IE62206B1 - Protease resistant urolinase composition, its production and use - Google Patents

Description

This invention relates to a composition comprising protease resistant single-chain urokinase, a method for making protease resistant single-chain urokinase and the use of the enzymes so prepared in the treatment of vascular embolisms.

Urokinase (E.C. 3.4.21.31) is a serine protease which activates plasminogen to plasmin. The protein is synthesized in a variety of tissues including endothelium and kidney, and is excreted in trace amounts into urine. Purified urokinase exists in two active forms, a IO high molecular weight form (HUK; approximately 50 K) and a low molecular weight form (LUK; approximately 30 K). Ihe entire amino acid sequence of both human forms has been determined (1,2,3). LUK has been shown to be derived iron HUK by a proteolytic clip after lysine 135; this clip releases the first 135 amino acids from HUK (1). Conventional wisdom has held that HUK or UJK must be converted to proteolytically active forms by the proteolytic hydrolysis of a single chain precursor, also termed prourokinase, between lysine 158 and isoleucine 159 to generate a two-chain activated form (which continues to correspond to either HUK or LUK). Ihe proteolytically active urokinase species resulting from this -2hydrolytic clip contain two amino acid chains held together by a single disulfide bond. The two chains formed by the activation clip are termed the A or Aj chains (HUK or LUK, respectively), and the B chain containing the protease domain of the molecule.

Urokinase has been shown to be an effective thrombolytic agent. However, since it is produced naturally in trace quantities the cost of the enzyme is high for an effective dosage. Urokinase has been produced in recombinant cell culture, and DNA encoding urokinase is known together with suitable vectors and host microorganisms (3,8).

As noted above, it has been believed that plasminogen activators exist as proteolytically inactive zymogens that must be activated by proteolysis before the enzyme can act upon plasminogen to commence the fibrinolytic cascade (4,5). While it has been observed that the urokinase single-chain proenzyme demonstrates high levels of activity on zymographic and fibrinolytic procedures (4,6), the fact that the proenzyme also exerts only low amidolytic activity on low molecular weight synthetic polypeptide substrates has led to the conclusion that traces of contaminating active (two-chain) urokinase in the proenzyme preparations, or traces of plasmin in the plasminogen used in the fibrin plate assays, accounted for the fibrinolytic activity of prourokinase (4). This in turn would compel the conclusion that single-chain urokinase must be converted to the two-chain form in order to cleave plasminogen and initiate fibrinolysis in vivo.

Ihe role of urokinase in clot lysis in vivo is complicated. Prourokinase now is believed to interact with an inhibitor in plasma. Fibrin is postulated to release this inhibitor, whereupon prourokinase 3θ is released for action on plasminogen (7). It is unclear whether removal of the inhibitor alone is sufficient to initiate plasminogen hydrolysis, or whether release from the inhibitor simply facilitates conventional urokinase activation to the two-chain form. Ihe urokinase domain bound by the inhibitor is unknown, nor is the binding mechanism 35 known. A further complicating hypothesis attributes a fibrin-binding -3capability of urokinase to the HUK species, in particular to a region called a kringle located within about residues 49 to 132 (8). The * relationship of this hypothesis to the inhibitor postulate, and their comparative merit, remains unresolved.

A major inpediment to the use of two-chain urokinase for the treatment of blood clots is that the two-chain form is apparently not bound by the putative inhibitor of prourokinase. If two-chain urokinase is administered peripherally it is therefore capable of activating plasminogen at any point within the circulatory system, thereby leading to undesirable side effects. Two-chain urokinase generated by plasmin hydrolysis of single-chain urokinase at the clot site enters circulation with the same adverse side effects, in particular systemic fibrinogenolysis and depletion of a2 anti-plasmin. These side effects hamper proper thrombogenesis in vivo. An improved form of single-chain urokinase is needed (a) which is capable of binding either fibrin or the postulated inhibitor, i.e., which in the end functions substantially the same as native prourokinase with respect to plasminogen activation at clot sites; (b) which is resistant to proteolytic digestion in particular to conversion to the two-chain form; and (c) which exhibits minimal or no antigenicity in patients to whom it is administered. 43 These and other objectives apparent to the skilled artisan are provided by a composition comprising protease resistant single-chain urokinase. Protease resistant single-chain urokinase is produced by combining urokinase with an agent to complex with urokinase or by covalently modifying single-chain urokinase at sites of proteolysis so ® that the urokinase is no longer susceptible to protease hydrolysis at those locations. The target sites include Arg^g to Lys^-g and, preferably, the site at residues Lys^g to Lys^g. Covalent modifications are accomplished by reacting native urokinase with derivatizing reagents or by the recombinant synthesis of mutants having Eite specific substitutions, insertions or deletions of amino acid -4residues at the target site(s). Complexing agents such as antibodies bind to urokinase at the target sites or at flanking sites so that access to the sites by proteases is impeded or prevented. All of these urokinase compositions are designed to reduce or eliminate the proclivity of proteases to cleave at target sites. The conversion of single-chain urokinase to two-chain urokinase by plasmin, bacterial proteases, trypsin and other proteases is impeded by such site specific nutations, thereby reducing undesirable side reactions in vivo, without also impeding the ability of the mutant urokinase species to fully perform otherwise as does the native single-chain urokinase. In particular it is unnecessary for single-chain urokinase to be converted to two-chain urokinase in vivo in order to activate plasminogen. Ihe mutant*? provided herein are substantially nonimnunogenic in humans, they remain ultimately fibrin specific and they are capable of activating plasminogen without releasing two-chain urokinase into the vasculature.

EP-A-0 210 279 discloses prourokinase like polypeptides having an amino acid sequence identical to natural human prourokinase but with an acidic amino acid residue at position 157 and optionally methionine at the N-terminus.

