls of one of the following solutions: mM histidine pH 7.0, 100 mM histtidine pH 7.0, 0.9% normal saline (NS), deionized water, ST4* and 0.05% Tween ST4* and 0.05% Tween, 5% mannitol ST4*, 4% mannitol ST4*, 5% mannitol ST4*, 20% dextrose ST4*, 10% dextrose 4% mannitol ST4* % mannitol sT4* and 4.5% mannitol 4.5% mannitol *7.7 mg/ml in 50mM histidine buffer -23IE 903343 SKLI-9 (SBC 14460) PATENT The solutions were allowed to stand for thirty minutes, and then were centrifuged for ±en minutes. The supernatants were decanted and analyzed by ultraviolet absorption (Perkin-Elmer Lambda 7 UV Spectrophotometer). The spectrophotometer was blanked against air. Samples were scanned from 500-620 nm (Amax = 575 nm). A 1.0 ml cell was used for all readings. In samples in which hemolysis occurred, tvo absorbance peaks appeared at 538 nm and 575 nm due to hemoglobin. Per cent hemolysis was calculated using the absorbance for normal saline (NS) as 0% hemolysis and the absorbance from deionized water as 100% hemolysis. All other per cent hemolysis values were determined by plotting on this two-point curve. _ SAMPLE ABSORBANCE UNITS HEMOLYSIS 1 Normal Saline 0.010 0.0 2 4% Mannitol 0.010 0.0 3 5% Mannitol 0.010 0.0 4 4.5% Mannitol 0.010 0.0 5 4% Mannitol + ST4 0.012 0.7 6 ST4 + 20% Dextrose 0.013 1.0 7 4.5% Mannitol + ST4 0.017 2.4 8 ST4 + 0.05% TWEEN + 5% Mannitol 0.017 2.4 9 5% Mannitol + ST4 0.017 2.4 10 ST4 + 10% Dextrose 0.239 77.9 11 Histidine 50mM 0.257 84.0 -24SKLI-9 (SBC 14460) PATENT 12 Histidine lOOmM 0.263 86.0 13 ST4 0.272 89.1 14 ST4 + 0.05% TWEEN 0.289 94.9 15 DEIONIZED WATER 0.304 100.0 Equation of 2 point line y = (340,136)x - 3-401 where x = absorbance units.
The x values on the chart above were inserted into this equation and the % hemolysis values were generated.
The data show that the addition of mannitol to sT4 in 50mM histidine buffer substantially reduces hemolysis of red blood cells when compared to hemolysis of red blood cells by sT4 in 50 mM histidine buffer alone.
Example 11 - Nephrotoxicity of sT4 The nephrotoxicity of sT4 prepared as two different formulations was tested. Vehicle A consisted of sT4 formulated as a 10 mg/ml solution in 50 mM L-histidine pH7, 0.05% Tween 80 and 4.5% mannitol. Vehicle B consisted of sT4 formulated as a 10 mg/ml solution in 35 mM L-histidine pH7, 0.3% saline. Other vehicles containing varying concentrations of histidine were used in previous toxicity studies in rats. sT4 was administered to four groups (I, II, III and IV) of CD® rats, 6 male and 6 female/group. Each animal received two intravenous bolus doses via tail vein, approximately 24 hours apart. Two groups (II and III) received sT4 in Vehicle A at 50 -25IE 903343 8KLI-9 (SBC 14460) PATENT and 200 mg/kg/day, respectively. A third group (IV) received sT4 in Vehicle B at 200 mg/kg/day. A fourth group (I) received 20 ml/kg/day of Vehicle A in a dose volume equivalent to that received by the 200 mg/kg/day (Vehicle A) group (III). The rats were dosed on days 1 and 2 and were killed and necropsied on day 3.
The results of the histopathologic examination of the kidneys are summarized in Table 5. Tubular cast nephropathy was observed in 6 of 12 rats that received 2 doses at 200 mg/kg/day of sT4 in Vehicle B. The lesions were similar to those observed in a previous single dose study in rats but were more severe. In contrast, examination of the kidneys from rats in Groups I, II and III revealed no evidence of tubular cast nephropathy or any other drug-associated change. These data show that formulating sT4 in 50mM L-histidine pH7, 0.05% Tween 80 and 4.5% mannitol substantially attenuates nephrotoxicity of sT4 in rats.
Table 5 Incidence of Tubular Cast Nephropathy after 2 doses of ST4 Group Dose Vehicle #/Group Tubular Cast Nephropathy (mg/kg/day) Male Female I 0 A 6M 6F 0/6 0/6 II 50 A 6M 6F 0/6 0/6 III 200 A 6M 6F 0/6 0/6 IV 200 B 6M 6F 4/6 2/6 -26IE 903343 SKLI-9 (SBC 14460) PATENT The above disclosure and examples fully disclose the invention and preferred embodiments thereof. However, the invention is not limited to the particular constructions illustrated herein but rather encompasses all modifications coming within the scope of the following claims.
Claims (13)
1. A pharmaceutical composition for internally administering an sT4 Protein to a human which comprises an sT4 protein and histidine in a pharmaceutically acceptable agueous solution.
