IE80914B1 - Insect-resistant plants - Google Patents

Description

INSECT-RESISTANT PLANTS The present invention relates to the fields of genetic engineering, biochemistry and plant transformation. Fiore particularly, the present invention is directed toward transformation of plant cells to express a chimeric gene encoding a protein toxic to Coleopteran insects.

Bacillus thuringiensis (B, t. ) is a spore forming soil bacterium which is known for its ability to produce a parasporal crystal protein which is toxic to a wide variety of insects. Most strains are active against Lepidopteran insects (moths and butterflies) and a few are reported to have activity against Dipteran insects (mosquitoes and flies, see Aronson et al. 1985). Toxin genes from a variety of these strains have been cloned and the toxins have been expressed in heterologous hosts (Schnepf et al., 1981; Klier et al., 1982). In recent years, 3. t. var. tenebrionis (B't.t., Krieg et al., 1983; Krieg et al., 1984) and B. t. var. san di ego (B.t.sd., Hermstadt et al., 1986) strains have been identified as having activity against Coleopteran insects. The toxin gene from B. t. sd. has been cloned, but the toxin produced in E. coli was reported to be a larger size than the toxin from B.t.sd. crystals, and activity of this recombinant B.t.sd. toxin was implied to be weak.

Insects susceptible to the action of the protein toxin of Coleopteran-type Bacillus thuringiensis bacteria include, but are not limited to, Colorado potato beetle (Leptinotarsa decemlineata), boll weevil (Anthonomus grandis), yellow mealworm (Tenebrio molitor), elm leaf beetle (Pyrrhalta luteola) and Southern corn rootworm (Diabrotica undecimpunctata howardi). 8091 4 ·2~ Therefore, the potential for genetically engineered plants which exhibit toxicity or tolerance toward Coleopteran insects was foreseen if such plants could be transformed to express a Coleopteran-type toxin at a insecticidally-effective level. Agronomically important crops which are affected by Coleopteran insects include alfalfa, cotton, maize, potato, rape (canola), rice, tobacco, tomato, sugar beet and sunflower.

Although certain chimeric genes have been expressed in transformed plant cells and plants, such expression is by no means straight forward. Specifically, the expression of Lepidopteran-type £. t. toxin proteins has been particularly problematic. It has now been found that the teachings of the art with respect to expression of Lepidopteran-type B. t. toxin protein in plants do not extend to Coleopteran-type B. t. toxin protein. These findings are directly contrary to the prior teachings which suggested that one would employ the same genetic manipulations to obtain useful expression of such toxins in transformed plants.

In accordance with one aspect of the present invention, there has been provided a method for producing genetically transformed plants which exhibit toxicity toward Coleopteran insects, comprising the steps of: (a) inserting into the genome of a plant cell susceptible to attack by Coleopteran insects a chimeric gene comprising: i) a promoter which functions in plant cells to cause production of RNA; -310 ii) a DNA sequence that causes the production of a RNA sequence encoding a Coleopteran-type toxin protein of Bacillus thuringiensis; and iii) a 3’ non-translated DNA sequence which functions in plant cells to cause the addition of polyadenylate nucleotides to the 39 end of the RNA sequence; (b) obtaining transformed plant cells, and (c) regenerating from the transformed plant cells genetically transformed plants exhibiting resistance to Coleopteran insects.

In accordance with another aspect of the present invention, there has been provided a chimeric plant gene comprising in sequence: (a) a promoter which functions in plant cells to cause the production of RNA; (b) a DNA sequence that causes the production of a RNA sequence encoding a Coleopteran-type toxin protein of Bacillus thuringiensis; and (c) a 3s non-translated region which functions in plant cells to cause the addition of polyadenylate nucleotides to the 3’ end of the RNA sequence.

There has also been provided, in accordance with another aspect of the present invention, bacterial cells, transformed plant cells and plant transformation vectors that contain, respectively, DNA comprised of the above-mentioned elements (a), (b) and (c). -4In accordance with yet another aspect of the present invention, a differentiated plant has been provided that comprises transformed plant cells, as described above, which exhibit toxicity to Coleopteran insects. The present invention also contemplates seeds which produce the above-described transformed plants.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the DNA probes used for isolation of the B. £. £. toxin gene.

Figure 2 shows the steps employed in the preparation of plasmid pMON5432.

Figure 3 shows the orientation of the 3.0 kb HindiII fragment encoding the toxin gene in pHON5420 and pMON5421 with respect to the multilinker of pUC119.

Figure 4 shows the strategy utilized for sequencing of the B.£.£. toxin gene contained in pMON5420 and pMON5421.

Figure 5 shows the DNA sequence and location of restriction sites for the 1932 bp ORF of the B. t.£. gene encoding the 644 amino acid toxin protein.

Figure 6 shows the bands observed for B. £.£. toxin following SDS-PAGE analysis.

Figure 7 shows the N-termini of proteins expressed from the B. 1.t. toxin gene or proteolytically produced in vivo in B.t.£.

Figure 8 represents the altered S. £.£. genes used to analyze the criticality of the C-terminal portion of the toxin.

Figure 9 represents the altered B. £. £. genes used to analyze the criticality of the N-terminal portion of the toxin. -5Figure 10 shows the deletions produced in evaluation of B.t.t. toxin protein mutants.

Figure 11 shows the steps employed in preparation of plasmids pMON9758, pMON9754 and pMON9753.

Figure 12 shows the steps employed in preparation of plasmid pMON9791.

Figure 13 shows the steps employed in preparation of plasmid pMON9792.

Figure 14 shows a plasmid map for plant transformation cassette vector pMON893.

Figure 15 shows the steps employed in preparation of plasmid pMON9741.

Figure 16 shows the steps employed in the preparation of plasmid pMON5436„ Figure 17 illustrates the elements comprising the T-DNA region of disarmed Agrobacterium ACO.

Figure 18 shows the DNA sequence for the enhanced CaMV35S promoter.

STATEMENT OF THE INVENTION The present invention provides a method for transforming plants to exhibit toxicity toward susceptible Coleopteran insects. More particularly, the present invention provides transgenic plants which express the Coleopteran-type toxin protein of Bacillus thuringiensis at an insecticidal level.

In one aspect, the present invention comprises chimeric genes which function in plants and produce transgenic plants which exhibit toxicity toward susceptible Coleopteran insects. The expression of a plant gene which exists as double-stranded DNA involves the transcription of one strand of the -6DNA by RNA polymerase to produce messenger RNA (mRNA), and processing of the mRNA primary transcript inside the nucleus. This processing involves a 3s non-translated region which adds polyadenylate nucleotides to the 3s end of the mRNA.

Transcription of DNA to produce mRNA is regulated by a region of DNA usually referred to as the promoter.” The promoter region contains a sequence of nucleotides which signals RNA polymerase to associate with the DNA, and initiate the production of a mRNA transcript using the DNA strand, downstream from the promoter as a template to make a corresponding strand of RNA.

A number of promoters which are active in plant cells have been described in the literature. These include the nopaline synthase (NOS), octopine synthase (OCS) and mannopine synthase (MAS) promoters which are carried on tumor-inducing plasmids of Agro· bacterium tumefaciens, the cauliflower mosaic virus (CaMV) 19S and 35S promoters, and the light-inducible promoter from the small subunit of ribulose bis-phosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide). These types of promoters have been used to create various types of DNA constructs which have been expressed in plants; see e.g., PCT publication WO 84/02913 (Rogers et al., Monsanto).

Promoters which are known or are found to cause production of a mRNA transcript in plant cells can be used in the present invention. Suitable promoters may include both those which are derived from a gene which is naturally expressed in plants and synthetic promoter sequences which may include redundant or heterologous enhancer sequences. The promoter selected should be capable of causing sufficient -7expression to result in the production of an effective amount of toxin protein to render the plant toxic to Coleopteran insects. Those skilled in the art recognise that the amount of toxin protein needed to induce the desired toxicity may vary with the particular Coleopteran insects to be protected against. Accordingly, while the CaFIV35S, ssRUBISCO and MAS promoters are preferred, it should be understood that these promoters may not be optimal promoters for all embodiments of the present invention.

The mRNA produced by the chimeric gene also contains a 5s non-translated leader sequence. This sequence may be derived from the particular promoter selected such as the CaMV35S, ssRUBISCO or MAS promoters. The 5' non-translated region may also be obtained from other suitable eukaryotic genes or a synthetic gene sequence. Those skilled in the art recognise that the requisite functionality of the 5 s non-translated leader sequence is the enhancement of the binding of the mRNA transcript to the ribosomes of the plant cell to enhance translation of the mRNA in production of the encoded protein.

The chimeric gene also contains a structural coding sequence which encodes the Coleopteran-type toxin protein of Bacillus thuringiensis or an insecticidally-active fragment thereof. Exemplary sources of such structural coding sequences are B. t. tenebronis and B. t. san diego. Accordingly, in exemplary embodiments the present invention provides a structural coding sequence from Bacillus thuringiensis var. tenebrionis and insecticidally-active fragments thereof. Those skilled in the art will recognize that other structural coding sequence substantially homologous to the toxin coding sequence of B. c.t. can be utilized -8following the teachings described herein and are, therefore, within the scope of this invention.

The 3s non-translated region contains a polvadenylation signal which functions in plants to cause the addition of polvadenylate nucleotides to the 3’ end of the RNA. Examples of suitable 3’ regions are (1) the 3’ transcribed, non-translated regions containing the polvadenylate signal of the tumor-inducing (Ti) plasmid genes of Acrobacterium, such as the nopaline synthase (NOS) gene, and (2) plant genes like the soybean storage protein genes and the ssRUBSICO. An example of preferred 3’ regions are those from the NOS, ssRUBISCO and storage protein genes, described in greater detail in the examples below.

The Coleopteran-type toxin protein genes of the present invention are inserted into the genome of a plant by any suitable method. Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens such as those described in, e.g. EPO publication 131,620 (Rogers et al.), Herrera-Estrella 1983, Bevan 1983, Klee 1985 and EPO publication 120,516 (Schilperoort et al.). In addition to plant transformation vectors derived from the Ti or root-inducing (Ri) plasmids of Agrobacterium, alternative methods can be used to insert the Coleopteran-type toxin protein genes of this invention into plant cells. Such methods may involve, for example, liposomes, electroporation, chemicals which increase free DNA uptake, and the use of viruses or pollen as vectors. If desired, more than one gene may be inserted into the chromosomes of a plant, by methods such as repeating the transformation and selection cycle more than once. -9The plant material thus modified can be assayed, for example, by Northern blotting, for the presence of Coleopteran-type toxin protein mRNA. If no toxin protein mRNA (or too low a titer) is detected, the promoter used in the chimeric gene construct is replaced with another, potentially stronger promoter and the altered construct retested. Alternately, level of toxin protein may be assayed by immunoassay such as Western blot. In many cases the most sensitive assay for toxin protein is insect bioassay.

This monitoring can be effected in whole regenerated plants. In any event, when adequate production of toxin protein mRNA is achieved, and the transformed cells (or protoplasts) have been regenerated into whole plants, the latter are screened for resistance to attack by Coleopteran insects. Choice of methodology for the regeneration step is not critical, with suitable protocols being available for hosts from Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciierae (cabbage, radish, rapeseed, etc.), Cucurbiiaceae (melons and cucumber), Gramineae (wheat, rice, corn, etc.), Solanaceae (potato, tobacco, tomato, peppers), Malvaceae (cotton, etc.), Chenopodiaceae (sugar beet, etc.) and various floral crops. See e.g. Ammirato et al. (1984).

All protein structures represented in the present specification and claims are shown in conventional format wherein the amino group at the N-terminus appears to the left and the carboxyl group at the C-terminus at the right. Likewise, amino acid nomenclature for the naturally occurring amino acids found in protein is as follows: alanine (ala;A), asparagine (Asn;N), aspartic acid (Asp;D), arginine (Arg;R), cysteine (Cys;C), glutamic acid (Glu;E), glutamine (Gln;Q), glycine (Gly;G), histidine (His;H), isoleucine (lie;I), leucine (Leu;L), lysine (Lys;K), methionine (Met;M), phenylalanine (Phe;F), proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryptophan (Trp;W), tyrosine (Tyr;Y) and valine (Val;V).

