IE20080786A1 - Marker assisted selection of bovine for desired milk or tissue content - Google Patents

Abstract

The present invention provides methods of genotyping bovine for desired milk or tissue colour or β-carotene content traits by determining the SCARB1 genotype of said bovine, and particularly wherein the presence or absence of the C allele at the C-321G promoter polymorphism in the SCARB1 gene is associated with variation in milk or tissue colour or β-carotene content.

Description

[0001] This invention relates to an application of ma^Wwawirted > sekahen-aTfeovine for a quantitative trait loci (QTL) associated with milk and tissue colour and β-carotene content, particularly by assaying for the presence of polymorphisms in a gene which is associated with the QTL.

BACKGROUND [0002] The genetic basis of bovine milk production is of immense significance to the dairy industry. An ability to modulate milk volumes and composition has the potential to alter farming practices and to produce products which are tailored to meet a range of requirements. In particular, a method of genetically evaluating bovine to select those which express desirable traits, such as desirable milk fat colour or composition, would be useful. Similarly, a method of genetically evaluating bovine with desirable tissue colour or composition would be useful.

[0003] Genetic bases for variations in the composition of milk, for example, the relative amounts of major milk proteins, and the effect of these variations on milk production characteristics and milk processing properties, has been the subject of considerable research, debate, and review. For example, PCT International application PCT/NZ01/00245 (published as WO02/36824) reports that polymorphisms in the bovine Diacylglycerol-o-acyltransferase (DGAT1) gene are associated with increased milk yield and altered milk composition, and in particular that the presence of a K232A mutation in the DGAT1 gene results in a decrease in milk fat percentage, milk fat yield, solid fat content and milk protein percentage, while increasing milk volume and milk protein yield. In another example, PCT International application PCT/NZ02/00157 (published as WO03/104492) reports that polymorphisms in the bovine growth hormone receptor (GHR) gene are associated with an increased milk volume and altered milk composition, and in particular that the presence of the F279Y amino acid variant results in increased milk yield and decreased milk fat and milk protein percentage, as well as a decrease in live weight. For other characteristics of milk composition, the basis for variation is less clear.

[0004] The yellow colour of milk and milk fat, caused primarily by the presence of βcarotene, is considered a negative characteristic in some consumer markets. Conversely, «0 8 0786 ΙΕΟ 8 07 06 2 other markets prize the yellow colour, while foods enriched in β-carotene have been associated with health benefits. Consequently, strategies to modulate milk colour could be economically valuable. Although environmental factors, such as diet, lactation stage and milk volume, influence milk colour, previous research suggests that some of the variation in milk colour may be attributable to genetics (Winkelman et al., 1999). Similarly, different consumer markets variously perceive tissue colour.

[0005] Strategies to modulate milk colour or β-carotene content or tissue colour or βcarotene content could provide health benefits and are expected to be economically valuable. β-carotene and vitamin A deficiencies are still major health problems (particularly in developing countries) leading to blindness and childhood mortality. Milk with increased βcarotene content would be of benefit, for example in markets where other dietary sources of β-carotene are scarce or not commonly consumed.

[0006] Marker assisted selection, which provides the ability to follow a specific favourable genetic allele, involves the identification of a DNA molecular marker or markers that segregate(s) with a gene or group of genes associated with or which in part defines a trait. DNA markers have several advantages. They are relatively easy to measure and are unambiguous, and as DNA markers are co-dominant, heterozygous and homozygous animals can be distinctively identified. Once a marker system is established, selection decisions are able to be made very easily as DNA markers can be assayed at any time after a DNA containing sample has been collected from an individual animal, whether embryonic, infant or adult. [00071 It is an object of the present invention to provide a method for marker assisted selection of bovine with desired milk colour or milk β-carotene content or tissue colour or tissue β-carotene content; and/or to provide animals selected using the method of the invention as well as milk produced by or tissue(s) derived from the selected animals; and/or to provide the public with a useful choice.

SUMMARY OF THE INVENTION [0008] This invention relates to the elucidation of the role of the gene encoding Scavenger receptor class B, member 1 (SCARB1, also known as CD36 antigen, collagen type I receptor, and thrombospondin receptor-like 1) in milk or tissue colour or β-carotene content, particularly milk fat colour and β-carotene content. In particular, the invention relates to the identification of the C-321G promoter polymorphism in the SC ARBI gene, and to the »0β07Η association of the C allele with production of milk and particularly milk fat with increased βcarotene content for the first time. 10009] This gives rise to numerous, and separate, aspects of the invention.

[0010] In one aspect the invention provides a method of determining the genetic merit of a bovine with respect to milk or tissue colour or β-carotene content or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, which comprises determining the SC ARBI allelic profile of the bovine, and determining the genetic merit of the bovine on the basis of the SCARB1 allelic profile. [0011] In one embodiment, milk β-carotene content is milk fat β-carotene content.

[0012] In another embodiment, milk content is milk colour, more preferably milk fat colour.

[0013] In still further embodiments, the tissue is selected from liver or adipose tissue.

[0014] In one embodiment, the genetic merit with respect to milk or tissue colour or βcarotene content is production of milk or tissue with increased colour or β-carotene content. [0015] Accordingly, in various embodiments the invention provides a method for identifying or selecting a bovine that produces milk, tissue, milk fat, or tissue fat with increased β-carotene content, or that is capable of producing progeny that produce milk, tissue, milk fat, or tissue fat with increased β-carotene content, comprising determining the expression or activity of the SC ARBI gene product, and identifying or selecting the bovine on the basis of the determination.

[0016] In another embodiment, the genetic merit with respect to milk or tissue colour or β-carotene content is production of milk or tissue with decreased colour or β-carotene content. Accordingly, in various embodiments the invention provides a method for identifying or selecting a bovine that produces milk, tissue, milk fat, or tissue fat with decreased β-carotene content, or capable of producing progeny that produce milk, tissue, milk fat, or tissue fat with decreased β-carotene content, comprising determining the expression or activity of the SCARB1 gene product, and identifying or selecting the bovine on the basis of the determination.

[0017] In one embodiment, the method comprises determining the expression or activity of a SCARB1 gene or gene product, and preferably identifying or selecting the bovine on the basis of the determination.

[0018] In one embodiment, expression or activity of the SCARB1 gene product is determined using SCARB1 mRNA, for example by determining the presence or amount of SC ARBI mRNA. In other embodiments, expression or activity of the SC ARBI gene product is determined using SCARB1 protein, preferably by determining the amount of SC ARBI protein, for example the amount of SC ARBI protein, or by determining the activity of SC ARBI protein, for example the enzymatic activity of SC ARBI protein present in a sample obtained from the bovine. It will be apparent that the activity of SC ARBI protein (such as that present in a sample obtained from the bovine) may be determined by determining the localisation of SC ARBI or of SC ARBI ligand, for example by determining the ratio of intracellular SC ARBI to extracellular SCARB1, or by determining the the ratio of intracellular SC ARBI ligand to extracellular SC ARBI ligand, or by determining the transport or uptake of SC ARBI or of SC ARBI ligand across, out of, or into a cell or membrane. In still other embodiments, the expression or activity of the SCARB1 gene product is determined using SC ARBI DNA, preferably by determining the presence or absence of one or more polymorphisms associated with decreased or increased SC ARBI expression or activity, for example one or more promoter polymorphisms associated with increased or decreased expression, or one or more coding sequence polymorphisms associated with increased or decreased expression or activity.

[0019] In another embodiment, the SCARB1 allelic profile of the bovine is determined together with the allelic profile of the bovine at one or more genetic loci associated with milk or tissue colour or β-carotene content.

[0020] In one embodiment, the one or more genetic loci is one or more polymorphisms in one or more genes associated with milk or tissue colour or β-carotene content.

[0021] The one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with said one or more polymorphisms.

[0022] Linkage disequilibrium (LD) is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present infers the presence of the other. (Reich DE et al; Linkage disequilibrium in the human genome, Nature 2001, 41 l.T 99-204.) [0023] It will be apparent that as used herein, the phrase “SCARB1 allelic profile” contemplates data indicative of the presence or absence of one or more alleles at one or more polymorphisms in the SCARB1 gene or which affect expression from the SC ARBI gene or the expression or activity of a SCARB1 gene product or which are associated with variation I F 86 ΕοβΟΖίβ in the expression from the SC ARBI gene or in the expression or activity of a SC ARBI gene product. In preferred embodiments, the SC ARBI allelic profile comprises data indicative of the presence or absence of one or more alleles at one or more polymorphisms associated with increased or decreased milk or tissue colour or β-carotene content. For example, in preferred embodiments the SC ARBI allelic profile comprises data indicative of the presence or absence of the C allele, or of the presence or absence of the G allele, at the C-321G promoter polymorphism in the SCARB1 gene. In other embodiments, the SCARB1 allelic profile comprises data indicative of the presence or absence of one or more alleles at one or more polymorphisms in the promoter of the SCARB1 gene, or in a regulatory region of the SCARB1 gene, or in an intron of the SCARB1 gene, or in a coding region of the SCARB1 gene, and preferably comprises data indicative of the presence or absence of one or more alleles which affect expression from the SC ARBI gene or the expression or activity of a SCARB1 gene product or which are associated with variation in the expression from the SC ARBI gene or in the expression or activity of a SC ARBI gene product.

[0024] It will further be appreciated that the SC ARBI allelic profile may comprise information correlating the presence or absence of one or more polymorphisms as described above with milk or tissue colour or β-carotene content.

[0025] In one embodiment, the allelic profile is determined using nucleic acid obtained from said bovine, preferably DNA obtained from said bovine, or alternatively, said allelic profile is determined using RNA obtained from said bovine.

[0026] In yet a further embodiment, the allelic profile is determined with reference to the amino acid sequence of expressed SC ARBI protein obtained from said bovine. [0027J In another embodiment, the allelic profile is determined with reference to the amount or activity of SCARB1 protein obtained from said bovine.

[0028] Conveniently, in said method the presence or absence of DNA encoding a reference SC ARBI gene product, or of nucleotide sequence comprising a reference SC ARBI gene, in said bovine is determined, directly or indirectly, for example using an expressed SCARB1 gene product.

[0029] Alternatively, in said method the presence or absence of at least one nucleotide difference from the nucleotide sequence of a reference SC ARBI gene, for example, at least one nucleotide difference from the nucleotide sequence encoding reference SCARB1, in said bovine is determined, directly or indirectly. ΙΒΟ 8 07** [0030] In one embodiment, the method comprises determining the SCARBI C-321G promoter allelic profile of the bovine.

[0031] More specifically, in said method the presence or absence of one or more of the C allele or G allele at the C-321G promoter polymorphism in the SCARBI gene is determined, directly or indirectly. For example, the presence of the C allele or of the G allele at the C321G promoter polymorphism in the SCARBI gene may be determined using a polymorphism in linkage disequilibrium with the C allele or with the G allele at the C-321G promoter polymorphism.

[0032] In one embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, whether a sequence of the DNA encoding a protein “(A)” having biological activity of reference SCARBI is present, or whether a sequence of the DNA encoding an allelic protein “(B)” at least partially lacking the activity of (A) is present, or whether a sequence of the DNA encoding (A) and a sequence of the DNA encoding (B) are both present.

[0033] As used herein, biological activity of reference SCARBI protein refers to both expression levels and activity characteristic of SCARBI protein expressed from the reference SCARBI gene.

[0034] In another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, whether a reference SCARBI gene sequence is present. In still another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, the expression of the SCARBI gene product, preferably by determining the presence or absence of one or more polymorphisms associated with decreased or increased SCARBI expression, for example one or more promoter polymorphisms associated with increased or decreased expression.

[0035] In one embodiment, this method includes ascertaining whether a sequence of the mRNA encoding a protein “(A)” having biological activity of a reference SCARBI is present, or whether a sequence of the mRNA encoding a protein “(B)” at least partially lacking the activity of (A) is present, or whether a sequence of the mRNA encoding (A) and a sequence of the mRNA encoding (B) are both present.

[0036] In another embodiment, the method includes ascertaining the amount of SCARBI mRNA present in a sample of material containing mRNA obtained from the bovine. /86 116 6 07 It [0037] In another embodiment, the method includes ascertaining whether a protein “(A)” having biological activity of a reference SC ARBI is present, or whether a protein “(B)” at least partially lacking the activity of (A) is present, or whether (A) and (B) are both present. 10038] In another embodiment, the method includes ascertaining the amount or activity of SCARB1 protein present in a sample of material containing protein obtained from the bovine. 10039] In another aspect, the invention is a method for determining the SC ARBI genotype of a bovine, as may be desirable to know for breeding purposes.

[0040] In one embodiment, the method includes ascertaining, with reference to a sample of material containing nucleic acid obtained from the bovine and uncontaminated by heterologous nucleic acid, whether the sample contains (i) nucleic acid molecule encoding a protein having biological activity of reference SCARB1 and optionally ascertaining whether the sample contains an (ii) allelic nucleic acid molecule encoding a protein lacking biological activity of reference SCARB1.

[0041] In another embodiment, the method includes ascertaining, with reference to a sample of material containing protein obtained from the bovine and uncontaminated by heterologous protein, whether the sample contains (i) a protein having biological activity of reference SCARB1 and optionally ascertaining whether the sample contains a protein lacking biological activity of reference SCARB1. 10042] In a further embodiment, the invention provides a method of determining genetic merit of a bovine with respect to milk or tissue β-carotene content which comprises determining the SC ARBI allelic profile of the bovine, together with determining the allelic profile of the bovine at one or more genetic loci associated with milk or tissue β-carotene content.

[0043] In one embodiment, the one or more genetic loci is one or more polymorphisms in one or more genes associated with milk or tissue β-carotene content, preferably one or more polymorphisms in one or more genes involved in β-carotene uptake or metabolism.

[0044] In a further aspect, the invention includes a probe comprising a nucleic acid molecule sufficiently complementary with a nucleic acid sequence comprising a bovine SCARB1 gene or encoding a bovine SC ARBI gene product, or its complement, so as to bind thereto under stringent conditions, as well as a diagnostic kit containing such a probe.

[0045] The invention also includes a primer composition useful for detection of the presence or absence of a reference SC ARBI gene and/or the presence or absence of nucleic Τ’ ? Η Ιΐοβοηί acid encoding reference SCARB1. In one form, the composition can include a nucleic acid primer substantially complementary to a nucleic acid sequence comprising a reference SC ARBI gene or encoding reference SCARB1, or its complement. The nucleic acid sequence can in whole or in part be identified in SEQ ID No.l or SEQ ID No.3. The invention also includes a primer composition useful for detection of the presence or absence of a variant SCARB1 gene and/or the presence of the DNA encoding a variant SC ARBI protein at least partially lacking reference SCARB1 activity. In one form, the composition can include a nucleic acid primer substantially complementary to a nucleic acid sequence comprising a variant SCARB1 gene or encoding a variant SC ARBI protein, or its complement. The nucleic acid sequence can in whole or in part be identified in SEQ ID NO: 1 οι SEQ ID NO:3. Diagnostic kits including such a composition are also included.

[0046] Particularly contemplated are primers comprising or substantially complementary to a nucleic acid sequence present in SEQ ID NO;1 and within approximately 1 to about 2000 bp of the C-321G promoter polymorphism, more preferably within approximately 1 to about 1000 bp, or within approximately 1 to about 500 bp, approximately 1 to about 400 bp, approximately 1 to about 300 bp, approximately 1 to about 200 bp, approximately 1 to about i00 bp, approximately 1 to about 50 bp, or approximately 1 to about 20 bp of the C-321G promoter polymorphism.

[0047] It will be appreciated by those skilled in the art that a pair of such primers can be used to determine the identity of the nucleotide at the C-321G promoter polymorphism, by, for example the selective generation of an amplicon with one or more sequence-specific primers. Primer compositions comprising a pair of such primers are accordingly contemplated.

[0048] The invention also provides a diagnostic kit including a primer composition useful for determining the presence or absence of a reference SC ARBI gene and/or the presence or absence of nucleic acid encoding reference SCARB1, the diagnostic kit comprising one or more primers or primer compositions as described herein. [0049J The invention further includes an antibody composition useful for determining the presence or absence of reference SC ARBI protein, or for determining the presence or absence of a variant protein at least partially lacking reference SCARB1 activity, or for determining the expression of SCARB1 protein, as well as a diagnostic kit containing such an antibody together with instructions for use, for example in a method of the invention.

L « o 110 6 07»!

[0050] The invention further provides a diagnostic kit useful in detecting DNA comprising a variant SCARBI gene, or DNA or mRNA encoding a variant SCARBI gene at least partially lacking reference activity, in a bovine which includes first and second primers for amplifying the DNA or mRNA, the primers being complementary to nucleotide sequences of the DNA upstream and downstream, respectively, of a polymorphism in the SCARBI gene which results in or is associated with increased or decreased milk or tissue colour or βcarotene content.

[0051] In one embodiment at least one of the nucleotide sequences is selected to be from a non-coding region of the reference SCARBI gene.

[0052] The kit can also include a primer complementary to a naturally occurring mutation of a coding or non-coding portion of the reference SCARBI gene, for example a mutation in the promoter of the SCARBI gene. Preferably the kit includes instructions for use, for example in accordance with a method of the invention.

[0053] Thus, in another embodiment the invention provides a method of assessing the genetic merit of a bovine with respect to milk or tissue β-carotene content which comprises the step of determining the presence or absence of one or more polymorphisms selected from the group comprising: the C-321G promoter polymorphism in the SCARBI gene, or one or more polymorphisms in linkage disequilibrium with the C-321G promoter polymorphism in the SCARBI gene.

[0054] In another embodiment the invention provides a method of assessing the genetic merit of a bovine with respect to milk or tissue colour or β-carotene content which comprises the step of determining the presence or absence of one or more polymorphisms selected from the group comprising: the C allele at the C-321G promoter polymorphism, or the G allele at the C-321G promoter polymorphism.

[0055] Again, the one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with the one or more polymorphisms. (0056] Thus, in another embodiment the invention provides a method of assessing the genetic merit of a bovine with respect to milk or tissue β-carotene content which comprises the step of determining the presence or absence of the G allele at the C-321G promoter polymorphism in the SCARBI gene. The invention further provides a method of assessing 110 8 07$$ the genetic merit of a bovine with respect to milk or tissue β-carotene content which comprises the step of determining the presence or absence of the C allele at the C-321G promoter polymorphism in the SCARB1 gene.

[0057] In another aspect, the present invention provides a method for selecting a bovine with a genotype indicative of desired milk colour or of desired milk β-carotene content or of desired tissue colour or of desired tissue β-carotene content. The method comprises determining the bovine SCARB1 allelic profile of said bovine, and selecting the bovine on the basis of the determination. 10058] In one embodiment, the invention provides a method for identifying or selecting a bovine with increased milk colour or increased milk β-carotene content, preferably increased milk fat colour or increased milk fat β-carotene content.

[0059] In another embodiment, the invention provides a method for identifying or selecting a bovine with increased tissue colour or increased tissue β-carotene content, preferably increased tissue fat colour or increased tissue fat β-carotene content.

[0060] In one embodiment, the invention provides a method for identifying or selecting a bovine with a SC ARBI allelic profile indicative of increased milk colour or increased milk βcarotene content, preferably of increased milk fat colour or increased milk fat β-carotene content.

[0061] In another embodiment, the invention provides a method for identifying or selecting a bovine with a SC ARBI allelic profile indicative of increased tissue colour or increased tissue β-carotene content.

[0062] Preferably the method comprises determining the presence of the C allele at the C-321G promoter polymorphism in the SCARB1 gene, and selecting the bovine on the basis of the determination. Alternatively or additionally, the method comprises determining the absence of the G allele at the C-321G promoter polymorphism in the SCARB1 gene, and selecting the bovine on the basis of the determination.

[0063] Preferably, the method comprises determining the presence of the CC genotype at the C-321G promoter polymorphism in the SC ARBI gene, and selecting the bovine on the basis of the determination.

[0064] In another embodiment, the invention provides a method for identifying or selecting a bovine with decreased milk colour or decreased milk β-carotene content, preferably decreased milk fat colour or decreased milk fat β-carotene content. Τ η ΙΙ0807Η [0065] In another embodiment, the invention provides a method for identifying or selecting a bovine with decreased tissue colour or decreased tissue β-carotene content, preferably decreased tissue fat colour or decreased tissue fat β-carotene content. (0066] In a further embodiment the invention provides a method for selecting a bovine with a SC ARBI allelic profile indicative of decreased milk colour or decreased milk βcarotene content, preferably of decreased milk fat colour or decreased milk fat β-carotene content.

[0067] In another embodiment, the invention provides a method for selecting a bovine with a SC ARBI allelic profile indicative of decreased tissue colour or decreased tissue βcarotene content.

[0068] Preferably the method comprises determining the absence of the C allele at the C321G promoter polymorphism in the SC ARBI gene, and selecting the bovine on the basis of the determination. Alternatively or additionally, the method comprises determining the presence of the G allele at the C-321G promoter polymorphism in the SC ARBI gene, and selecting the bovine on the basis of the determination.

[0069] Preferably, the method comprises determining the presence of the GG genotype at the C-321G promoter polymorphism in the SCARB1 gene, and selecting the bovine on the basis of the determination.

[0070] In one embodiment, the invention provides a method for identifying or selecting a bovine with intermediate milk colour or intermediate milk β-carotene content, preferably intermediate milk fat colour or intermediate milk fat β-carotene content.

[0071] In another embodiment, the invention provides a method for identifying or selecting a bovine with intermediate tissue colour or intermediate tissue β-carotene content, preferably intermediate tissue fat colour or intermediate tissue fat β-carotene content.

[0072] In a further embodiment the invention provides a method for selecting a bovine with a SC ARBI allelic profile indicative of intermediate milk colour or intermediate milk βcarotene content, preferably of intermediate milk fat colour or intermediate milk fat βcarotene content.

[0073] In another embodiment, the invention provides a method for selecting a bovine with a SCARB1 allelic profile indicative of intermediate tissue colour or intermediate tissue β-carotene content. ||0 8 [0074] Preferably, the method comprises determining the presence of the CG genotype at the C-321G promoter polymorphism in the SCARB1 gene, and selecting the bovine on the basis of the determination. [0075[ In one embodiment, the presence of the C allele or of the G allele is determined with respect to a SCARB1 polynucleotide (genomic DNA, mRNA or cDNA produced from mRNA) obtained from the bovine.

[0076] In one embodiment, the presence of the C allele or of the G allele is determined by sequencing a SC ARBI polynucleotide obtained from the bovine, [0077] In a further embodiment the determination comprises the step of amplifying a SCARB1 polynucleotide sequence from genomic DNA, mRNA or cDNA produced from mRNA derived from said bovine, for example by PCR.

[0078] Preferably the determination is by use of primers which comprise a nucleotide sequence having at least about 12 contiguous bases of or complementary to the sequence of SEQ ID NO:1 or SEQ ID NO:3 or a naturally occurring flanking sequence.

[0079] In one embodiment at least one of the primers comprises sequence corresponding to at least one of the allele-specific nucleotides described herein.

[0080] In an alternative embodiment, the method comprises restriction enzyme digestion of a nucleotide derived from the bovine. Such digestion may also be performed on a product of the PCR amplification described above.

[0081] In a further embodiment, the presence of the C allele or of the G allele is determined by mass spectrometric analysis of a SC ARBI polynucleotide, such as that obtained from the bovine or from a method as described herein.

[0082] In an alternative embodiment, the presence of the C allele or of the G allele is determined by hybridisation of a probe or probes comprising a nucleotide sequence of or complementary to the sequence of SEQ ID NO: 1 or SEQ ID NO:3.

[0083] Preferably the probe or probes comprises 12 or more contiguous nucleotides of or complementary to the sequence of SEQ ID NO: 1 or SEQ ID NO:3.

[0084] Preferably the probe or probes comprise sequence corresponding to the C allelespecific or the G allele-specific nucleotides described herein or complements thereof.