Such polypeptides are excluded from the scope of the present invention.

In the drawing: Fig. 1 depicts the amino acid and nucleotide sequence for human urokinase. Ihe amino acid sequence is shown on the top line, the nucleotide sequence below. Untranslated 5' and 3' regions are also shown.

Single—chain urokinase is defined to comprise the protein having the amino acid sequence of human urokinase depicted in Figs. IA and IB in its high molecular weight (ca. 54,000 daltons, NH2~Ser1 Gln2 Glu3-terminus, or its low molecular weight (ca. 33,000 daltons, NH2~ L^s136I>ro137Ser138"terB^nus^ species, and the amino acid sequence variations and derivatives thereof including natural alleles, wherein the molecule consists of a single amino chain which remains uncleaved at the proteolysis site comprising residues Arg15g through Lys15g (hereafter the chain conversion site). Protease-resistant single-chain urokinase is a urokinase derivative having a single amino -5acid chain which is less susceptible to proteolytic hydrolysis than the corresponding underivatized, native form of urokinase. In particular, protease resistant urokinase is resistant to conversion to two-chain urokinase by proteolysis at the chain conversion site. Typically, this is determined by incubating the urokinase derivative believed to be protease resistant with human plasmin and comparing the activity of the treated candidate on a chromogenic substrate such as S-2444 in comparison with native single-chain urokinase treated and assayed in the same manner. If the rate of plasmin conversion of the candidate urokinase derivative to the two-chain species (as assayed by an increase in S-2444 hydrolytic activity) is less than about 50%, ordinarily less than 10% of the rate of conversion of the comparable native urokinase to the two-chain species, then the candidate is said to be proteolysis resistant. This procedure is described further in the Examples.

Proteolysis resistant single-chain urokinase also includes single-chain urokinase derivatives which are substantially incapable of proteolytic cleavage at the Lysi35Lysi35 s^te (hereinafter the LUK site). These derivatives are defined as those in which the conversion of HUK to LUK proceeds at a lesser rate with the proteolysis resistant urokinase than with native single-chain urokinase. If the rate of trypsin conversion of the candidate urokinase derivative to the LUK form (as assayed by gel electrophoresis, gel filtration, immunoassay or the like) is less than about 50%, ordinarily less than about 10% of the rate of conversion of the comparable urokinase species to LUK, then the candidate is said to be proteolysis resistant.

Proteolysis resistance also is optionally defined in terms of other proteases to be expected in the environment of the single chain urokinase. Microorganisms employed as hosts for recombinant synthesis of single-chain urokinase contain proteases such as endo and exopeptidases, as well as some esterases or amidases with proteolytic activity. Some of these adventitious proteases will cleave single chain urokinase, and are particularly difficult to deal with during purification when the recombinant urokinase is soluble and may be -6exposed to elevated concentrations of these proteases. Previously, the answer to this problem has included the use of proteolysis inhibitors, e.g. 1M guanidine HCI, in the purification solvents (3).

In addition, an enzyme identified as a single-chain urokinase was isolated from natural sources by rapid separation procedures (6) intended to prevent conversion to the two-chain species.

The protease resistant single-chain urokinase is produced by methods per se known to those skilled in the art. The chain 10 conversion site, and preferably the LUK site as well, are either covalently modified so as to be less susceptible to proteolytic cleavage or are combined with an agent that inhibits access of the protease to the sites. *5 Agents that inhibit access of the protease include monoclonal antibodies or fragments thereof, e.g. fab fragments, directed against the sites in question or neighboring epitopes positioned so that the bound antibody sterically hinders access of proteases to the site. In this embodiment the urokinase may be a native as well as a mutant molecule, but it is noncovalently associated with another molecule that confers protease resistance. Suitable antibodies or other binding proteins are easily identified by immunizing an animal, e.g. mice against single-chain urokinase in Freund's complete adjuvant, recovering spleen cells from the immunized animal, fusing the cells to produce hybridomas and screening the fusion culture supernatants for antiproteolytic activity. A suitable screening assay is accomplished by first incubating the candidate antibody with single-chain urokinase and then with plasmin, trypsin or any other protease of concern. Thereafter, a protease inhibitor is added to stop the reaction and the 3θ fragments separated by gel electrophoresis. A comparison with and without reduction on an electrophoresis gel will demonstrate whether or not the antibody has protected the single-chain urokinase, i.e. the presence of a band migrating with single-chain urokinase on the reducing gel will illustrate the degree of protection afforded the 35 single-chain urokinase. -ΊAnother embodiment contemplates the covalent modification of single-chain urokinase at the chain conversion site and, preferably, the LUK site so as to render them less susceptible to proteolytic cleavage. Covalent modification generally is accomplished in one of two ways. In one embodiment, single-chain urokinase is exposed to a derivatizing compound and reacted until at least one residue in a substantial population of the chain conversion or LUK sites is substituted by or sterically hindered by covalent linkage of the urokinase to an organic moiety. The conditions for the reaction are determined by a simple matrix experiment in which preservation of the plasminogen activating activity of the urokinase is compared with increases in proteolytic resistance. Suitable agents are monofunctional compounds which are used under conditions so as to be 15 maximally selective for the side chains of the arginine and, preferably, lysine residues, including 1,2 - cyclohexane dione, acetic anhydride and phenyl glyoxal. Undesirable derivatization in the urokinase active site and kringle structure is minimized by conducting the reaction in a stoichiometric excess, respectively, of plasminogen (or other substrate or substrate analogue) and fibrin or benzamidine. Since the agent is monofunctional the proteins will not be crosslinked.