ISOLATION OF B.t.t. TOXIN GENE The B. t.t. gene encoding the Coleopterantype toxin protein was isolated as described below.

Isolation of Protein Crystals B. t. tenebrionis was grown in Tryptics.se Soybroth (TSB) medium for the isolation of protein crystals. In attempting to isolate intact crystals from B. t. t. a significant difference between these crystals and those of the Lepidopteran-type was noted. While Lepidopteran-type crystals are routinely isolated on gradients formed from Renografin, Hypague or NaBr, it was found that 3,t.t. crystals dissolved in these gradients media. It was found that B.t. t. crystals were stable in gradients of sucrose, and sucrose gradients were used for the isolation of B. t. ¢. crystals.

Isolation of B.t.t. Toxin from Crystals Purified crystals were analyzed for their protein composition by SDS polyacrylamide gel electrophoresis. Results of these experiments indicated that B. t. t. crystals contained at least two protein components with molecular weights of approximately 68 to 70 kilodaltons (kDa) and approximately 60 kDa, respectively. The relative amounts of the components were variable from preparation to preparation. In addition, it was suggested that the higher molecular weight component might consist of more than a single protein. Bernhard (1986) reported proteins of about 68 kDa and 50 kDa as components of B.Z.t. crystals. Herrnstadt et al. (1986) reported that the crystals of B. i. san diego were composed of a protein of about 64 kDa. In contrast, Lepidopteran-type B.t. strains such as B. t, kurstaki typically contain a higher molecular weight protein of 130 kDa to 140 kDa. This result indicates a significant difference in the structure of the Lepidopteran and Coleopteran toxin proteins.

Several approaches were taken to purifying the individual protein components of the crystal. Isoelectric focusing was not successful because all of the protein precipitated. Anion exchange high pressure liquid chromatograph (HPLC) on a Mono Q column failed to resolve the components. Cation exchange HPLC on a Mono S column in the presence of 4 M urea resolved five peaks. Analysis of the peaks by SDS gel electrophoresis indicated that peak A contained only the higher molecular weight band from whole crystals. Peak B was rich in this higher band with small amounts of the lower band. Peak C was rich in the lower band with significant amounts of the upper band. Peaks D and E were mixtures of both bands. In most preparations the higher molecular weight band, corresponding to peaks A and B, was the predominant protein in the crystals. For the HPLC separated material, peaks A and B represented most of the recovered protein.

The N-terminal amino acid sequences corresponding to peaks A, B, and C were determined. Peaks A and B were found to have the same N-terminal sequence while the peak C sequence was different. The sequences determined were: -12Peak A and B: 15 Met Asa Pro Asa Asn Arg Ser Glu His Asp Thr lie Lys Thr Thr Peak C: 15 Met X Pro X Thr Arg Ala Leu Asp Asp Thr lie Lys Lys Asp Val He Glyn Lys X represents an undeterminent amino acid.

Insect Toxicity of B. ¢.1. Proteins Several preparations of B. £. £. and B. £. £. proteins were tested for toxicity to various insects including both Lepidopterans and Coleopterans. No activity was observed towards Lepidopterans (corn earworm, black cutworm, tobacco hornworm and cabbage looper). Among the Coleopterans, activity was observed against Colorado potato beetle (Leptinotarsa decemlineata) and boll weevil (Anthonomus grandis). Lower level activity was exhibited against Southern com rootworm (Diabrotica undecimpunctata howardi). Insecticidal activity was found in crude bacterial cultures, purified crystals, solubilized crystals and isolated peaks C, D, E (pooled), A and B.

Assays for toxicity to Colorado potato beetle were carried out by applying the preparation to be tested to tomato leaves and allowing the insects to feed on the treated leaves for four days. Assays with boll weevil and Southern corn rootworm were performed by incorporating the test material in an appropriate diet mixture. -13IDENTIFZCATION AND CLONING OF THE B„ ±. t.

TOXIN GENE IN F. GOBI AND PSEVDOMOWAS Using this N-terminal protein sequence information, synthetic DNA probes (Figure 1) were designed which were used in the isolation of clones containing the B.t.t. toxin gene. Probes were endlabeled with [γ-32^Ρ] ATP according to Maniatis (1982). B. thuringiensis var. tenebrionis was grow, for 6 hours at 37°C in Spizizen medium (Spizizen, 1958) sup10 plemented with 0.1% yeast extract and 0.1% glucose (SPY) for isolation of total DNA. Total DNA was isolated from B.t. t. by the method of Kronstad (1983). Cells were grown on Luria agar plates for isolation of Β. έ. t. crystals used in toxicity studies.

E. coli and Pseudomonas cultures were routinely grown in Luria Broth (LB) with ampicillin (Ap, 200yg/ml), kanamycin (Km, 50pg/ml), or gentamicin (Gm, 15pg/ml) added for plasmid selection and maintenance.

Isolation and Manipulation of DNA Plasmid DNA was extracted from E. coli and Pseudomonas cells by the method of Birnboim and Doly (1979) and large quantities were purified using NACS™ 52 resin (Bethesda Research Laboratories) according to manufacturer's instructions. Restriction endonu25 cleases, calf alkaline phosphatase and T4 DNA ligase were used according to manufacturer's instructions (New England Biolabs). Restriction digestion products were analyzed on 0.8% agarose gels electrophoresed in Tris-acetate buffer. DNA fragments for cloning were purified from agarose using the freeze-thaw method. Construction of recombinant DNA molecules was accor -14ding to Maniatis et al. (1982). Transformation into E. coli were performed according to Maniatis (1982).

Cloning of the B. ¢. ¢. Toxin Gene Southern analysis (Southern, 1975) was performed using the modified dried gel procedure (Conner et al., 1983). Colony filter hybridisation, for detection of B.£»1. toxin clones, used the tetramethyl ammonium chloride method (Wood et al., 1985).

Southern analysis of BamHI and HindiII digested B.i.t. total DNA identified a 5.8 kb BamHI and a 3.0 kb Hindi 11 fragment which hybridized to the synthetic Al probe. BamHI fragments of B.t.i. DNA (5.4-6.5 kb) were purified from agarose gels and ligated to alkaline phosphatase treated BamHI digested pUC!19. pUC119 is prepared by isolating the 476 bp HgiAI/Dral fragment of bacteriophage Ml3 and making the ends of the fragment blunt with T4 DNA polymerase (New England Biolabs). This fragment is then inserted into pUC19 that has been digested with Ndel and filled with Klenow DNA polymerase (New England Biolabs).. The ligated B.i.t. and pUC119 DNA was then used to transform E. coli JM101 cells. After several attempts only 150 Ap resistant colonies were obtained. Hindi11 fragments of B. 1.1. DNA (2.8-3.5 kb) were also cloned into the Hindi 11 site of pUC119, and 1100 colonies were obtained. All colonies were screened by colony hybridisation to the Al probe (Figure 1). Eleven HindiII clones showed strong hybridization, but none of the BamHI colonies showed any hybridization. The colonies identified by hybridization to Al were then screened using synthetic probe A2 (Figure 1) and two colonies showed hybridization to the second probe. Restriction digest patterns of the two colonies indi-15cated that the same 3.0 leb Hindlll fragment was contained in both hut in opposite orientations. These clones were designated pMON5420 and pKON5421 (Figure 3). To confirm that the clones did contain the gene for the B. t. £. toxin protein, the single stranded DNA from both clones was sequenced using degenerate probes Al and A2 as primers for di-deoxy sequencing (Sanger, 1977). Sequence analysis with Al probe as primer revealed an open reading frame (ORF) whose sequence was identical to amino acids 9 through 15 of the amino acid sequence determined for purified peaks A and B of the B, t. t. toxin protein. Probe A2 produced DNA sequence which began beyond the end of the determined amino sequence, hut this DNA sequence was identical to sequence produced with Al. These results confirm that the desired B. £. £. toxin gene was cloned.

Southern hybridization to total B. i, t. DNA using degenerate probes based on the N-terminus of peak C failed to detect specific bands suggesting that the amino acid sequence determined for peak C was incorrect or most probably was obtained from a mixture of two or more proteins comprising peak C.

Analysis of Proteins Produced in E. coli B. £.£. crystal proteins and recombinant £.£.£. proteins were examined by SDS-PAGE (Laemmli, 1970). One ml of E. coli was centrifuged, the pellets resuspended in lOOpg SDS-sample buffer and 10μ1 samples were electrophoresed on 7.5% polyacrylamide gels. The gels were either stained with Coomassie Blue or probed for cross reactivity to antibodies raised against purified £.£.£. toxin crystals. Western Blots were performed using the horseradish peroxidase conjugated antibody procedure (Towbin et al., -161984). High molecular weight markers were purchased from BioRad.

Further confirmation that the clones produced S.t.t. toxin was obtained by Western blot analysis of the proteins produced in E. coli. E. coli JM.101 cells containing either pUC119, pMON5420 or pMON5421 were grown overnight in the presence of IPTG (O.lmM) to induce the lac promoter. Duplicate samples were analyzed by SDS-PAGE along with purified B. t. t. crystal proteins included as controls. Western blot analysis of one gel revealed the production of 2 cross reacting proteins by E. coli containing pMON5420 or PMON5421. These proteins were identical in size to the major and minor proteins of the B.t.t. crystal. Molecular weights of the proteins x-xere determined by comparison to the molecular weight standards on the second gel stained with Coomassie blue. The major toxin protein was determined to be 74 kDa in size and the minor toxin protein was determined to be 68 kDa in size. The level of B.t.t, toxin proteins produced by pMON5420 was increased by the addition of IPTG while production of toxin proteins by pMON5421 was unaffected.

Production of B.t.t. Toxin(s) in Pseudomonas fluorescens A broad host range vector, pMON5432, was constructed by cloning BamHI digested pMON5420 into the BamHI site of pMON7111 as shown in Figure 2. This vector was then mated into P. fluorescens 701E1 for analysis of toxin production. Tri-parental matings into Pseudomonas fluorescens were done as previously described (Ditta et al., 1980). Samples of overnight cultures, grown with and without IPTG, were prepared for Western blot analysis and insect toxicity studies. -17The proteins produced by Pseudomonas were identical in sise to the E, coli produced proteins and protein expression was increased with the addition of IPTG.

Insect Toxicity Assay Coleopteran toxin activity was assayed using newly hatched Colorado potato beetle (Lepiinotarsa decemlineata) insects in a tomato leaf feeding assay. E. coli and Pseudomonas cultures were grown overnight in the presence of IPTG, centrifuged and resuspended at various concentrations in lOmM MgS04. The cells were disrupted by sonication (three 15 sec. pulsed treatments on ice). Tween-20 (0.1%) was added and the sample painted onto a tomato leaf placed into a 9cm petri dish lined with moist filter paper. Ten Colorado potato beetle larvae were added to each leaf. After four days, the percentage corrected mortality (percentage of insects alive in the control minus the percentage of insects alive in the treated sample divided by the percentage alive in the control) was computed using Abbott's formula (Abbott, 1925). Assays were performed in duplicate and the data combined. B. t.t. crystal/spore preparation were used as positive controls.

E. coli cultures of pMON5420 and pMON5421 were evaluated for Coleopteran toxicity using different concentrations of cultures grown with added IPTG. A comparison of recombinant and wild type B. t. t. toxin activities is shown below in Table I. The results show that the recombinant B.t.t. protein(s) are toxic to Colorado potato beetle. The 2x-concentrated, IPTG-induced pMON5420 culture killed 100% of the insects as did the B.t.t. spore/crystal control. These toxicity results demonstrate that the B. t.t. snft· -18gene cloned was the gene that encodes the B. £.£. toxin protein.

Insect feeding assay showed that the Pseudomonas produced toxins were toxic to Colorado potato beetle. The relative toxicity of Pseudomonas cultures was consistent with the amount of toxin protein produced as determined by Western blot analysis when compared to B. coli cultures.