[0085] In an alternative embodiment, the presence of the C allele or of the G allele is determined by analysis of a SC ARBI polypeptide obtained from the bovine.

[0086] In a further aspect the invention provides a bovine selected by a process of the invention; milk produced by the selected bovine or the progeny thereof as well as dairy liο β one products produced from such milk; and ova or semen produced by or tissue from the selected □ovine. 10087] In still a further aspect the invention provides a method of selecting a herd of bovine, comprising selecting individuals by a method of the present invention, and segregating and collecting the selected individuals to form the herd. The invention further provides a herd of bovine so selected, as well as a herd comprising bovine produced by bovine selected by the methods described herein.

[0088] In a still further aspect, the invention provides a method of determining genetic merit of a bovine with respect to one or more milk or tissue colour or β-carotene content traits, or with respect to capability of producing progeny predisposed to or with one or more milk or tissue colour or β-carotene content traits, the method comprising providing data about the SC ARBI allelic profile of said bovine, and determining the genetic merit of the bovine on the basis of the data. [(1089] Preferably, the data about the SCARB1 allelic profile comprises data representative of the presence or absence of the C allele or the G allele at the C-321G promoter polymorphism in the SC ARBI gene.

[0090] Preferably, the method additionally comprises providing data comprising the result of at least one analysis of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits, wherein the data is representative of the genetic merit of the bovine.

[0091] Preferably, the one or more genetic loci are one or more polymorphisms associated with an increase or decrease in expression or activity of a SC ARBI gene product. [0092] Preferably the genetic loci is the SCARB1 gene (including all regulatory elements such as the promoter, introns and 3’UTR).

[0093] In one embodiment, the one or more milk or tissue colour or β-carotene content traits is selected from the group comprising production of or capability of producing milk with increased milk colour, production of or capability of producing milk with increased milk β-carotene content, increased tissue colour, or increased tissue β-carotene content.

[0094] In another embodiment, the one or more milk or tissue colour or β-carotene content traits is selected from the group comprising production of or capability of producing milk with decreased milk colour, production of or capability of producing milk with decreased milk β-carotene content, decreased tissue colour, or decreased tissue β-carotene content.

B «080719 [0095] Accordingly, in one embodiment the invention provides a method of determining genetic merit of a bovine with respect to milk or tissue colour or β-carotene content, or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, the method comprising providing data about the SC ARBI allelic profile of the bovine, and determining the genetic merit of the bovine on the basis of the data.

[0096] Preferably, the data about the SCARB1 allelic profile comprises data representative of the presence or absence of the C allele or the G allele at the C-321G promoter polymorphism in the SC ARBI gene.

[0097] Preferably, the method additionally comprises providing data comprising the result of at least one analysis of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits, wherein the data is representative of the genetic merit of the bovine.

[0098] Preferably, the one or more genetic loci are one or more polymorphisms associated with an increase or decrease in expression or activity of a SCARB1 gene product. [0099] Preferably the genetic loci is the SCARB 1 gene (including all regulatory elements such as the promoter, introns and 3’UTR).

[00100] In a further aspect the invention provides a method for identifying or selecting a bovine with respect to one or more milk or tissue colour or β-carotene content traits, the method comprising providing the result of one or more genetic tests of a sample from the bovine, and analysing the result for the presence or absence of one or more polymorphisms associated with increased or decreased expression or activity of SCARB 1 gene product, or one or more polymorphisms in linkage disequilibrium with one or more polymorphisms associated with increased or decreased expression or activity of SCARB 1 gene product, wherein a result indicative of the presence or absence of one or more of said polymorphisms is indicative of a bovine with one or more desired milk or tissue colour or βcarotene content traits; and identifying or selecting the bovine on the basis of the result.

[00101] Preferably, the one or more polymorphisms associated with increased or decreased expression or activity of SCARB 1 gene product is one or more polymorphisms in the SCARB 1 gene. 6 1E0807H [00102] In a further aspect the invention provides a method for selecting a bovine with one or more desired milk or tissue colour or β-carotene content traits, the method comprising a) providing the result of one or more genetic tests of a sample from the bovine, and b) analysing the result for the presence or absence of one or more polymorphisms selected from the group comprising: the C-321G promoter polymorphism in the SCARBI gene, or one or more polymorphisms in linkage disequilibrium with the C-321G promoter polymorphism in the SCARBI gene, wherein a result indicative of the presence or absence of one or more of said polymorphisms is indicative of a bovine with one or more desired milk or tissue colour or β-carotene content traits.

[00103] In other aspects, the invention provides a system for performing one or more of the methods of the invention, said system comprising: computer processor means for receiving, processing and communicating data: storage means for storing data including a reference genetic database of the results of genetic analysis of a bovine with respect to one or more milk or tissue colour or β-carotene content traits and optionally a reference milk or tissue colour or β-carotene content trait database of non-genetic factors for one or more bovine milk or tissue colour or β-carotene content traits; and a computer program embedded within the computer processor which, once data consisting of or including the result of a genetic analysis for which data is included in the reference genetic database is received, processes said data in the context of said reference databases to determine, as an outcome, the genetic merit of the bovine, said outcome being communicable once known, preferably to a user having input said data.

[00104] Preferably, said system is accessible via the internet or by personal computer. [00105] Preferably, said reference genetic database comprises or includes the results of one or more analyses of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits, more preferably the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or tissue colour or β-carotene content traits.

[00106] In yet a further aspect, the invention provides a computer program suitable for use in a system as defined above comprising a computer usable medium having program code embodied in the medium for causing the computer program to process received data ! ο »0 8 0711 consisting of or including the result of at least one genetic analysis of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits in the context of both a reference genetic database of the results of said at least one genetic analysis and optionally a reference database of non-genetic factors associated with one or more bovine milk or tissue colour or β-carotene content traits.

[00107] Preferably, the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or tissue colour or β-carotene content traits. [00108] Preferably the gene is the SCARB1 gene (including all regulatory elements such as the promoter, introns and 3’UTR). 100109] Preferably, the one or more polymorphisms are one or more polymorphisms associated with an increase or decrease in expression or activity of a SC ARBI gene product. [00110] In still another aspect, the invention provides a method of determining genetic merit of a bovine with respect to milk or tissue colour or β-carotene content, or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, the method comprising determining milk or tissue colour or β-carotene content of the bovine, determining the SCARB1 allelic profile of the bovine, comparing the SC ARBI allelic profile of the bovine or the milk or tissue colour or βcarotene content of the bovine with that of a bovine having a known SC ARBI allelic profile; determining the genetic merit of the bovine on the basis of the comparison.

[00111] It will be appreciated that for the purposes of the comparison, the milk or tissue colour or β-carotene content associated with the known SC ARBI allelic profile is known. It will further be appreciated that the association of milk or tissue colour or β-carotene content with a particular SCARB1 allelic profile may be established by the methods described herein. [00112] In another aspect, the invention relates to an isolated, purified or recombinant nucleic acid molecule comprising nucleotide sequence selected from the group comprising: (a) at least 12 contiguous nucleotides of SEQ ID NO:1 and comprising the C-321G promoter polymorphism; or (b) any one or more of SEQ ID NOs:5 - 44; or (c) a complement of (a) or (b); or (d) a sequence of at least 12 contiguous nucleotides and capable of hybridising to the nucleotide sequence of any one of (a) to (c) under stringent conditions. ί-? 8 0 7 g 1Ε0807Η [00113] In one embodiment, the SCARB1 nucleic acid molecule is a SC ARBI fragment as defined herein, wherein the SCARB1 fragment comprises the C-321G promoter polymorphism.

[00114] The invention also provides a genetic construct comprising a SC ARBI nucleic acid molecule of the invention, a vector comprising the genetic construct or a nucleic acid sequence as described above, a host cell comprising the genetic construct or vector, a polypeptide encoded by a SCARB1 nucleic acid molecule of the invention, an antibody which selectively binds a polypeptide of the invention, and a method for recombinantly producing a polypeptide of the invention.

[00115] The term “comprising” as used in this specification means “consisting at least in part of’. When interpreting each statement in this specification that includes the term “comprising”, features other than that or those prefaced by the term may also be present. Related terms such as “comprise” and “comprises” are to be interpreted in the same manner. [00116] In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows a graph showing the range and seasonal effect of β-carotene concentration determined as described in the Example. Data for peak (35 days post calving), mid (late November) and late (late February) lactation is shown.

Figure 2 shows a graph depicting a QTL for milk fat colour on bovine chromosome 17. The maximum F-value of 10.6 occurred at 71 centimorgans (cM). The approximate map location of the SC ARBI gene was between two microsatellite markers BMS1879 at 50.7 cM and BM1862 at 67.5 cM.

Figure 3 is a schematic showing a graphical representation of the C-321G promoter polymorphism in bovine SCARB1. A: Graphical representation of the predicted gene structure of bovine SCARB1 where vertical bars represent exons, as well as 5’ UTR and 3’ UTR. B. Identification of the C/G polymorphism at position -321 relative to the +1 translation start site 1Etet7H (promoter). The polymorphism (highlighted) was heterozygous in five FI sires, and one sire was homozygous for the G allele.

Figure 4 is a graph showing the effect of SCARB1 genotype on milk fat colour. Data shown are means ± s.e.m. Data shown are for peak lactation but are representative of the additional two time points that were measured. The main effect of SCARB1 genotype was significant at P < 0.01.

Figure 3 is a graph showing the adjusted statistical effect of SCARE 1 genotype on the bovine chromosome 17 milk fat colour QTL. Solid line: milk fat colour QTL (residual of modeled data excluding SC ARBI genotype). Dotted line: milk fat colour QTL after SC ARBI genotype included in statistical model (residual of modeled data including SCARB1 genotype as a fixed effect). The decrease in QTL significance (F-value) suggests a significant association of the SCARB1 genotype with the milk fat colour QTL variation.

Figure 6 is a graph showing the β-carotene content of bovine adipose tissue. The main effect of the SCARB1 genotype was significant at p < 0.01. Data shown are means ± s.e.m. Significance between specific genotype groups is indicated by asterix (** P < 0.01). For the CC, CG and GG genotype groups there were n=5, n=12 and n=7 animals, respectively.

Figure 7 is a graph showing the effect SC ARBI genotype on liver SC ARBI mRNA levels as measured by quantitative real time PCR. Data shown are the fold change means relative to a reference sample ± s.e.m. Significance between genotype groups is indicated by asterix (** P < 0.01). For the CC, CG and GG genotype groups there were n=7, n=13 and n=8 animals, respectively.

DETAILED DESCRIPTION OF THE INVENTION [00117] The present invention recognises for the first time that a polymorphism in the SC ARBI gene in bovine is associated with a QTL for variations in milk colour and milk βcarotene content, and for variations in tissue colour and tissue β-carotene content.

[00118] For the sake of clarity, the phrase “milk or tissue colour or β-carotene content” is to be read as referring to milk colour or milk β-carotene content or tissue colour or tissue βcarotene content. Grammatical equivalents or components thereof are to be read likewise, such that the phrase “milk or tissue colour” is to be read as “milk colour or tissue colour”. [00119] It will be apparent to those skilled in the art that milk or tissue colour can readily be determined qualitatively or quantitatively. For example, a visual comparison may in many «080788 cases be sufficient to qualitatively determine a sample of milk or tissue having increased colour, or decreased colour, relative to another sample. Methods for quantitative determination of milk or tissue colour or β-carotene content are also known in the art, and examples are provided herein.

[00120] The invention provides methods of assessing the genetic merit of a bovine with respect to milk β-carotene content, more particularly milk fat β-carotene content. One such method comprises the step of determining the SCARB 1 allelic profile of said bovine. Another such method comprises the step of determining the level of the SCARB 1 gene product of said bovine.

[00121] The invention also provides a method for selecting a bovine with a genotype indicative of desired milk β-carotene content, particularly desired milk fat β-carotene content. One of the major applications of the present invention is in the selection of bovine having the C allele or the G allele of the C-321G promoter polymorphism in the SCARB 1 gene, which are associated with increased milk fat β-carotene content and milk fat colour, and decreased milk fat β-carotene content and milk fat colour, respectively. Accordingly, one method comprises determining the presence or absence of the C allele or of the G allele at the C-321G promoter polymorphism of the SCARB 1 gene, and selecting the bovine on the basis of the determination.

[00122] Additionally, the invention is directed towards the selected bovine and semen from the selected bovine which may be useful in further breeding programs. Bovine so selected will be useful for milk production. The invention is also directed towards milk produced by the selected bovine or the progeny thereof, as well as dairy products produced from such milk.

[00123] The production of a wide variety of dairy products is well known in the art, and dairy products contemplated herein include ice creams, yoghurts and cheeses, dairy based drinks (such as milk drinks including milk shakes, and yogurt drinks), milk powders, dairy based sports supplements, food additives such as protein sprinkles and dietary supplement products including daily supplement tablets.

[00124] Similarly, the production of a wide range of tissue products, such as but not limited to meat, organs, pelts, fluids and the like, is well known in the art. Particularly contemplated herein are meat, organs, blood and serum having increased or decreased colour or β-carotene content. ΪΙθ8θ?ί8 !ΕθβΟ76β 0125] The present invention recognises that polymorphisms in the gene encoding SCARBI, as well as SCARBI levels or activity, may be used as a selection tool to breed animals with higher or lower milk concentrations of β-carotene (and thus milk fat colour). This in turn may allow the production of milk products more suitable to markets favouring white milk and milk products, or the production of milk products more suitable to markets favouring yellow milk and milk products, or the production of milk and milk products, such as foods, high in β-carotene.

SCARBI [00126] SCARBI is believed to be involved in the uptake of carotenoids into cells. A Drosophila knockout model is reported to be blind, with no carotenoids present, and vitamin A deficient (Kiefer C., et al., 2002).

[00127] The present invention relates to the identification that a polymorphism in the SCARBI gene leads to variation in milk or tissue colour or β-carotene content, particularly variation in milk fat colour and milk fat β-carotene content, and tissue fat colour and tissue fat β-carotene content.

[00128] The genomic sequence comprising the bovine SCARBI gene is presented herein as SEQ ID NO:1. The predicted exon structure is shown in SEQ ID NO:1, and the derived amino acid sequence is presented herein as SEQ ID NO:2. The predicted coding sequence of bovine SCARBI is presented as SEQ ID NO:3, and a provisional sequence is available as NCBI accession number NM_174597.2 (GI:31341575). This coding sequence is derived from a cDNA clone, the sequence of which is available as NCBI accession number AF019384 (01:2429347). The amino acid sequence encoded by the reference coding sequence of SEQ ID NO:3 is presented herein as SEQ ID NO:4, and is itself available as NCBI accession number NP_777022.1 (GI:27807079).

[00129] As described herein, the SCARBI C-321G polymorphism was closely associated with milk colour phenotype. Animals homozygous for the C allele (CC genotype) produced milk with more β-carotene than heterozygous animals (CG genotype), who in turn produce milk with more β-carotene than animals homozygous for the G allele (GG genotype). This effect was observed at three stages of lactation, [00130] The CC genotype for SCARBI was present in 23.52% of animals in the HolsteinFriesian x Jersey crossbred trial, while the CG genotype was present in 48.85% of animals, and the remaining 27.64% of animals were of GG genotype. ΙΕΟ 8 07·· i(i ’ ' ?96 [00131] A reference bovine SCARB1 nucleotide sequence is presented as SEQ ID NO.T, and the compiled reference coding sequence is presented as SEQ ID NO:3, with the corresponding amino acid sequences presented as SEQ ID NO:2, and SEQ ID NO:4, respectively. Accordingly, as used herein with respect to SCARB1, such as use with respect to a SCARB1 gene or a SCARB1 gene product, the term “reference” recognizes the characteristics of the SCARB1 nucleotide sequences presented as SEQ ID NOs:l and 3, and of the protein product encoded thereby. For example, when used with respect to activity, the term “reference” denotes activity associated with the reference SCARB1 protein. Similarly, when used with respect to expression amount, the term “reference” denotes a level of expression associated with the reference SC ARBI gene or promoter.

[00132] It will be apparent that the term”activity” may refer both to the inherent activity of a single molecule of SCARB1, which may be reference activity or may be less or greater than reference activity as may depend, for example on the amino acid sequence, the presence of any amino acid substitutions, the availability of co-factors, and the like, as well as to the total activity of the population of SC ARBI molecules present (for example, in a bovine or in a sample taken from a bovine), as may depend on both the activity of each molecule present and the level of expression (for example, how many such molecules are present).

[00133] As used herein, such as when used in reference to an allelic protein lacking the activity of reference SCARB1, the phrase “lacking the activity of (A)” contemplates activity both greater than that of (A) and less than that of (A). For example, an allelic protein lacking the activity of reference SCARB1 may be a variant SCARB1 protein of greater or lesser activity than that of reference SCARB1.

[00134] Methods to assay the activity of SC ARBI are well known in the art. For example, one such method utilises quantification of SCARB1 mRNA, such as that described herein. Another exemplary method utilises an assay of the uptake of β-carotene as described in During and Harrison (2007).

[00135] The genetic polymorphism identified in the bovine SC ARBI gene is identified as a variant in SEQ ID NO:1 and 3, and is reported in Figure 3. The nucleic acid and proteins sequences of the SCARB1 G and C alleles at the C-321G promoter polymorphic site are shown in Figure 3B.

Identification and analysis of polymorphisms [00136] It will be apparent to those skilled in the field that the convention of identifying promoter polymorphisms by their position relative to the +1 translation start site of the gene W«^'?86 KO 8 0799 22 in which they occur is followed herein. Accordingly, the C-321G polymorphism in the 3CARB1 gene described herein lies 321 nucleotides upstream of the +1 translation start site of the SCARB1 gene.

[00137] The C-321G promoter polymorphism can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with the C-321G promoter polymorphism. Linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich DE et al; Linkage disequilibrium in the human genome, Nature 2001, 411:199-204.) [00138] Various degrees of linkage disequilibrium are possible. Preferably, the one or more polymorphisms in linkage disequilibrium with one or more of the polymorphisms specified herein are in greater than about 60% linkage disequilibrium, are in about 70% linkage disequilibrium, about 75%, about 80%, about 85%, about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% linkage disequilibrium with the C321G promoter polymorphism of the SCARB1 gene. (Devlin and Risch 1995; A comparison of linkage disequilibrium measures for fine-scale mapping, Genomics 29: 311-322).

[00139] There are numerous standard methods known in the art for determining whether a particular DNA sequence is present in a sample, many of which include the step of sequencing a DNA sample. Thus in one embodiment of the invention, the step determining whether or not the specified nucleotides are present in a nucleic acid derived from a bovine, includes the step of sequencing the nucleic acid. Methods for nucleotide sequencing are well known to those skilled in the art.

[00140] In one aspect, the present invention provides a method for determining the genetic merit of a bovine with respect to milk or tissue β-carotene content, and particularly with milk fat colour or β-carotene content. In one embodiment the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, whether a sequence of the DNA encoding “(A)” a protein having biological activity of reference SCARB1 is present, and whether a sequence of the DNA encoding “(B)” an allelic protein lacking the activity of (A) is present. In another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, whether the reference SCARB1 gene sequence is present. In still another embodiment, the method includes ascertaining, from a sample of material containing DNA obtained from the bovine, the expression of the SC ARBI »080788 g;ne product, preferably by determining the presence or absence of one or more polymorphisms associated with decreased or increased SCARB1 expression, for example one or more promoter polymorphisms associated with increased or decreased expression. 100141] An example of another art standard method known for determining whether a particular DNA sequence is present in a sample is the Polymerase Chain Reaction (PCR). One embodiment of the invention thus includes a step in which ascertaining whether a sequence of the DNA encoding (A) is present, or whether a sequence of the DNA encoding (B) is present, includes amplifying the DNA in the presence of primers based on a nucleotide sequence encoding a protein having biological activity of reference SCARB1, and/or in the presence of a primer containing at least a portion of a polymorphism known to naturally occur and which when present results in high relative β-carotene levels, and particularly in milk or tissue having inter alia a higher β-carotene content, and/or in the presence of a primer containing at least a portion of a polymorphism known to naturally occur and which when present results in low relative β-carotene levels, and particularly in milk or tissue having inter alia a lower β-carotene content.

[00142] A primer of the present invention, used in PCR for example, is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficient length to selectively hybridise to the corresponding protein of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR. Likewise, a probe of the present invention, is a molecule, for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid molecule of interest, which selectively binds under high or low stringency conditions with the nucleic acid sequence of interest for detection in the presence of nucleic acid molecules having differing sequences.

[00143] Accordingly, a preferred embodiment of the invention thus includes the step of amplifying a SC ARBI polynucleotide in the presence of at least one primer comprising a nucleotide sequence of, or complementary to, the SC ARBI gene (SEQ ID NO:1 and SEQ ID NO:3) or flanking sequence thereof, and/or in the presence of a such a primer comprising sequence corresponding to or flanking the C-321G C allele-specific or C-321G G allele30 specific nucleotides described herein. PCR methods are well known by those skilled in the art (Mullis et al., 1994.) The template for amplification may be selected from genomic DNA, mRNA or first strand cDNA derived from a sample obtained from the bovine under test (Sambrook et al., 1989). 6 1E09076S [00144] Primers suitable for use in PCR based methods of the invention should be sufficiently complementary to the SCARB1 gene sequence, such as SEQ ID NO:1 or SEQ ID NO:3 or flanking sequence thereof, and of sufficient length to selectively hybridise to the corresponding portion of a nucleic acid molecule intended to be amplified and to prime synthesis thereof under in vitro conditions commonly used in PCR. Such primers should comprise at least about 12 contiguous bases of or complementary to SEQ ID NO :1 or SEQ ID NO:3, or naturally occurring flanking sequences thereof. Examples of such PCR primers are presented herein as SEQ ID NOS :5-44.

[00145] Suitable PCR primers may include sequence corresponding to the C-321G C allele-specific or C-321G G allele-specific SCARB1 nucleotides described herein. Generation of a corresponding PCR product, or the lack of product, may constitute a test for the presence or absence of the specified nucleotides in the SC ARBI gene of the test bovine. [00146] Other methods for determining whether a particular nucleotide sequence is present in a sample may include the step of restriction enzyme digestion of nucleotide sample. Separation and visualisation of the digested restriction fragments by methods well known in the art, may form a diagnostic test for the presence of a particular nucleotide sequence. The nucleotide sequence digested may be a PCR product amplified as described above.

[00147] Still other methods for determining whether a particular nucleotide sequence is present in a sample include a step of hybridisation of a probe to a sample nucleotide sequence. Thus, methods for detecting the C-321G C allele-specific or C-321G G allele-specific nucleotides may comprise the additional steps of hybridisation of a probe derived from the SCARB1 sequence of SEQ ID NO:1 or SEQ ID NO:3.

[20148] Such probes should comprise a nucleic acid molecule of sufficient length and sufficiently complementary to the SCARB1 gene sequence, to selectively bind under high or low stringency conditions with the nucleic acid sequence of a sample to facilitate detection of the presence or absence of the allele-specific nucleotides described herein.

[00149] With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30° C (for example, 10° C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., 1989; Ausubel et al., 1987). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0.41% (G + C-log (Na+).

[00150] With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10° C below Tm. On average, the Tm of «080766 a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length)0 C.

[00151] Such a probe may be hybridised with genomic DNA, mRNA, or cDNA produced form mRNA, derived from a sample taken from a bovine under test.

[00152] Such probes would typically comprise at least 12 contiguous nucleotides of or complementary to the sequences presented SEQ ID NO:1 or SEQ ID NO:3, and may comprise sequence corresponding to the allele-specific nucleotides described herein.

[00153] Such probes may additionally comprise means for detecting the presence of the probe when hound to sample nucleotide sequence. Methods for labelling probes such as radiolabelling are well known in the art (see for example, Sambrook et al., 1989).