However, the preferred method for producing the protease resistant single-chain urokinase of this invention is to introduce an amino acid sequence variation into the chain conversion or LUK sites by recombinant methods. A DNA sequence that encodes single-chain urokinase is known, as are methods for its expression in recombinant host cells (3,8). Methods are known per se which can be used to introduce mutations into this DNA that are expressed as proteolysisresistant amino acid sequence variants. For example, DNA segments encoding the chain conversion and LUK sites (as well as flanking regions if necessary) are excised from the urokinase-encoding DNA by sequential digestion with restriction endonucleases, acting at locations flanking the DNA encoding the proteolysis sites (as -8determined by DNA sequence analysis), recovering the properly cleaved DNA (as determined by gel filtration), synthesizing an oligonucleotide encoding the desired amino acid sequence and flanking regions, digesting with the restriction enzymes also used to excise the undesired fragment, thereby creating cohesive terminii, and ligating the synthetic DNA into the remainder of the single-chain urokinase structural gene. DNA encoding the LUK site, for example, is excised by partial digestion of pUK54trp207-l(3) with Mstl and Ball, recovering the vector fragment, and reconstituting the vector by ligating this fragment to a synthetic oligonucleotide having the desired sequence. In this embodiment, DNA encoding [Lys^^^^] human urokinase is created by inserting at the Mstl and Ball terminii an oligonucleotide having the sequence pGCAGATGGAAAGCCCTCCZTCTCCTCCAGAAGAAITAAAATTTCAGTGTGG CGTCTACCTTTCGGGAGGAGAGGAGGTCTTCTIAA'nnAAAGTCACACCp. • · 530 582 (Ihe numbers below the sequence correlate with Fig. 1) 2q Similarly, the DNA encoding the chain conversion site, for example, is excised by partially digesting the urokinase DNA with Ball and EcoRI in the same fashion and ligating into the opened gene an oligonucleotide bearing the base sequence encoding the desired amino residues. To illustrate, a representative oligonucleotide to be used in preparing [Arg^^g-Hlis; Lys^^A] human urokinase is -HisPhellepCCAAAAGACTCTGAGGCCCCACTTTATTATIGGGGGAG GGTTTTCTGAGACTCCGGGGTGAAATAATAACCCCCTCTIAAp. 583 627 2Q Other variant sequences are made by synthesizing and inserting appropriate oligonucleotides in analogous fashion.

However, it is usually more convenient to mutate the urokinase DNA using the M13 phage mutagenesis method (9). This method, which is well known per se. -9The amino acid sequence mutants herein are characterized by the deletion or substitution of the basic residues (arginine and/or lysine) found in the protease sites, or the insertion of residues that render the basic residues substantially incapable of participating in proteolytic cleavage. Combinations of insertions, deletions or substitutions are employed. Preferred mutations are set forth in the Table below. This table is not intended to be exclusive of useful mutations.

Urokinase Residue(s)Mutational Event 4. Phe15.Lys158 1· Lysi35 2- Lys136 3. Ar3l56Phe157Lys15e Δ; or Lys^-ttis, Ser or Tyr Δ; or Lys 236>pro (His,) (His,] Δ; orAr9l56phe157Lys158* Ser, iyr, ^he157: Ser, Tyr, Glu Glu, or or .Gly > 156 .Gly , His,' Ser, Δ; orPhe157Lys158 *Phe157: Tyr, Glu, or .Gly . 158 Δ; or Lys15g-»His, Ser, Tyr or Gly . Lys15£|6‘ Lys158Ile159 ->Lys158 Prolle159 If is undisturbed or mutated to arginine, Lys13g should be mutated to proline or deleted. In addition, if Lys^g is undisturbed or mutated to arginine, proline should be inserted between LySisg and or proline substituted for Ile^. The most preferred embodiments are the deletion mutants, especially of Lys235' Arg156 and Lys15g, closely followed by histidinyl substitutions of these three residues, since such mutations are the least likely to -1010 generate autoantibodies in patients. The preferred embodiment is a deletion of Lys^^s or LYsi36 combined with a deletion of phei57Lysi58· This mutant has the advantage that, even though limited proteolysis does occur after Arg^^g, ^en Prote°lytic conversion to the two-chain form does occur the resulting molecule has the same C and N terminii in both urokinase chains as does two chain urokinase (normal proteolysis of prourokinase in vivo releases the Phe Lys dipeptide). Furthermore, with the preferred mutant the molecule remains in the HUK form.

The nucleic acid encoding the protease resistant variant is inserted into an expression vector, the vector used to transform a host cell, the transformant cultured until the variant urokinase accumulates in the culture and the variant then recovered from the culture. The methods for recombinant urokinase preparation described in the published literature (3), which are expressly incorporated by reference, are all satisfactory for preparation of the variants. An exemplary method is described in the Exanples below. However, it will be understood that other vectors and host cells are to be used satisfactorily in preparing the variants described herein.

Variant urokinase produced directly in recombinant bacteria (i.e., without the use of a secretory leader) is deposited as intracellular, water-insoluble aggregates called refractile bodies. These are recovered by separating the refractile bodies from cellular debris such as cell wall fragments and the like. This is conveniently accomplished by centrifugation methods, e.g. sucrose gradient separation. Thereafter, the refractile bodies are solubilized in a protein denaturing agent such as 6M guanidine hydrochloride, refolding the protein, the agent removed for example by dialysis and the variant urokinase purified further by classical techniques such as ion exchange resin or gel columns. However, since the variant urokinase is protease resistant it is not necessary to employ benzamidine sepharose to separate single-chain from two-chain urokinase, nor is it necessary to employ either a protease inhibitor (1M guanidine -11hydrochloride) or rapid separation procedures during the purification steps.