TABLE I Coleopteran Toxicity of Recombinant B.£.£. Toxin Sample1 B. coli JM101 Concentration2 Corrected Mortality pUC119 2x 0% PMON5420 lx 83% pMON5420 2x 100% pMON5421 lx 44% pM0N5421 2x 61% P. fluorescens 701E1 pM0N5432 3x 60% B. 1.1. prep 100% 1 Cultures were grown overnight with added IPTG, concentrated, sonicated and tested for toxicity. 2 lx equals cellular concentration of overnight culture.

SEQUENCE OF TOXIN GENE OF B.£.£.

Location and orientation of the B.t. £. gene within the cloned fragment was determined based on the following information: a) DNA sequence was obtained from the single stranded pMON5421 template. b) A Pstl site identified, by DNA sequence analysis, near the start of translation was mapped in pMON5420 and pMON5421, c) several other restriction sites were mapped, d) a deletion from a BglH site to a BamHI site which deletes 130 bp was constructed and both full-length proteins were produced. This information was used to construct maps of pMON5420 and pMON5421. Referring to Figure 4, the toxin coding region begins 500 bp from the 5’ Hindi 11 site, and 150 bp upstream of the Pstl site. The coding region ends approximately 450 bp from the 3’ Hindi 11 site. The BglH site is approximately 350 bp downstream of the stop codon.

Plasmids The plasmids generated for sequencing the B. t. t. insecticidal toxin gene are listed in Table II. The parental plasmids, pMON5420 and pMON5421, are independent isolates of the HindiII fragment cloned into pUC119 in opposite orientation. -20TABLE II Sequencing Plasmids pMON5420 PMON5421 PMON5307 pMON53O8 P.MON5309 ΡΜΘΝ5310 pMON5311 pMON5312 pMON5313 PMON5314 PMON5315 pMON5316 pMON5426 pMON5427 pMON5428 PMON5429 3.0 Hindlll insert from B. t. t. DNA (parent plasmid) 3.0 Hindiϊϊ insert from B.t.t. DNA (parent plasmid) EcoRI deletion of pMON5420 EcoRI deletion of pMON5421 Pstl deletion of pMON5420 Xbal deletion of pMON5421 EcoRV-Smal deletion of pMON5421 Ndel-BamHI deletion of pMON5421* Ndel-BamHI deletion of pMON5420* AsuII-BamHI deletion of pMON5421* AsulI(partial)-BamHI deletion of PMON5421* AsuII-BamHI deletion of ΌΪΟΝ5421** Bglll-BamHI deletion of pMON5420 EcoRV-Smal deletion of pMON5420 Hpal-Smal deletion of pMON5420 Xbal deletion of pMON5420 - After digestion of the DNA with both enzymes, the ends were filled in with Klenow polymerase, ligated and used to transform JM101.

** - Generation of the AsuII-BamHI deletion of this construct resulted in a rearrangement of an AsulI fragment to an orientation opposite to its original location. This resulted in a sequence of 5316 reading toward the NH2 end. -21Preparation of Single Stranded Template for Sequencing The following protocol provides reproducibly good yields of single stranded template for sequencing. A single colony containing the pUC119 with the fragment to be sequenced was streaked on L-agar (10 g tryptone, 5 g yeast extract, 5 g Nael, and 15 g agar per liter) containing ampicillin (200pg per ml). A single colony from this plate was inoculated into 3 ml of L-broth (200pg per ml ampicillin) and incubated at 37°C overnight with shaking. From this culture, 50 pi was inoculated into 10 ml of 2X YT (20 g tryptone and 10 g yeast extract per liter) with 200 pg of ampicillin per ml in a 150 ml side arm flask and incubated at 37°C with shaking. After 2-3 hours (Klett reading of 50), 100 pi of M13K07 (helper phage) grown in E. coli JM101 was added to induce the culture. The flask was shaken for one hour followed by the addition of 20 ml of 2X YT adjusting the final concentration of kanamycin to 70pg per ml and ampicillin to 200 pg per ml. The cultures were shaken for 16-18 hours at 37°C.

A total of three mis of the induced overnight culture was found to be sufficient to isolate a suitable amount of template for four sequencing experiments. The three mis were spun in 1.5 ml eppendorf tubes for 1 minute, decanted and filtered through a 0.2 um Gelman Sciences Acrodisc®. This step was found to be useful for the removal of cellular debris and intact E, coli. Ά polyethylene glycol precipitation (20% PEG, 2.5M NaCl, 500 pi per 2 ml of lysate) at room temperature for 10 minutes was followed by centrifugation for 10 minutes. The supernatant was discarded followed by a brief spin (15 seconds) and removal of the residual PEG. Any remaining PEG will be carried through the -22template isolation, and adversely affect DNA sequencing reactions. The pellets are resuspended in 100 μΐ of TE (XOmM Tris, ImH EDTA, pH 8.0), combined and mixed well with 200 μΐ of buffered phenol (buffered by sequilibration with an equal volume of 1M Tris-HCl, pH 8.0, then 0.1M Tris-HCl, pH 8.0, followed by an equal volume of TE). After incubation at 55°C for 10 minutes an equal volume (200 μΐ) of phenol/chloroform (1::1) was added, vortexed, and centrifuged for 2 minutes. The top layer was removed, extracted with 200 μΐ of chloroform, centrifuged and the aqueous phase removed. The single stranded template was precipitated with 25 μΐ of 3M- sodium acetate (pH 5.2) and 500 μΐ of 95% ethanol, incubated on dry ice for 5 minutes and centrifuged for 10 minutes. The precipitate was resuspended in 25 μΐ of H2O and 2 μΐ was checked on an agarose gel for correct size, relative concentration and contaminating DNA.

Sequencing Reagents and Conditions The protocols for DNA sequencing are described in detail in the Handbook available from Amersham Corporation. Reagents (nucleotides, primer, buffer, chase solution and Klenow polymerase) were obtained from the Amersham H13 sequencing kit (catalog #N4502). The sequencing mixes provided in the Amersham kit were adjusted for efficient sequencing of the A-T rich £.£.£. gene. Instead of the recommended 1::1 mix of dNTP to ddNTP, the following ratios were found to be more appropriate; 40 μΐ dATP: 10 μΐ ddATP, 35 μΐ dTTP: 15 μΐ ddTTP, 15 μ 1 dGTP: 35 μ 1 ddGTP, and 10 μ 1 dCTP: 40 μΐ ddCTP. Radioactive sulfur ([a-35S] dATP) was used in the sequencing reactions (Amersham catalog #SJ.13O4). The sequencing gels (prepared as described -23in the Amersham handbook) were run on the Hoeffer ”Poker Face apparatus at 70 watts (1200-1400 volts) which was found to give very good resolution. Higher voltages resulted in fussy bands.

Sequencing of the B. t. t. Toxin Gene The isolated plasmids, pMON5420 and pMON5421, contained a 3.0 HindiII fragment in opposite orientation (see Figure 3). The major protein of the B.t.t. crystal, which was used as the basis for design of the oligonucleotide probes, has a molecular weight estimated to be 73-76 kdal corresponding to approximately 2.0 kb of DNA. Initial sequencing from the Al and A2 primers (synthetic oligonucleotides based on the amino acid sequence of Peak A; see Table III, below) confirmed that the DNA sequence corresponded to the anticipated amino acid sequence.

TABLE III Synthetic Oligonucleotides Used for Sequencing the 3.t.t. Insecticidal Toxin Gene Primer Template Sequence Location1 Bttstart Bttext Bttseq BttAl* BttA2* pMON5420 pMON5421 pMON5421 pM0M5421 pMON5421 tgaacatggttagttgg 291-275 taggtgatctctaggcg 422-439 ggaacaaccttctctaatat 1156-1175 atgaayccnaayaaycg , 205-222 garcaygayacyathaa 227-242 * y = t or c r = a or g h = t,c or a. n = a,g,c or t. 1 The location of the primers is based on the total of 2615 bases sequenced. Sequencing from pMOK5420 proceeded toward the amino acid end and from pM0N5421 toward the carboxyl end (see Figure 3). -24A Pstl site was located in the initial seguence which was used to identify the location and probable orientation of the B. t.t. gene within pMON5420 and pMON5421 (see Figures 3 and 4). Mapping of restriction sites with a number of enzymes (Hpal, Xbal, Ndel, EcoRV, and Bglll) and the numerous unique sites remaining in the puC119 portion of both pMON5420 and pMON5421 provided the opportunity to obtain sequence using the universal sequencing primer. Deletions were generated in both pMON5420 and pMON5421 bringing the universal primer homologous region in close proximity to internal regions of the gene. In areas not easily sequenced by generating deletions, synthetic oligonucleotides corresponding to sequenced regions in the coding sequence (Table III) were used as primers to obtain extensions of the sequenced regions. The regions sequenced (sequence coordinates; Table IV) and the direction of sequencing is depicted in Figure 4.

TABLE IV Source of Sequence Data Plasmid Length (bp) Location Plasmid Length (bp) Location pMON5307 414 797-1211 pMON53l6 153 1861-2041 pMON5308 276 1895-2171 pMON5426 300 2220-2520 pMON5309 170 114-284 pMON5427 110 1701-1812 pMON5310 283 1595-1880 PMON5428 129 1548-1677 PMON5311 110 1812-1922 pM0N5429 303 1292-1595 pMOM5312 248 782-1030 Bttstart 264 1-264 pM0N53l4 291 2041-2305 Bttext 380 440-820 pMON5315 330 1157-1187 BttA2 267 250-517 -25COMPUTER ANALYSIS OF THE B.t.t.

INSECTICIDAL TOXIN GENE A total of 2615 base pairs of sequence were obtained from pHON5420 and pMON5421. Computer analysis of the sequence revealed a single open reading frame from base pair 205 to 2136. Referring to Figure 5, the B.t.t. insecticidal toxin gene is 1932 base pairs, coding for protein of 644 amino acids with a molecular weight of 73,091 daltons. The protein has a net charge of -17 and a G-C content of 34%.

Comparison Between Coleopteran-type and Lepidopteran-type Toxin Genes and Proteins Although the Coleopteran-type toxins and the Lepidopteran-type toxins are derived from Bacillus thuringiensis, there are significant differences between the toxin genes and the toxin proteins of the two types. As isolated from Bacillus thuringiensis both types of toxins are found in parasporal crystals; however, as described above, the solubility properties of the crystals are distinctly different. In addition, the sizes of the toxin proteins found in solubilized crystals are completely different. Lepidopteran-type toxin proteins are typically on the order of 130 kDa while the Coleopteran-type toxin proteins are approximately 70 kDa.

Isolation and DNA sequence analysis of the Coleopteran-type toxin gene from B. t. tenebrionis predicts the amino acid sequence of the toxin protein (see Figure 5). Both the nucleotide sequence and the derived amino acid sequence of the Coleopteran-type toxin gene have been compared to nucleotide and amino acid sequence of a typical Lepidopteran-type toxin. -26This comparison was performed using the computer program BESTFIT of Devereux et al (1984) which employs the algorithm of Smith and Waterman (1981). BESTFIT obtains maximum alignment of two nucleotide or amino acid sequences. BESTFIT calculates two parameters, quality and ratio, which can be used as alignment metrics when comparing different alignments. Ratio varies between 0 and 1.0. A larger ratio indicates a better alignment (greater similarity) between two sequences.

The BESTFIT alignment shows that the two types of toxin genes are related at both the nucleotide sequence and amino acid sequence level. However, the alignment also shows that the two sequences are clearly distinct and possess many regions of mismatch at both the nucleotide and amino acid sequence levels. For example, the ratio for comparison of the two amino acid sequences is only 0.22. At the nucleotide sequence level, maximum alignment is obtained only by the introduction of many gaps in both sequences, and the ratio is only 0.072.