[00154] ,ίλ will be apparent to a person skilled in the art, promoter function may be determined by various well-known methods, for example use in reporter systems. For example, one approach of determining the allelic state of a promoter would be via a reporter construct, where the promoter of interest is fused upstream of a reporter gene (e.g. luciferase), and the activity of the reporter is determined and correlates with promoter function. [00155J Accordingly, in one embodiment the method for determining the genetic merit of a bovine with respect to milk or tissue colour or β-carotene content includes ascertaining, from a sample of material containing DNA obtained from the subject, whether a sequence of the DNA encoding the promoter of the SCARB 1 gene is associated with higher or lower relative levels of expression.

[00156] In another aspect, the invention provides a method for determining the genetic merit of bovine with respect to milk or tissue colour or β-carotene content with reference to a sample of material containing mRNA obtained from the bovine. In one embodiment this method includes ascertaining whether a sequence of the mRNA encoding (A) a protein having biological activity of a reference SCARB 1 is present, and whether a sequence of the mRNA encoding (B) a protein at least partially lacking the activity of (A) is present, and may include determining the amount of mRNA.

[00157] Again, if an amplification method such as PCR is used in ascertaining whether a sequence of the mRNA encoding (B) is present, and whether a sequence of the mRNA encoding (A) is present, the method includes amplifying the mRNA, for example in the presence of a pair of primers complementary to a nucleotide sequence encoding a protein having biological activity of a reference SCARB 1, or in the presence of a pair of primers complementary to a nucleotide sequence encoding a variant SCARB 1 protein. It will be Βθ607g6 appreciated that in embodiments of the invention reliant on assessing the amount of SCARBI mRNA present in a sample, quantitative amplification methods well known in the art may be employed, for example quantitative RT-PCR, microarray analysis, and other methods described herein.

[00158] Other methods to quantitate or otherwise assess the amount of nucleic acid, particularly the amount of mRNA are well known in the art. These include Northern analysis using probes able to hybridise to the target SCARBI mRNA. Such probes should comprise a nucleic acid molecule of sufficient length and sufficiently complementary to the SCARBI coding sequence to selectively bind under high or low stringency conditions with the nucleic acid sequence of a sample to facilitate detection and assessment of the amount of SCARBI mRNA present. As is evident to the person skilled in the art, such quantitative methods generally utilise an internal control, for example in the case of Northern analysis quantitation may be done with reference to, for example, rRNA present in the sample.

[00159] In a further aspect, the invention provides a method of determining genetic merit of a bovine with respect to milk or tissue β-carotene content which comprises determining the SCARBI allelic profile of said bovine, together with determining the allelic profile of said bovine at one or more genetic loci associated with milk or tissue β-carotene content.

[00160] In one embodiment, said genetic loci is a polymorphism in a gene associated with milk or tissue β-carotene content, preferably a polymorphism in a gene involved in β-carotene uptake or metabolism. [00161 ] The methods of the invention are reliant on genetic information such as that derived from methods suitable to the detection and identification of polymorphisms, particularly single nucleotide polymorphisms (SNPs) associated with the qualitative trait for which an assessment is desired. For the sake of convenience the following discussion refers particularly to SNPs, yet the art-skilled worker will appreciate that the methods discussed are amenable to the detection and identification of other genetic polymorphisms, such as triplet repeats or microsatellites.

[00162] A SNP is a single base change or point mutation resulting in genetic variation between individuals. SNPs are believed to occur in mammalian genomes approximately once every 100 to 300 bases, and can occur in coding or non-coding regions. Due to the redundancy of the genetic code, a SNP in the coding region may or may not change the amino acid sequence of a protein product. A SNP in a non-coding region can, for example, alter gene expression by, for example, modifying control regions such as promoters, transcription factor £ ' Κ 9^97|f /tiding sites, processing sites, ribosomal binding sites, mRNA stability, and affect gene transcription, processing, and translation.

[00163] SNPs can facilitate large-scale association genetics studies, and there has recently been great interest in SNP discovery and detection. SNPs show great promise as markers for a number of phenotypic traits (including latent traits), such as for example, disease propensity and severity, wellness propensity, drug responsiveness including, for example, susceptibility to adverse drug reactions, and as described herein association with desirable phenotypic traits. Knowledge of the association of a particular SNP with a phenotypic trait, coupled with the knowledge of whether a subject has said particular SNP, can enable the targeting of diagnostic, preventative and therapeutic applications to allow better disease management, to enhance understanding of disease states, to develop selective breeding regimes, and to identify subjects of desirable genetic merit.

[00164] Indeed, a number of databases have been constructed of known SNPs, and for some such SNPs, the biological effect associated with a SNP. Understandably, there has been a focus on human genetics. For example, the NCBI SNP database “dbSNP” is incorporated into NCBI’s Entrez system and can be queried using the same approach as the other Entrez databases such as PubMed and GenBank. This database has records for over 1.5 million SNPs mapped onto the human genome sequence. Each dbSNP entry includes the sequence context of the polymorphism (i.e., the surrounding sequence), the occurrence frequency of the polymorphism (by population or individual), and the experimental method(s), protocols, and conditions used to assay the variation, and can include information associating a SNP with a particular phenotypic trait. Similar databases are available for a number of species of commercial and scientific interest.

[00165] There has been and continues to be a great deal of effort to develop methods that reliably and rapidly identify new SNPs associated with a phenotypic trait. This is no trivial task, at least in part because of the complexity of mammalian genomic DNA (e.g., the haploid human genome of 3 x 109 base pairs, while current estimates of the size of the haploid bovine genome are in the range of 2.6 - 2.7 x 109 base pairs), and the associated sensitivity and discriminatory requirements.

[00166] Genotyping approaches to detect SNPs well-known in the art include DNA sequencing, methods that require allele specific hybridization of primers or probes, allele specific incorporation of nucleotides to primers bound close to or adjacent to the polymorphisms (often referred to as “single base extension”, or “minisequencing”), allele- Ko 6 07 Η ’δ specific ligation (joining) of oligonucleotides (ligation chain reaction or ligation padlock probes), allele-specific cleavage of oligonucleotides or PCR products by restriction enzymes (restriction fragment length polymorphisms analysis or RFLP) or chemical or other agents, esolution of allele-dependent differences in electrophoretic or chromatographic mobilities, by structure specific enzymes including invasive structure specific enzymes, or mass spectrometry. Analysis of amino acid variation is also possible where the SNP lies in a coding region and results in an amino acid change.

[00167] DNA sequencing allows the direct determination and identification of SNPs. The benefits in specificity and accuracy are generally outweighed for screening purposes by the difficulties inherent in whole genome, or even targeted subgenome, sequencing.

[00168] Mini-sequencing involves allowing a primer to hybridize to the DNA sequence adjacent to the SNP site on the test sample under investigation. The primer is extended by one nucleotide using all four differentially tagged fluorescent dideoxynucleotides (A,C,G, or T), and a DNA polymerase. Only one of the four nucleotides (homozygous case) or two of the four nucleotides (heterozygous case) is incorporated. The base that is incorporated is complementary to the nucleotide at the SNP position. 100169] Λ. number of sequencing methods and platforms are particularly suited to largescale implementation, and are amenable to use in the methods of the invention. These include pyrosequencing methods, such as that utilised in the GS FLX pyrosequencing platform available from 454 Life Sciences (Branford, CT) which can generate 100 million nucleotide data in a 7.5 hour run with a single machine, and solid-state sequencing methods, such as that utilised in the SOLiD sequencing platform (Applied Biosystems, Foster City, CA). [001701 A number of methods currently used for SNP detection involve site-specific and/or allele-specific hybridisation. These methods are largely reliant on the discriminatory binding of oligonucleotides to target sequences containing the SNP of interest. The techniques of Illumina (San Diego, CA), Affymetrix (Santa Clara, CA.) and Nanogen Inc. (San Diego, Calif.) are particularly well-known, and utilize the fact that DNA duplexes containing single base mismatches are much less stable than duplexes that are perfectly basepaired. The presence of a matched duplex is usually detected by fluorescence. A number of whole-genome genotyping products and solutions amenable or adaptable for use in the present invention are now available, including those available from the above companies. [00171] The majority of methods to detect or identify SNPs by site-specific hybridisation require target amplification by methods such as PCR to increase sensitivity and specificity «? 11980789 (see, for example U.S. Pat. No. 5,679,524, PCT publication WO 98/59066, PCT publication WO 95/12607). US Application 20050059030 (incorporated herein in its entirety) describes a method for detecting a single nucleotide polymorphism in total human DNA without prior amplification or complexity reduction to selectively enrich for the target sequence, and without the aid of any enzymatic reaction. The method utilises a single-step hybridization involving two hybridization events: hybridization of a first portion of the target sequence to a capture probe, and hybridization of a second portion of said target sequence to a detection probe. Both hybridization events happen in the same reaction, and the order in which hybridisation occurs is not critical. (00172] US Application 20050042608 (incorporated herein in its entirety) describes a modification of the method of electrochemical detection of nucleic acid hybridization of Thorp et al. (U.S. Pat. No. 5,871,918). Briefly, capture probes are designed, each of which has a different SNP base and a sequence of probe bases on each side of the SNP base. The probe bases are complementary to the corresponding target sequence adjacent to the SNP site. Each capture probe is immobilized on a different electrode having a non-conductive outer layer on a conductive working surface of a substrate. The extent of hybridization between each capture probe and the nucleic acid target is detected by detecting the oxidation-reduction reaction at each electrode, utilizing a transition metal complex. These differences in the oxidation rates at the different electrodes are used to determine whether the selected nucleic acid target has a single nucleotide polymorphism at the selected SNP site.

[00173] The technique of Lynx Therapeutics (Hayward, Calif.) using MEGATYPE™ technology can genotype very large numbers of SNPs simultaneously from small or large pools of genomic material. This technology uses fluorescently labeled probes and compares the collected genomes of two populations, enabling detection and recovery of DNA fragments spanning SNPs that distinguish the two populations, without requiring prior SNP mapping or knowledge.

[00174] A number of other methods for detecting and identifying SNPs exist. These include the use of mass spectrometry, for example, to measure probes that hybridize to the □NP. This technique varies in how rapidly it can be performed, from a few samples per day to a high throughput of many thousands of SNPs per day, using mass code tags. A preferred example is the use of mass spectrometric determination of a nucleic acid sequence which comprises the polymorphisms of the invention, for example, which includes the C-321G promoter polymorphism in the SC ARBI gene (whether the coding sequence or a ΙΕ5807»? complementary sequence). Such mass spectrometric methods are known to those skilled in the art, and the genotyping methods of the invention are amenable to adaptation for the mass spectrometric detection of the polymorphisms of the invention.

[00175] SNPs can also be determined by ligation-bit analysis. This analysis requires two primers that hybridize to a target with a one nucleotide gap between the primers. Each of the four nucleotides is added to a separate reaction mixture containing DNA polymerase, ligase, target DNA and the primers. The polymerase adds a nucleotide to the 3’end of the first primer that is complementary to the SNP, and the ligase then ligates the two adjacent primers together. Upon heating of the sample, if ligation has occurred, the now larger primer will remain hybridized and a signal, for example, fluorescence, can be detected. A further discussion of these methods can be found in U.S. Pat. Nos. 5,919,626; 5,945,283; 5,242,794; and 5,952,174.

’Hl76] US Patent 6,821,733 (incorporated herein in its entirety) describes methods to detect differences in the sequence of two nucleic acid molecules that includes the steps of: contacting two nucleic acids under conditions that allow the formation of a four-way complex and branch migration; contacting the four-way complex with a tracer molecule and a detection molecule under conditions in which the detection molecule is capable of binding the tracer molecule or the four-way complex; and determining binding of the tracer molecule to the detection molecule before and after exposure to the four-way complex. Competition of the four-way complex with the tracer molecule for binding to the detection molecule indicates a difference between the two nucleic acids.

[00177] Protein- and proteomics-based approaches are also suitable for polymorphism detection and analysis. Polymorphisms which result in or are associated with variation in expressed proteins can be detected directly by analysing said proteins. This typically requires separation of the various proteins within a sample, by, for example, gel electrophoresis or HPLC, and identification of said proteins or peptides derived therefrom, for example by NMR or protein sequencing such as chemical sequencing or more prevalently mass spectrometry. Proteomic methodologies are well known in the art, and have great potential for automation. For example, integrated systems, such as the ProteomlQ™ system from Proteome Systems, provide high throughput platforms for proteome analysis combining sample preparation, protein separation, image acquisition and analysis, protein processing, mass spectrometry and bioinformatics technologies. fl -ft «οβ®7Η [00178] The majority of proteomic methods of protein identification utilise mass spectrometry, including ion trap mass spectrometry, liquid chromatography (LC) and LC/MSn mass spectrometry, gas chromatography (GC) mass spectroscopy, Fourier transform-ion cyclotron resonance-mass spectrometer (FT-MS), MALDI-TOF mass spectrometry, and ESI mass spectrometry, and their derivatives. Mass spectrometric methods are also useful in the determination of post-translational modification of proteins, such as phosphorylation or glycosylation, and thus have utility in determining polymorphisms that result in or are associated with variation in post-translational modifications of proteins.

[00179] Associated technologies are also well known, and include, for example, protein processing devices such as the “Chemical Inkjet Printer” comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots. After in-situ digestion and incubation of the proteins, the membrane can be placed directly into the mass spectrometer for peptide analysis.

[00180] It will be apparent that the presence or absence of the C allele or of the G allele at the C-321G promoter polymorphism in the SCARB 1 gene may also be determined by analysis of a polypeptide sample, derived from a bovine.

[00181] Suitable polypeptide-based analyses include those able to discriminate between full-length and truncated protein products, and may include but are not limited to, the following: Native polyacrylamide gel electrophoresis (PAGE), isoelectric focussing, 2D PAGE, or Western blotting with specific antibodies. Mass spectroscopy, immunoprecipitation, and peptide fingerprinting are also suitable.

[00182] A large number of methods reliant on the conformational variability of nucleic acids have been developed to detect SNPs.

[00183] For example, Single Strand Conformational Polymorphism (SSCP, Orita et al., PNAS 1989 86:2766-2770) is a method reliant on the ability of single-stranded nucleic acids to form secondary structure in solution under certain conditions. The secondary structure depends on the base composition and can be altered by a single nucleotide substitution, causing differences in electrophoretic mobility under nondenaturing conditions. The various polymorphs are typically detected by autoradiography when radioactively labelled, by silver staining of bands, by hybridisation with detectably labelled probe fragments or the use of fluorescent PCR primers which are subsequently detected, for example by an automated DNA sequencer. lloeons '00184] Modifications of SSCP are well known in the art, and include the use of differing gel running conditions, such as for example differing temperature, or the addition of additives, and different gel matrices. Other variations on SSCP are well known to the skilled artisan, including,RNA-SSCP, restriction endonuclease fingerprinting-SSCP, dideoxy fingerprinting (a hybrid between dideoxy sequencing and SSCP), bi-directional dideoxy fingerprinting (in which the dideoxy termination reaction is performed simultaneously with two opposing i i : :ners), and Fluorescent PCR-SSCP (in which PCR products are internally labelled with multiple fluorescent dyes, may be digested with restriction enzymes, followed by SSCP, and analysed on an automated DNA sequencer able to detect the fluorescent dyes).

[00185] Other methods which utilise the varying mobility of different nucleic acid structures include Denaturing Gradient Gel Electrophoresis (DGGE), Temperature Gradient Gel Electrophoresis (TGGE), and Heteroduplex Analysis (HET). Here, variation in the dissociation of double stranded DNA (for example, due to base-pair mismatches) results in a change in electrophoretic mobility. These mobility shifts are used to detect nucleotide variations.

[00186] Denaturing High Pressure Liquid Chromatography (HPLC) is yet a further method utilised to detect SNPs, using HPLC methods well-known in the art as an alternative to the separation methods described above (such as gel electophoresis) to detect, for example, homoduplexes and heteroduplexes which elute from the HPLC column at different rates, thereby enabling detection of mismatch nucleotides and thus SNPs.

[00187] Yet further methods to detect SNPs rely on the differing susceptibility of single stranded and double stranded nucleic acids to cleavage by various agents, including chemical cleavage agents and nucleolytic enzymes. For example, cleavage of mismatches within RNA:DNA heteroduplexes by RNase A, of heteroduplexes by, for example bacteriophage T4 endonuclease YII or T7 endonuclease I, of the 5’ end of the hairpin loops at the junction between single stranded and double stranded DNA by cleavase I, and the modification of mispaired nucleotides within heteroduplexes by chemical agents commonly used in MaxamGilbert sequencing chemistry, are all well known in the art.

[00188] Further examples include the Protein Translation Test (PTT), used to resolve stop codons generated by variations which lead to a premature termination of translation and to protein products of reduced size, and the use of mismatch binding proteins. Variations are detected by binding of, for example, the MutS protein, a component of Escherichia coli DNA mismatch repair system, or the human hMSH2 and GTBP proteins, to double stranded DNA *080780 II ο β β 78 6 heteroduplexes containing mismatched bases. DNA duplexes are then incubated with the mismatch binding protein, and variations are detected by mobility shift assay. For example, a simple assay is based on the fact that the binding of the mismatch binding protein to the E ieroduplex protects the heteroduplex from exonuclease degradation.

[00189] Those skilled in the art will know that a particular SNP, particularly when it occurs in a regulatory region of a gene such as a promoter, can be associated with altered expression of a gene. Altered expression of a gene can also result when the SNP is located in the coding region of a protein-encoding gene, for example where the SNP is associated with codons of varying usage and thus with tRNAs of differing abundance. Such altered expression can be determined by methods well known in the art, and can thereby be employed to detect such SNPs. Similarly, where a SNP occurs in the coding region of a gene and results in a nonsynonomous amino acid substitution, such substitution can result in a change in the function of the gene product. Similarly, in cases where the gene product is an RNA, such SNPs can result in a change of function in the RNA gene product. Any such change in function, for example as assessed in an activity or functionality assay, can be employed to detect such SNPs.

[00190] The above methods of detecting and identifying SNPs are amenable to use in the methods of the invention.

Polynucleotide and polypeptide variants [00191] The term “polynucleotide(s),” as used herein, means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length but preferably at least 15 nucleotides, and include as non-limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences complements, exons, introns, genomic DNA, cDNA, premRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments. A number of nucleic acid analogues are well known in the art and are also contemplated.

[00192] A “fragment” of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is preferably at least 15 nucleotides in length. The fragments of the invention preferably comprises at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 40 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 contiguous nucleotides of a polynucleotide of the invention. A fragment of a polynucleotide sequence can be used in antisense, gene silencing, triple helix or KQ 8 07 Η ribozyme technology, or as a primer, a probe, included in a microarray, or used in polynucleotide-based selection methods.

[00193] The term “fragment” in relation to promoter polynucleotide sequences is intended to include sequences comprising cis-elements and regions of the promoter polynucleotide sequence capable of regulating expression of a polynucleotide sequence to which the fragment is operably linked.

[00194] Preferably fragments of polynucleotide sequences of the invention comprise at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 100, more preferably at least 200, more preferably at least 300, more preferably at least 400, more preferably at least 500, more preferably at least 600, more preferably at least 700, more preferably at least 800, more preferably at least 900 and most preferably at least 1000 contiguous nucleotides of a polynucleotide of the invention.

[00195] The term “primer” refers to a short polynucleotide, usually having a free 3ΌΗ group, that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the template. Such a primer is preferably at least 5, more preferably at least 6, more preferably at least 7, more preferably at least 9, more preferably at least 10, more preferably at least 11, more preferably at least 12, more preferably at least 13, more preferably at least 14, more preferably at least 15, more preferably at least 16, more preferably at least 17, more preferably at least 18, more preferably at least 19, more preferably at least 20 nucleotides in length.

[00196] The term “probe” refers to a short polynucleotide that is used to detect a polynucleotide sequence that is complementary to the probe, in a hybridization-based assay. The probe may consist of a “fragment” of a polynucleotide as defined herein. Preferably such a probe is at least 5, more preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 100, more preferably at least 200, more preferably at least 300, more preferably at least 400 and most preferably at least 500 nucleotides in length.

[00197] The term “variant” as used herein refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the polynucleotides and polypeptides possess biological Ι®β076β activities that are the same or similar to those of the reference polynucleotides or polypeptides. The term “variant” with reference to polynucleotides and polypeptides encompasses all forms of polynucleotides and polypeptides as defined herein. 1 Polynucleotide variants [00198] Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least %, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a specified polynucleotide sequence. Identity is found over a comparison window of at least 20 nucleotide positions, preferably at least 50 nucleotide positions, at least 100 nucleotide positions, or over the entire length of the specified polynucleotide sequence.

[00199] Polynucleotide sequence identity can be determined in the following manner. The subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.10 [Oct 2004]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences - a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250), which is publicly available from NCBI (ftp.7/ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity parts should be turned off. [(10200] The identity of polynucleotide sequences may be examined using the following unix command line parameters:

[00201] bl2seq -i nucleotideseql -j nucleotideseq2 -F F -p blastn [00202] The parameter -F F turns off filtering of low complexity sections. The parameter —p selects the appropriate algorithm for the pair of sequences. The bl2seq program reports sequence id _. tity as both the number and percentage of identical nucleotides in a line “Identities = [00203] Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443- 453). A full implementation of the Needleman-Wunsch global alignment algorithm is found in the needle program in the EMBOSS package (Rice,P. Longden,I. and Bleasby,A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp.276-277) which can be obtained from http://www.hgmp.mrc.ac.uk/Software/EMBOSS/. The European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at http:/www.ebi.ac.uk/emboss/align/.

[00204] Alternatively the GAP program may be used which computes an optimal global alignment of two sequences without penalizing terminal gaps. GAP is described in the following paper: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10,227-235.

[00205] Polynucleotide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.10 [Oct 2004]) from NCBI (ftp://ftp.ncbi.nih.gov/blast/).

[00206] The similarity of polynucleotide sequences may be examined using the following unix command line parameters:

[00207] bl2seq -i nucleotideseql -j nucleotideseq2 -F F -p tblastx [00208] The parameter -F F turns off filtering of low complexity sections. The parameter selects the appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an “E value” which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. The size of this database is set by default in the bl2seq program. For small E values, much less than one, the E value is approximately the probability of such a random match.

[00209] Variant polynucleotide sequences preferably exhibit an E value of less than 1 x '10, more preferably less than 1 x IO'20, less than 1 x IO'30, less than 1 x IO40, less than 1 x IO’50, less than 1 x IO'60, less than 1 x 10'7°, less than 1 x 10'8°, less than 1 x 1 O'90, less than 1 x IO'100, less than 1 x 10‘110, less than 1 x 10'12° or less than 1 x 10‘123 when compared with any one of the specifically identified sequences. »090799 [00210] Alternatively, variant polynucleotides of the present invention hybridize to a specified polynucleotide sequence, or complements thereof under stringent conditions.

[00211] The term “hybridize under stringent conditions”, and grammatical equivalents thereof, refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency.

[00212] With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30°C (for example, 10°C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing,). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0. 41% (G + C-log (Na+). (Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84:1390). Typical stringent conditions for polynucleotide of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in IX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C.

[00213] With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10°C below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (Ybb/oligonucleotide length)°C.

[00214] With respect to the DNA mimics known as peptide nucleic acids (PNAs) (Nielsen 4 al., Science. 1991 Dec 6;254(5037): 1497-500) Tm values are higher than those for DNADNA or DNA-RNA hybrids, and can be calculated using the formula described in Giesen et al., Nucleic Acids Res. 1998 Nov 1;26(21):5004-6. Exemplary stringent hybridization conditions for a DNA-PNA hybrid having a length less than 100 bases are 5 to 10°C below the Tm.

B L 7 §6 «980781 [00215] Variant polynucleotides of the present invention also encompasses polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention. A sequence alteration that does not change the amino acid sequence of the polypeptide is a “silent variation”. Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.