Protease resistant urokinase, whether variant urokinase synthesized in recombinant bacteria, yeast or higher eukaryotic cell cultures, or prepared by covalent or adsorptive modification of native urokinase, is then formulated into a composition for therapeutic administration to patients having blood clots. The urokinase concentration, route of administration and pharmaceutical excipients ·® previously used for native urokinase are equally satisfactory for the protease resistant urokinase of this invention. Typically, about from 10,000 to 75,000 IU/ml of resistant urokinase is formulated into 5% dextrose or other isotonic intravenous vehicle, together with carriers, excipients and stabilizers if desired. The protease15 resistant urokinase is infused intravenously at a rate sufficient to achieve perfusion of the occluded artery or vein as ordinarily visualized by conventional techniques, usually greater than about 4,000 IU/Kg/hr. Generally, however, the rate of infusion and the concentration of urokinase will vary considerably based on the activity of the urokinase derivative selected, the general condition of the patient, e.g. the extent of the clot and the hemostatic status of the patient, and the administration route, e.g. by coronary catheter or peripheral administration. The determination of appropriate urokinase concentrations and rates of administration will be within the skill of the ordinary artisan. It should be appreciated that the relative absence of side effects achieved with the present urokinase species facilitates the use of greater doses and rates of administration than has heretofore been possible with two-chain urokinase. -12Exanple 1 Construction of Lys^g+A Mutant 5 . * Plasmid pUK54trp207 IX was used as the starting plasmid.

This plasmid contains DMA. encoding the complete HUK gene under the control of the E. coli trp promoter. This plasmid is identical to pUK54trp207-l (3) except that it contains only one EcoRI site, near the 3' end of the trp promoter, and the 641 bp between the Aval and PvuII sites of the pBR322 vector component have been deleted (the so-called XAP deletion) (14).

Plasmid pUK54trp207-l*TX is made by a known procedure (3) except that the starting plasmid used in that procedure was pHGH207-l*XAP rather than pHGH207-l. pHGH207-l*XAP was produced by partial EcoRI digestion of pHGH207-l to open the plasmid, the cohesive terminii filled in using the Klenow fragment of DNA polymerase I, the plasmid re circularized using T4 ligase and thereafter used to 2q transform E. coli. A plasmid, pHGH207-l , was selected in which only the EcoRI site at the 3’ end of the trp promoter survived, as determined by restriction enzyme analysis.

In order to effect the XAP deletion, pHGH207-l* was digested with Aval and PvuII, the large vector fragment recovered, the cohesive terminii filled in using the Klenow fragment of DNA polymerase I, the plasmid blunt-end ligated using the T4 ligase and E. coli transformed with the ligation mixture. pHGH207-l*XAP was recovered and employed in the known method to arrive at pUK54trp207*TX. pUK54trp207-l TX was digested with Pstl and Bell and the fragment spanning about bases 439 to 732 was recovered. Double stranded Ml3rapl0 (equivalent phage Ml3mpl8 is commercially available from Bethesda Research Laboratories) was digested with Pstl and BamHI and annealed to the Pstl-Bcll urokinase DNA fragment to form -13Ml3mplOUKl. E. coli JM101 cells (ATCC No. 33876) were transformed with the double stranded replicative form (RF) of Ml3nplOUKl. The single stranded and RF M13raplOUKl were isolated from infected E. coli JM101 cells in known fashion. Note that Bell and BamHI form cohesive terminii, so that the Ml3mpl0 phage was able to recircularize with the urokinase insert. The single stranded form was used for the site specific mutagenesis of urokinase at the Lys13g site.

A synthetic oligonucleotide was prepared by the solid phase phosphotriester method (16) for use as a mutagenesis primer. The following primer was used for the deletion of Lys13g: ' pGCAGATGGAAAACCCTCCTCTCCT. • · 530 556 This is the portion of the urokinase coding strand flanking Lys13g except that the AAG codon for Lys13g was deleted.

Ihe procedure described hereinafter was used to generate a urokinase clone containing the mutated sequence of the synthetic primers. Ihis procedure is generally known per se (9). ng of the synthetic oligonucleotide was phosphorylated for 30 minutes at 37°C in 10 μΐ of a mixture and 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP containing 8 U of T4 polynucleotide kinase. For use as a probe, 400 ng of the synthetic oligonucleotide was phosphorylated as above except that ATP was replaced with 60 mCi [γ^^Ρ]-ΑΤΡ (3000 Ci/mmol) resulting in approximately 50 to 60 x 10^ cpm/400 ng of 24mer. For heteroduplex formation, 100 ng single stranded M13mplOUKl was heated to 95eC (10 min), and slowly cooled to room temperature over a 30 min time period in 40^1 of a mixture containing lOmM Tris-HCl pH 7.5, lOmM MgCl2> ImM dithiothreitol, and 10 ng of the phosphorylated primer and 500 ng of EcoRI-digested M13mplOUKl large fragment. Primer extension was started by the addition of 10 μΐ buffer containing 50 mM Tris HCl pH.7.5, 10 mM MgCl2 and ImM dithiothreitol, 2mM ATP, 0.25 mM each of -14dGTP, dTTP, dCTP and dATP, 5 U of E. coli DNA polymerase I large fragment and 400 U of T4 DNA ligase. After 1 hr at 12°C the reaction mixture was used to transform E. coli JM101 cells.

Transformation was accomplished by mixing 10pl of the ligation mixture with 200 pi of competent JM101 cells, followed by incubation for 30 min on ice and 5 min at 37°C. Then 3.5 ml 2YT top agar at 55°C was mixed with 300 pi saturated JM101 cells, 10 pi IPTG (200 mM) and 50 pi Xgal and after addition of the transformed cells 1® plated on 9 cm Petri dishes containing LB with no drugs.

Two colorless plaques (B2 and G12) were picked and transferred to a microtiter dish containing 100 pi 2YT medium. The inoculated microtiter fluids were stamped on 15 cm diameter LB agar I® plates overlayed with a lawn of 600 pi JM101 cells in 8 ml 2YT top agar and incubated overnight at 37°C. The formed plaques were transferred to a nitrocellulose disc by physical contact for 1 min.