There are many sequenced examples of Leptidopteran-type toxin genes; similar comparison among these genes has shown that the gene from B.t. kurstaki HD-l. described by Schnepf et al. (1985) and that from B. i. kurstaki HD-73 described by Adang et al. (1985) represent the two most divergent Lepidopteran-type toxin genes. By comparison with the ratios calculated above for alignment of the Colepteran-type and the Lepidopteran-type gene, the ratio for amino acid sequence comparison of the two most divergent Lepidopteran-type proteins is 0.811, and the ratio for these two Lepidopteran-type genes at the nucleotide sequence level is 0.755. This indicates that although the -27Coleopteran-type and Lepidopteran-type toxin genes may be evolutionarily related, they are quite distinct in both nucleotide and amino acid sequence.

HIGH LEVEL PRODUCTION OF RECOMBINANT 5 B. t. t. TOXIN IN E. COLI To facilitate purification of large quantities of recombinant B. t. t. toxin, it was necessary to clone the B. t.1. gene into an E. coli high expression vectors. Site directed mutagenesis was used to intro10 duce an Ncol restriction site into pMON5420 at the ATG codon at the start of the open reading frame.

Site Directed Mutagenesis Site-directed mutagenesis to introduce new restriction sites was performed by the method of Kun15 kel (1985). Plasmid pMON5420 was introduced by transformation into E. coli strain BW313, which contains the dut~ and ung~ mutations in order to incorporate deoxyuridine into the DNA. A single transformed colony was grown overnight in 2X YT medium containing 100 pg/ml ampicillin and 0.25 pg/ml uridine. A 0.5 ml aliquot of this culture was added to 10 ml of the same medium and incubated for one hour at 37°C with vigorous shaking to a density of 0.23 (A600). To induce formation of single strand containing phage particles, helper phage M13K07 was added at a multiplicity of approximately 10 and incubation was continued for one hour to a density of 0.4 (A600). The culture was diluted by addition of 30 ml of the above medium, and kanamycin was added to a final concentra30 tion of 70 pg/ml. Incubation was continued for 15 hours at which point cells were removed by centrifuga-28tion. Phage particles were precipitated from 25 ml of supernatant by addition of 5 ml of 20% PEG/2.5 M NaCl/50 pg/ml RNAase A followed by incubation on ice for 15 minutes. Phage were recovered by centrifugation and dissolved in 0.8 ml TE buffer. DNA was isolated from the particles by three extractions with 0.8 ml phenol/chloroform/isoamyl alcohol (25:24:1) followed by ethanol precipitation. The DNA pellet was dissolved in 100 pi of water to a final concentration of approximately 1 mg/ml (estimated by agarose gel electrophoresis).

Synthetic oligonucleotide primers for mutagenesis were suspended in water at a concentration of approximately 10 pmole/pl. The oligonucleotides were phosphorylated utilizing T4 polynucleotide kinase in a reaction containing 50 pmoles oligonucleotide, 1 mM ATP, 25 mM Tris-Cl pH 8, 10 mM MgCl2, 0.2 mM spermidine-HCl, 1 mM DTT and 2 units of enzyme. The reaction was incubated at 37°C for 30 minutes and then heated at 70°C for 5 minutes. The phosphorylated primer was annealed to the deoxyuridine containing phage DNA by mixing approximately 1 pmole of the phage DNA (2 pg) with 10 pmole primer in a reaction containing 6.6 mM Tris-HCl, 6.6 mM MgCl2, 6.6 mM NaCl and 5 mM DTT. The mixture was heated to 70°C for seven minutes and then slowly cooled to room temperature. The annealed primer/template was used as the substrate for synthesis of double-stranded, closed circular DNA by addition of each dNTP to 0.5 mM, ATP to 0.5 mM, 5 units of Klenow fragment DNA polymerase and 400 units T4 DNA ligase (New England Biolabs). The reaction was carried out in the same buffer salts as for annealing at 15°C for approximately 15 hours. At this time an additional 400 units of ligase was added and incubation was continued for two hours. 29“ One half of the reaction was used to transform 0.15 ml of CaCl2-treated JM101 cells, and the cells were spread on LB plates containing 100 pg/ml ampicillin. Between 30 and several hundred colonies were recovered for each mutagenesis reaction. Single colonies were grown overnight in LB containing ampicillin and plasmid minipreps were prepared by the alkaline SDS method. Plasmids were analyzed for the presence of the new restriction site and the presence of the site was confirmed by sequence analysis as described above.

A plasmid containing a Ncol site (pMON9759) at the start of the B. i. t. insecticidal toxin gene was generated by site-specific mutagenesis. The primer used is shown below: Desired Site Primer Ncol GATTGTTCGGATCCATGGTTCTTCCTCCCT The generation of the Ncol site at the N-terminus has changed the second amino acid from asparagine to aspartic acid. This change does not affect insect toxicity. BamHI and Styl sites have also been generated as a consequence of the introduction of this Ncol site. The plasmid containing the Ncol site has been designated pMON9759. The 2.5 kb Ncol-Hindlll fragment containing the toxin encoding segment from pMON9759 was then cloned into Ncol-Hindlll digested pMON5634 to produce pMON5436. Referring to Figure 16, pMON5534 is a pBR327 based plasmid which also contains the fl phage origin of replication. The vector contains a synthetic recA promoter which is induced by nalidixic acid. The gene 10 leader from phage T7 (described in 30commonly assigned U.S. patent application serial number 005821, filed February 4, 1987, the disclosure of which is hereby incorporated by reference) is also present to increase expression in B. coli. A synthetic linker with multiple cloning sites was added for insertion of genes downstream of the promoter and gene 10 leader sequence.

For induction of the recA promoter, overnight cultures were diluted 1:50 into M9 minimal media (Miller, 1972) with 0.2% casamino acids and 0.25% glucose added. At 150 Klett units, naladixic acid was added to 50pg/ml and cells were harvested 3 hours post induction. The level of B. £. £. toxin produced by nalidixic acid induced pMON5436 was compared to IPTG induced pMON5420 by analysis on SDS-PAGE. The Coomassie blue stained gel revealed no detectable B.£.£. produced by pMON5420 while the level of B.i. t„ produced by pMON5436 was approximately 5% of total protein. This construct was used to isolate large quantities of tbe recombinant B.£. £. toxin proteins to investigate toxicity levels, insect specificity, and mode of action.

B. £.£. TOXIN CHARACTERIZATION Identification of the Number and Origin of the B. £. £. Proteins B. £. var. tenebrionis produces a number of Coleopteran-type toxin proteins, present in protein crystals, which are produced co-incidentally with sporulation (see Figure 6). These protein crystals are released into the media as cells autolyse during or following sporulation. To determine the number of toxin proteins produced by B. £. var. tenebrionis, 500 -31ml cultures of this organism were grown in 2 liter flasks in 15% TSB medium in 100 mM 2-(N~morpholino) ethanesulfonic acid (MES) buffer, pH 7.0 at 30°C for 7 days. At this point the cultures have sporulated and the cells lysed. Protein crystals and spores were harvested by centrifugation at 20,000 x gravity (g) for 20 min. at 4°C. Pellets were washed three times with excess water, followed by three washes with 2 M NaCl. The resultant pellet was stored at 4°C in water plus 0.02% sodium azide. £.£.£. toxin protein was solubilized from the crystals by suspending the pellet in 100 mM sodium carbonate buffer, pH 10 and stirring this suspension for two hours at room temperature. After centrifugation 20,000 x g for 20 min to remove unsolubilized materials, the supernatant was filtered through a 0.2 pm filter to remove any remaining spores Β. i.£. toxin protein prepared in this manner, as do crystals solubilized in 125 mM Tris-HCl, 4% SDS, 20% glycerol and 10% 2-mercaptoethanol, pH 6.8, (SDS sample buffer used to prepare samples for SDS-PAGE analysis) is comprised of four major and different proteins as judged by SDS-PAGE analysis. Five unique products were identified by N-terminal amino acid analysis. To determine whether all five of these pro25 teins were derived from the same gene or whether two or more genes are required for their synthesis, the N-terminal amino acid sequence of each of these proteins were determined using automatic Edman degradation chemistry.

An Applied Biosystems, Inc. Model 470A gas phase sequencer (Foster City, CA) was employed (Hunkapiller, et al., 1983). The respective PTH-amino acid derivatives were identified by RP-HPLC analysis in an on-line fashion employing an Applied Biosystems, Inc. -32Model 120A PTB analysis fitted with a Brownlee 2.1 mm I.D. PTH-C18 column. Determination of the N-terminal amino acid sequence of each protein will establish whether all these proteins were derived from the B.t.t. toxin gene described above.

The strategy to sequence these proteins was to sequence the B.1.t. toxin proteins corresponding to bands 1 and 3 (see Figure S) from the E, coli clone JM101 (pMON5436), bands 2, 3 and 4 by electro^elution of the proteins produced by 3. t. var. tenebrionis from SDS-PAGE gels. The sequence of B.t.t. 1 and 3 was determined with proteins purified from JM101 (pMON5436). JM101 (pMON5436), as well as the other E. coli constructs (pMON5450, 5456 and 5460, infra) produces the 3. i. t. in the form of insoluble retractile bodies after cultures are induced for high level expression. The E. coli constructs were grown in modified M9 media at 37°C. A culture grown overnight was used to inoculate 400 ml of the modified M9 media in 2.4 1 fembach flasks to an initial starting density of 10 Klett units. Nalidixic acid, in 0.1 N NaOH, was added to the cultures at 100 Klett units to a final concentration of 50 pg/ml, to induce B.t.t. toxin protein expression. After an additional 4 hours of incubation, cultures were harvested hy centrifugation at 20,000 x g for 20 min. at 4°C. Cell pellets were suspended in water to a density equivalent to 5000 Klett units per ml and sonicated in an ice bath with a Heat Systems Ultrasonics sonicator at a power of 9, 50% duty cycle for a total of 5 min. The sonicated preparation was centrifuged for 20 min. at 20,000 x g at 4°C. Pellets, containing refractile bodies and cell debris, were washed twice with cold water and suspended at 10,000 Klett unit equivalents -33per ml in water plus 25% sulfolane. After stirring at room temperature for 2 hours, the solubilized retractile body preparations were centrifuged again at 20,000 x g at 4°C to remove unsolubilized materials. Tris-HCl was added to the supernatant to a final concentration of 50 mM, pH 7.6. The B.t.t. bands 1 and 3 were co-purified on an HR5/5 MonoQ ion exchange column using a 75 to 200 mM Nacl gradient in 50 mM Tris-HCl, 25% sulfolane, pH 7.6. Fractions containing B. c. c. bands 1 and 3 were identified by 9% SDS-PAGE analysis, pooled, dialyzed into 100 mM sodium carbonate, pH 10 buffer and concentrated in Amicon centricon concentrators. B. 1.1. toxin protein corresponding to band 3 was purified from JM101 (pMON5456) in an analogous manner.

Bands corresponding to 2 alone and bands 3,3s and 4 (see Figure 6) combined were electroeluted from 7% SDS-PAGE slab gels which were run with 48 pg of B. t. t. crystals solubilized in 100 mM sodium carbonate, 20 mM dithiotheitol (DTT), pH 10 buffer. Gels were stained for 10 min in Coomassie blue R250 and destained in 50% methanol, 10% acidic acid for 20 min. Appropriate bands were excised with a razor blade and the B. t. t. protein electro-eluted. Knowing the amino acid sequence, deduced from the DNA sequence of the B. t. t. toxin gene cloned in E. coli, all five H-termini of these unique proteins were identified (Figure 7).

Proteins corresponding to band 1 and 3 originated from two independent translational initiation events which start at the methionine at positions 1 and 48 (Figures 6 and 7), respectively. Proteins corresponding to B.t.t. bands 2, 3 and 4, observed only in 3. t. var. tenebrionis and not in the E. coli 34constructs, apparently arise from proteolytic cleavage of either bands 1 or 3. These results establish that all five proteins originate from the same gene.