[00216] Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247,1306). [00217J Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.10 [Oct 2004]) from NCBI (Rp://Ttp.ncbi.nih.gov/blast/) via the tblastx algorithm as previously described.

[00218] Polypeptide Variants [00219] The term “variant” with reference to polypeptides encompasses naturally occurring, recombinantly and synthetically produced polypeptides. Variant polypeptide sequences preferably exhibit at least 50%, more preferably at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least %, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a sequences of the present invention. Identity is found over a comparison window of at least 20 amino acid positions, preferably at least 50 amino acid positions, at least 100 amino acid positions, or over the entire length of a polypeptide of the invention.

[00220] Polypeptide sequence identity can be determined in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using V' ·. I10H7M JB0 8 07 8I BLASTP (from the BLAST suite of programs, version 2.2.10 [Oct 2004]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity regions should be turned off.

[00221] Polypeptide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs. EMBOSS-needle (available at http:/www.ebi.ac.uk/emboss/align/) and GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.) as discussed above are also suitable global sequence alignment programs for calculating polypeptide sequence identity.

[00222] Polypeptide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.10 [Oct 2004]) from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The similarity of polypeptide sequences may be examined using the following unix command line parameters: bl2seq -i peptideseql -j peptideseq2 -F F -p blastp [00223] Variant polypeptide sequences preferably exhibit an E value of less than 1 x 1 O’10, more preferably less than 1 x 1 O'20, less than 1 x 1 O'30, less than 1 x IO-40, less than 1 x 10'5°, less than 1 x IO'60, less than 1 x IO'70, less than 1 x 10’8°, less than 1 x IO'90, less than 1x10' 1θθ, less than 1 x IO'110, less than 1 x IO'120 or less than 1 x 10'123 when compared with any one of the specifically identified sequences.

[00224] The parameter -F F turns off filtering of low complexity sections. The parameter —p selects the appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an “E value” which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. For small E values, much less than one, this is approximately the probability of such a random match.

[00225] Conservative substitutions of one or several amino acids of a described polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al., 1990, Science 247,1306). φό ' ΐ S Κο β ¢7 it 100226] A polypeptide variant of the present invention also encompasses that which is produced from the nucleic acid encoding a polypeptide, but differs from the reference polypeptide in that it is processed differently such that it has an altered amino acid sequence. For example a variant may be produced by an alternative splicing pattern of the primary RNA transcript to that which produces a reference polypeptide.

Diagnostic kits [00227] The invention further provides diagnostic kits useful in determining the bovine SC ARBI allelic profile of bovine, for example for use in the methods of the present invention.

[00228] Accordingly, in one embodiment the invention provides a diagnostic kit which can be used to determine the SC ARBI genotype of bovine genetic material. One kit includes a set of primers used for amplifying the genetic material. A kit can contain a primer including a nucleotide sequence for amplifying a region of the genetic material containing a nonreference allele at a polymorphism. Such a kit could also include a primer for amplifying the corresponding region of the reference gene, for example one that produces a reference SCARB1. Usually, such a kit would also include another primer upstream or downstream of the region of the gene. These primers are used to amplify the segment containing the polymorphism of interest. The actual genotyping is carried out using primers that target specific alleles such as those described herein, and that could function as allele-specific oligonucleotides in conventional hybridisation, Taqman assays, OLE assays, etc. Alternatively, primers can be designed to permit genotyping by microsequencing.

[00229] One kit of primers can include first, second and third primers, (a), (b) and (c), respectively. Primer (a) is based on a region containing a SC ARBI mutation. Primer (b) encodes a region upstream or downstream of the region to be amplified by a primer (a) so that genetic material containing the mutation is amplified, by PCR, for example, in the presence of the two primers. Primer (c) is based on the region corresponding to that on which primer (a) is based, but lacking the mutation. Thus, genetic material containing the non-mutated region will be amplified in the presence of primers (b) and (c). Genetic material homozygous for the wild type gene will thus provide amplified products in the presence of primers (b) and (c). Genetic material homozygous for the mutated gene will thus provide amplified products in the presence of primers (a) and (b). Heterozygous genetic material will provide amplified products in both cases. *08670 [00230] For example, the kit may include a primer comprising a cytosine at the position corresponding to the C-321G promoter polymorphism in the SCARB1 gene or comprising a nucleotide capable of hybridising to a cytosine at the position corresponding to the C-321G promoter polymorphism in the SC ARBI gene. Those skilled in the art will recognise that in such a primer, the cytosine, or the nucleotide capable of hybridising to a cytosine, as applicable, may be substituted for a nucleotide analogue having the same discriminatory basepairing as the substituted nucleotide.

[00231] In another example, the kit may include a primer comprising a guanine at the position corresponding to the C-321G promoter polymorphism in the SCARB1 gene, or comprising a nucleotide capable of hybridising to a guanine at the position corresponding to the C-321G promoter polymorphism in the SCARB1 gene. Those skilled in the art will recognise that in such a primer, the guanine, or the nucleotide capable of hybridising to a guanine, as applicable, may be substituted for a nucleotide analogue having the same discriminatory base-pairing as the substituted nucleotide.

[00232] In one embodiment, the diagnostic kit is useful in detecting DNA comprising a variant SC ARBI gene or DNA or mRNA encoding a variant SCARB1 polypeptide at least partially lacking reference activity in a bovine which includes first and second primers for amplifying the DNA or mRNA, the primers being complementary to nucleotide sequences of the DNA or mRNA upstream and downstream, respectively, of a polymorphism in the portion of the DNA encoding SCARB1 which results in increased β-carotene levels (particularly increased β-carotene content in milk fat), preferably wherein at least one of the nucleotide sequences is selected to be from a non-coding region of the reference SC ARBI gene. The kit can also include a third primer complementary to a naturally occurring mutation of a coding portion of the reference SCARB1 gene. Preferably the kit includes instructions for use, for example in accordance with a method of the invention.

[00233] In one embodiment, the diagnostic kit comprises a nucleotide probe complementary to the sequence, or an oligonucleotide fragment thereof, shown in SEQ ID NO:1 or SEQ ID NO:3, for example, for hybridisation with mRNA from a sample of cells; means for detecting the nucleotide probe bound to mRNA in the sample with a standard. In a particular aspect, the kit of this aspect of the invention includes a probe having a nucleic acid molecule sufficiently complementary with a sequence presented in SEQ ID NO:lor SEQ ID NO:3 or complements thereof, so as to bind thereto under stringent conditions. “Stringent hybridisation conditions” takes on its common meaning to a person skilled in the art.

A ppropriate stringency conditions which promote nucleic acid hybridisation, for example, 6x sodium chloride/sodium citrate (SSC) at about 45°C are known to those skilled in the art, including in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989). Appropriate wash stringency depends on degree of homology and length of probe. If homology is 100%, a high temperature (65°C to 75°C) may be used. However, if the probe is very short (<1 OObp), lower temperatures must be used even with 100% homology. In general, one starts washing at low temperatures (37°C to 40°C), and raises the temperature by 3-5°C intervals until background is low enough to be a major factor in autoradiography. The diagnostic kit can also contain an instruction manual for use of the kit. 100234] In another embodiment, the diagnostic kit comprises an antibody or an antibody composition useful for detection of the presence or absence of reference SCARB1, or determining the presence or absence of a variant protein at least partially lacking reference activity, or determining the level of expression of the SC ARBI protein, together with instructions for use, for example in a method of the invention.

Sample preparation [00235] As will be apparent to persons skilled in the art, samples suitable for use in the methods of the present invention may be obtained from tissues or fluids as convenient, and so that the sample contains the moiety or moieties to be tested. For example, where nucleic acid is to be analysed, tissues or fluids containing nucleic acid will be used.

[00236] Conveniently, samples may be taken from milk, tissues including blood, serum, and plasma, cerebrospinal fluid, urine, semen or saliva. Tissue samples may be obtained using standard techniques such as cell scrapings or biopsy techniques. For example, the cell or tissue samples may be obtained by using an ear punch to collect ear tissue from bovine. Similarly, blood sampling is routinely performed, for example for pathogen testing, and methods for taking blood samples are well known in the art. Likewise, methods for storing and processing biological samples are well known in the art. For example, tissue samples may be frozen until tested if required. In addition, one of skill in the art would realize that some test samples would be more readily analyzed following a fractionation or purification procedure, for example, separation of whole blood into serum or plasma components.

Computer-Related Embodiments [00237] It will also be appreciated that the methods of the invention are amenable to use with and the results analysed by computer systems, software and processes. Computer systems, software and processes to identify and analyse genetic polymorphisms are well Ιο 8 ®7 Bis known in the art. For example, the results of one or more genetic analyses as described herein may be analysed using a computer system and processed by such a system.

[00238] Both the SNPs and the results of an analysis of the SNPs utilised in the present invention may be “provided” in a variety of mediums to facilitate use thereof. As used in this section, “provided” refers to a manufacture, other than an isolated nucleic acid molecule, that contains SNP information of the present invention. Such a manufacture provides the SNP information in a form that allows a skilled artisan to examine the manufacture using means not directly applicable to examining the SNPs or a subset thereof as they exist in nature or in purified form. The SNP information that may be provided in such a form includes any of the SNP information provided by the present invention such as, for example, polymorphic nucleic acid and/or amino acid sequence information, information about observed SNP alleles, alternative codons, populations, allele frequencies, SNP types, and/or affected proteins, phenotypic effect or association, or any other information provided by the present invention in Tables 1 - 3 and/or the Sequence ID Listing.

[00239] In one application of this embodiment, the SNPs and the results of an analysis of ri c SNPs utilised in the present invention can be recorded on a computer readable medium. As used herein, “computer readable medium” refers to any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media. A skilled artisan can readily appreciate how any of the presently known computer readable media can be used to create a manufacture comprising computer readable medium having recorded thereon SNP information of the present invention. One such medium is provided with the present application, namely, the present application contains computer readable medium (floppy disc) that has nucleic acid sequences used in analysing the SNPs utilised in the present invention, together with derived amino acid sequence, provided/recorded thereon in ASCII text format in a Sequence ID Listing. (90240] As used herein, “recorded” refers to a process for storing information on computer readable medium. A skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate manufactures comprising the SNP information of the present invention. ΙΙΟβΟ78<

[00241] A variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon SNP information of the present invention. The choice of the data storage structure will generally be based on the means chosen to access the stored information. In addition, a variety of data processor programs and formats can be used to store the SNP information of the present invention on computer readable medium. For example, sequence information can be represented in a word processing text file, formatted in commercially-available software such as WordPerfect and Microsoft Word, represented in the form of an ASCII file, or stored in a database application, such as OB2, Sybase, Oracle, or the like. A skilled artisan can readily adapt any number of data processor structuring formats (e.g., text file or database) in order to obtain computer readable medium having recorded thereon the SNP information of the present invention. [00242] By providing the SNPs and/or the results of an analysis of the SNPs utilised in the present invention in computer readable form, a skilled artisan can routinely access the SNP information for a variety of purposes. Computer software is publicly available which allows a skilled artisan to access sequence information provided in a computer readable medium. Examples of publicly available computer software include BLAST (Altschul et at, J. Mol. Biol. 215:403-410 (1990)) and BLAZE (Brutlag et at, Comp. Chem. 17:203-207 (1993)) search algorithms.

[00243] The present invention further provides systems, particularly computer-based systems, which contain the SNP information described herein. Such systems may be designed to store and/or analyze information on, for example, a number of SNP positions, or information on SNP genotypes from a number of subjects. The SNP information of the present invention represents a valuable information source. The SNP information of the present invention stored/analyzed in a computer-based system may be used for such applications as identifying or selecting subjects, in addition to computer-intensive applications as determining or analyzing SNP allele frequencies in a population, mapping disease genes, genotype-phenotype association studies, grouping SNPs into haplotypes, correlating SNP haplotypes with response to particular drugs, or for various other bioinformatic, pharmacogenomic, drug development, or selection or identification applications.

[00244] As used herein, “a computer-based system” refers to the hardware, software, and data storage used to analyze the SNP information of the present invention. The minimum hardware of the computer-based systems of the present invention typically comprises a central llo 8 07 86 processing unit (CPU), an input, an output, and data storage. A skilled artisan can readily appreciate that any one of the currently available computer-based systems are suitable for use in the present invention. Such a system can be changed into a system of the present invention by utilizing the SNP information, such as that provided herewith on the floppy disc, or a subset thereof, without any experimentation.

[00245] As stated above, the computer-based systems of the present invention comprise data storage having stored therein SNP information, such as SNPs and/or the results of an analysis of the SNPs utilised in the present invention, and the necessary hardware and software for supporting and implementing one or more programs or algorithms. As used herein, “data storage” refers to memory which can store SNP information of the present invention, or a memory access facility which can access manufactures having recorded thereon the SNP information of the present invention.

[00246] The one or more programs or algorithms are implemented on the computer-based system to identify or analyze the SNP information stored within the data storage. For example, such programs or algorithms can be used to determine which nucleotide is present at a particular SNP position in a target sequence, or to analyse the results of a genetic analysis of the SNPs described herein. As used herein, a “target sequence” can be any DNA sequence containing the SNP positions) to be analysed, searched or queried.

[00247] A variety of structural formats for the input and output can be used to input and output the information in the computer-based systems of the present invention. An exemplary format for an output is a display that depicts the SNP information, such as the presence or absence of specified nucleotides (alleles) at particular SNP positions of interest. Such presentation can provide a rapid, binary scoring system for many SNPs or subjects simultaneously. It will be appreciated that such output may be accessed remotely, for example over a LAN or the internet. Typically, given the nature of SNP information, such remote accessing of such output or of the computer system itself is available only to verified users so that the security of the SNP information and/or the computer system is maintained. Methods to control access to computer systems and the data residing thereon are well-known in the art, and are amenable to the embodiments of the present invention. [002481 One exemplary embodiment of a computer-based system comprising SNP information of the present invention that can be used to implement the present invention includes a processor connected to a bus. Also connected to the bus are a main memory (preferably implemented as random access memory, RAM) and a variety of secondary storage »0 89791 devices, such as a hard drive and a removable medium storage device. The removable medium storage device may represent, for example, a floppy disc drive, a CD-ROM drive, a magnetic tape drive, etc. A removable storage medium (such as a floppy disc, a compact disc, a magnetic tape, etc.) containing control logic and/or data recorded therein may be inserted into the removable medium storage device. The computer system includes appropriate software for reading the control logic and/or the data from the removable storage medium once inserted in the removable medium storage device. The SNP information of the present invention may be stored in a well-known manner in the main memory, any of the secondary storage devices, and/or a removable storage medium. Software for accessing and processing the SNP information (such as SNP scoring tools, search tools, comparing tools, etc.) piefcrably resides in main memory during execution.

[00249] Accordingly, the present invention provides a system for performing one or more of the methods of the invention, said system comprising: computer processor means for receiving, processing and communicating data; storage means for storing data including a reference genetic database of the results of genetic analysis of a bovine with respect to one or more milk or tissue colour or β-carotene content traits and optionally a reference milk or tissue colour or β-carotene content traits database of non-genetic factors for bovine milk or tissue colour or β-carotene content traits; and a computer program embedded within the computer processor which, once data consisting of or including the result of a genetic analysis for which data is included in the reference genetic database is received, processes said data in the context of said reference databases to determine, as an outcome, the genetic merit of the bovine, said outcome being communicable once known, preferably to a user having input said data.

[00250] Preferably, said system is accessible via the internet or by personal computer. [00251] Preferably, said reference genetic database comprises or includes the results of one or more analyses of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits, more preferably the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or tissue colour or β-carotene content traits, [00252] In yet a further aspect, the invention provides a computer program suitable for use in a system as defined above comprising a computer usable medium having program code embodied in the medium for causing the computer program to process received data 11080769 consisting of or including the result of at least one genetic analysis of one or more genetic loci associated with one or more milk or tissue colour or β-carotene content traits in the context of both a reference genetic database of the results of said at least one genetic analysis and optionally a reference database of non-genetic factors associated with bovine milk or tissue colour or β-carotene content traits.

[00253] Preferably, the one or more genetic loci are one or more polymorphisms in one or more genes associated with one or more milk or tissue colour or β-carotene content traits. [00254] It will be appreciated that it is not intended to limit the invention to the above example only, many variations, which may readily occur to a person skilled in the art, being possible without departing from the scope thereof as defined in the accompanying claims.

[00255] This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.

[00256] The invention consists in the foregoing and also envisages constructions of which the following gives examples only.

EXAMPLE -Analysis of the genetic basis for milk fat colour [00257] This example describes the investigation of the genetic basis for observed variations in milk fat colour using the results of a Holstein-Friesian X Jersey cross-bred trial conducted to facilitate the discovery of QTLs, genes and mutations associated with economically important milk traits.

Materials and methods 1. Trial design [00258] A Holstein-Friesian x Jersey crossbred trial was conducted using an F2 trial design with a half-sibling family structure. Reciprocal crosses of Holstein-Friesian and Jersey animals were carried out to produce six FI bulls of high genetic merit. 850 F2 female progeny forming the basis of the trial herd were then produced through mating of high genetic merit FI cows with these FI bulls. The herd was formed over two seasons; animals in cohort one were bom in spring 2000, and entered their first lactation in spring 2002, while animals in cohort two were bom in spring 2001 and entered their first lactation in spring 2003. A total of 724 F2 cows entered their second lactations (during which milk fat colour was measured).

Ko β ο? at The animals were farmed under standard New Zealand dairy farming practices using a pasture based management system. All animal work was conducted in accordance with the Ruakura Animal Ethics committee. 2. Milk fat colour measurement [00259] All milk measurements were taken during the animals’ second lactation. Cows were milked twice daily; milk volume was recorded at each milking. Milk fat colour was measured at three time points during lactation: peak lactation (35 days post-calving), mid lactation (mid November) and late lactation (late February). On each collection day, samples were collected from the a.m. and p.m. milkings and combined to make a single composite sample for each animal. Milk fat colour was measured as previously described (Winkelman et al., 1999). Briefly, nonsaponifiable material (including carotenoids) was extracted from fresh milk samples and the absorbance at 450nm was measured. Fat colour (gg βcarotene/mg milk fat) was calculated (Winkelman et al., 1999). 3. Genotyping [00260] Genomic DNA was prepared from whole blood from a total of 1665 animals within the trial pedigree (850 F2 daughters, six FI sires, 796 FI dams, and 13 selected F0 sires). An initial whole genome scan was conducted by genotyping each animal for 285 microsatellite markers, obtained primarily from published marker maps. Subsequently, the pedigree was genotyped using the Affymetrix Bovine 10K SNP GeneChip. A total of 6634 informative SNP markers were placed on the map. 4. Candidate gene sequencing [00261] SC ARBI was identified as a candidate gene for the milk fat colour QTL on chromosome 17, Intron/exon boundaries were determined using the UniGene bovine Bt.4520. The promoter sequence was amplified using the primers presented as SEQ ID NOS: 5 and 6. Exons were amplified using the primers presented as SEQ ID NOS: 7-44 and sequenced in both directions. The reference gene sequence for the SC ARBI gene is shown in SEQ ID NO. 1. In addition to coding regions, an additional 1.2 kb of 5’ untranslated region was also sequenced. The predicted structure of the bovine gene is shown in Figure 3. Primers were designed within introns so that complete sequence was obtained from each exon.

. Statistical analysis [00262} The dataset consisted of milk fat colour phenotypes collected during the animals’ second lactation for two cohorts of F2 animals. Data manipulation was performed using SAS (version 9.1). Phenotype data for milk fat colour was recorded at three time points during ; 1 ,3 '^6 JtO 9® 7» f lactation (peak, mid and late lactation). These data were matched with the following covariates: cohort (cohort 1 or cohort 2), sire (sires 1 - 6), milk fat%, milk protein%, lactose%, milk solids%, milk yield, condition score, live weight (average taken for ± seven days around each of the milk fat colour time points at peak, mid and late lactation), somatic ( ell count (threshold of 200,000 cells during ± seven days around sampling times), free fatty acids (as an indicator of milk fat quality, measured in the same sample as milk fat colour at peak, mid and late lactation), calving week, and estrus week. Animals with missing data points for any of the measurements were excluded and the final datasets included 597, 648 and 632 observations at peak, mid and late lactation, respectively.

[00263] Analyses were conducted using both raw and log-transformed data. ANOVA was conducted for the milk fat colour phenotype at peak, mid and late lactation. The final ANOVA models for each of the lactations were produced using a backward elimination process; all the covariates were included in the model at the first stage of the modeling process and the least significant covariates removed at each subsequent stage until all the remaining covariates were found to be significant (sig. level set at 0.1). Thus, the final models were as follows: peak lactation (sire, cohort, protein%, calving week), mid lactation (sire, cohort) and late lactation (sire, cohort, protein0/», milk solid0/», and somatic cell count). 6. QTL detection [00264] The data used for QTL detection were the residuals from each model for both non-transformed and log-transformed data. The raw phenotype data (no covariates or modeling) was also used to detect QTLs. Since the same results were detected with each kind of data, results presented below used non-transformed, modeled data. QTL detection was conducted using a line of descent model (Haley et al. 1994) and a half-sib model (Baret et al. 1998). Subsequently, the SCARBI polymorphism was included as a covariate into the models for peak, mid and late lactation, and ANOVA was performed to test for an association between the SCARBI mutation and β-carotene concentration of milk. 7. Tissue SCARBI mRNAmeasurements [00265] Subcutaneous adipose tissue biopsies (~500mg tissue) and liver biopsies (-100 mg tissue) were taken from a subset of 40 cows (8 CC animals, 21 CG animals and 11 GG animals). Total RNA was isolated using the Qiagen RNeasy method, according to manufacturer’s instructions. RNA yields were quantified by absorbance at 260nm and RNA integrity was determined using the Agilent Bioanalyser. SCARBI mRNA was determined by quantitative real time PCR using the Roche Universal Probe library system. An Intron ΙΕΟ 8 07 $e spanning assay was used to prevent amplification of any contaminating genomic DNA. The assay was designed using SEQ ID NO: 3 as a reference sequence. The details of the primers (SEQ ID NOs: 42 and 43) and amplicon sequence (SEQ ID NO:44) are presented in Table 1 ’ «clow. Universal probe number 62 was used for the assay (sequence cagcaggt).

Table 1: Details of SC ARBI quantitative real time PCR assay Primer Length Tm %GC Sequence Left 18 59 50 tggtgccctcaatcatca [SEQ ID NO:42] Right 22 60 45 catgttgaaagacaggctgttg [SEQ ID NO:43] Amplicon 74 tggtgccctcaatcatcaagcagcaggtcctcaagaatgtgcgcatcgac cccaacagcctgtctttcaacatg [SEQ ID NO:44] [00266] Results are expressed as fold-change relative to animal single reference sample (tiΉ animal was not included in the subsequent analysis). Genotype effects were determined by ANOVA, using genotype as a fixed effect, and the significance level was set at p = 0.05. [00267] β-carotene adipose tissue measurements were determined using HPLC with ίϋ commercial standards, based on a published method (Hulshof et al., 2006). The inter-assay variation was on average 5%.

Results 1. Detection of a major QTL for milk fat colour on bovine chromosome 17 [00268] Analysis of the β-carotene data within the line of descent model of QTL analysis showed the presence of a significant QTL on bovine chromosome 17 (Figure 2). The maximum F value for the QTL was 10.6, and the most likely position was estimated at 71 cM. 2. Identification of SCARB1 as a candidate gene and detection of a polymorphism [00269J The SC ARBI gene was thought to be approximately located between markers BMS1879 at 50.7 cM and BM1862 at 67.5 cM on bovine chromosome 17. To determine whether the SCARB1 gene was involved in the observed variation in milk colour and βcarotene content, the SC ARBI promoter and coding regions were sequenced in the six FI sires to identify any genetic polymorphisms that could potentially alter the function, activity, or expression of this protein. The predicted structure of the bovine gene is shown in Figure 3, and in SEQ ID NOs:l and 3.