The nitrocellulose disc was treated with 0.5 M NaOH, 1.5 M NaCI for 3 min and washed twice with 3 M NaCl-0.5 M TrisHCl pH 7.5 for 15 min and then with 2X SSC for 15 min. Prehybridization mix contains 10 mM Tris pH 7.5, 5DM EDTA, 0.9 M NaCI, IX Denhardt, 0.5 percent NP40, lOOpM ATP, ImM sodium pyrophosphate, 1 mM sodium phosphate and 50 pg/ml E. coli tHNA. IX Denhardt's contains per liter 200 mg Ficoll, 200 mg polyvinylpyrrolidone, 200 mg bovine serum albumin (BSA; fraction V).

The disc was baked at 80°C in vacuo for 90 min. the disc was then incubated for 3 hrs with 6 ml prehybridization fluid in a Petri dish followed by addition of 5x10$ cpm labeled primer and hybridized overnight. Selective washing of the disc was performed with 0.4X SSC at 49°C and after air-drying the disc was exposed to X-ray film. The 30 positively hybridizing clones were further analyzed by dideoxy sequencing. The B2 clone was confirmed to contain the proper sequence containing the Lys136 deletion.

The expression plasmid was reconstituted by ligating Xbal-Bcl 35 and Xbal-Pstl fragments from pUK54trp207-l*TX with the Sau3A-PstI -15insertion fragment from plaque B2 and transforming the ligation mixture into E. coli. A transformant was selected which contained a plasmid carrying the mutant gene (pUK54B2). The fragments were obtained by conventional restriction enzyme digestion and recovery of the fragment desired. While in doing so the Bell and BamHI sites are both destroyed, note that the M13 urokinase insert was excised at the same point as the Bell and BamHI ligation by Sau3A, which recognizes the center four bases of any of the Bell, BamHI or BclI-BamHI ligation sites. pUK54B2 was used to transform E. coli. At the present time the preferred strain of E. coli is W3110fhuA~. This strain is not essential for the preparation of the urokinase mutants herein, but it is more convenient because it is more resistant to contaminating phage 15 and thus more practical for commercial scale synthesis.

E. coli W3110 fhuA~ is a Tl phage resistant bacterium characterized by a deletion or inversion of DNA sequences associated with the fhuA gene.

Briefly, E. coli W3110 (ATCC 27325) is transduced with lambda bacteriophage containing the transposable element TnlO which confers tetracycline resistance.

Strains of TnlO transduced W3110 are selected for resistance to phage infection. Phage resistant strains are pooled and infected with 25 bacteriophage Pl. The resulting lysate is used to transduce E. coli AT982 (17). Strain AT982 contains a DAP mutation located close to the fhuA gene. Accordingly, transduction of strain AT982 by the Pl lysate and selection of transductants which are tetracycline resistant and which regenerate the DAP function indicates that transposon ItilO is 3θ located within the fhuA gene. Strains which are tetracycline resistant and demonstrate regenerated DAP function are the source of DNA for bacteria phage Pl transduction of E. coli W3110. Transduced W3110 strains expressing tetracycline resistance and phage resistance are selected. These strains are then selected on the basis of 35 resistance to phage infection and reversion to tetracycline -16sensitivity (18). The reversion to tetracycline sensitivity coupled with the retention of resistance to TI phage infection indicates that DNA sequence associated with the fhuA gene have either been deleted or inverted irreversibly. Strains so constructed are designated E. coli W3110 fhuA-.

The phage containing the transposable element TnlO which was used to insert TnlO into W3110 was constructed as follows. The starting material was lambda cl857b 2210am29. This phage is known to those skilled in the art (19), and was constructed from three well known mutants of lambda phage by standard procedures. A lysate of this lambda phage was prepared on the amber suppressor E. coli C600 (ATCC No. 23724) which had been manipulated by procedures known to those skilled in the art to also carry the TnlO transposon (19). This lysate was used to infect E. coli C600 (lambda C1857) which contains an amber suppressor and a lambda prophage carrying the cl857 genotype. Lysates of tetracycline resistant colonies were prepared by heat induction by growing the tetracycline resistant colonies first in broth at 32eC and thereafter at 42°C for 90 minutes. The lysate was then plated on E. coli C600 and replica plated. The plaques appearing on E. coli C600 were replica plated at 32eC on E. coli C600 and E. coli W3102 sup+ (lambda imm434) which contains the heteroimmune prophage lambda imm434 (20). Plaques appearing on the heteroimmune strain are plated onto tetracycline plates. Plaques appearing on these plates are capable of transducing tetracycline resistance and are used in the above described method for generating E. coli W3110 fhuA-.

Recombinant native and [LysliC->0] human urokinase were 30 obtained from 1 liter cultures of W3110 or W3110FhuA cells transformed with the appropriate plasmid. Expression was induced further by addition of indoleacrylic acid. -17Example 2 Construction of [Lys^^g->A; Phe^gyLys^gg^A] Hunan Urokinase Substantially the same procedure was followed in generating expression plasmids carrying other or additional mutants. It is convenient in some instances to use the M13 phage already carrying one or more mutants in the preparation of DNA mutated at additional sites. 3,9 Ihe following procedure was used to prepare [ Phe^^Lys^gg^A; Lys^jg-A] human urokinase. M13mplOUKl was used as a template for a primer having the following sequence: ' pCTGAGGCCCCGCATTATTGGGGGA. • · 593 621 Using the method described above, plaque 2F3 was identified. Phage from plaque 2F3 were determined to carry a urokinase DNA fragment containing the Phe^Lys^gg-frA mutation. The expression plasmid for this mutation vhich also contains the Lys^jg deletion mutation (Ex. 1) was reconstituted by ligating the vector fragment from a Ball-Bell digestion 2® of pUK54B2 with the BalI-Sau3A insertion fragment of phage 2F3, transforming and culturing E. coli W3110 or W3110FhuA". Transformed cells were grown on minimal media overnight, to an O.D. at 550nm of 1.2. Additional media was added. Indole acrylic acid, a compound which further induces expression of the tryptophan operon controlled genes, 25 was added to a concentration of 10 //g/ml. Ihe cells were incubated 2 hours and harvested.