Purification of B. 1.t. Bands 1 and 3 for Insect Toxicity Testing The B. i. i. proteins produced in E. coli corresponding to bands 3 and 1 plus 3 which were solubilized in 25% sulfolane and purified by MonoQ chromatography for N-terminal amino acid sequence analysis showed no insect toxicity against Colorado potato beetle insects. In subsequent experiments, it was demonstrated that sulfolane itself inactivates B. t. £. Therefore, an alternative purification method was developed and used compare the relative insecticidal toxicities of B.£.£. bands 1 and 3 produced in E. coli compared to the B. £. £. solubilized from native crystals of B. £. var. tenebrionis. Cultures were grown, induced, harvested and refractile bodies isolated as described above. The various B.t.t. proteins were solubilized from the refractile bodies using 100 mM sodium carbonate, pH 10. The solubilized B.t.t. toxin, concentrated using Amicon stirred cells with YM-10 membranes, was purified on a Pharmacia Superose12, gel filtration FPLC column, which separates B.t.t. bands 1 and 3 and from other contaminating proteins. Appropriate fractions, based upon SDS-PAGE analysis, were pooled, concentrated and used for insect toxicity experiments with the Colorado potato beetle insects. Proteins corresponding to band 1 (pMON5436, band 1 (pMON5460) and band 3 (pMON545S) were greater than 90% pure based upon SDS-PAGE analysis. Band 1 produced by pMON5460 has isoleucine at amino acid 48 in place of methionine (see below). -35To obtain native protein toxin from B, t. var. tenebrionis for toxicity comparisons, native crystals were isolated and purified using sucrose gradient centrifugation as described above. Crystals were solubilized in 100 mM sodium carbonate, 20 mM DTT, pH 10 and used for insect toxicity tests.

All B. t. t. toxin protein preparations and controls for insect assay contained 0.3% Tween 20, a surfactant which enhances the ability of these solutions to bind to tomato leaves. Insect toxicity experiments were performed by thoroughly painting the upper and lower surfaces of 3 to 4 week old detached tomato leaves with buffer solutions containing the designated B. t. proteins at the indicated protein concentrations. After the solutions were air dried on the surface of the tomato leaves, a single leaf and 10 Colorado potato beetle insects were placed in a petri dish and incubated at 22°C for 4 days. The number of dead insects was determined and the toxicity results expressed as % corrected mortality (%CM); according to Abbott-s formula described above. All experiments were performed in duplicate and all but the B. 1.1. band 1 from pMON5460 were repeated on different days. The results of these tests are shown in the table below. -36’ TABLE V Toxicity of £. £.£. Proteins Against Colorado Potato Beetle Sample Concentration Correc (ug/ml) Mortalit £. £. £. Solubilized 100 100 20 70 4 10 Purified Band 1 100 • 87 (pMON5436) 20 68 1034 Purified Band 1 100 67 (pMON5460) 20 72 10 44 Purified Band 3 100 91 (pMON5456) 20 64 10 32 Relative toxicity of purified proteins from different E. coli constructs were compared to solubilized native B. £.£. crystals. Band 1 (pMON5436) and Band 3 (pM0N5456) were purified as described. Band 1 (pMON5460) was purified using gel filtration chromato-graphy. Native £.£.¢. crystals were solubilized in 100 mM Na2CO3i pH 10.

The amounts of £.£.£. toxin required to kill 50% of the Colorado potato beetle insects were essentially identical for £.£. £. band 1 isolated from pMON5436 and pMON5460 and £.£.£. band 3 isolated from pMON5456 (Table V). Likewise, all of these purified £. £.£. preparations from £. coli demonstrated toxicities essentially identical to that observed with the sodium carbonate solubilized native toxin from £.t. var. tenebrionis. -37DETERMINATION OF TOXIC FRAGMENTS OF B.t.t. TOXIN PROTEINS Several groups (Schnepf et al. 1985, Hofte et al. 1986, and Wabiko et al. 1986) have reported that C-terminal truncations of the Lepidopteran-type toxins do not reduce toxicity (of the 1155 amino acids a truncation to amino acid 607 did not result in a loss of toxicity). Therefore, the C-terminal half of the protein is not required for toxicity. Others have also reported that the Lepidopteran-type toxin genes which contain C-terminal deletions are more highly expressed in transformed plants. There are also reports that to retain toxicity, only small truncations can be made at the N-terminus (Schnepf et al. 1985, and Hofte et al. 1986). Contrary to those teachings it has now been found that the Coleopterantype toxin of B. t. t. has substantially different properties. That is, the C-terminal portion appears to be critical for toxicity therefore permitting essentially no truncations. However, N-terminal deletions can be made and maintain toxicity. These differences were uncovered using the constructs described below: Construction of pMON5426 (Bglll/BamHI Deletion) pMON5420 was digested with Bglll and BamHI, ligated and transformed into JM101 to create pMON5426. This deletion was constructed to confirm that the Bglll site was not within the coding region of the B.t.t, toxin gene. -38Construction of pMON5438 (Hpal, C-terminal Deletion of 463 bp) pMON5420 was digested with Hpal and ligated with the following synthetic terminator linker. The linker contains nonsense codons in each reading frame and a BgllI 5“ overhang.

·-TAGTAGGTAGCTAGCCA-3 8 3 8-ATCATCCATCGATCGGTCTAG-5 8 The ligation was digested with BgllI, to remove multiple linker inserts and then re-ligated. The ligation was transformed into JM101 and pMON5430 was isolated. To generate a Ncol site at the start of the truncated gene, the 2.32 kb Pstl fragment of pWON9759 was replaced with the 1.47 kb Pstl fragment of pMON5430 and the new construct was designated pMON5434. Tbe 1.57 kb Ncol/Hindlll fragment from pMON5434 was cloned into the B. coli high expression vector pMON5634, to create pMON5438.

Construction of pMQN5441 (EcoRV, C-terminal Deletion of 327 bp) pMON5420 was digested with EcoRV and ligated with the synthetic terminator linker. The ligation was digested with BgllI, to remove multiple linker inserts and then re-ligated. The ligation was transformed in JM101 and pMON5431 was isolated. To generate a Neo I site at the start of the truncated gene, the 2.32 kb Pstl fragment of pMON9759 was replaced with the 1.61 kb Pst fragment of pMON5431, and the new construct was designated pMOM5435. The 1.71 kb Ncol/Eindlll fragment from pMON5435 was cloned into the B. coli high expression vector pMON5433 to create PMOM5441. -39Construction of pMON5449 (Bal31, C-terminal Deletion of 190 bp) Bglll digested pMON9759 was treated with Bal31 nuclease for 5 min. following the manufacturer’s instructions. The DNA was electrophoresed in a 0.8% agarose gel and purified from the agarose by the freeze thaw method. The synthetic terminator linker was then ligated to the purified DNA and pMON5442 was isolated. The Ncol/Bglll fragment of pMON9759 was replaced with the truncated gene fragment from pMON5442 to create p'MON5445. The Ncol/Hindlil fragment from pMON5445 was cloned into the E„ coli high expression vector p'MON5634 to create pMON5449. The endpoint at the Bal31 created deletion was determined by DNA sequence analysis.

Construction of pF£ON5448 (XmnI, C-terminal Deletion of 16 bp) pMON5436 was digested with XmnI and ligated with the synthetic terminator linker. The ligation was then digested with Ncol and Bglll and the 1.92 kb Ncol/Bglll fragment containing the truncated gene was cloned into Ncol and Blgll digested pMON9759 to replace the full-length gene and create pMON5446. The Ncol/Hindlil fragment from pMON5446 was cloned into E. coli high expression vector pMON5634 to create pMON5448.

Construction of pMON545Q (Ncol fill-ends, Removal of First ATG from Toxin ORF pMON5436 was digested with Ncol, the ends filled using Klenow fragment DNA polymerase, ligated and transformed into JM101 to create pMON5450. This plasmid expresses only band 3 protein. -40Constructlon of pMON5452 (N-terminal, Deletion of 224 bp) The B.t.t. gene contains two Styl sites (227 and 1587) and a third site was added by the mutagenesis to create a Ncol site in pMON9759. The following experiments were performed to delete 5s B. t. t. DNA to base pair 227. pMON5434 (Hpal deletion derivative described above) was digested with Styl, the ends filled with Klenow DNA polymerase, ligated, and transformed into JM101 to isolate pMON5444. This manipulation destroys both the Ncol and Styl cleavage sites. This manipulation creates an in frame fusion with the first methionine (amino acid 1) and leucine (amino acid 77). The C-terminus of the gene was added by cloning the 1.9 kb Ndel/Κρηϊ fragment from pMON9759 into pMON5444 to create pMON5452.

Construction of pMON5456 (Band 3 Mutant, N-terminal Deletion of 140 bp) A Ncol site was introduced into pMON5420 at the ATG for band 3 by site directed mutagenesis as described above using the primer: Mutagenesis Primer - BTTLOOP CGTATTATTATCTGCATCCATGGTTCTTCCTCCCT to create pMON5455. The mutagenesis also deleted the upstream sequence which encodes the N-terminal 48 amino acids of band 1. The NcoX/ΗΐηάϊϊΙ fragment from pMON5455 was cloned into the E. coli high expression vector pMON5634 to create pMON5456. This plasmid expresses only band 3. The generation of the Ncol site changes the second amino acid from thionine to aspartic acid. -41Construction of pMQN5460 (Mutant Band 1 Gene with MET48 Changed to ILE) The codon for methionine at position 48 in pMON9759 was changed to a codon for isoleucine by site directed mutagenesis as described above using the primer: Mutagenesis Primer - BTTMET ATTATTATCTGCAGTTATTCTTAAAAACTCTTTAT to create pMON5458. The Ncol/Hindlll fragment of PMON5458 was cloned into the E. coli high expression vector pMON5634 to create ρΚΟΝ54δΟ. By removing the ATG codon which initiates translation of band 3 protein, pMON5460 produces only band 1 protein with an isoleucine residue at position 48.

Construction of PMON5467 (Band 5 Mutant, N-terminal Deletion of 293 bp) A Ncol site was introduced into pMON5420 to create a N-terminal deletion of ninety-eight amino acids by site directed mutagenesis using the primer: Mutagenesis Primer TCACTTGGCCAAATTGCCATGGTATTTAAAAAGTTTGT to create pMON5466. A methionine and alanine were also inserted by the mutagenesis. The Ncol/Hindlll fragment from pMON54S6 was cloned into the E. coli high expression vector pMON5634 to create pMON5467. -42“ INSECT TOXICITY RESULTS C-Terminal Truncations Coleopteran-toxin activity was determined using newly hatched Colorado potato beetles in a tomato leaf feeding assay as previously described. The mutant 3. t. t. genes used for analysis of the C~ terminus are shown in Figures 8 and 10. pMON5438 contains 490 amino acids of B.t.t. toxin protein plus 3 amino acids encoded by the linker used in the vector construction. The truncated protein was produced at high levels in Ξ. coli, but had no activity against Colorado potato beetle. pMON5441 produces a protein which contains 536 amino acids of the B. £. £. toxin. The truncated protein was produced at high levels in E. coli but had no activity against Colorado potato beetle. pMON5449 contains 582 amino acids of the 3. t. t. protein plus two amino acids encoded by the linker used in the vector construction. The truncated protein was produced at high levels in E. coli, but had no activity against Colorado potato beetle. pMON5448 contains 640 amino acids of the B. £. £. protein plus 2 amino acids encoded by the linker used in the vector construction. The truncated protein was produced at high levels by E. coli, but the protein had no activity against Colorado potato beetle. These results suggest that the C-terminus of the B. t. t. toxin protein is required for toxicity to Colorado potato beetle. A deletion of only 4 amino (pM0N5448) acids resulted in a complete loss of activity. These results are directly contrary to the reported literature with respect to Lepidopteran-type B. £. toxins. -43“ Results for Ν-Terminal Mutations and Deletions The other mutant B.t.t. genes used for analysis of the N-terminus are shown in Figures 9 and 10. Analysis of protein produced by pMON5450 revealed that band 3 production in E. coli was due to translation initiation at MET48 rather than a product of protease cleavage. Toxicity studies also showed that band 3 was toxic. pMON5456 produces a protein which begins at amino acid 48 with amino acid 49 changed from threonine to aspartic acid. This protein was produced at high levels in E. coli and was toxic to Colorado potato beetle. pMON5452 produces a protein which begins at amino acid 77. This protein was expressed in E. coli, and it had activity against Colorado potato beetle. pMON5467 produces a protein which begins at amino acid 99 and has two amino acids added to the N-terminus (methionine and alanine). This protein was produced in E. coli and exhibited no detectable activity against Colorado potato beetle, however, the level of expression for this deletion variant was significantly lower than other variants. These results suggest that the N-terminus of the B. t.t. toxin protein can tolerate deletions. A deletion of 76 amino acids exhibitied toxicity. A deletion of 99 amino acids did, however, result in a loss of toxicity. pMON5460 contains a mutation which changed methionine at position 48 to isoleucine to prevent production of band 3. The toxicity of band 1 produced by pMON5460 was equal to the toxicity of band 3 produced by PMON5456. -44CONSTRUCTION OF PLANT TRANSFORMATION VECTORS The B. t. var. tenebrionis toxin gene contained in pMON5420 was modified for incorporation into plant expression vectors. A Bglll site was introduced just upstream of the ATG codon which specifies the initiation of translation of the full-length £. 1.1. toxin protein (referred to as band 1) using the site specific mutagenesis protocol of Kunkel (1985) as previously described. The seguence of the B. £. t. toxin gene in the region of the initiator ATG is: ATGATAAGAAAGGGAGGAAGAAAAATGAATCCGAACAATCGAAGTGAACATGATACAATA MetAsnProAsnAsaArgSerGluHisAspThrlle The primer for this mutagenesis (bttbgl) was 27 nucleotides in length and has the sequence: CGGATTCATT TTAGATCTTC CTCCCTT Following mutagenesis a plasmid containing the new Bglll site was identified by digestion with Bglll and the change was verified by DNA seguence analysis. The resulting plasmid containing the £.£.£. toxin gene with the new Bglll site was designated PMON9758 (Figure 11).