[00270] One polymorphism in the bovine SCARB1 gene was identified. A substitution of C to G at genomic nucleotide position -321 (see SEQ ID NO:1) in the promoter of the SC ARBI gene was heterozygous in five FI sires. The remaining sire was homozygous for the G allele. To determine whether this polymorphism was associated with the milk colour llo β and β-carotene content phenotypes, the remainder of the FJXB trial pedigree was genotyped. The frequency of each SC ARBI genotype in the F2 population is shown in Table 2 below. Table 2: Genotype frequencies of F2 population Genotype Total % CC 194 23.52 CG 403 48.84 GG 228 27.64 Total 825 100.00

[00271] The SCARB1 genotype was subsequently introduced into the statistical model as 5 a fixed effect. As shown in Figure 5, this reduced the QTL significance (F-value), showing a close association of the SCARB1 genotype with the milk fat colour QTL variation. 3. SCARB1 polymorphism has a significant effect on β-carotene concentration in milk [00272] The effect of the SCARB1 polymorphism on milk fat colour is shown in Table 3 Blow and in Figure 4.

Table 3: Genotype effect on milk fat colour Milk fat colour Genotype N Peak Lactation N Mid Lactation N Late Lactation CC 150 11.6 160 9.52 152 7.55 CG 293 10.87 320 8.91 298 7.19 GG 178 10.22 186 8.81 174 6.73

[00273] Animals homozygous for the C allele produce milk with greater milk fat colour and greater concentrations of β-carotene than heterozygous (CG) animals. Furthermore, heterozygous animals produce milk with greater milk fat colour and greater concentrations of β-carotene than animals homozygous for the G allele. The genotype effect was similar at each stage of lactation. 4. SC ARBI polymorphism has a significant effect on SCARB1 mRNA levels in liver tissue [00274J The effect of the SCARB1 polymorphism on SC ARBI mRNA levels in liver tissue is shown in Figure 7. SC ARBI mRNA levels were measured in liver samples from a subset of 40 F2 cows. The relative expression level of SC ARBI mRNA was significantly lower in liver tissue from animals homozygous for the C allele. Heterozygous animals had intermediate expression of SCARB1 mRNA, and animals homozygous for the G allele had the highest relative expression of SCARB1 mRNA. <080784 . SCARB 1 polymorphism has a significant effect on adipose tissue β-carotene content.

[00275] The effect of the SCARB 1 polymorphism on adipose tissue β-carotene content is shown in Figure 6. Animals homozygous for the C allele had higher concentrations of bcarotenc in adipose tissue than heterozygous animals or animals homozygous for the G allele. Discussion [00276] The present invention recognises that the SCARB1 polymorphism described above is useful as a selection tool to breed animals with higher or lower milk concentrations of β-carotene, with increased or decreased milk fat colour, or with increased or decreased tissue colour or β-carotene content. Such a strategy may allow the production of, for example, milk products more suitable to particular markets, depending on the preference for white or yellow milk and milk products, or the dietary or health requirements prevalent in a market.

Publications Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing.

Baret P., S. Knott and P. Visscher, 1998 On the use of linear regression and maximum likelihood for qtl mapping in half-sib designs. Genet. Res, 72:149-158.

Bolton and McCarthy, PNAS 1962,84:1390.

Bowie et al., Science 1990,247,1306.

Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989).

Devlin and Risch 1995; A comparison of linkage disequilibrium measures for fine-scale mapping, Genomics 29: 311-322.

During and Harrison, J Lipid Research 2007. Oct:48(10) 2283-94.

Giesen et al., Nucleic Acids Res. 1998, Nov 1 ;26(21):5004-6.

Haley C.S., S. Knott, J. Elsen, 1994 Mapping quantitative trait loci in crosses between outbred lines using least squares. Genetics 136:1195-1207.

Huang, X., On Global Sequence Alignment. Computer Applications in the Biosciences 1994, 10,227-235.

Hulshof P., T. van Roekel-Jansen, P. van de Bovenkamp, C. West, 2006 Variation in retinol and carotenoid content of milk and milk products in the Netherlands. J Food Comp. Anal. 19:67-75.

Kiefer C, Sumser E, Wemet MF, Von Lintig J.,A class B scavenger receptor mediates the cellular uptake of carotenoids in Drosophila.Proc Natl Acad Sci USA. 2002 Aug 6;99(16):10581-6. (Η ί ο - 5δ ΙΕθ 8 07 Μ Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser.

Needleman, S. B. and Wunsch, C. D., J. Mol. Biol. 1970,48,443-453.

Nielsen et al., Science 1991, Dec 6;254(5037): 1497-500.

Orita et al., PNAS 1989, 86:2766-2770.

Reich DE et al; Linkage disequilibrium in the human genome, Nature 2001,411:199-204.

Rice P. Longden,I. and Bleasby,A., EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics, June 2000, vol 16, No 6. pp.276-277.

Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press.

Tatiana A. Tatusova, Thomas L. Madden, Blast 2 sequences - a new tool for comparing protein and nucleotide sequences, FEMS Microbiol Lett. 1999,174:247-250.

Winkelman et al., Estimation of Heritabilities and Correlations Associated with Milk Color Traits, J Dairy Sci. 1999, 82:215-224.