While pUK54trp207-l*lX was the plasmid actually used in the preparation of the protease-resistant urokinase sequence variants 3® described herein, it will be appreciated by those skilled in the art that other expression vectors are suitable for use herein. All that is needed is cloned DNA encoding urokinase. This DNA is obtained by synthesis or by obtaining mRNA from suitable cells, e.g. Detroit 562 cells (ATCC No. CCL 138), and preparing cDNA therefrom (3). This DNA is identified by at least substantial DNA and amino acid sequence homology -18with the native urokinase sequence shown in Fig. 1. Suitable restriction enzyme sites are identified from the DNA sequence and employed, together with adaptors or linkers as required, to obtain DNA suitable for insertion into the selected expression vector. The use of other plasmid constructions and host-vector systems will be within the skill of the art.

Example 3 θ Purification of [Lys^gg-^A; Phe^g^Lys^gg+A] Human Urokinase 200 gm of cell paste, harvested from half of a 10 liter fermenter conducted as described in Example 2, was homogenized at 4°C in 3-3 10 liters of 0.05M Tris, pH 7.2, containing 0.02M EDTA, 0.5 gn/liter lysozyme (Sigma) and 0.01 gm/liter each of ribonuclease (Sigma) and deoxyribonuclease (Sigma). The solution was passed three times through a Menton Gaulin mill at 4,500 psi and centrifuged for 30 minutes at 4,700 x g at 5eC. The resulting pellet, which contains urokinase as 2θ monitored by SDS-PAGE and Western blotting, was resuspended by homogenization in 500 ml of 0.05M Tris and 0.02M EDTA, pH7.2. This suspension was layered over 1.3 liters of 50% glycerol and centrifuged again for 30 minutes at 4,700 x g.

The urokinase which again is found in the pellet, was dissolved with stirring for 6 to 8 hours, in 300 ml 6.0M guanidine hydrochloride at 4*C. Insoluble material was removed by centrifugation for 30 minutes at 4,700 x g. The supernatant was diluted to 6.0 liters for refolding. The final concentration of salts in the pH 9.0 refolding buffer was: 3θ 0.05M Tris, 1.0M guanidine hydrochloride, 0.2M arginine, 0.005M EDTA, 0.005% Tween 80, 1.25mM reduced glutathione and 0.25mM oxidized glutathione. The volume of 6.0 liters was calculated to give an OD28q <1. The solution was allowed to stand 24 hours at 4°C to obtain maximal yields of activity as measured by fibrin plate assay. Refolding *5 reagents were removed by dialysis at 4 °C against two changes of 60 -19liters each of 0.05M sodium phosphate, pH 6.8 containing 0.005% Tween 80. The dialysis was completed overnight. All subsequent purification steps were carried out at 4° C.

The dialyzed solution was batch extracted with 400 mis of DE-52 cellulose (Whatman) equilibrated in the dialysis buffer. The slurry was filtered using a Buchner funnel. The supernatant, containing unadsorbed urokinase, was loaded immediately onto a 100ml (5 x 5cm) hydroxylapatite (BioRad) column previously equilibrated with the dialysis buffer. The column was washed with 0.125M sodium phosphate, pH 6.8 containing 0.005% Tween 80. Urokinase was eluted with 0.4M sodium phosphate, pH 6.8 containing 0.005% Tween 80.

The elution pool from the hydroxylapatite column was concentrated to approximately 30 ml using a YM10 Amicon filter and was loaded onto a 2.5 x 130 cm Sephacryl S-200 sizing column equilibrated with 0.05M sodium phosphate, pH 6.8 containing 1.0M guanidine hydrochloride and 0.005% Tween 80. The peak containing urokinase was pooled and dialyzed against 100 volumes of 0.05M sodium phosphate, pH 2θ 7.3, containing 0.15M sodium chloride and 0.005% Tween 80.

Example 4 Activity of [Lysi3g-*A; Phe^ 2 5 Hunan Urokinase _ The relative activities of [Lys136-*A;Phe157Lys15B-»A] human Urokinase and its mutants were assayed on fibrin plates (11). The fibrin plates consisted of 1.25% agarose, 4.1mg/ml human fibrinogen, 0.3 units/ml of thrombin and 0.5 //g/ml of soybean trypsin inhibitor. 2θ Urokinase and its mutants also were assayed as noted by direct chromogenic substrate, S-2444 (Helena Laboratories, Beaumont, Texas) (12). All assays were compared to the urokinase standard (Calbiochem) for absolute activities. -20recombinant urokinase, recombinant native HUK (3) and siative HUK were compared by fibrin plate assay. The results were 96/ u, 126,200 and 121,200 Ploug Units (FU)/tag, respectively. This demonstrates that the three amino acid deletions did not substantially modify the plasminogen activating capacity of the mutant urokinase. 300 PU of the mutant contained only 0.76 PU by S-2444 chromogenic activity. This was only about 0.25% of the S-2444 activity of native urokinase. It was concluded that the mutant exhibited either some residual S-2444 activity or that limited conversion to the two-chain form had occured.