2. The pharmaceutical composition of claim 1 in which the sT4 protein is sT4.
3. A pharmaceutical dosage unit which comprises the pharmaceutical composition of claim 1.
4. A pharmaceutical dosage unit which comprises the pharmaceutical composition of claim 2.
5. A pharmaceutical composition for internally administering an sT4 Protein to a human which comprises an sT4 protein, histidine and a non-ionic surfactant in a pharmaceutically acceptable aqueous solution.
6. The pharmaceutical composition of claim 5 which comprises about 5 to about 50 mg/ml of sT4, about 30 to about 75 mg/ml of histidine, and about 0.01 to about 0.6% of the non-ionic surfactant.
7. The pharmaceutical composition of claim 5 which also comprises a sugar.
8. The pharmaceutical composition of claim 7 which comprises about 3% to about 7% of mannitol.
9. The pharmaceutical composition of claim 8 which comprises about 5 to about 50 mg/ml of sT4, about 30 to about 75 -28IE 903343 SKLI-9 (SBC 14460) PATENT mg/ml of histidine, and about 0.01 to about 0.6% of the non-ionic surfactant.
10. The pharmaceutical composition of claim 5 which is lyophilized.
11. A pharmaceutical dosage unit which comprises the pharmaceutical composition of claim 5.
12. A kit comprising in one container the pharmaceutical composition of claim 10 and, in another container, a solution for reconstitution.
13. A pharmaceutical composition substantially as hereinbefore described by way of Example.
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US40860289A | 1989-09-18 | 1989-09-18 |
Publications (1)
Publication Number | Publication Date |
---|---|
IE903343A1 true IE903343A1 (en) | 1991-04-10 |
Family
ID=23616952
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
IE334390A IE903343A1 (en) | 1989-09-18 | 1990-09-14 | FORMULATION FOR SOLUBLE sT4 FOR TREATMENT OF HIV INFECTION |
Country Status (3)
Country | Link |
---|---|
AU (1) | AU6433790A (en) |
IE (1) | IE903343A1 (en) |
WO (1) | WO1991004043A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
IT1277897B1 (en) * | 1995-08-03 | 1997-11-12 | Mendes Srl | USE OF L-CARNITINE, ITS DERIVATIVES AND THEIR PHARMACEUTICALLY ACCEPTABLE SALTS IN COMBINATION WITH ANTIRETROVIRAL DRUGS TO REDUCE |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4597966A (en) * | 1985-01-09 | 1986-07-01 | Ortho Diagnostic Systems, Inc. | Histidine stabilized immunoglobulin and method of preparation |
-
1990
- 1990-09-14 IE IE334390A patent/IE903343A1/en unknown
- 1990-09-17 WO PCT/US1990/005282 patent/WO1991004043A1/en unknown
- 1990-09-17 AU AU64337/90A patent/AU6433790A/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
AU6433790A (en) | 1991-04-18 |
WO1991004043A1 (en) | 1991-04-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1084147B1 (en) | Process for producing immunoglobulins for intravenous administration and other immunoglobulin products | |
KR102546471B1 (en) | liquid pharmaceutical composition | |
CA2005143C (en) | Stabilized hydrophobic protein formulations of g-csf | |
JP5752671B2 (en) | VEGF antagonist preparation | |
US7138120B2 (en) | Process for producing immunoglobulins for intravenous administration and other immunoglobulin products | |
AU651188B2 (en) | Stabilized factor VIII preparations | |
US5919443A (en) | Stable lyophilized pharmaceutical preparations of G-CSF | |
KR101280273B1 (en) | Stabilized anti-hepatitis B (HBV) antibody formulations | |
JP4789698B2 (en) | Formula for factor IX | |
JP4879104B2 (en) | Highly concentrated, lyophilized, and liquid, factor IX formulation | |
JP2002544174A5 (en) | ||
JPS61103836A (en) | Fibronectin pharmaceutical preparation | |
JPS5822085B2 (en) | Intravenous gamma globulin preparations | |
AU2003244470B2 (en) | Immunocytokine-containing lyophilized preparation | |
KR20040018458A (en) | Liquid formulation comprising cetuximab and a polyoxyethylene sorbitan fatty acid ester | |
US20030118548A1 (en) | Human interferon-beta formulations | |
IE903343A1 (en) | FORMULATION FOR SOLUBLE sT4 FOR TREATMENT OF HIV INFECTION | |
Mulford | Derivatives of blood plasma | |
IE903344A1 (en) | Method of administering soluble t4 for treatment of human¹immunodeficiency virus infection | |
WO2004084816A2 (en) | IMPROVED CD4-IgG2 FORMULATIONS | |
JP2023539476A (en) | Annexin A1 N-terminal peptide formulation and method | |
WO2024120458A1 (en) | Taci-fc fusion protein liquid pharmaceutical preparation | |
Polenaković et al. | Hantaan virus infection with acute renal failure | |
KR810001235B1 (en) | Process for preparing lyophilized native gamma globulin for intravenous administration | |
JPH01238540A (en) | Remedy for spinal disease participating type i lymphotropic virus of human t cell |