INDUSTRIAL APPLICATION [00277] The present invention is directed to methods of genotyping bovine to facilitate the selection of animals with altered milk or tissue colour or β-carotene content traits. In particular, such traits include desired milk fat colour or β-carotene content, or desired tissue colour or β-carotene content. It is anticipated that herds of bovine selected for such traits will produce milk fat and tissue of more desirable colour (whether more or less yellow), or more desirable β-carotene content, and therefore be of significant economical benefit to farmers. »019 719 SEQUENCE LISTING <110> <120> Conten -. λ30> <160> <170> Vialactia Biosciences Marker Assisted Sel t 566948 JBM 44 Patentln version 3.2 <21 0> 1 <211> 92944 <212> DNA <213> Bos taurus <221> variant <222> (1188) . .(1188) <223> -321 C/G polymorphism Z21> CDS <222> (1509). .(1634) <221> misc feature <222> (27335) ..(27384) <223> n is a, c, g, or t <221> CDS <222> (49437) ..(49594) <221> CDS <222> (52514) ..(52655) misc feature <222> (55223) ..(55272) <223> n is a, c, g, or t <221> CDS <222> (57539), ..(57742) <221> CDS <222> (60150) ..(60245) <221> misc feature <222> (60827), . . (60876) <223> n is a, c, g, or t <221> CDS <222> (62427), ..(62542) <221> misc feature <222> (63468), ..(63814) <223> n is a, c, g, or t <221> CDS <222> (65184) , ..(65350) <221> CDS <222> (72042). ..(72160) <221> CDS <222> (77621). ..(77694) <221> misc feature <222> (79987), ..(80036) <223> n is a, c, g, or t <221> CDS (82267). ..(82318) <221> CDS <222> ¢83183). ..(83329) <221> misc feature <222> (85511), ..(85560) <223> n is a, c, g, or t <221> CDS <222> (86998). , . (87123) - TQQ> 1 gttgaagaag aatttcattc tgagccctca gggactgggc tgccttaccc aggtgttggg 60 gatccccgcg tgaccctcaa ctagacaatg aggggactga cctacatcag ggttccagga 120 tcagtgcagg gtgggggtgc tgcgggcact ctgagcaggt tggcgggggg gcctcatgga 180 ggactgcagg ggagcacagg cccatgtttt actattttgg agggggtgtc agtaatctat 240 ccttcatttc ctcacttgcc catcctctgt cttcctgttc attagaaagc agacacttgg 300 atttgttgac ctaacctgct gtgcctgttt gcttatgtgc aaaatggagt cggtgtggga 360 aaggctttta gcacagaacc tggctcccag aaggctcctc accgcttcat tctaaactgt 420 tccttgtgag cagacattcc tagccaggca gccgtcaagc tactgagagg ggagggtggg 480 ggcagagagc tgccccgtag cattttaggg cctggagatg gtcacaatgc aagaacaaat 540 gaatgtggca catgcctggt ggcgcccctt gataagggtg aggggagagc tgacgctatt 600 ctatttcaca cagggtggct gggaaggcct ttccgataag atggccccag cagtcgtgaa 660 ggaagaagcg gggcagatat ctgggtgcgg gttgggggcg gacagaattc caagttgtgg 720 ggagtatgag gtcctgaggc aggagtctgc taggcttgtt ccagggagaa agaggctgga 780 atagaatgtg tgtgcacgtg tgtgtgtgtg gggggggggg ggctgggatg gggtggggcc 840 agctgaggac gcagaggtgg gtgcggggtt ggggggggga agctctggag ttcctgcaag 900 agttgggaaa tttctactaa ataccaaaaa tgatgacggt caggacagag gaagtgggag 960 gggaggaggg gcgaaatgag aggaggagga ggagggagac agcgggagga gggggagaga 1020 qatgcggggg agggagaaga tgggggtgct catggaaagg gataagcagg gagcaggtgg 1080 gagtgaggaa gcggggaagg gttaggaggt ggaggggagc caggtccaac tttgcacgcg 1140 ggccacgagg gccccagggc tccctcagcc agaaacggaa gctcgggcgc cggattcccg 1200 gcggtggccc cgccccagtc ggaccgtctg atccgcgccc cgcctcgggc acgccccttg 1260 ctaacttagg ccccgcccct tcgcccatgc tcgcccgcgc cggcccgaat cccggtgccc 1320 agggcgtccc ggggggcggt ccgccccggt gatggcgcat aaaaccgctg gccacctgcc 1380 gggccgctcc tccgtgctct gcgggcctcg tcctcggagt cgctgcctct atcacctccg 1440 tccccgtctc ggtccctcca caggcgcgga accccgcgag caccgcgcgg gcgccggggc 1500 gcgcagac atg ggc aac etc tet aga geg ege egg gtg acc geg geg ctg 1550 Met Gly Asn Leu Ser Arg Ala Arg Arg Val Thr Ala Ala Leu 15 10 ggt ttc ate ggg etc etc ttc gcc gtg ctg ggc att ate atg ate gtg 1598 Gly Phe lie Gly Leu Leu Phe Ala Val Leu Gly He lie Met lie Val 25 30 atg gtg ccc tea ate ate aag cag cag gtc etc aag gtgggtgagg 1644 Met Val Pro Ser He He Lys Gin Gin Val Leu Lys 40 ggcttggcct gggacccatg cgcgggatac cgtccgaggc tggagggcgt tgggcgcccg 1704 ggaaggccag gcgcgcagcc ggcgggctgg cgacccggtg ccgggatccg cgtgccctgg 1764 gcccgggccc ctgagcaccg gagagaccag agggcatgag gcaagccagt tggccatctt 1824 tcccaggaac ctccccgact caggacgcag gctgagtttg ggggccaagg aggcccccca 1884 gggccttctg ctggaggcac tggactgggg ttgggaaagc ctgaaggaga gaccacctgg 1944 gagcctgacc tcacctgaag ggttcggggt ccaaggcggg cgtggagtgt ggccgtgttt 2004 ctgatgccgc caggagaagc cctggggcag actccatgct tcttgcctac tgtacagcag 2064 cctctgacgg tgtctggtag aactggcact gcactttgct tgcttcctgt gagcgcaggc 2124 ggacaggaac cctccaagca tgtgcatgtg aggctcacat gggtgcccag gccgccactt 2184 gtccctgctt ccaaaacctc cccttgcaga cctcttcttt aaaggcagaa tgggttgccc 2244 tctcctcccc tgccgctgcc ttcctgatgc agattggcag tgataagctg ctttactccc 2304 cagatccacg catgggcagg aataagccca aggetgeata aacagggtct ttcaggagcc 2364 cacagcctga gggttttcct ctgatcctaa ccttatacac cactgccctt tcaaccaggg 2424 agacaaatta aggctgtcgg ctggccttca gaccggcaga ctctgccctg ggtgtctggg 2484 cagcctgttt gaatgagcct ggagttactg aaggacaggc agattccaga gtatcacatt 2544 caagetaaaa ccattcaggg etttgaggee aaggccacag cacctgcagg gctcagaggg 2604 gaaactgagg ctcaccttgg cgcctcccag atacagccaa gatgeagage tgggataaag 2664 atgtggctct tgtcacttgc taattgattg ctctttcccc ctgctttagg cgagtttctt 2724 gagaatgagg actgggtcac atttcatgtc catgccccat gcccaatgca agatgettga 2784 gagatgaatg aatgatgaat gaatgaatga aggctgtatc tgcttagacc cggttgccat 2844 ttttttggct ttaaagatgg agcaacaccc ttctggtttt tctcgaggtc tctgggccag 2904 tggttgtctg ggtcatattg gccacagcat gtcctttgtt ttgttctcaa atcttgtccc 2964 attaagtcct ttcctcttag acctcagagc tgcttttcaa tcagtgaaag ggagggatgg ? ktcttactt ttgtcaaccc gatgtgtatg tcctcctctg tttccaggct at Lggtctgt tggacagctc ggagactgag ctgcacgtgt tgctttgggg agaaactatt ggctcttcac gtgcacgggc cgggcttcag aggctgagta acaggggtcg cagggaagee gggtctctcc ctttgtaaga tatacttaca acagatacca tttgaatact tctgtgtatg agaaggtctg atttataatt tgatgaccag tacatttctc gctcagggtt tcacctctga tcctgtcaag tttcccattt ataaggaaac gttatggtca gaatgeagaa tatatttggg ggLtctttgt tcagtgcttg ttactcaggg ttttttttta tgggatcttt tcttagttgt actgggagtg tatattcatg agaatggcca atggagctcc sccagtggg aggatgacta attctgggac gtaatttgct ggacaggcat atggaccagg tggtccacca cgtgtagtga aatetetett gtaatctgat tggtttttta aacagaactg agtagctgta ccggctgtaa tcactcgtgt tgggggtggg agcccttctt tgtttgtgtg ggcttccaga taaaettgag ggctgagtgg aggegaaget tgaatagtac ccatgtacaa ttaatgaaag tetettettt tgctgtgagg ttctcattgt tagttgtggc gttgtggtgc aaactgtgtg ccaggacatg cctcgctcat agacttttat cgtattgaac tttgaaaatg gtacacttac tggatcacca tccgttttga ccatccagag tgtattagca aggttgctga tgcagacctg gccaggggtt atgatgaagt gaaggttatc tgaggcatac ggaatcctga gtcttttatc cacagaaaag gttaaaaaaa taaaagcacc aactgggggt ataattaatt ttttttttca ggcttgtggg tggagtetta tattatgtgt gatgagttca ctgggagagg gagggttgga cgtgccaggc acacctctca ggggtgtgtg gcttgtatcc aaccctgggc ggggaggtcc tggacctggt ttgtaaaaaa tgcagggagg attttgcctg cttcttttta agaaaaaaaa acgcctgcca ctgtatgcat gggatgggga ggacttaatg aatgtacatg gaagaaagca ggagagtcac tgtgaagaca ccggccaaga attaggagag cttgaatggg aagtccatgt tttaaaatat gettetttet ggtgacttct atgtgggctc aegggettag tctctgccat cattcttgtt tttattcccc agagatacac tatactatgt tttccatatc ctgtttctcc cttccactgg atttggtcac tatgaaacta tettgaataa tggggttgca ggcgtgccct gtgtcttcag gcaaaggcga acactcatgt aaagcccaga ccacaaatct cagtggattt caaagcggac aaaacactca gaaaaaggtg gtggtggggg aattattaat gttgcagcat atetagttet gccacaaacc ttagttaaag atacagagtg ccttgaggga tgagaggtat atcttggtaa ttgtcatcgt tgtgtgtgtg atagcctcga taggtctctg tgctgggcca agccttctcc agattttatt ΙΕοββ tcctggccaa tgaagtggcg tcccatggcg aaaaaaaaaa attttgtagt ggtgaaccct atgagtggaa caggtgtttt cgcacatgca ccactgtcct ccagcatcta tggaggegag gccttccgtc gaagggatgg aggacttgtg atataaaaga aattttattt agttgcggcg cttgttgtgg actagttgcg tggctctgca tgacaggtgg tgtaaaaaaa ttetegatag atcatggatg ctaaacagcc tgtcacattt actgactgat gtgcatttct agcctaatga ctcactcccc ttttggcggg cccgttttga ttgcttgctg ctctgaggca tgacatgtgt aagctgttgt gacatgtcag gggtctacac ctgggcagag gaacatgtga atgaaattet tggaagggtg gaaacatgct ttgtctgctc gcagagcttt ctgaccaggg cccagacttt gttagttatg tgggaggctc gaagaagact tcagactgaa atgteaatea ctacagttag tgtgtaaata atggagcctg ggcatgtatt aggggaaggg acggccgggg tgttttggct tggtgacatt ggaaaaagtt gccaatgggt gtagctgtga ttctgtgctg gtcgtgatcc tttatagttg ctttttatgg tgccctacct cagttgtccc ccataaatat cccagcccgt agaagaagag cctgttggtg ctttgatttc catgcattct atttgttttg agcaggggcc agcaggggct attcctggac gcatgtggga attcttcatc attcaagttg taccactatc tgtatttaga tgcagtttgc tcactgctgc aattttctca agaagagaaa cctttctgaa cacatttctg ttaatctgat aactggtgtc gggacctcag ggaatcagat gtaaccctgg ggtgtttttc ggttcacaca ttcaataggg attatagaga ctaattgaaa gtatttttac caccagactg ttatctgtga caggtcttaa tttagtttcg attgaatetg ttctttttaa aatccatagc acagctgagg catttcttct cacatttagg tctcaattag ggaaacaaaa gtctgaggca gcatgcgtgg cccaaattac gcttatctgc gtgggggaag gtgccgggtc gagttctgag ttgtggggag gtttttgctt gagetttate tgtgtaccct tgtgcgagag atgaagaatc cagtcagaag aatttctcat ggagetaaga cccaaaggtg gccagcttct tgtgtgttca tttgctttgg tactgtttta tttttaaccg tggctgtgct cctcttttcg ccagggcact cctagagcac tcttcctgga actgagccac agggaaaaca atcagattat catagtaata ttttcaattc atagtatttc tacatacctt cctctagacc gatcaagagc ccattattgg gcgtgtaatt agtttccaga gccaggtact ctagtttgcc atgtacccgt cttcctacag gctcatggca gaataggaag aagatcttta aaagccataa tagattteta acaaaagtgg agttcatact ttttggccca gcatgcaaac ggttttctgc acaaggagaa tttcccccaa ggacctgtgg cctttctccc agtgtaatca tcctgggaga gettaagaga aatcccagga ccctctctgt tggctgtctc tgggccactg tgggaaaccg ttagttgaag 3024 3084 3144 3204 3264 3324 3384 3444 3504 3564 3624 3684 3744 3804 3864 3924 3984 4044 4104 4164 4224 4284 4344 4404 4464 4524 4584 4644 4704 4764 4824 4884 4944 5004 5064 5124 5184 5244 5304 5364 5424 5484 5544 5604 5664 5724 5784 5844 5904 5964 6024 6084 6144 6204 6264 6324 6384 6444 6504 6564 catgtgaaat ctttagttgt ggcatgtggg atctagttct ctgaccaggg atcgaacctg ggccccctgc attgggaact cagactgtaa gccactggac taccagggaa gctccttctc tgccatcttt aaagttttat agttggaatc agccttgggt gctttatcca ctcatttttc cagctgccaa attcttccct cacctgtgtc cccagctcaa taaatgacac ctccatttgt tccctcaagc acaaaccttg ggttatcctg gatgcctttt gtggtatcct tgtatctgct ccatcagcaa aatctattag gattaccttc aaaacatatt tgcattctga caccttgtca atatctttgc cactctggcc ttctccattc accacttgga ctgatgctgt agtctcatct ctggtctcca tagacaacct gatcacgtgt cctctctgct cacagccctt taaggtatcc ccatttcact ctgagtgaat accaaggtca gtgtggtgac ctccctgcca tgatccagct cctgttgcct ctttcactgc accccctgcc ttggcccctc tgctcacctg ccacagtgtc cagtcttcag tgtccttgag cccactgagc ctggttccac caaactctct ggcttccttt ccccaccgct ctgaaggctc gccccccaga tatctgcata gctcacctct cacatcccta aaagccaccc cccacttatg ttacatgttg atttgtgcat tttctttctc cctcgtgggc aggagtgggg gctctcctgt cactctctct gtagtgaccc caggaccaga tcagcgcttg ggttcacaat gggatggtgg gatgaacaga ccctgagcgc tttgaggttg ggctcttcct tggccttttc ccacccccac tctcagcctc cctattttta ccccctctcc ctctgcaagg gccacccaag gaacctttag gacaccatgc tgtgtcccag ttgcttctca ccaaggcgta actgctcagt cgtgtgtgac tcttggtggc cccatggact gtagcccacc aggctcctct gtccatagga attttccagc aagaatgctg gagccagttg ctgtttcgtc cttcagggga tcttcttgac ccagggatta aacccacatc tcctgtgtca cctgcactga caggtgattt ctttaccacg gaatcacctg gaagccatca gttgcttttc gccctctggc agatttcttt . ' ί-gtgtcag ttcagaggtg ggggttgggg agagataacg atcatagaca ctgattaagc accagatacc cttctaggtg tttaacttgc agtcattcgc ttcatttagt atctaaatag cttcctcatt ttttattgag ggcaatggaa gcacagagcc gaaaagacac ttgccgcagg ctgcaccgca gcagcggcag ccccagattc tagctgggtg ggctgctgcc tgtggcccct cttccccact ctccgtatcc ctcagagctc aacttggtgt ttggaggcag ggcaaaccct tcccctgctc tgcttgggtc tctgcttggg tccaccgtcc cttgtccttt tcctgcacag tggggcggtg gggtccttcc caggcttttt tcctgatcat cacctccctc aaactgtgag tgcagggtgc ctcccgacgc cttccctcca tggctgtccg ataggcctgg gtgggctcta gaatcaccaa tgccaaggga agctgcctgt ggtcccagcg attctcaggg tggccctgct gtcctgcagg gtctgcttgg ccagctctgt tccctgtccc ctgtctgggg ctccagaaag ccccaggggt cgtgtctcag agggtgtcaa agtgttgagg gctgactgca tctggctgcc tctggccatg gaggataagg ctgtagactt gacctgtggc cgcagatcgc aggggatgca ctcccttctc agggggcagt ggggtcgcag gtgtgttcca attttgttgt gtttttcttc ctctttcctg cctggggctt cctacccctc tggtgtgtga gagggcggct tccactactc cagagccagg gctgaaaaac atgggctatt tttagtttcc ctgagtgtca gttatttttg tttccctctt tgcttctcat ggatttgctt caccagtgtg tgtgtttgag agtgtgctgc atatacatgt tgatgtatgt atacgcgtgt tggtagtaca cgtatgacac atgaacatgt gttggcacgc acccacgcac acttgtgtgt gaccatatgc tgaagcatgc acacattcat gttgtgtgtt ggcatggggg cacagtgtct ttgtgatagc atatgtatgt atgctcatga .icacatgtgt acacacacat tgacatgtgc ccacacttgg ttcttggcac acgtgggttc acacgtatta ttgttatcca tgtgtatatg cgtgggttca catgtgtgtc ggcacatgct gggcgtatag ttacacatgt ggacacctat ggtaacacgt gttccaagcg tgttggggtg tgtatacaca cacgtggcca tgtgtcgtat tgcagtctgg ctttctggag gcctggcccg gggctgtgtt cagtgcacct aaagaaagaa agaaagaaag aaaaagtgaa gtcgcttagt cgtgactgac tcttgtgacc ccgtggactg tagcctgcca ggctcctcgt ctttggaatt ttccagggaa gggtactgga gtggattgcc atttccttct ccaggggatc tcaggagggc ttccctggag gctcagatgg taaagagtct gcctgcagtg tgggagacct gggttcagtg tgcctggctt ttcccatttc atgacatgtt ccccaagcct tcctaggatg actcatactt gccaggcctt ctctctgtga cccatgtggt tagctagaat ttagagaagc ttggctatct ggaatcatcc tgttatgact tcaacatgta gcaaacggga tggaagtgcg tggatgtcaa ggacttcctt gttgaagatt ttcattttcc cttgggcagt tttattctgc tggaacctgg ;cccaggcac gtctgctcca tcagtgactg tggatcttgg tgcctggaag catgatccta tgtgcttggt cagcagcaga gaggcccctg ggcagagagg cccccccaag gcaggtttca gccacaaggc tgacttctct ggctcatcat cttagaatta gagaatttgg ttacgagagc atctactccc cttcccccca cccctcttct gtgccataga gatccagcag ctttgtcccc ataaacacat ttaaagtgca aagaattcaa ctctaggtag gactcagcca aaaaaaaaaa aaaggagaag ttcttttatg tacctcatct cctacccgct ggttcagatg tgaccttggc ctccactggc ccttggaggg gccatgggag ctgaaatgca aagagaaaca aaaaccaaca ccaaaaagct cattcttggc tttggggctc tctggggccc tggagctggc gaattacagc 6624 6684 6744 6804 6864 6924 6984 7044 7104 7164 7224 7284 7344 7404 7464 7524 7584 7644 7704 7764 7824 7884 7944 8004 8064 8124 8184 8244 8304 8364 8424 8484 8544 8604 8664 8724 8784 8844 8904 8964 9024 9084 9144 9204 9264 9324 9384 9444 9504 9564 9624 9684 9744 9804 9864 9924 9984 10044 10104 10164 <080789 ctgtccaggg • Λ gaatccag -cttccccc ggtaggagga gttccttcca ctcttgggct - jgcacgtc Lgccatcttt actccagcct gtcatgctta tcctcccacc a-'iagccttgg ccatcttcaa tgtcaatgca acttttaaag atgctacaac gtgccctagt L:.acccgaaa gccaccaccc ccacctttgc gcaatcagag cctccgagtc ccctttctgt ctaactggca gacgtgtgcg atgaatgtct cccctaccag gccaccaggg tacgaacttt cagaattcac aggcccatga gatgcctagc gagtggtttc gggggctccc ctacaggagc ctgccacagt ctttctttct acactcctgg cacttatgta tgtctctagt tctcattgag agttgtggcc gaacccacga ccctatgctc tgggtgtggt tccctgcact ggttacgcca aggcagtgaa ttcttttcct cttctcccca tcaaatggta · 'atctgtg atactgttca gtatcccatg ccgagccagt ctttggcttc cctgggagcc tgcttgtatt gttggtgtct agttgtcact gtgcctggga aggtccgggc acctccaccc aggaatagga ccttttctgg gctcttgaac cctgcactaa gtctgggccc tgagcatcca ctctagccag acgttcccat agtcagcctt aatatatgca gggggcccgg ttcacattcc ttagaaaaaa taagatgtgg aacacaaaag tggtccaagg tccctggcta catcagcctc aaggtgaggc cctccccttc catcagcctt tgattctctc ttcttttttt ggatcgaacc aagtccttct ccttaccctg ctttgtatcc gggcagggac acatagtggt acagggaggt ctccccctgt tccctctccg agaatgttct ttggctgtac aagtggaagc tgtacgtact tgcagggagc gtggcttctc cacaggctta tccctgcatt ttaaaaataa atgaaaccca tctgtctgtt cgcagcttgc agcatggagt cccatgcaca gaagcctttt ctcttgatga ttataagcat cttggttgag gttgggaacc gagaggagtc aatgctggct tggtctttgt ccagagatat tctgattgat ggggccatct cccacatttg ccctggtgac catcgtttcc gtggcccaac aagctgctag tcagatgatg agcctttcct ctcccaaatt gtggccagct tgcttgactt ctcaggccat gattctctca gagagacctc gtttgatccc aggacaaaag aaaaggtccc aacagctaaa taaaaatgta caccatcaag ggtttttcag ttctgcttaa cttatgttgg agcttgacct attgagttct tcctgcctcc ttttttttgg tgtgcccctt ctttttgaat ctgtttttct tgtttattgc cttgggtttt aggttctcga acgtgaccag gtggctccac ggccgtctgc ttattgtttg ctcacagcct atgttgtctt ttatctgttt gggggctgct ttgttgtggg gttgccatgt ggcaggtgga tgtaaattgc tttgctcctc gtagcctcac aggatcttag cctaaccact gatgttcttt tcctcctgac ttacccctct tccatgttat gttccccggg ctggtctagg caatcgggat cttcccctcc ggtgtgttca ctctctgact ccctcctctg gggggtggta aagctcagag cctgggcaca tcctgtgccc ctgtgcttgc aaggactctc gtgtctcctt ggctgaggtc tatatcctag ctgtatctca cgcatcactg cgcttctcca cttcccacgt cctggtggtc tggtcagaga atccctcatg tcatgcccca taaataaaca cccagaatcc tttcacctgg cacagcagcc ataaagcccg cccttgaggc tgcacccggc tccctttgcc tttaggcctt tctcactgtg gtagtgcaag attgcaagtt tctgttgccc ttattgtctg gttcattgct atagttactg tggcaagttg tccacatgaa tcctactcac tcttcttctt gcggaacttc aaccactaga ctggctgtac ctctagctgc gcttgggctc ggcatgtgga ttcttattca atcatttcac atggcctgtg agacttttct ttccccgacc ggacaaccaa cctgcctcag ttttatgctg cctcccccac tatcttctaa acaggggcct gcagagacct cttcaaattc ttcccgtcct tggattcagg ccagtgactg ccccaattcg ggttaaaaaa tcattctgct gctggcttca cgatttattg ttcctggcat cagacgcttt atctccctga acacgatctc gcccaggcct gcccgggtgt cccctgcccc tctgccagct gggacctttt tagtggctaa gctagatccc ctgcaattaa atgaagatca gataaacgta agcttctctc attcctgcac aaagggatcc gcagtgggcc ccgtaccatc cctgctggct cacagctctt tgttcggatc cagcatgcgg tgtggattct ttcttccctt catcatccgc tttctctcca gtgtcccaag aatggatgtt tcaccctcta gctgtcctat gccactcttg tgggattatt cttgactagg ccaccaggga tgggtcctca ggtgttgcag tagggctcat atcttcccag ttggaccacc aatactgatt agcccctttc tcttgttgtt agggatcgaa agaattcgcc agcctttgca gattcttttc tccccaccct cctgtcaeca cgtctgtctt ggctgggaag atggatttgg atctcccgca acctgaatct ggtgtttttc aagggacatc cagcacctgt cagaacctcc ttgtctggct cttcgtgctg ttggggtgaa gatgtgtggt ccgctggcca acacgtctaa ttccccttga tcaaaggcaa agaaettcat cccccggccg gtttttggcc gactccacgc acagggcgca gagatttege aagatcccct agatactaaa cacacccagg atctccgtgt catgaaatct cacaccatcc cgaacctcac gttcctcaga tccctgatgt tcactttctc gaccttactt taaccatggg tccccggtgc tgagatactg tgagagtgtc cacttggaac tagaaaaega tggtgacgtg ctctcaccta tccattttcc tttgatattt gattgaacct agcccagctg ttgcgagggt cgtaccagct gggcttcagt accagggatt agggaagtcc aaaaccttct ctgcatccac ttttgttttt cctgggtcct teatgagett cagactgttc atttttaagc atgaacctac ttctggaatg gttcatgact ggaccttagg aaggcagact ccagagagga caacaagtcc ctggctgagc ggtttatgaa cttggcccag 10224 10284 10344 10404 10464 10524 10584 10644 10704 10764 10824 10884 10944 11004 11064 11124 11184 11244 11304 11364 11424 11484 11544 11604 11664 11724 11784 11844 11904 11964 12024 12084 12144 12204 12264 12324 12384 12444 12504 12564 12624 12684 12744 12804 12864 12924 12984 13044 13104 13164 13224 13284 13344 13404 13464 13524 13584 13644 13704 13764 gggcccaggg agggatcctc tatttccctc cttgtcctcg ttgctggtga aatcatttac gcagagaggc •b'.qggatcca gatggccacc caaagggaac taaagttgta ccctgagcca gatgcccgtc ggtggggtgg agggtgacag catctcattg ctaccttgga aatgtttcat gaaacaaaaa gcactgtcag gggagcaggg caggtagaaa gattgggagg tgcaggcttt ggaagagaga ggagttgacc tcaacagtcc catacccttc ccagggtctc ccttccacct tgacatgtca ctggccagag ggcagcctgg acttaacctc tatacagggc cagccttttt taagggggat ttttcttaca ctgacttaga accttataca cactatgccc caggcacctg gccattccca gttttgggaa ctgatgctga gttgcttgtg agaaatattt tgcttctttg ttacaacaat tttctcctcc aacactagtg ttgtctcttt ctttgagtc cctctctcac gtgagtttga ctcttgcctg gaagagtcag ggaaatggca tgggctgctg gcagttggac aggtgtggag ctgctggcat ccactgcatt tgggcagaaa tatgtacttc ctgcactcaa ggtggggagg gcctgaatgc tgcgccacat tttatggagg gtatgaaggc atcactgtag cttggagttg gtggtgccct gcagcagaaa cctcccactg ctgcttgaga aaactcagat cccagaggga ggaagactgt cttgggagaa gttcccaggg aggtgtttgt gtctttcccg taagcgaagt gggaatcatt cccggatgaa ttcacctagg tgggagcatc gaatgagaag tcatcaaggt ttttggcatc gttcaaatcc tctgtgcctt tcttatgaag ggcaccaggg agttttgaga tcagctccac ataacagctt cacatccatt actttccagc ggtagctctc tgagcagtag agttgtgaac caatttgtag aacgtgatga ttttttgtaa atctcatgct tttttgtctt tctaatccag tttataaagg ctgcatgaac agatgggagt ccccagcttg atcgccccac gaaaatccca acacgactga acccaatcca tctatggggt tggaagaagc ng gctggcctgg cttggcttca gaggccctgg tggcccacgt ctctgtacat taaaccacaa gagcttcctg aatccaagag gggggagaaa gaccttcaga tcatgggctc cttgagaaat gagaaggagg aaaggaaaag tggttgatgg cctctgccta gggtggtaac tgttagatct gctaggattt tgtcaagtgg gcccagtggt tcctggtctg tgtaaactgg ggtgggagcc ttctcacctt gtagctagca ctcctgacaa acagtgagga cccttgcaca catgggacag caggcatggc caggagctag tggttctgcc atttcctcct atggggtgtg actggttttg tgattcaatg ctcagatcat ggcaagtgtc gtaggattag atcttgcttt agtgggtatc tgttcttttc acagtgcagt catttgcact catctcactc ccgccagtca cagatgacat tattgtttga actagtcctc gataggccag gcacgttttc agagccctcc gcagccagcc ggactggaag tggacggagg gcgacttcac gtgttcttgc cgcacagagt ccctgattcc agccacctca gctgggtggc gtcatcatta gaggctggag ataggatctc gtcaactggg tggccctgtt ttaaacattc ctggttgctt ggtaattaga tgattggcag ggactgctct cctttttccc ggtgggaagg atgcttttct ttgtagtgtt taactgatca ggcactcagt aagtcaggcc ggagggaaag tgtgaaacca tatgcctgcc gagaagtgtc aaccttggtg catcagaact