A comparison of the activity of plasmin on (LySj3g-»0;Phe^^ LySigg-+A] human urokinase and recombinant single chain native urokinase was conducted. When 0.0625 units of plasmin were added to 300 PU (fibrin plate) of mutant and incubated for 1 hour at 37°C, enzyme was produced having an S-2444 activity of 10.36 PU, whereas a much smaller quantity of plasmin (0.005 units) incubated for a shorter period (15 min) at 37°C with 50 PU of recombinant single-chain native urokinase yielded enzyme having a much greater S-2444 activity(-45 PU). The comparative S-2444 specific activities of two chain and plasmin incubated recombinant native and recombinant mutant urokinases are shown below.

Enzyme S-2444 Activity (PUxlO3/tog) recombinant single-chain HUK 89.0 chain recombinant HUK 102.2 chain native HUK 92.7 mutant recombinant single-chain HUK 3.3 Thus, the mutant is far less susceptible to plasmin activation than is the native molecule. -211. 2. 3. 4. . 6. 7. 8. 9.

BIBLIOGRAPHY Gunzler, W.A., et al. The primary structure of high molecular mass urokinase from human urine: The complete amino acid sequence of the A chain. Hoppe-Seyler's Z. Physiol. Chem. Bd. 363: 1155-1165 (1982).

Steffens, G.J., et al. The complete amino acid sequence of low molecular mass urokinase from human urine. Hoppe-Seyler's Z. Physiol. Chem. Bd. 363: 1043-1058 (1982).

EP Publication No. 92182 Wun, T-C, et al. A Proenzyme Form of Human Urokinase. Journal of Biological Chemistry 257: 7262-7268 (1962).

Nielsen, L.S., et al. Purification of Zymogen to Plasminogen Activator from Human Glioblastoma cells by Affinity Chromatography with Monoclonal Antibody. Biochemistry 21: 6410-6415 (1982).

U.S. Patent 4,381,346.

Zamarron et al., Competitive Inhibition by Human Plasma of the Activation of Plasminogen by Pro-Urokinase in Thrombosis and Haemostasis 54(1): abs.604, pp 102, (July 14, 1985).

Heyneker, H. et al., Functional Expression of the human urokinase gene in Escherichia coli in Genetics of Industrial Microorganisms, 1982, Proceedings of the IVth International Symposium K. Ikeda et al. Eds., pp 214-221 (1983).

Adelman, J. et al., In Vitro Deletional Mutagenesis for Bacteial Production of the 20,000-Dalton Form of Human Pituitary Growth Hormone. DNA 2(3): 183-193 (1983). -2210. Winter, G. et al., Redesigning Enzyme Structure by Site-directed Mutagenesis: Tyrosyl tPNA Synthetase and ATP Binding. Nature 290: 756-758 (1982). 11. Ploug, J. et al., Urokinase: An activator of plasminogen from human urine. I. Isolation and Porperties. Biochim. Biophys.

Acta 24: 278-282 (1957). 1® 12. Hayashi, S. et al., Assay of urokinase activity in plasma with a chromogenic substrate. Thrombosis Research 22: 573-578 (1981). 13. Gray et al. Bio/Technology 2: 161-165 (February 1984). 14. Sutcliff, Cold Spring Harbor Symposium on Quantitative Biology, 43: (1979).

. Goeddel, D., et al.. Nature 287: 411 (1980). 16. Crea et al., Proc. Nat. Acad. Sci. USA 75: 5765 (1978). 17. Bukhari, et al., J. Bacteriology 105:844 (1971). 18. Naloy et al., J. Bacteriology 145: 1110 (1981). 19. Kleckner et al., j. Mol. Biol. 116: 125 (1977).

. Kleckner et al., Genetics 90: 427 (1978).

Claims (33)

1. A composition comprising single-chain urokinase which is resistant to proteolytic conversion to two-chain 5 urokinase and has fibrinolytic activity, said urokinase not being a native single-chain urokinase, and not being a urokinase having an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with an acidic amino acid residue at position 157 and optionally 10 methionine at the N-terminus.

2. A composition of claim 1 wherein the urokinase is an amino acid sequence variant.

3. A composition according to claim 2 wherein the urokinase is human and the variation includes a mutant amino acid sequence in the region of residues Arg 156 to Lys ise . 2q

4. A composition of claim 3 wherein the urokinase is (Phei S7 Lys 158 -Δ] urokinase.

5. A composition of any one of claims 2 to 4 wherein the variation also includes a mutant amino acid sequence in the 25 region of residues Lys ns to Lys 136 .

6. A composition comprising urokinase having fibrinolytic activity and which is an amino acid sequence variant of human urokinase the variant having a mutant amino acid sequence in the region of residues Lys 13S to Lys 136 such that the variant is resistant to proteolytic cleavage at the Lys-135 Lys-|35 site; said urokinase not being a urokinase which has an amino acid sequence identical to the natural 5 human prourokinase of Fig. 1 but with a non-basic amino acid residue at position 135 and optionally methionine at the N-terminus.

7. The composition of claim 6 wherein the urokinase is Lys l36 -» A urokinase.

8. A composition of any one of claims 2 to 6 wherein the urokinase is a deletional mutant of urokinase.

9. A composition of any one of the preceding claims 15 wherein the urokinase is resistant to bacterial proteases.

10. A composition of any one of the preceding claims wherein the urokinase is resistant to plasmin. 20

11. A composition of any one of the preceding claims wherein the protease resistant single-chain urokinase is converted upon incubation with human plasmin to two-chain urokinase at a rate of less than about 10% of the rate of conversion of native single-chain urokinase.

12. A composition of any one of the preceding claims wherein the protease-resistant urokinase is less susceptible to proteolytic conversion to two-chain urokinase than is native single-chain urokinase.