The £. £. £. toxin gene in pMON9758 was inserted into the expression cassette vector pMON316 (Sanders et al., 1987). pMON316 contains the CaMV35S promoter and the 3' end from the nopaline synthase (NOS) gene with a Bglll site for gene insertion between these two elements. Plasmid pMON9758 was digested with Bglll and a fragment of approximately 2.3 kb was isolated. This fragment extends from the -45Bglll site just upstream of the ATG codon to a Bgll J. site found approximately 350 bp downstream of the termination codon for the B. t. t. toxin gene. Thus, this fragment contains the complete coding sequence of the 3. t. £. gene and also about 350 bp of noncoding sequence 3 s to the termination codon. This Bgll I fragment was ligated with BgllI digested pMON316. Following transformation into E. coli, a colony was identified in which the B. t.£. toxin gene was inserted into pMON316 such that the 5’ end of the toxin gene was adjacent to the CaMV35S promoter. This plasmid was designated pMON9753. A plasmid containing the B. £.£. toxin gene in the opposite orientation in pMON316 was isolated and designated pMON9754 (Figure 11).

Both pMON9753 and pMON9754 were introduced by a triparental mating procedure into the Agrobacterium tumefaciens strain ASS which contains a disarmed Ti plasmid. Cointegrates between pMOM9753 or pM0N9754 and the disarmed Ti plasmid were identified as described by Fraley et al. (1985), and their structures confirmed by Southern analysis of total Agrobacterium DNA.

Additional plant expression vectors containing the B. t. £. toxin gene have also been constructed (see Figures 12 and 13). In these vectors the B. t. t. toxin gene has been inserted into the plant expression vector pMON893 (Figure 14). Referring to Figure 14, the expression cassette pMON893 consists of the enhanced CaMV35S promoter and the 3s end including polyadenylation signals from a soybean gene encoding the alpha-prime subunit of beta-conglvcinin (referred to below as the 7S gene). Between these two ele-46ments is a multi-linker containing multiple restriction sites for the insertion of genes.

Tha enhanced CaMV35S promoter was constructed as follows. A fragment of the CaMv35S promoter extending between, position -343 and *9 was previously constructed in pUC13 by Odell et al. (1985). This segment contains a region identified by Odell et al. (1985) as being necessary for maximal expression of the CaMV35S promoter. It was excised as a ClalHindlll fragment, made blunt ended with DNA polymerase I (Klenow fragment) and inserted into the Hindi site of pUC18. The upstream region of the 35S promoter was excised from this plasmid as a Hindlll-EcoRV fragment (extending from -343 to -90) and inserted into the same plasmid between the Hindlll and Pstl sites. The enhanced CaMV35S promoter thus contains a duplication of sequences between -343 and -90 (see Figure 18).

The 35 end of the 7S gene is derived from the 7S gene contained on the clone designated 17.1 (Schuler et al., 1982). This 3’ end fragment, which includes the polyadenylation signals, extends from an Avail site located about 30 bp upstream of the termination codon for the beta-conglycinin gene in clone 17.1 to an EcoRI site located about 450 bp downstream of this termination codon.

The remainder of pMON893 contains a segment of pBR322 which provides an origin of replication in E. coli and a region for homologous recombination with the disarmed T-DNA in Agrobacterium strain AGO (described below); the oriV region from the broad host range plasmid RK2; the streptomycin resistance/sprectinomycin resistance gene from Tn7; and a chimeric NPTII gene, containing the CaMV35S promoter and the nopaline synthase (NOS) 3’ end, which provides kanamycin resistance in transformed plant cells. -47pMON9753 contained approximately 400 bp of 3’ noncoding sequence beyond the termination codon. Since this region is not necessary for toxin production it was removed from the B.t.t. toxin gene segments inserted in pMON893. In order to create a B.t.t toxin gene containing no 3’ flanking sequence, a BgllI site was introduced just after the termination codon by the method of Kunkel (1985). The sequence of the B.t.t. toxin gene around the termination codon is: GTTTATATAGACAAAATTGAATTTATTCCAGTGAATTAAATTAACTAGAAAGTAAAGAAG ValTyrlleAspLysIleGluPhelleProValAsnEnd Mutagenesis was performed with a primer (bttcterm) of sequence: CTTTCTAGTT AAAGATCTTT AATTCACTG Mutagenesis of the B. t. t. toxin gene was performed in pMON9758„ A plasmid which contains the new BgllI site was designated pMON9787 (Figure 12). Because pMON9787 contains a BgllI site just upstream of the ATG initiation codon, the full coding sequence for the B. t. t. toxin gene with essentially no 5! or 3' flanking sequence is contained on a BgllI fragment of about 1940 bp.

This 1940 bp fragment was isolated from pMON9787 and ligated with BgllI digested pMON893. A plasmid in which the 5s end of the B.t.t. toxin gene was adjacent to the enhanced CaMV35S promoter was identified and designated pMON9791 (Figure 12).

A variant of the full length B. t. t. toxin is produced in E. coli from a second methionine initiator codon. This protein, designated band 3, has been found to be as toxic to Colorado potato beetle as the full length toxin (band 1). It is possible -48that, as was the case for the B.t.k. gene, truncated forms of the 3.£.t. gene might he more easily expressed in plant cells. Therefore, a modified B.t.t. toxin gene was constructed in which the region upstream of the band 3 ATG codon has been removed. In order to remove this sequence, a Bglll site was inserted just upstream ox the band 3 ATG by the method of Kunkel (1985). The sequence surrounding the band 3 ATG is: ccaaatccaacactagaagatttaaattataaagagtttttaagaatgactgcagataat ProAsnProThrLeuGluAspLeuAsnTyrLysGluPheLeuArgMetThrAlaAspAsn Mutagenesis was performed with primer (bttnterm) of sequence: ATCTGCAGTC ATTGTAGATC TCTCTTTATA ATTT Mutagenesis with this primer was performed on the B.t.t. toxin gene contained in pMON5420. A plasmid containing the new Bglll site was designated pMON9788. A truncated B.t.t. toxin gene .beginning at this band 3 Bglll site and extending to the Bglll site just distal to the termination codon found in PMON9787 was constructed in pMON893 as follows. pMON9788 (Figure 13) was digested with Bglll and Xbal and a fragment of about 1250 bp was isolated. This fragment extends from the band 3 ATG to a unique Xbal site in the middle of the B.t.t. toxin gene. pMON9787 was also digested with Bglll and Xbal, and a fragment of about 550 bp was isolated. This fragment extends from the unique Xbal site in the middle of the toxin gene to the Bglll site just distal to the termination codon. These two fragments were mixed and ligated with Bglll digested pMON893. A plasmid was identified in which the 5s end to the toxin gene was adjacent to the -49enhanced CaMV35S promoter and designated pMON9792. pMON9792 contains a N-terminal truncated derivative of the B.t.t. toxin gene (Figure 13) which encodes only band 3.

Both pM0N9791 and pMON9792 were introduced into A. tumefaciens strain ACO which contains a disarmed Ti plasmid. Cointegrates have been selected and have been used in the transformation of tomato and potato.

ACO is a disarmed strain similar to pTiB6SE described by Fraley et al. (1985). For construction of ACO the starting Agrobacterium strain was the strain A208 which contains a nopaline-type Ti plasmid. The Ti plasmid was disarmed in a manner similar to that described by Fraley et al. (1985) so that essentially all of the native T-DNA was removed except for the left border and a few hundred base pairs of T-DNA inside the left border. The remainder of the T-DNA extending to a point just beyond the right border was replaced with a novel piece of DNA including (from left to right) a segment of pBR322, the oriv region from plasmid RK2, and the kanamycin resistance gene from Tn601. The pBR322 and oriv segments are similar to the segments in pMON893 and provide a region of homology for cointegrate formation. The structure of the ACO Ti plasmid is shown in Figure 17.

CHIMERIC B. t. t. TOXIN GENE USING A MAS PROMOTER The MAS promoter was isolated from pTiA6 as a 1.5 kb EcoRI-Clai fragment. This DNA fragment extends from the Clai site at nucleotide 20,138 to the EcoRI site at 21,631 in the sequence of Barker et al. (1983). Referring to Figure 15, the EcoRI-Clal -50fragment was ligated with the binary vector pMON505 (Borsch et al. 1986) which had been previously digested with EcoRl and Clal. The resulting plasmid was designated pMON706. A fragment containing the NOS 3’ end was inserted downstream of the MAS promoter to obtain a MAS-NOS 3s expression cassette vector. The NOS 38 fragment was excised from pMON530 as a 300 bp Bglll-BamHI fragment and inserted into Bgllldigested pMON706. The resulting plasmid was designated pMON707.

Plasmid pMON530 was constructed by cleavage of pMON200 with Ndel to remove a 900 bp Ndel fragment to create pMON503. Plasmid pMON503 was cleaved with HindiII and SmaX and mixed with plasmid pTJS75 (Schmidhauser and Helinski, 1985) that had also been cleaved with Hindi 11 and Smal. A plasmid that contained the 3.8 kb Hindi I I-Smal fragment of pTJS75 joined to the 8 kb HindiII-Smal fragment of pMON503 was isolated and designated pMON505. Next the CaMV35S-NOS38 cassette was transferred to pMON505 by cleavage of pMON31& with Stul and Hindi! and isolation of the 2.5 kb Stul-Hindlll fragment containing the NOS-NPTI18-NOS marker and the CaMV35S~NOS38 cassette. This was added to pMON505 DNA cleaved with Stul and Hindi!I. Following ligation and transformation a plasmid carrying the CaMV35S-NOS3’ cassette in pMON505 was isolated and designated pMON530.