ggtatattct ccttgttgat ggtcggtgtg cagagagtgc actggaacag ttctcaaacc gtggacccaa ctttcttagc ccgtaaaatg ggcacgtgtg tggaagacat catcacgttt ctggcattag acctgagttt ttagttggtc tctgactcca tagatgactg ccaccctgat gaatttctgt ctctgtctct tggagcactg ccgtcacact tcagagtctc atcatgtcct cagccctgtt tgttttggca ttctgacaga tggctgagtt ccctcctgca cggagaaggc agcctggtgg tttcactttt ctggagaatc cggacacgac atctggcctt ctctgcctcc ttggattggg aagtggaatt ttgggagacc atgtcgtctc tcagtattgg gtttctcctg atttttaaac ttaatttccc gaattttccc ggcttgtctc gattggtcaa ccctaaagca actgttagga ccagaatagc agagattatt gctaattgtt tccatctttt agagagcaaa tgggtgatca agtcatgagc cacccacctc agggctgggg tgcactggag tgcccaggta gtgaaccagc ccttgtccca ggagtgaccc cctgtgtgcc ggggagctgg cccaggattc gagcgtagac tgtatgtctt gaattaatga acgtgcttag tttttccagg attgtgcact atcttgaagg tttctcttgt actttaccga tctcttctct aacatcccac gtttcagttt aagccttctc cgtggccaaa cagcgtgcgt caggaaagct ttactgtgcc gtgtctggtt ctttttactg ggatgccctt ttcctacaca gggatggata gccagcctgg aatggcaccc gccacagtcc cactttcatg ccagggacgg tgaagcgact ggctctttca cagagggaga ggaggggtgg gtttatgttt caggtccagt aaccatgcaa cctggagggt tgggtcctgt ctagggctca catgagtctc agtggccggg atatgcttat ccttggatta gggagactga gaaggaggaa tttctcactt ttctttgtct tctgtcaggg attctttgag ttaggagtga gatgggctgg taatgttttt ctggaagcag tgtgccaaag ggggtggcgt cagatgcaga acacctgtca caccctagga acctggacag cgagtgagaa caggcagtgt tctctagggt ttcggagcca tggacaagtg aagtatctcc aacgtgggcc gacccaggtg ttatttctgt ttggggaccc catcatatta aatgggactg gaattttccc ggttgtacca gaaaactttt tcgagctcca ccatctggga gtcttaggac tgtgttggtt aagagcacta gccttgtttc aacccttcac caatttggat aaagtctcct tcgggacttt gcccccccgg ctctccagca atggggtcgc cactggagaa gggagcctca taacggctta gctgttcctc 13824 13884 13944 14004 14064 14124 14184 14244 14304 14364 14424 14484 14544 14604 14664 14724 14784 14844 14904 14964 15024 15084 15144 15204 15264 15324 15384 15444 15504 15564 15624 15684 15744 15804 15864 15924 15984 16044 16104 16164 16224 16284 16344 16404 16464 16524 16584 16644 16704 16764 16824 16884 16944 17004 17064 17124 17184 17244 17304 17364 atctgcttc cttccagccg catggaaaca ttgcaactct ttgtcttccc cccatctggc actgccgctg actgcctgtt actttgaatt gctcagtagt gacctgggat cagggaagtc tataatatca ggggctggtg tcagaatggg tacaatattg at tatatact attagtgtga cagaagcttg gctttatctg tattctctca aggcctttgg ' ttagagaac cetccataat aagatctcag gaaccaccca ttaaaaacgc gtgcttactg ttccctggtg ccctggttgg «:atatatt agttgttgag gtgaggccac ccatgtttgt tggtagaatt gctctggaat actcaaaggg aacaaaaacc gacaatttga agccagattg atttttcagg ggaaggacca gcccacgttt caaacccagg ggctaccccc catcagccca tttgggggtc gggagtgcct tttcacaggt tttttttatt , itcagcta cactcatttt cttgtgagag tggccccccc aggcttttgg gccctcataa gagaagtctg cttccagcct ttgttacagc tttgtcttgt ctaatttcct ccctcagcca tgatgccttg ggggtgccag agcctgtccc ctcttggctg gaatcccttg cccagggtcc ttgttttttc tgcagtgcat cgaacccgag ccctttcttt tttatgaaac cactgggacg gaatacatgt taaagttaaa tgaaagtaag tcatctccag cttggcttct attgtgaact aaattcatac gaggtgatta ccccctgccc gtgaggacgc acttccagcc aacggactaa agaagtggct gaaaagccta gtccagtggt ggaactaagc ttttaaaaaa aaagcctctg tttgatgata tgtgaaatgg ggtgggtgat gcttatgatc gaatctgatc aagaaaagga taagattagt gactgaaggg acaggactag gaaggccatt cagatgactt taggtggagc gcagagctgt aggatgggtt accttgcacc gtcctatgcc tcacagctgg ggagtataat tatgtataca tgatttatat agacatggat aaatgcatat gaggtgattt aagagacctt cacgccagaa gccgccttat agcccagccc tcttgcttcc tagctctgat gcctgcccgc tgggctgggt agcctgcctg tctgagcctt gcagatgcag gcagctttga gcggattcca tgcgtttctc gggcttagtt tcccctgcat ttattgtgaa gagtcgccag acccaaaggg atacctgtgg ttaaataaaa tgtctaagac ataaaaaagc tatcatgtta ttaaatgagt tttgaaatcc gcttatgagg gccccccgcc agtaaaagtc tcctgttttt gacagaaatt ttggatctgg ttactgccac tatgacctca tcccacatgt agaataaagt gtttgttaga tctcaagtga cagaggacct gaaagtggct aaatgccagc tttaaaaatt gactgcctgt gtgtgtgtca gaagaccgga ggagctattt cagagatcac ctgctcagtg caccagggtg gggggcccag tttcttgaac tgttcccttt tatctcacca agtctcacct tcctttacaa tatatcccct agttagatga atggggcagc gttggaaacc ggttatgaca agagagctcc gagcaccctc gaaataaatg tgatggaata cattatgttt tccttgccct tcccctccag tgccgcctca gtggagatgg acagaagttc gtcactctgg aagaccaact tctgctgcag ttgttgtggc gcccgaaagc tggaaggcgg atattactgg tccaggttcg atggtatggg cagattcatt ttaaaaataa acacatgtta agaacctcat tgatgtctac ggaatcttac taatgtccaa gtggaaccct gccaccgccg tctagcccag ttaagccatc ggttccagga gcaatgaata gaagagatca tgctttcaat caccctcatg gattctcgtg gaaacctaag aaaagaggaa ggctgagtta acctgcctgc agaaggacag tggaaaagtc tgggaagaga acaagacatc aggcatgagg gactgggaaa cagggcttcc gagccatggg cgagtatcac ccacagccac cttggagtat tttttttttt ctgcattttg gttttatttt tatgtgttag ccctcttcaa gactttggac attcattatg taataccctc gtggatggag ctcacccctt atcggaccac ttgtttataa agacacatac gtgagaccca cacgcccagg ccctcatcgt tcctctggcc gatggcaggt ttgtgccagg atttactcgg aggcctcggg tctcctgctt acacagactc gtgtgggatc attcttaacc gagaatggca atgcacgata gagggaggag ttgatatatg ggctgataaa aataaatatc ctgccctcca atccctaaac tgctatgatc agtgatgaag catgaatagg cacagagaac aagagggtcc tggtctatgg ggggctctgc gaggctggaa ttaaaagcaa gcagggggca ctgtgtggtg ggggttcaga aggctgtgag cttgcaaatt tgattgtgtt agctggttct gacttaaaga tcaacctatc agaccaaggg tgccacctga tgggaggtcg atgctgttta tcctcaaaag gcccgggctg ctggagagcc agtgggtctg atgttgatcg cctatttctc gaagcacata attttatttt tttctgctgt cctccctccc ttcaactttt gcctgaatgt ggtgatagca ccttcctgaa ccaccatgtg gctagcaccc gccacccatt tctgtatttt tccatgttgt tgtgtggatc ctcccaggac tgggaaggca gagggccttc tccccctgac ctgagagccc acttccttcg tggattttca tagagcacag ttagttcccc actgggccac ttgaaatatg ctggatgctt ggaggagggt gcaaaaccaa aaaaagaaat taagataagc gaagcccctg actgggatta tgacttcctg ttaggaggtg attagtgccc tcccttgcct ttaccgaacc cattttgtga agtaatacac gagtcttcag ttctaagaac tgggttcaat tggccaagaa tagagaggag caaaatgttg gggggaaagg gcaacgtttt aagcacagta tagaattgat tgtattggaa tgtggctaat gcaggaaaat ggattcttag aaacgaggga tggggtcatt ccccccccaa ttaggcctgt gaagacagaa ccccattagg cctttggaat acatatgtga tttaaaaatt acaataaagt acacccccct gggttgatga ttgtgtttcc ttgggaggtc taggattagt aggacacagt tgatcccaga cggtgatgtt tttttttaat tacaataaac 17424 17484 17544 17604 17664 17724 17784 17844 17904 17964 18024 18084 18144 18204 18264 18324 18384 18444 18504 18564 18624 18684 18744 18804 18864 18924 18984 19044 19104 19164 19224 19284 19344 19404 19464 19524 19584 19644 19704 19764 19824 19884 19944 20004 20064 20124 20184 20244 20304 20364 20424 20484 20544 20604 20664 20724 20784 20844 20904 20964 cacgccccat cgagcgtctc ctgatttcct ttccgaagtg gaggtgaaat gcacattcac atcctttctt uiggatgtat tgccaggctt agcgctttac tgtttatcca tggtgctgct t< taaaaaaa tctttagtgc ctcgggcttc ataggcttag cctgcattgc tatatttctt ccctgggggg ggtctgcttg cctggctctg ·ί tagactcc atgggctaat cacatgggct tcttagccct ccatggcttc ttttatgacg acttcccatc gttgtagggc cagaagggtt ctagaatgcc tccttcttcc ccgtgggggg agaaatcttt ggcatctgtt gattgtagct ccgctaaggg agggctttgt tatttgactt 1 c ccctacc cugggaagtc ccaggaggac tgttgccttc caagtgtttg ttggattctc ctggttttct cagcttaaga ccaagacagc aattgaaagt ggggtcacag gcctaagaca cagaaaaaga tatagctccc tcctgacaaa ccaggacccc tttgttctag .agctgtg gctgaaactg gatccattgt agggcaagtg cttcatatct cagctccagg ctagggtcca atcgaatcag tcacataacg ggtgttgtat ccttccaact ccgttctgga cttcccctca tcctttttat tctatcggtg ggggatttgt aaatatttta ttggccttct attagttgca ttgccccaag agggcagatt cttctcctcc tatgtcttta gaacagtggt ccttttgcct cataaaatag aggtggcaag gccagagcct gctcttgtcc ttctaatgcc ggtgtctggt gtaaagttct acgcatggga cttgccatgc agcggttgcc atttgtaagc tacacacagt tgtccccagt cagctgtaga gaccccacgt tgtcctgtgg cttcacgtgg ttggccacac aggaatcaca ccctccctgc ctcatctgga tgaggttcca tccgaccttc taggaacttg cagctcccac catgccactt ccccactggc ggggacttcc gttccatccc ggataaataa gtcacaactg ttgccccaca tagtgtttgt gcttgccttt cccggaactc ggctttgtat tgaccaaaga gaagaaacct tgtttcctgg gtaaaatgtt ttatgaacac caaaaagagg tgttccgttt taaaatgaat aaccaccacc cccctgttcg cattcccttt gcatcatgtt ggctgaatca agggacactt gtgtacacat tttttggctg ccttgtggtg gctcccgggt tcatgtggaa cttaaaccac tccttctcat aataggacat ccggagctcg gtgcgtgacc tacaaaccac tgctttgagc gggaagagag cttcatcatc tggatttccg tccttccact cacgtatttc agggggaggc cctcccacat atgggtgttg caatgggagt aaactggaga gaccaaggtc ggctcagtgg accctgggct tcaccttgct ccatcccctc tttttttatt gccaggcccc cttttcttat gatcagtaac gctaggcatg ggaccagcag attttcttct aaactaaaat aagacagctg accagaaata ctggtggccc tcattgggga agattaaagt caataaaaaa gcggtcctgg gttcactggg ctccaccttg accctcctgt acggagcgct actcgttcct tcctgctggt gacttctgta Hot ccatgaggct tcttggccct caaacctgcg cattacaggc catttaaagt tctgtctgct ctggcagtca aaatgaaaac tccaaggttc tatttcactg tggttatttc gtttattttc tgttgggtct gcttctctcg tctagcgctc tctccccaga tggaccacca gtctcacccc gtatgtcctt gttttgagca tggggcaggt gccttcccaa tgggcatggc cagacctctt tggaaatcta agtttatatt cctacctccc cttgggatgt aggggggcca ctcctccagc ttttcttttg acagggtcga tagaccccag agctgcaggg gagagttcag attgtctgcg gtgtaattgt tgtatgcctc gggctacact ctgcagtgga ctgtcactga ttgttcacat acttcttggg aactccaggt gaaagtcaat acaggtagag gacgggacgt aggaaaataa actggttatg actaggatcc ttcttaaaaa aaaagaaaga ctgcaaaggc agcaggatat gtttggcacc tcctgggctg gtaaaggctg tgggacctga gacggccatg acacatgatc Wil gtcctggttt tgccctcgga ggttcccgga tttttattta gatccattca tctagaatgt ctagtctgct ctacactgca ttcaggttgt tgtgtggatg caccttttga cctttgaaaa tcgttgctgc tgaagcacag gggctcagta tcaggggtga gggaagtcca tcactgcccc gtgccacagg aggtaggtgt ttcccaagtc agggttgaaa caggcaggtc tcttggtccc tccacgtatt cctctcattt caagcagcaa gcagggcctg gagtaatcag acctgatacc catttctaag ggctcagagt aatttggact agaggacaga ccttattcag gtcagcatag catgtgtgtc tgtgtccttg gcgtacatgc agtcttaacc atttaggacc ctccagagac gatactgttc tcaaatccag gtcctctctg cggcctcgga gcttggtagg aataggggca accctgagct cacatgccat aaaaaaaaat aaaggcagta aacttgggtt cttcccgtca aagggggtat agggcctgtt gggctgtttc caaaggaaga ttgtcttctg acagatgtct ctccatcgtg gtgcacgagc agtgccagac ataacgtata gtggcagtta ttctatcacc ttctgtctct tggccctttg agcctgtgtc aaacacattc tcactgtgaa tattgtctcc acgtgggctt gctctaggct cttgtggtgc acccatgttc tttgtctcct tgcacccatc tggtgctggg ggaagcccgt tctgggtttg tgaagatcga ctatgcctag cgactcctgc cttgtctggc tatttattcc acgtcctgga ggacagccag acgtgccttc atctggcctt ttgtgttcaa ttggggggac tggtttaatt ggatactagg gatggggagg gggtcccctc tttatttccg tctctaattt aggatcttag actggactgc caccctcagt acttttccag gacccagaac gccctggctc caattggcag tgtggcatga acggctcttg cagtgaaaaa cccaattgca gcatagcctg tgaaagcata cataaaaagt aatagttcct ggtccaccca cttggagacc tctgtgtgta tctatttact cacaggtccg gaactttctc tttattttac 21024 21084 21144 21204 21264 21324 21384 21444 21504 21564 21624 21684 21744 21804 21864 21924 21984 22044 22104 22164 22224 22284 22344 22404 22464 22524 22584 22644 22704 22764 22824 22884 22944 23004 23064 23124 23184 23244 23304 23364 23424 23484 23544 23604 23664 23724 23784 23844 23904 23964 24024 24084 24144 24204 24264 24324 24384 24444 24504 24564 $£0 80711 :. '· ttttggcc taccccctgc tgggtggttt gaggtgttgg ttggcttgtg gtctttgcta atcttatttt tggcccagtg gggaactaga aataaagtca aacgcagaat cactaaccag gacctccagg accaggctgc gcaccccact cagtccatgg ttcatgcatt ggacggggga cgacttcact .gttcttgcc tcacagagtc tgagttgtag cctgcctgaa * ttgtccca Ltgtgtggtc ccgatgatag gcagccattg cttgccaggt cctcaatttc tgtgagggat agccgtgagg atgctcagtc tccatgggat cgacccacag caccagggaa atggaggtcg ttgagagccc ttccgtatct aatttaaaaa tatatatagg cctgagtctc tctctgtggg aggggatggt gtggtgggga ggcacatgga gggctggggt tgcaagagga tgggacctgg gcaggggaga gggggttggg tgaacagagt • tgcggtgtg aatggtggag ggacttccct tgatccctgg gcacagtcgc ctcctctgtc agtatatctt ggattcttta aaaaaaagat acacctcaag attggaaggt agaatagaga ccatactctc tccccatccc ctgtggacac gagatcctta gttaagactg tcccacatac tgttcacaat ctcttagttg agactgaacc gaagtctcca ctattgtata ccagtactct ggtcgctaag ggagaaggaa gcctggtagg ttcactcttc tggagaatcc ggacacgact taatgtttat gttacacagc aggttgcagc catgctgcta atacaaatct gccagggtct tgatgtatcc ctcctctgta aagtgggttg aggctgcatc gtgtctgact tttcccaggc atcaaacccg gcccagctgt tccagggtcc ctcagggttc ctgacagtac tataatttat gagggtgagg tgtttcctca attcagggag gggggtggtg tgatgatgag atagtgtggc tggagctgga nnnnnnnnnn ggaggagttt ccatgatctg tggggggaag ccagatccct ggggcagaag ctgttttccc ggtggtccag ttagggaact tcagccatgt catcggattt cccgccccag ccactgagcc cctgtgtgcc gcatgtggga ggagtcttaa tgtcttctct actaaggagc tctggtctct tcatcattgg attacatctg tgtgttccaa agcatggcgc taaaaaaaat cagcatgcag tgggccccct tattcacagg ggttcattgg tgcctggaaa aatcggacat atggcaaccc ctgcagtcca actttcatgc cagggacggg gaatcgactt tttcccgctg tggtgtagac ccagcctctc ttaaaaaaaa agatttctag gtccctgttg tagttacatg aaatggggat ataaatggga aggctggcct ctttgtgacc aagaatacag tgtctcctgc taatcaccag tgggtgatgg tggcactgct ttgtgctttc gactataatt attcagaaaa aatgtcagat caaagtgctt gagtgggtgg ggtggtggtg ctggggaagt ccctgtccct nnnnnnnnnn cgatatggtt atgcgtgtta ggctggggag tttgcaggga agaagtcaaa agatggaaat tggctcagat agatcccacg ccgactctgc tccaggcaga ggattgaacc acttgggaag gcagctaaga tcttagttcc ccactggacc ctcagttctg cttgtgtctt gcctttatct atttaaggtc caaagacatc tgcagagggc atgcagccaa taatttggct gatctttggt gcattgggag ttttggggca atcctcataa atcccatgga gactgagcga actccagtgt tggggtcact attggagaag ggagcctggt agcagcagca gagtcatgga agaacttgga ccagaattca tgaaactggt gcaatggtga gatgaggtct gccgtgggga aatcatagcc agtgagtaag tgtagctgtt ccatggactg gagcaggttg actggcaggt cctcttttgg aagcgttggt tatggcctta tgcctgctta atcattctat ctggccatac gagatgatgc tcgagtgttc gaacatggga ctggggatgg gggagccgag gggagcatcc nnnnnnnnnn ttcagttcct cagagccctc tttgggagga gagtcagcca ctctttagtt atacaggagg tccatgcccc tactgcaact caccccattg atactggagt acgtctcctg ccccacctaa tctggtatag ctgaccaggg aacagagaga gagaccagaa ttggtgactc cccatggcgt cacccatgta tttttctggg acaggttctg aaaaaaagac gtgccaggtc tgtggcatgt tttgggagtc gaacttcctg cctcttctga cagaggagcc tttcactttc tcttgcctgg aaaagtcgga gaaatggcaa gggctgctgt gcagcagcag ggctcagaga ccagtgcctg gaccaggttg cactaaagtt cagtttggaa gttccttggt agtgacttgg ttggcctcat tgctgttggc aattgtatgt tagcccacca ccatatacag gaattcttct aatacattca tgtagcggga ggtgcattgt agtgagggaa tgatagtata ttgggcagtg tagtgtccac cccaccctta gtggtgggga gaaagaaggg gtggctgcgg tggtcctccc nnnnnnnnnn tgagatgcca tggtgctgtg ggcagtgtaa catgtgctga tctatctgag gtggtcaaaa ccatgcagtg aagagtcttt actgccaccc gggttgccat cgtctcctgc cagtctgtat ccaaataaat attgaaccca cccatacaga gtctgcagtg caggcactcc ctgcctctgt atccagaatg atttccctag ttccaggtta cttgtctcca tttgttgtgg gggtctagtt ttaaccactg tgcgctaggc gaaggcaatg tggtaggctg acttttcacc agaatcccag cacgactaag cccactccag ctatggggtc caaactcttc ggctgaggca agctcctcac gagagatgtt taaagatggg attctacgcg aggcctcatt cccttccagg gggttatagc tgcagttgtg gcatgcgtgc ggctcctctg gggatcttcc accactgagc gacttagttc agctgggcag aaatctcggt taatgaaaat tgtggcagta atctcatctt ggcatggagc cagagagcca tcggggggtg tgtgtggcag ccacaggtct tgtcctgtct nnnnnnnnnn gtgttcctga aatagaaagc ttggaaggag cagatgagac ggactccgtg gcaggtggag ggcctgggtt gtgtgtgcgt caccgccagg ttcctgctgc attggcaggc gccacatcta aagtaagtat 24624 24684 24744 24804 24864 24924 24984 25044 25104 25164 25224 25284 25344 25404 25464 25524 25584 25644 25704 25764 25824 25884 25944 26004 26064 26124 26184 26244 26304 26364 26424 26484 26544 26604 26664 26724 26784 26844 26904 26964 27024 27084 27144 27204 27264 27324 27384 27444 27504 27564 27624 27684 27744 27804 27864 27924 27984 28044 28104 28164 atatataaaa aactcaatca ccaaggaaga ttggggaaat ctagtaaaaa ctgttggagg caaaaaatga tcaaaataat ttatttgcaa aacagaatgt ctgacgcagt tcatgaaaag gactcataga gagaagttgc tgaagatggt agtttaacct ggcatggatc cattcccagc ι Lccaggct ttcttgaacc cctttctaca gcgctgacac gacaggggtt ccaaacaggt 1.l itccctg cgtgagtttc caaacattta gtatgactga ctccaatata tgcccagaaa catgcttgag ctatcctctg tgcttgtctt tcggtggagg tgtttcagca ttaccaaggc tctgtcacta cagttttctc taaatgaaag caagtcgctg gatgtttcca gactttctga tgtcacacac ttcttcctct tgggcctgta tggaagcaag tacccagtaa tcaagtaacc ccaagggtga tttatcaaaa aggcttgtga accattgtgt getaccagga cgaataccca ttccccagta tttagtagct tctttggcca actccctgta gccagtgtta ttgtgtgtct ggagatggaa caccaaaaaa tatacagata gcaaatccta aaaaatgaca gattgtaaaa aaacatagaa tgaaagcagg tagccaaaag ggttcatcca ctacaatatg acacatattg gacaaagggt acaatgatgt acattcgatg gagagagggt gggttcagta tgcttgcaaa tacagcacca cgggccaggg cccgggtgca cgaggaggaa accacattag tctgtctcag agtgggggct atgtaaattt agaatgtatg atcctttggc aaatagaaag caggcaccag aaattgccca cctgacttat aaagagcagg atgagattgt gtcttctccc agtagaatgt ctgggtttgt atcaacaaaa cattgcttca gtataatagg gatttattca gccttgccct atcactcaaa tattgcaaga ctacagtcgg tcaggatttg atgctggcat agcagcatct ctgctaccct tggaatcaca gatagaccca gaatatacag gtagaactgc ggaatgggat gtatcccaga gattccccaa catcacgtgg gtggaagtgt aatgatgttc gaatcatttg agtatggggc gaacccaatt accaacaggc accacagtga gtgattggcc tggtgtagct ttgccatcag gacttgaaga gtgaaaacaa tattttggaa gatgaacttt tacgattgat accaggcgct aaatgtactt ttaatgtgta tggtacctgt ggtggtagac agatgaagtc ttgcgccatc tgagtggagg ttcttcagag ggggaggtac tggtagagga cctctcacct tgtctaagtg catgtgttgc gttgggagga tgtccacctg ttaaaaaata gccagatgtg ctttcttatt gtggagaaag gccagttgca gcctgattcc tcccctgtga tagggcccag gcccttgggg cagagcagat gatggaatcc gagctttatt gcagttcagt cataatctca gccagaaaga ggattttttt gggccatctt ttttgtggga catcatatca tagaatcccc gacttcttcc cagtgggtac cattgcatgt tgatgtcctg tgggagcatt tactggggtg gtgtatacca cagcatgcca catgcgggtt ggagtcctaa cagtgccagt tgaataacct 110 β ataaatctgg agaaaatggg ataggaggaa gtgatcacct aggacgtgga actgtggggt atgcaacaat gctaggtaca tccacgtgtc tgggattcag gaggatattg tctacttatg gatggggata catgctgctg ctggagcaca ccccttcctg cgggttgccc tttgaaggag ttacaagacc aagcctcatt cagtgcatgt tcacgtctcc caaatagtaa ccacatggtc ccacaacagc caataagtat gagtttgggg aaattatcac aaaatgtaaa gcccacaggc ggggtgaaat tggggctgaa ctgcctggag cctggggtca tcctttccca gctctgggtg gcaagtaagt aatggtacct tttgggctga attgtgcttc tatttcaggg tgatgactgc gggatggtac tttttttttc ctctgagatt gaaggggata gacaggcaga tggtgctccc agcatagctt tgatattgtc ggctgttctt gttaataatt tgtgtggacg ttgggcatgg gagtgtatca gcctattgac cttagttcct ccgctgggcc agatatgctt gtcattttcc acttacagtc ccaaggactt gcgccctgca catgcctgat gagattgaag aagtctggca tttacctctg cacccatgtt cctccataga cctcagaaag tgctgagtga ggaggtcccc tagtttcagt agctgtagac attttaaaaa ccccccaacc ggcccccagg gcaaccctga ttggtgagtt tagcaaccat ccttggtcac atggcgactg atatttttca ctctatgtgg tttgcttgag tcttgtttct gagaatggat aacattgtta accattgtta tgtagtttgc tggaatgttt gtcagtcctg ttcccatcat tagaatcgga tccacaccta cagactagag ggtttagtct gcctcatgga agcaacagaa gggagagact cactgggtca catagtgcca aacgggagag tcagaagcta taaggctttg aaggtgacct actttcacaa cactcctttg agttttacct tggcttcttt cctcactgct gggttgtttc tggattttca acgtttgctt tcactcatac agtcctgcca caaccagtga gccagggaag aatgagctga taatccctgc ttggtaggag agagatttct tcactcatca ggaagggctg ctcttgtgca gtcagtgcct gggtacatat cattgcagta tggatggata gaaggaaatt aataagccag atgggaggca tggggaagat ttaaaaatgg gtcatgatag tcatcccggt gtgattacag gccgctgatt tccccatgcg cgttgtgtgg ttgattcttg agggggaggg actttagagg acatccttga gacaccaact tttttttctt acatgtacat atcggctgta gctcccagga tgaattgttt gaaggaaggg ggggaaattg ggtggtgtag actgcgtgtg cgatgagcct ttgaggaccc ctgggtgcct ctgtcagatt aacctgcttc ggaggtggtg gtgtccatgt gacatcacac ctctgttcag gacaggctca tgcccaatac ttgagcctgg ctgaacatcc ccacccagcc ggttttgtac gctcaacatt gtgtaaatat tggtttggag tttctcttag tagtagctga cagagtttgc atgttttgtt tcgaaactgt tcccactcct gctcttccta tcagctctgt 28224 28284 28344 28404 28464 28524 28584 28644 28704 28764 28824 28884 28944 29004 29064 29124 29184 29244 29304 29364 29424 29484 29544 29604 29664 29724 29784 29844 29904 29964 30024 30084 30144 30204 30264 30324 30384 30444 30504 30564 30624 30684 30744 30804 30864 30924 30984 31044 31104 31164 31224 31284 31344 31404 31464 31524 31584 31644 31704 31764 ctgatgaact ggcagagttg acaaactcag tgaggtctta cagctgctcc cctcccggtt atcaacaaat ctgacagttt ggttgcaaat aaaaagagca ettcctct (I :ter.tag gcttgttaaa gacggacctg cacactttga cccgtgcctt tgaggaattt k ttgggtccc gccaggaagc cccaatctgt tccccaattc tggctgacag caccctgtgt ggcctgtctg ccccaccccg tgtttctttt cacgggcttt tgttgtggag tggtttcggc gctctgcggc aggcagattc aagttcacac ccaccttgtc aggggcgcat cggggctgtg ccctcaaaga gctttgtaga gatgggacta tgtgatgatg >actggaa gcagacacct ttcgactgtg caggcaagaa gatcgaaccc cacctgggac ttttaagcca tttgcttcca ataaattetg tattattatt tgcacacagg ttgeattgea . r atctac ctggggctcg tgaccctcat tacagaaaaa tattgttaac cjtcagcactt aaacaattgt cgaaactgcg ccttcatctc ttgcttcccc gaatgaatga atccctggaa gggagccatg ttagctcagc ttttagaaga tcaagtattt gtggagttgg tttaactggt cagcaagatt ttcatctgta tctctgacac gcacagatat agaatcagga gaaccactgc tgaagctgcc tccaaatgat ttttgcaggg ttcctgagac cctgtgggaa tgatgctgcc tgcagctcgt cattgtcagg aggccccaaa ccccactgca tttaataatt cctctacttg ttcaggttct tcacgggctc acgtgggaat tttaccactg aaggaggggc ctggcggggt ggggaacaaa tgggaggaag agttctaatc tgtgattaca acgtcatcat aaagctgagg aagctaggtg tgattttagc cgaccccata