13. A composition of any one of the preceding claims wherein the urokinase is selected from [Lys 136 -*j\] human 5 urokinase [Phe 1S7 Lys lse human urokinase, [Phe 157 Lys 158 Lys 136 human urokinase, [Arg 158 ] human urokinase, [His 158 ] human urokinase, [Gly 158 ] human urokinase, [Ser 158 ] human urokinase, [Tyr 158 ] human urokinase, [Arg 156 -» His; Lys 15e -» Ser] human urokinase, [Arg 156 Lys 158 -»A1 human urokinase, 10 [Atg 156 Phe 157 Lys 158 -M\] human urokinase, [Lys 158 Ile 159 -* Lys 158 Pro He 159 ] human urokinase, [Phe 157 Lys 158 Arg 156 -» His] human urokinase, and [Arg 156 Phe 157 -» A; Lys 158 -» Gly] human urokinase.

14. 15 14. A composition according to any one of the preceding claims comprising a therapeutically effective concentration of the protease-resistant urokinase in admixture with a pharmacologically acceptable excipient. 20 15. A composition of claim 14 wherein the concentration is about from 10,000 to 75,000 IU urokinase/ml.

15. 16. A nucleic acid encoding a single-chain urokinase which is resistant to proteolytic conversion to two chain 25 urokinase, has fibrinolytic activity and is an amino acid sequence variant of urokinase, other than urokinase having an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with an acidic amino acid residue at position 157 and optionally methionine at the N-terminus.

16. 17. A nucleic acid according to claim 16 wherein the urokinase is human and the variation includes a mutant 5 amino acid sequence in the region of residues Arg 156 to Lys 15e .

17. 18. A nucleic acid according to claim 16 or 17 wherein the variation further includes a mutant amino acid sequence in 10 the region of residue Lys 135 to Lys 136 .

18. 19. A nucleic acid encoding a urokinase having fibrinolytic activity and which is an amino acid sequence variant of human urokinase the variant having a mutant 15 amino acid sequence in the region of residues Lys 135 to Lys 136 such that the variant is resistant to proteolytic cleavage at the Lys 135 Lys 136 site; other than urokinase which has an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with a non-basic amino acid residue at position 135 and

19. 20 optionally methionine at the N-terminus. 20. A nucleic acid according to any one of claims 16 to 19 wherein the variant is a deletional mutant of the urokinase gene.

20. 21. A nucleic acid according to claim 20 wherein the mutant is [Lys 136 human urokinase.

21. 22. A replicable vector comprising a nucleic acid according to any one of claims 16 to 21.

22. 23. A recombinant host cell transformed with a vector 5 according to claim 20.

23. 24. A method for making a variant of urokinase, comprising (a) providing nucleic acid encoding a fibrinolytically active amino acid sequence variant of single-chain 10 urokinase which variant is resistant to proteolytic conversion to two chain urokinase, other than urokinase having an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with an acidic amino acid residue at position 157 and optionally methionine at the N-terminus 15 (b) transforming a host cell with the nucleic acid of step (a), (c) culturing the transformed host cell until the variant urokinase accumulates in the culture and (d) recovering the variant urokinase from the culture. 20 25. A method for making a variant of urokinase, comprising (a) providing a nucleic acid encoding a urokinase having fibrinolytic activity and which is an amino acid sequence variant of human urokinase the variant having a mutant amino acid sequence in the region of residues Lys 135 to Lys 136

24. 25 such that the variant is resistant to proteolytic cleavage at the Lys 135 Lys 136 site; other than urokinase which has an amino acid sequence identical to the natural human prourokinase of Fig: 1 but with a non-basic amino acid residue at position 135 and optionally methionine at the N-terminus (b) transforming a host cell with the nucleic acid of step (a), (c) culturing the transformed host cell until the variant urokinase accumulates in the culture and (d) recovering the variant 5 urokinase from the culture.

25. 26. A method of claim 24 or 25 wherein the host cell is a prokaryotic cell. 10

26. 27. A method of any one of claims 24 to 26 wherein the urokinase is recovered from the culture by a method comprising: (a) harvesting refractile bodies containing the singlechain urokinase; 15 (b) solubilizing the urokinase contained in the refractile bodies; (c) adsorbing undesired proteins onto a cationic exchange resin; (d) adsorbing the solubilized urokinase on 20 hydroxylapatite; and (e) eluting the urokinase from the hydroxylapatite.

27. 28. A method of any one of claims 24 to 27 wherein the urokinase is recovered by a process not including either 25 the use of an exogenously-added proteolysis inhibitor or benzamidine sepharose.

28. 29. A composition of any one of claims 1 to 13 for use in treating a vascular embolus.

29. 30. A composition of claim 29 wherein the urokinase is [Lys 135 Phe 157 Lys 158 for administration by intravenous 5 infusion at a dosage of about 4000IU/kg/hr.

30. 31. A composition of claim 30 wherein the urokinase is [Lys 136 -» for administration by intravenous infusion at a dosage of about 4000IU/kg/hr.

31. 32. A protease resistant modified human urokinase having a mutated amino acid sequence at (a) residues Arg 156 Phe 157 LySise» (b) residues Lys 135 Lys 136 or (c) residues Arg 156 Phe 1S7 Lys 158 and residues Lys 135 Lys 136 ; other than: (i) urokinase 15 having an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with acidic amino acid residue at position 157 and optionally methionine at the N-terminus; or (ii) urokinase having an amino acid sequence identical to the natural human prourokinase of Fig. 1 but with a non-basic amino 20 acid residue at position 135 and optionally methionine at the N-terminus. -3033. A composition according to Claim 1, substantially as hereinbefore described and exemplified.

32. 34. A method according to Claim 24 or 25 for making a variant of urokinase, substantially as hereinbefore described and exemplified.

33. 35. A variant of urokinase whenever made by a method claimed in any one of Claims 24 to 28 and 34.