Since some binary vectors have greatly reduced frequencies of transformation in tomato as compared to co-integrating vectors, (McCormick et al., 1986), the MAS-NOS 35 cassette was moved from pMON707 into the co-integrating vector pMON200 (Fraley et al., 1985). Plasmid pMON200 was digested with Stul and Hindi 11 and a 7.7 kb fragment isolated by agarose gel -51electrophoresis. Plasmid pMON707 was similarly digested with Stul and Hindlll and a 3.5 kb StulHindiII fragment containing the MAS-NOS 3“ cassette was isolated by agarose gel electrophoresis and recovery on a DEAE membranes with subsequent elution with 1M NaCl. These two DNA fragments were ligated and the resulting plasmid was designated pMON9741 (Figure 15). This plasmid contains the MAS-NOS 3s cassette in the pMON200 co-integrating background.

Chimeric B. t. £. toxin, genes driven by the MAS promoter are prepared by digesting either pMON9791 or pMON9792 with BgllI, recovering the toxin encoding fragment and moving this fragment into pMON9741 following the teachings provided herein.

These intermediate vectors may be used to transform plants to exhibit toxicity to Coleopteran insects susceptible to the B.£.t. toxin protein.

COLEOPTERAN-TYPS TOXIN GENE EXPRESSION IN PLANTS Tomato Plant Transformation The A. tumefaciens strains pMON9753-ASE and pMON9754~ASE were used to transform tomato leaf discs by the method of McCormick et al. (1986). Transformed tomato plants were recovered as described and assayed for kanamycin resistance.

Insect Toxicity of Transgenic Tomato Plants Tomato plants transformed with the B.£. £. toxin gene contained in pMON9753 were assayed for expression of the toxin gene by bioassay with Colorado potato beetle (Leptinotarsa decemlineata) insects. Leaf cuttings from plants to be assayed were placed in -52“ petri dishes containing water saturated filter paper. Ten or twenty newly hatched potato beetle insects were added to the leaf cuttings and allowed to feed on the leaves. After four days the insects were scored for mortality. In addition, insects were examined for evidence of slowed growth rate (stunting), and the leaf tissue remaining was examined to determine relative feeding damage.

In each experiment many non-transformed plants were included as controls. Between 50 and 100 non-trans formed plants have now been assayed as controls. Of these control plants, more than 80% show no mortality to potato beetle; about 15% give 10% mortality; and, 5% or fewer show 20% mortality. Mortality of greater than 20% has not been seen with a control plant.

Table VI below summarizes toxicity results obtained with several pMON9753 transgenic tomato plants.

TABLE VI Toxicity of Transgenic Tomato Plants Containing PMON9753 to Colorado Potato Beetle Plant Kanamycin1 Resistance Mortality of CPB (%) Assay #1 Assay #2 Assay #3 794 R 30 20 810 n.d. 50 20 40 871 R 30 10 (stunted) 886 R 50 40 887 n.d. 20 30 30 1009 n.d. 50 1044 R 20 (stunted) 1046 R 40 (stunted) 20 i n.d. represents No Data -53As shown in Table VI several plants have been recovered which consistently show higher levels of mortality of Colorado potato beetle than non-transformed control plants. These results indicate that the B.t.t. toxin gene is being expressed at levels sufficient to kill a significant number of the insects feeding on these plants.

COLEOPTERAN TOXIN EXPRESSION IN POTATO Shoot tips of potato cultivar Kennebec are subcultured on media containing MS major and minor salts, 0.17 g/1 sodium dihydrogen phosphate, 0.4 mg/1 thiamine-HCl, 0.1 g/1 inositol, 3% sucrose, 2.0 g/1 Gelrite (Kelco Co.) at pH 5.6. Cultures are grown for 4 weeks at 24°C in a 16 hour photoperiod. Stem internodes are cut into approximately 8mm lengths and the cut surfaces are smeared with Agrobacterium strain pMON9753-ASE which has been streaked on an LB agar plate and grown for 2 to 3 days. pMON9753~ASE which is described above contains the chimeric B. t. t. toxin gene driven by the CaMV35S promoter. Alternatively, Agrobacterium strains pMON9791-ACO or pMON9792-ACO containing chimeric B.t.t. toxin genes are used. Stem sections are placed on 0.8% agar-solidified medium containing salts and organic addenda as in Jarret et al. (1980), 3% sucrose, 3 mg/1 BA and 0.1 mg/1 NAA at pH 5.6. After 4 days the explants are transferred to medium of the same composition but with carbenicillin at 500 mg/1 and kanamycin as the selective agent for transformed plant cells at 100 mg/1. Four weeks later the explants are transferred again to medium of the same composition but with GA3 at 0.3 mg/1 as the sole hormone. Callus which developed in the presence of -54100 mg/1 kanamycin are shown to contain the NPTII enzyme when tested by a dot blot assay indicating that the potato cells are transformed. Uninoculated control tissue is inhibited at this concentration of kanamycin. Transformed potato tissue expresses the B. 1.1. toxin gene. B. 1.1. toxin mRNA may be detected by Northern analysis and 3,t.¢. toxin protein may be detected by immunoassay such as Western blot analysis. However, in many cases the most sensitive assay for the presence of B. t. t. toxin is the insect bioassay. Colorado potato beetle larvae feeding on the transformed tissue suffer from the effects of the toxin.

This procedure for producing kanamycin resistant transformed potato cells has also been successfully used to regenerate shoots. Shoots which are 1 to 2 cm in length are removed from the explants and placed on the shoot tip maintenance medium described above where the shoots readily root.

Plants generated in this fashion are tested for transformation by assaying for expression of the NPTII enzyme and by the ability of stem segments to form callus on kanamycin containing medium. Transformed plants express the B. t, t. toxin gene. B.t.t. toxin mRNA may be detected by Northern analysis and B. t.t. toxin protein may be detected by immunoassay such as Western blot analysis. Colorado potato beetle larvae feeding on the transformed tissue suffer from the effects of the toxin.

COLEOPTERAN TOXIN EXPRESSION IN COTTON Cotton seeds are surface sterilized by first soaking them for 10 minutes in a detergent solution of water to which Sparkleen soap has been added, then by -55agitating them for 20 min. in a 30% Chi or ox, solution containing 2 drops of Tween 20 per 400 mis before rinsing them twice with sterile distilled water. The seeds are then soaked in 0.4% henolate for 10 min. The henolate is poured off prior to placing the seeds aspetically onto agar solidified half strength MS salts. Seeds are germinated for 3-10 days in the dark at 32 °C. The cotyledons and hypocotyls are then removed aspetically and segmented. The segments are placed onto 1) agar solidified MS medium containing 3% glucose, 2 mg/1 napthalene acetic acid (NAA), and 1 mg/1 kinetin (Medium MSS) or 2) Gelrite solidified MS medium containing 3% glucose, B5 vitamins, 100 mg/1 inositol, 0.75 mg/1 MgCl2, 0.1 mg/1 dichlorophenoxy acetic acid (2,4-D) and 0.1 or 0.5 mg/1 kinetin (Medium MST). Callus is maintained in a 16/8 photoperiod· at 28°C on either of these media until embryogenesis is initiated. Subculture of the embryogenic callus is made onto the same medium as for initiation but containing 3% sucrose instead of glucose. Somatic embryos are germinated by moving them onto Gelrite solidified Stewart’s medium without plant growth regulators but containing 0.75 g/1 MgCl2. Germinated embryos are moved to soil in a growth chamber where they continue to grow. Plants are then moved to the greenhouse in order to set seed and flower.

Transformation of cotton tissues and production of transformed callus and plants is accomplished as follows. Aseptic seedlings are prepared as for plant regeneration. Hypocotyl and cotyledon segments are inoculated with liquid overnight Agrobacterium cultures or with Agrobacterium grown on nutrient plates. The explants are co-cultured for 2-3 days on MSS or MST medium containing 1/10 the concentration -56of MS salts. Explants are blotted on filter paper to remove excess bacteria and plated on MSS or MSN medium containing 500 mg/1 carbenicillin amd 30-100 mg/1 kanamycin. Callus which is transformed will grow on this medium and produce embryos. The embryos are grown into plants as stated for regeneration. The plants are tested for transformation by assay for expression of NPTII.

When the Agrobacterium strain used for transformation contains a chimeric B. t. £. toxin gene such as pMON9753, pMON9791 or pMON9792, the B.t.t. toxin gene is expressed in the transformed callus, embryos derived from this callus, and in the transformed plants derived from the embryos. For all of these cases, expression of the B.t.t. toxin mRNA may be detected by Northern analysis, and expression of the B. t. t. toxin protein may be detected by immunoassay such as Western blot analysis. Insect bioassay may be the most sensitive measure for the presence of toxin protein.

Insect toxicity of the callus, embryos or plants is assayed by bioassay with boll weevil larvae (Anthonomous grandis). Boll weevil larvae feeding on transformed cotton cells or plants expressing the B. t. t. toxin gene suffer from the effects of the toxin.

COLEOPTERAN TOXIN GENE EXPRESSION IN MAIZE The following description outlines the preparation of protoplasts from maize, the introduction of chimeric ,3.,£. £. toxin genes into the protoplast by electroporation, and the recovery of stably transformed, kanamycin resistant maize cells expressing chimeric B.t.t. toxin genes. -57Preparation of Maize Protoplasts Protoplasts are prepared from a Black Mexican Sweet (BMS) maize suspension line, BMSI (ATCC 54022) as described by Fromm et al. (1985 and 1986). BMSI suspension cells are grown in BMS medium which contains MS salts, 20 g/1 sucrose, 2 mg/1 (2,4-dichlorophenoxy) acetic acid, 200 mg/1 inositol, 130 mg/1 asparageine, 1.3 mg/1 niacin, 0.25 mg/1 thiamine, 0.25 mg/1 pyridoxine, 0.25 mg/1 calcium pantothenate, pH 5.8. Forty ml cultures in 125 ml erlenmeyer flasks are shaken at 150 rpm at 26°C. The culture is diluted with an equal volume of fresh medium every 3 days. Protoplasts are isolated from actively growing cells 1 to 2 days after adding fresh medium. For protoplast isolation cells are pelleted at 200 X g in a swinging bucket table top centrifuge. The supernatant is saved as conditioned medium for culturing the protoplasts. Six ml of packed cells are resuspended in 40 ml of 0.2 M mannitol/50 mM CaCl2/10 mM sodium acetate which contains 1% cellulase, 0.5% hemicellulase and 0.02% pectinase. After incubation for 2 hours at 26°C, protoplasts are separated by filtration through a 60 pm nylon mesh screen, centrigured at 200 X g, and washed once in the same solution without enzymes.

Transformation of Maize Protoplasts with B. t. t. Toxin Gene DNA Vectors Using an Electroporation Technique Protoplasts are prepared, for electroporation by washing in a solution containing 2 mM potassium phosphate pH 7.1, 4 mM calcium chloride, 140 mM sodium chloride and 0.2 M mannitol. After washing, the protoplasts are resuspended in the same solution at a concentration of 4 X 106 protoplasts per ml. One-half -58ml of the protoplast containing solution is mixed with 0.5 ml of the same solution containing 50 micrograms of supercoiled plasmid vector DNA and placed in a 1 ml electroporation cuvette. Electroporation is carried out as described by Fromm et al. (1986). As described, an electrical pulse is delivered from a 122 or 245 microFarad capacitor charged to 200 V. After 10 min. at 4°C and 10 min. at room temperature protoplasts are diluted with 8 ml of medium containing MS salts 0.3 M mannitol, 2% sucrose, 2 mg/1 2,4-D, 20% conditioned BMS medium (see above) and 0.1% low melting agarose. After 2 weeks in the dark at 26°C, medium without mannitol and containing kanamycin is added to give a final kanamycin concentration of 100 mg/1 liquid. After an additional 2 weeks, microcalli are removed from the liquid and placed on a membrane filter disk above agarose solidified medium containing 100 mg/1 kanamycin. Kanamycin resistant calli composed of transformed maize cells appear after about 1-2 weeks.

Expression of B.t.t Toxin Genes in Maize Cells As described by Fromm et al. (1986), transformed maize cells can be selected by growth in kanamycin containing medium following electroporation with DNA vectors containing chimeric kanamycin resistance genes composed of the CaMV35S promoter, the NPTII coding region and the NOS 3' end. pMON9791 and pMON9792 contain such chimeric NPTII genes and also contain chimeric B.t.t. toxin genes. As decribed above, maize protoplasts are transformed by electroporation with DNA vectors where the DNA vectors are pMON9791 or pMON9792. Following selection for kanamycin resistance, the transformed maize cells are assayed for expression of the B.t.t. toxin gene. -59Assays are performed for 3. t. t. mRNA by Northern blot analysis and for J3. t. i. toxin protein by immunoassay such as Western blot analysis.

Assays for insect toxicity are performed by feeding transformed maize call! to Southern corn rootworm larvae (Diabroiica undecimpunctata howardi). Alternatively, a protein extract containing the B. t.t. toxin protein is prepared from transformed maize cells and this extract is incorporated into an appropriate insect diet which is fed to the Southern corn rootworm larvae. Rootworm larvae feeding on transformed calli or protein extracts of such calli suffer from the effects of the toxin.

The above examples are provided to better elucidate the practice of the present invention and are not intended, in any way, to limit the scope of the present invention. Those skilled in the art will recognize that modifications may be made without deviating from the spirit and scope of the invention as described. -60REFERENCES Abbott, W. S. (1925), J. Econ. Entomol. 18:265-267.

Adang, M. J., Staver, M. J., Rocheleau, T. A., Leighton, J., Barker, R. F. and Thompson, D. V. (1985) Gene 36:289-300.

Ammirato, P. V., et al. (eds), 3 HANDBOOK OF PLANT CELL CULTURE - CROP SPECIES (MacMillian Publ. Co. 1984).

Aronson, A. I., Beckman, W. and Dunn, P., (1986). Microbiological Reviews 50:1-24.

Barker, R. F., Idler, K. B., Thompson, D. V. and Kemp, J. D. (1983) Plant Mol. Biol. 2:335-350.

Bernhard, K. (1986). FEMS Microbiol. Lett. 33, 261-265.

Bevan, M., et al. (1983) Nature 304:184.

Birnboim, H. C. and Doly, J. (1979) Nucleic Acid Res. 7:1513-1524.

Conner, B. J., Reyers, A. A., Morin, C., Itakura, K. Teplitz, R. L. and Wallace, R. B. (1983). Proc. Natl. Acad. Sci. USA 80:278-282.

Devereux, J., Haeberli, and Smithies (1984) Nucl.

Acids Research 12:387-395.

Ditta, G., Stanfield, S., Corbin, D. and Helinski, D. R., (1980). Proc. Nat. Acad. Sci. USA 77:7347-7751. -61» Fraley, R. T„, Rogers, S. G., Horsch, R. B., Eichholts, D. A., Flick, J. S,, Fink, C. L., Hoffmann, N. L. and Sanders, P. R. (1985). Bio/Technology 3, 629-635.

Fromm, M., Taylor, L. P. and Walbot, V. (1985) Proc. Nat. Acad. Sci. U.S.A. 82:5824-5828.

Fromm, M., Taylor, L. P. and Walbot, V. (1986).

Nature 319:791-793.

Herrera-Estrella, L., et al. (1983) Nature 303:209.

Herrnstadt, C., Soares, G. G., Wilcox, E. R. and Edwards, D. L. (1986). Bio/Technology 4, 305-308.

Horsch, R. and Klee, H., Proc. Natl. Acad. Sci. USA Vol. 83, 4428-4432.

Hofte, H. et al. (1986) Eur. J. Biochem 161:273-280.

Hunkapiller, M. W. Hewid, R. ML, Dreyer, W. J. and Hood, L. E. (1983) Methods in Enzymology 91, 399-413.

Jarret, R. L. et al., Physiologia Plantarum 49:177-184 (1980).

Klee, H. J., et al., Bio/Technology 3:637-642 (1985).

Klier, A., Fargette, F., Ribier, J. and Rappaport, G. (1982). EMBO J. 1:791-799. „62Krieg, A., Huger, A. M., Langerbrunch, G. A. and Schnetter, W. (1983) Pathotyp. Z. Ang. Ent. 96:500-508.

Krieg, A., Huger, A. M., Langerbrunch, G. A. and Schnetter, W. (1984) Ang. Schadlingshde., Pflanzenschutz, Umweltschuts. 57:145-150.

Kronstad, J. W., Schnepf, Η. Ξ. and Whiteley, H. R. (1983) J. Bacteriol. 154:419-428.

Kunkel, Ϊ.Α. (1985). Proc. Nat. Acad. Sci. USA 82, 488-492.

Laemmli, U. K. (1970) Nature 227:681-685.

Maniatis, T-, Fritsch, E. F. and Sambrook, J. (1982). Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratories, Cold Spring Harbor, NY.

McCormick, S., Niederxneyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986).

Plant Cell Reports 5, 81-84.

Odell, J. T., Nagy, F. and Chua, N. H. (1985).

Nature 313:810-812.

Sanders, et al. (1987) Nucleic Acids Research 15:1543-1558.

Sanger, F., Micklen, S. and Coulson, A. R. (1977) Proc. Nat. Acad. Sci. USA 74:5463-5467. -63Schnepf, Η. E. and Whiteley, H. R. (1981). Proc. Nat Acad. Sci. USA 78:2893-2897.

Schmidhauser, T. and He1inski, D. , J. Bacteriology, 164, 446 (1985).

Schnepf, Η. E., Wong, H. C. and Whiteley, H. R. (1985) J. Biol. Chem. 260:6264-6257.

Schuler, M. A., Schmitt, E. S. and Beachy, R. N. (1982). Nucleic Acids Research. 10:8225-8244.

Smith and Waterman (1981), Adv. in App. Mathematics, 10 2:482-489.

Southern, E. M. (1975) J. Mol. Biol. 98:503-517.

Spizizen, J. (1958) Proc. Nat. Acad. Sci. USA 44:1072-1078.

Towbin, H. and Gordon, J. (1984) J. Immunol. Method. 15 72:313-340.

Wabiko, H., Raymond, K. C. and Bulla, L. A. (1986) DNA 5:305-314.

Wood, W. I., Gitschier, J., Laskv, L. A. and Lawn, R M. (1985) Proc. Nat. Acad. Sci. USA 82:1585-1588.

M13 Cloning and Sequencing Handbook, Amersham Corporation Cat. #N4502.

Claims (49)

1. A method for producing a genetically transformed plant which exhibits toxicity toward Coleopteran insects which comprises the steps of: (a) inserting into the genome of a plant cell a chimeric gene which comprises in sequence: i) a promoter which functions in plants to cause the production of RNA; ii) a DNA sequence that causes the production of a RNA sequence encoding a Coleopteran-type toxin protein of Bacillus thuringiensis: and iii) a 3' non-translated DNA sequence which functions in plant cells to cause the addition of polyadenylate nucleotides to the 3' end of the RNA sequence; (b) obtaining transformed plant cells; and (c) regenerating from the transformed plant cells genetically transformed plants exhibiting resistance to Coleopteran insects.

2. A method of Claim 1 in which the promoter is selected from the group consisting of CaMV35S promoter, MAS promoter and ssRUBISCO promoters.

3. A method of Claim 1 in which the DNA sequence encoding a Coleopteran-type toxin protein is from Bacillus thuringiensis var. tenebrionis.

4. A method of Claim I in which Coleopteran-type toxin protein is diego. the DNA sequence encoding a from Bacillus thuringiensis var. san

5. A method of Claim 3 in which the promoter is the CaMV35S promoter. - 65

6. A method of Claim 3 in which the promoter is the mannopine synthase promoter.

7. A method of Claim 5 in which the 3' non-translated DNA sequence is from the soybean storage protein gene.

8. A method of Claim 1 in which the plant is selected from the group consisting of tomato, potato and cotton.

9. A chimeric plant gene comprising in sequence: (a) a promoter which functions in plants to cause the production of RNA; (b) a DNA sequence that causes the production of a RNA sequence encoding a Coleopteran-type toxin protein of Bacillus thurinqiensis: and (c) a 3' non-translated DNA sequence which functions in plant cells to cause the addition of polvadenylate nucleotides to the 3' end of the RNA sequence.

10. A gene of Claim 9 in which the promoter is selected from the group consisting of CaMV35S promoter, MAS promoter and ssRUBISCO promoters.

11. A gene of Claim 9 in which the DNA sequence encoding a Coleopteran-type toxin protein is from Bacillus thurinqiensis var. tenebrionis.

12. A gene of Claim 9 in which the DNA sequence encoding a Coleopteran-type toxin protein is from Bacillus thurinqiensis var. san di ego.

13. A gene of Claim 11 in which the promoter is the CaMV35S promoter.

14. A gene of Claim 11 in which the promoter is the mannopine synthase promoter.

15. A gene of Claim 13 in which the 3' non-translated DNA sequence is from the soybean storage protein gene. - 65

16. A gene of Claim 13 in which the promoter contains an additional enhancer sequence.

17. A transformed plant cell containing a chimeric gene comprising in sequence: (a) a promoter which functions in plants to cause the production of bacterial RNA; (b) a DNA sequence that causes the production of a RNA sequence encoding a Coleopteran-type toxin protein of Bacillus thuringiensis: and (c) a 3' non-translated DNA sequence which functions in plant cells to cause the addition of polyadenylate nucleotides to the 3' end of the RNA sequence.

18. A cell of Claim 17 in which the promoter is selected from the group consisting of CaiW35S promoter, MAS promoter and ssRUBISCO promoters.

19. A cell of Claim 17 in which the DNA sequence encoding a Coleopteran-type toxin protein is from Bacillus thuringiensis var. tenebrionis.

20. A cell of Claim 17 in which the DNA sequence encoding a Coleopteran-type toxin protein is from Bacillus thuringiensis var. san diego.

21. A cell of Claim 19 in which the promoter is the CaMV35S promoter.

22. A cell of Claim 19 in which the promoter is the mannopine synthase promoter.

23. A cell of Claim 21 in which the 3' non-translated DNA sequence is from the soybean storage protein gene.

24. A cell of Claim 17 in which the plant is selected from the group consisting of tomato, potato, cotton and maize. - 67 25. A differentiated plant exhibiting toxicity toward susceptible Coleopteran insects comprising transformed plant cells of Claim 17.

A plant

A plant

A plant

A plant of Claim 25 in of Claim 25 in of Claim 25 in transformation which the plant is tomato. which the plant is potato. which the plant is cotton. vector comprising a chimeric plant gene of

Claim 9.

30. A vector of Claim 29 comprising a gene of Claim 10.

31. A vector of Claim 29 comprising a gene of Claim 11.

32. A vector of Claim 29 comprising a gene of Claim 12.

33. A vector of Claim 29 comprising a gene of Claim 13.

34. A vector of Claim 29 comprising a gene of Claim 14.

35. A vector of Claim 29 comprising a gene of Claim 15.

36. A gene of Claim 16 in which the enhanced CaMV35S promoter contains additional enhancer DNA sequence corresponding to the DNA sequence -343 to -90, said enhanced promoter having the sequence shown in Figure 18.

37. A toxin protein having the amino acid sequence (1-644) shown in Figure 10.

38. A gene of Claim 9 encoding the toxin protein of Claim 37.

39. A seed produced from a plant of Claim 25.

40. A seed of Claim 39 in which the plant is tomato.

41. A seed of Claim 39 in which the plant is potato. - 58

42. A seed of Claim 39 in which the plant is cotton.

43. A method as claimed in Claim 1 substantially as described herein with reference to the Examples and/or the accompanying drawings.

44. A plant whenever produced by a method as claimed in any of Claims 1 to 8 or Claim 43.

45. A chimeric plant gene as claimed in Claim 9 substantially as described herein with reference to the Examples and/or accompanying drawings.

46. A transformed plant cell as claimed in Claim 17 substantially as described herein with reference to the Examples and/or accompanying drawings.

47. A differentiated plant comprising cells as claimed in Claim 46.

48. A plant transformation vector comprising a chimeric plant gene as claimed in Claim 45.

49. A seed produced from a plant as claimed in Claim 47.