tactgaagtg atgtetetta ctatttttga gtacatgttt ttaaagetag gtttgggttt atttttatgc cttagtttct aggtggtttc ttttaaacat cgtttttcct ggagccctgt tggaagagac atetttaatt tgttggggtt ttttggctgc ccccctgcag cttttttccc atgacacttg ataccatatt gggccatgct gagcctgtgg atgetagget agctggaaat tgaagtacag cttcaggaag ttaaaagaat gccacgtgcc ccgcaagtat tggttctcta ctgagtccct tttctgtcag tcaaacaggc accaggctgt gaactttttc ctgagggact ccttagaacc cctgttggct ctggggagag ggagttcttt ccaggctgtg ggggcttctc gcacttgcaa ttatttatct tggtgagtgg agggcacctg cggagcgcag ctcccagatc agccaccagg aetttaggag ccctgcttgg ggtcgccccg cctcacatgt ccaggacctg ttaaggagtt aagggtcctt teggagtgat actggattct tctgttatgg gactatagcc ggttgccatt ggtctcccac tttctgacct gataatttgt ggaagtaaaa aaataaaata tgegtetteg ccatggcatg ttaaccggtg ttcactattt ttgettetea gtgtcttgat aataeggagg agtgtagtcc teettagtte acctcgaggc tggaagcata tcctaggatc «0 81 aggaccagtt ctcatcctgt gacaatgcca tgatteggat acgtggggat ccagaacgta tgtgatccca acagatctgt gtgttatgaa cttcgcctgc ttttattctg actgtctcat tccccagaga gttcccaggt gcatggtaaa tattccgtca agctgtttag gtggctcagt ctgagtctgt tttggagggt gggaggctgg ggggtgtgtc ttttggtctt gcagacctga gaaaatccac atttttggct ggatcactct ggcttcagta gctcagtagt aggggttgaa gaaccctccc gacagtgggc tggctgcggg ccccggcagt ctgagtgggt tggatgcgtt cagggtggga gtaagaggga aagggggcca cctagaaagc tgtgtgcgtt ctctaggctc tccttctcca actggcagat ccaaagccgt tacatggcaa aaaaaaagaa tttaaaetta ttgtggtgtg taagatette gaccaccagg tctcaatgaa getetgatat agcttcctat gcgccctcgt attagtggtg ctatctcatc atgtgggatc gggtcttaac ccgtccagac gtgagcatag gttattgtag gtgagtaaag tgcaagtcct gcagacccag cctgccattt aactcatcca ttctctgggg aatttcaaat tttaatagac aagcaagtat gtggcaggag tgctgagtcg gatgttgctg caatgatgta aaaagaattc aaatgtcctg ggtcacttgg ctgtcctctg tgctttggga cttttaggcc tcagttcctg agaatttggg gttttgagaa ccagactttg atgctgggtc ttccctgcgg gttggggcat tgtggtgcac tctgtgtctc ccagtctgtt ctcccgcagt caaggatgcc ggggtgctcc atgggaagca acccccatgt agattgtccg ggcaggggag aggaatgcag ctccaggagg gttaagtcac ctctgtccat ggggatcttc gggctcttta tagatagtaa tagaaattga aagccagggg atgttttatt tgggctttct gctccctgat gaagtcccaa tttactgttc aactcagcca ttttaaaaca ttcccacact atccattagt teetttatet ttagtttcct cgctggacct accatgccac tagatgetta gtcagggctt cagcctggtg gtgccaggag agccagcaca ttaagatgtt gtggccaaat gtgcggtagg gtgcatttaa atcgagtccc ctgacatcag tcccaggagg gcagatttga gtccagggac aagcaaagga caaggtatag ggcccccacc gccctgcccg acctttgctc gatacccccc ctcagctttc ttccaatgga aggaggaagg caaaggcact ttctgccccg ttcgttgttg tgacttctcc gtgggttcag gggcttacat ctgcattggc tcttttaagg gggagctggt ctggaaagga tgggtgtgga ggatgatggc gacaaaaggg gaattateta tcagaaagga geggatteta aaccagccct ttcagttatg gggaattctc ccaacccagg ccacgagtgc atgtgtgaca atgeaatgaa taaatttata tatttattat ctagttgccg cagggctccc tattgtttta tggagcatta ggcactggtg gttttagatt tggcttcccc ataaactgtt tttcccttta ggccaaggat ccagagaagt aettagtegt 31824 31884 31944 32004 32064 32124 32184 32244 32304 32364 32424 32484 32544 32604 32664 32724 32784 32844 32904 32964 33024 33084 33144 33204 33264 33324 33384 33444 33504 33564 33624 33684 33744 33804 33864 33924 33984 34044 34104 34164 34224 34284 34344 34404 34464 34524 34584 34644 34704 34764 34824 34884 34944 35004 35064 35124 35184 35244 35304 35364 tgtgtttcct ϊ Lggatgatt gtctgatgtt gctcagtgct ctgtttccaa agaagggcag ‘Jgcttgtag tggtctccca tgttgagctt caccctttat cctggcagtc tggtcctgaa tagatttagc tggatgtgtg gtcatcccaa tggaatatca atctgtgtcc tcactcattt gtactgactg ctgacatctg tgagtcgaat aagtcatggg tctcaaggct ccaggcagta ctgggcagac atagtctctt catgcagtga gacttgagaa gcaaacggtc aggaacagtg gcgattagtg ttgggattta atgatcagat aaaggcaaac aggggccagg gcagccaaga gactcaactt tgtttttttt ttagtcaagg tgagttgagc gaaggaggcg tgagcaaact accctacaac cctgggatcc gaacccggcc tcctgttacc attaatttgt tacaggcctg aggtgatatt caatgaggca ggattctctg ctttattttt aagatcttcc cacagacttc gttccctgac tggtccacca tggaatgggg cttaggtagt attggcagtc gtggttcaat taggctctct ttgaagagca cctcttgtga gtgctcatct accctgttta gaagttagga ggagggcctc gaggcagcct ttgtgggctg attaaaattt cagtggttag actaagatcc atcagtgcag tttggcacgc ggtgctgcaa catcagtggg attccttttc gtggacatgt taccaaactg tcggtctttt ggacctttct attgtgtttc gcctcatgac ggaaggggga aaaacaggtg tgtccatttc gaaaccagca atgaagggat aatgcataag aggccaatgt tagctgcagg atccctagat atacctttta atgagagaac ggtggtgttg cttcctgatg cttagcttaa ttttttttct gtatggcatt caactcattg acagaggacg ctgggagatt tgaacaatga aggaggtaga tcgtacaggt ggtgggggca gaaactcctg catgttgatg tggccctcag aggtagacgg gcttccctgc taaaaacatt ttgcgtcatg agtagttgcg cagggatcga aggaagtccc tgactgtcca tccctgaagg agagtcatcc caacaccctg tggctgtgcc ctagttaggg ttagattgtg cattatgtca caggtgagga gatggggagt cagacccccc gagagcttca aggtgcctct cttttgcttt ggctctatac tgcaagctga gaaagtgtac tcacctgtgg cccccgcctc cgtcgagttt tttgcttggg gtgttattta cactttcacc tctcgttagc ctgaggactc ctatctttct ccagggtggc cttgtcaaca atggatggga atttactact aatattgttg cacctatgtg ccctatgcct ggctggatca gagccagagg aagtagggag aaccagtagc cagtgaagag gaaaaaagtg gatggttttt gcaactcatt ttaattcttc cccaaatcca gaaaagaccc agatggttag ggagtgccgc caacaaaatg gagtgactgg gaatcagagt ggattgcgtt tcctgtgtgc caaaaccagg gcctcagtgt aagagttttg ccttccccag tacttattta tgggatcttt gcacgaaggg aacggcatcc ttgttcatct tggaatgacc cttcctggag tgggagcata atcactcagc tgtttctcag gtttggtcgg gttctgggtt atatgactcc aaccagggca ggctgactgt ttccttctgg gaggtcagat tgagggagtg aatttttttt ttccactgca gtggcgaggc aaccttaggt aaggctgtcc tagcaccaga ctgttggtca tgatgtccca gcttcaggag agtgtgcatt ccttttggta actgcctagg tctttaccat tgctgtagct aatacatagg tgtgatgggg atagtcccca atggaaggcc gaccttggag accaggccca gagtgagcaa gtgtgagact ctgtgggagg tctgatctgt atgactgcat gatggatttt gggtgggaga ctgctgtttt ttgcctttaa gactgaatca tgatgctggg atggcatcac agtccatggg agccctatgg ctggagcggg cttggctcat ttgcaattca tccgagccca ggctcagtct ctgtgtctgt ttacgaccag cttctcaggg tggctgtttt tgttgcaatg cttaactgcc tctgtcttgc atctgtaaat caggtcttaa gaggtggcac gaagagtgca tttgccctgg lie i gtgttgttgg atgcctttcc tgggcaggaa ccagttgagc cagaaagttc agacatagag gtctccagtg ttgacaggat ctaaacagct cattaaaaaa gggcacatga tgaaaaaaaa gtagaggtcg tgaatccctc gactaccgtt tcgatgtgct ctgtatgaac acactgccac ctggtggctc tatggtatag gatgttgggg cctttgtgtg caatctatca aattgctgat gaaggactgc ggacctagaa tcattgagaa agaagattgc gaatcttggc ggtggactgt ttgtaggtca tgtttgagca gtggggaaca tggtctaagc gggtgtgtct gaagtggagg agcaacgtgc aatcaaagga gcccacacta agagattgag tgactcaatg gtcgcaaaga ggctgggggt aagagtctgg ctggttatta ttgggcagat gtgggagaga cttcctgcac tcaatgggtc tgctgtacag accccatctt gggtcttagt cacagactct gctcggcatg gagcaagaat tcagaatata ttagatcaga ctggagagtg acgggaggca ctttttctcc ttttggtgac atggggattt gagcacagag ttggtcctcc tggtagatgg ctgggtcccc gtctccttgc acagtctccc caaaagccct atctaaattc gtttgatccc aaaaaaattc aggaattacg catgtcagct gcccattccc cgtttaggtc atgccatttg atcattttct cacatccttg gatctctttg tgactccatg tggcttccat tgactgcatt gttgataatg tttagaaagg aagagcctga ggtgacttta ccttggagga tggtgggctc aaagggagct ctgttagagg ggaagatgcc gcctagggac aaatgatgct tagagcaaga agtcaagcat ttgggtttcc agtcagaact cagtcttccc ggcaggagga gacatgagtt gtaggatacg gtctctggat tctcgtccca gaggtgtgtt cagattaatg aacatgagga ctgtgacctc tttgagaata atggtggata attcatttat tgcggcatgc agttgtggta tgggatctta tcttagccat gcatctagca gcaggctcat gggttttgga gtaggcactt ctggattggg 35424 35484 35544 35604 35664 35724 35784 35844 35904 35964 36024 36084 36144 36204 36264 36324 36384 36444 36504 36564 36624 36684 36744 36804 36864 36924 36984 37044 37104 37164 37224 37284 37344 37404 37464 37524 37584 37644 37704 37764 37824 37884 37944 38004 38064 38124 38184 38244 38304 38364 38424 38484 38544 38604 38664 38724 38784 38844 38904 38964 »080798 ctgagcaggg ccattactgg tggatcagat ggagggggat cctgagacca agcccacacc gtcatccaga caaggggagg ccccttgaga tcccaggggt tctctactcc ttggagggac aagcagaaga gcaccccctc ggtggaccac tggccagtga cattcagttg -tttcaccat cccatctcgt tcttttccaa cataagtcct tacttaatt gggcctgggt ccctgccccc aggagaaggc tcatattgct tgaataaagc ·· Mgaacagt catagagcag gaggcatgtg aaacattgag tgtacaaggg gtcggatctg gcaacttaaa agttgttgtt ctgtccttca tgaacaggcc gtctgccaca aagcatggaa atcttgtacg c,xatcttgg gacgaggaga ggaaaggcgg tcctgggcgg cgaaggcggg gggcttgttt aatttgcagt tgcagttggt aagatccctt cagctggtaa gataccctgg q ; ί cccaaag cagttaataa gacattcaca cccaaaagga agactgtttt ttcagttcag ttcaccaact cacctcatcc ttttccaatg tctccccctg cgaatgtgat ggaccctaag gcgatgatgg ccaggggctg tcaattccgg gtgtggcttt tttcctggtg gatgctttcc gaggacagag aagctcatcc agttacgtga ctggtctggg taggcagggt tgctgatctg agttgcagat tgtctgactc ctcccagagt cctctgtcat tgagtctgtt tccagtgaat gagagatttc tcaatccctg aacccctact agatagctgc gagtgcctgc aactgaggat agacataatt gttagggggt aggaaagatt ggcagagaga atggcaagga gagaggccac taaaatgttt cagtcactca ccatctccca atagtgactg aagcatgtgg ttttaaccac catgtgggaa gatgcgagat gaatatctga gagttcgttc ggtcagcagt ggcggtgtgc ttctcaggtg tagtcttttt aaagaatctg ggagaagggc agaatcctcc agaagggaaa agttggacac aaaactcacc atgttgtata aaccctgtag ctgtgcctat ttcgactctt cccggaactt tctgttgtcc agtcagttct ccccaccccc cttatttgga tccaccagga aggcagagat gaggagcaag acttctagcc gttacagcag gctggtttaa tggcgtctgt gcccctggag caggcttgtg agcctgggcc gtcccacttc ctttactgcc agtctcagca cacattttaa tttgcaaccc ttgctcaaac accattctcc cttcgtatca attcagggtt tctagtggtc atcagggaac ttgtagtacc tccctagaca tgggtgccaa ctggtcctgg aattataagt tcagggattt aagaaggatg acagcctatg ggccagcatg agggaccagg catggtattt gtcgtgtccg gagtttgctc ttatctttct gatcttagtt tagaccacca tctgtagggc gactggcgtg gtagcggata ctgaagcttg gtctgaaagc tcacattctt acttaatttg tttttctttt cctgcaatgc taaggtaccc tgcagtgtgg ggctactcac aactgagcaa atttaaacca accattaccc ctattaagga cagttcagtt ttcgacccca gctcaaactc ccttctcctc tcacatcagg ccaaaaaaaa aatagggtct atgtctttat tggagggagg ttaggctcat tctagaggtg cccaaggagc ccgggctcgc gagcagagat ttgtggggcc ctggaggcct tttcccctgc tctgcccctg ccacccagaa tccattcacc ttaaaattat catggactgc tcatgtccat tcctgccctc ggtgccaaag gatttccttt cagtggttga taagatactg ttaagtacaa tttctactct cctctgttcc tggctttatg atgccagaag gagggtagat agagatttgg cagaggtcct gctggctgag ccggttggct tgcgtgtttg actctgcgac agactcatat gcagcttgtc ccccaaccag ggcaagtcct acagttgtcc agtgtcgacc atcctttggg tttccgtcac cagtgtgcca gggcatctct tgtccatctt tttaaagttg aggagaccct acccagtatt gagacctggg tccagcattc ttttcacttt ttaaaaacca acatgtctag gtcactcccc cagttcagtt tggaccgcag atgtccatgg ctgccttcaa tggcccaagt gtatgtccaa ttgcagatgt aggaagagga tggctacaag cccctggaac agagaagata cttaccgctc agacttcctg cctgtgatct cctctcagcc gcctggctgg cttctgtggg ggcctcagga aggaaatggg ccagtctcaa aatgtttgct agcacagtgg tgagtcggtg aatctttccc tattggagct agcattgtaa gactgcactt caaacctcgt gctttttaaa gattctgttt aggcctggga atctaacagg gtaacaatga agggtgtgtc ctatgctgct ggggcagggc taacagggac tctaggccaa aaaaattcat cccatggact ccattgagtc tttttttcac gaatcgaacc tcagtgattg agctctgggc agcactgtaa agtgtaagta ccaatgtgtg agcagggcac gtctccccac ttgggaagtg tgtcaaggct ggttctattc cttggacttc tttgatccca tggcctggag cactttcttt tacgattgag ttccagaata atgctcccct ttctgcgcct catgccaggc agtcggtaat tctttcccaa attggagttt gtcctaactc gatgaaagta cacacagaga ccaaggaatg cttcagaagg gatgttttaa tggagatggg gccccagtga ggctgctgac tctgcttgct cctgagttcc cctctctgtg catctgctcc agctgttgga ggctgcggcc gttggtcagt gctttcctgt atgccatcca agcatcaggg ttagcttcag tatttaagat ccactgctga agtgtgccac acatacacaa gttcctgagc gatccatcag agagacagat ctctggaaaa ttcctgagag acctcatgag tgtgcctact acggcaggat cactgtgctg gtgaataggc gcaggcttcc ggtgattcca tcaggtttct catacattag tttttcagcc tgcatgcgat gaacaaaaca gcattgtgct caggcagtga cgtagagtca accttttcct atcttgtttt tccctgattt ctgggttggg ccttgtggct gagttgggaa tagtccatgg tttcaagttt tgacatttag ttttcatcac ggcaactccc atcagttcag tcccctgttc ggcatccaac catcagggtc cagcttcagc 39024 39084 39144 39204 39264 39324 39384 39444 39504 39564 39624 39684 39744 39804 39864 39924 39984 40044 40104 40164 40224 40284 40344 40404 40464 40524 40584 40644 40704 40764 40824 40884 40944 41004 41064 41124 41184 41244 41304 41364 41424 41484 41544 41604 41664 41724 41784 41844 41904 41964 42024 42084 42144 42204 42264 42324 42384 42444 42504 42564 »0*7786 »080786 attagtcctt cttgcattcc tatttttttt aattgaaccc ctcccttgcc actgtcttat attccctttt atctgtcagt gagcacagaa ttgttgccag gttggccaag ctaggtccta gcaactgaga taaaaagatt gtcttttgta gtatgattct gcaggagacg cctgcagaat tctctcaaga ctattccgtt aaaagcatat ttttgcacag cccaactctt gctcagagaa ttctcttggt gaatcagcta tgcctggtcc agcggtgcaa ggtcactttg ci gttctaa ealcattgca ccataaggca gagccccaga attcattgat agcacagcag ttgcttaaaa tttaagccac acaacttccc gtggggttca gtattcttgc tgcaaagaat gaagtgaagc tccttccttt accgtggact actcctgtcc gctcctgcct ataatattat ccacatggta gggcccaggt aaacccactg acaaacatgt gatgagggga cttcgtatta tgaggtcgga gcaatgcagg gaggaaatgg ggcgggcccc attcaccaag gccgggcccc gggtgaggtg ccaatgaata aagggactct tttttttaac aggccacagc tgttctagac tgcctctagt cttcctaagg ggacacttgg aggctcatac acaggtgagg ataccttgct cgtgccacac ctggagcaaa aatgatcagg tctctgcttg ctttacaggg taaaagatgc cccatggaca gtctcctcta gtatagatac ttgggattgg gctgtgtccc tctttcacat tctggttgga ctttgtgtgt tgttgggcaa taatgcttct agtccaaccc tgccaggtga gcattttaca cccattttat aagctggctc accccacagc tcgaccttga aattccggaa acagggctgg tttactgctg taatggctca atccctgggt ctgggaaatc cgtacacgac catcaccaca ttatttatgg gcagcacgcc attgagtcga tcaatctttc tattagtcat gggagctccc ttggtccctg cattgtatat aaaaagaagg tggagagagg aaatttgaag attccacttt agacacagaa caacccactc agtccatggg cccgtgctga agcgtccctg ctctggcaag ttcaggcttg ccagaatctt catcttgcac cctgaaagcc acttcacaca aatgttttaa ctgaataacc gtcacatcca gcatcctttt tatgtgtatt ctcattgcag ctaagagttc cacattaaga acctcaaaaa ttttcaagaa cttcgcaggt aggttcagtc gaggtgcctg gcaccataat acagagttgg tggactttaa ctgccagtaa gccctctctt taagagggag gggctgtgat aaggccgtga ggtccagtgt ccaccagagg ctgcttggct aaggcattta ggatgaggaa atgggagatt cccttctgtt tttatccctg tttcaaaggc gggagggagg tatgattaac gcgggtaagg caggaagagg ccatggacag tgagcgacta atctacgttt ttgttgttca aggcttccct tgatgccatc gcagcatcag gatgaataaa tggcggtcca gttggggaac ttaaatattt aaactgggtt gcacgacaga gtttccatcc cttggcttcc gatgcaggct cagtactctt gttgcaaaga gggggcgggt cctgtgacac tgtgacaaag atttccttta cttctataga agcttatggg tggaatccta aatggaatcg aagttccctt ttggctacag ccttttggct aagcaaggcg tgataaaagt ggggcctggg gcgtgccgca caacaacaac tattttgcta atagagaatt cactctagtg cctgcatggc gagggctaca ttgaaagcat tttatccatc ggtagatcac caccctcctc ccaggcagcc ctgcgtccag ctttgacctt gcttggcctg gacggaaaga tggggcagca gacctgctgg aacctcacac actgaggcac ccctgtgagt gaagagagaa aattaggtgg ttctccaggc caggaactgg ataataaatt aatccgcctg ccctggagaa aagagcctgg agcatgtata aaacatgtcc gtcgctaaat gtccttcact caaccatctc ggtcttttac agatctgtat gtggttagga tatggtctga gctaagaggt gatgtgtttt ctgcctccgc gacccccaaa tcagtggctc cgatctctgg gcctgggaaa gtcggacatg ggcggggctg ggagaggtcc gggtctcctg ggatggactg tctgtcccta atctcagttt accactagcc tataatacgt atgatgtagc cacattacat cttatagata tgatgaaaat caacaaactg tttgatccct cctaaaagat agagtcagca agtaaaagga atgggtacat gtaaagaacc aacccactcc gtccataggg cggttctcct gtgaacattt gttcttagaa gtcttttttt ctcttgcctg gaagggatca ggggggtggg cgcactgtta aagttatccc atgggggagg gtccctaggc cagacctatg agaaaggatt gagtacccac acgtaagcct gaagaccagg ttctctgggt aaactgtttt agttgtatgt caatgcagga agaaatggca cgggctgtag caaccggatg atcacctctg tgtgtctgtc atctcccgca atcctctgtc aattatattt agtgcccaga ttctgtgctc caagcacagc tagagcttat cttctgaccg ctgtgggcct cccaccaaca aagtggtaga gtcaggaaga tcgcacggac acggggcaag gagaggagcc tccgctctgg gggtccagcc gtttgatctc tagatttgcc cctgacttgg tgccagggaa gtttttttct acagatgaga tcatccattc atgctgccag gtcccatttc ggacttcctc ggtcagggca cacccatgct aactacgctt gacgtttatg ttgaagactt tgcctgccaa agtgttcttg ttgcaaagag ttttatctat gagttgtttt gccacctagc catgacaaag tccagaatga ccttggcttt ggcagggata tctaatcagc tctgattgta gggaagggct tctacttgcc agatggatgc aaaaacgtat gaacggagtg tcatctggtg agattaggaa cactgtacct ttgttttaat atataattat gacacaagac acccactcca tgcatggggt agtttacaga aaagtttcct tctttgcaac gtttgctcaa gtccccttct ccaacattat gttagcagtg tcactgccca aaaaaataga gtgttttatt ctgttctgtg gtctttgttc acttccaggc gaaactgcct tcccctagag agaggagcct cattcacctc acacagcctc gagatggtct gtggcctgag 42624 42684 42744 42804 42864 42924 42984 43044 43104 43164 43224 43284 43344 43404 43464 43524 43584 43644 43704 43764 43824 43884 43944 44004 44064 44124 44184 44244 44304 44364 44424 44484 44544 44604 44664 44724 44784 44844 44904 44964 45024 45084 45144 45204 45264 45324 45384 45444 45504 45564 45624 45684 45744 45804 45864 45924 45984 46044 46104 46164 ’86 Ho 8 Ο7 8e gatgcgccat ctgcctcccg ggtgtgttga ttttgaataa taccgtgttg ctcttgaaac aatcgggaga tgccatagaa acatctggat ttctggcagc tcacataatt tgggaggagc tggaaaaacc tgagccccag ggacctcggg gcccagaagg gagttgcagc tgctgccttt gttgaaggtg agggccatga ccctcttggt tcgaggggtc atggtgttgg ttggggaggt gacaatgatg tgacgagcct agaacagcac ctgacacaca ggcaatccct gggaaatgct tgtgtttttt tttttttaat tttgtattgg tataaagttg atttacagtg ttatgtgagt ttccagtgta cagcacagca atttgtatgc agtagtgtct gtgtgttaat cccaacctcc taatatatac ctgtccccac ccttcctccc tggcacctat aagcttgttt tctgtgtcta tgagtctgtt tctgtcttac aaataagttc atttgtatca tattttaaga ttcctcatgt gatatcatag gatatttgtc tttctttgtc tgacttactt cacttagtgt gacaatctct agtttgatcc acattgccac aaatggcatt atttcatctt ttctatggtg agaatattcc attgtatata tgccataact tctttatcca ttcatctgtg agtagacact taggtaattt ccatgtcttg gctattgtaa atagtgctgc agtgaacatt ggggtgcatg tatcttttcg aatgagtttt gtccagatgt atgcccggga gtgggattgc aggatcatat ggtaatttta tttttagttt tttgaggaat ttcaatactg ttctccatag tgactgcacc agtttacatc tccaccaaga ttgtaggagg gttccttttt ctccacaccc tcttcagcaa ggaaacgctc atttgtgtgt tgctttgtac aaaccacatt ttctcgtcac ctttatttgc atgtactcga tgctcaggtt ataaaaatga tcctggattt ccctggtggt tcagcggtta agaatatgcc tgccagtaca ggggatgtgg gtttgatccc tggtctggga agagtctaca tgctgtgggg cagctgagcc tgtggaccac aaatactgag cctgcgtgct acaactactg aaatctgacc gctgcaacta gaaagtagcc cctgctccct gcaactagag aaagtctgca tgcaacagtg aagactcaac gcagccaaag ataaataaat aaattttaaa aaccttaaaa aaaaatgatc cttgtgactc ttgtagctgg taggaagatg tgttcatcaa taaaggattg ttacacccta aggcaagtct ctgatctgat attttcaaga gaacttcgaa atccaggttt tatgttaaat catttttttt gttgttgttc ttgacaatga gttcaacttt tcttcattga agtgccatgt agatcaaatg aagcacagtt gaggttacag agtcactggc cccattgcac agatgggaaa actgaggttc agggctggcc aacttgccct caggtctgac tctctccaaa tccacttctt cccaaaatct accagttagg gacatggggc tgggcctgac tggccagctc cagtcttctt vjttctccag agcccctgcc caccggttct gggacagtct ggggacagtg ggagtggctg tccttgtcct gggaggccac attcaaagaa aaagtgaagg tgacgcaagc tgttccagac acttggcttt gcaacatgga gcaactacct gatgggctgg tcaggttggg agcggggtta ggtgacaagg ggtttttgcc aagctttata aacctggaga tttatagttc atatggcgct agtgataaag aacctgcctg ccagtgcagc agacacagaa gacacggatt tgactcctgg gtcggggaag atcccctgga ggaggaaatg acaacccact ccagtattct tgcctggaga atcccatgga cagaggagcc tggcaggcta cagttcatag ggtcacagag tcagacatga ccaaagcaac ttagcacaag agcacagcac ataaatttct gtatttctgg cttttcatcg aaaattgctc ttgttctcat ctcctgccct cccactcaca ggctctgctc cccaccacac tggcctcctg gctgttcccc attgctctgt ctcagttctc ccagccccag ggcctttgca caggctgtat cttatgcatg aaattaccca ccaccactaa atccctccag tgcctttagt ttttaatttt ggtttagttt tttttgcttt gtttttcctt acattttcac ctgcctggct cctctgttta aaattgcagt cctcctccca gtccctgctg tgttttcact atgtcctttc atacaccaca tgttgtaccc taattgttga tgacctgtct ttcctctact ggaataaaag ccccgtgaag ttagagatct gggtttgtct tgttcgcttt tctaacacca gctgttaaaa gagggtctgg catgtcgtag gtgttcagta aatgtgtatt gacatggaga acaaacttag ggttaccaaa ggggaagggg ggagggataa attaggaatt aacagataca cacaactata tataagtaga taaacaacaa ggacttacta tatagcacaa ggaactatat tcaatatctt ataataacct atagtggaaa agaatctgaa aaagaatata tatatatata aaattgaata ttttgctgta cacctgaaac attgtaaatc aactatactt cagtttttca aaatgtgtgt taaatgaatg agtgaatgaa tgaatgatga atttgacaca cggagctcag ttcccaccag gtgtcatgag ctgtggttga gcagtggcca cctcccagtc tcttgatcag gctgttgtta ttataacaca tttaaaaata atgcatacaa ataatatcaa ctattaacat taattatgtc ,' t. .itgtcaac tctggagcag catgtgtcaa cagctttccc acctcctcct gctcctagaa catctccagg gagccccttc ctcaatgacc ccgtggagtc tgtgatgcag gctggcacca agcagccctt ttggagcctt gtggtagggc aggtgggtgg gtgggggtcc tggccctctt cctcatgagc ttgtttgtct cgtcccccac ag aat gtg cgc ate gac ccc aac Asn Val Arg lie Asp Pro Asn 45 age ctg tet ttc aac atg tgg aag gaa ate cct gtc ccc ttc tac etc Ser Leu Ser Phe Asn Met Trp Lys Glu He Pro Val Pro Phe Tyr Leu 46224 46284 46344 46404 46464 46524 46584 46644 46704 46764 46824 46884 46944 47004 47064 47124 47184 47244 47304 47364 47424 47484 47544 47604 47664 47724 4 7784 47844 47904 47964 48024 48084 48144 48204 48264 48324 48384 48444 48504 48564 48624 48684 48744 48804 48864 48924 48984 49044 49104 49164 49224 49284 49344 49404 49457 49505 f|0 < ' ' /? 6 IE Ο 8 Ο 7 · β 60 tet Ser gtc tac ttt ttc aac ate gtc aac cct Pro 75 gag ggg ate ate caa ggc Gly 49553 Val Tyr Phe Phe 70 Asn lie Val Asn Glu Gly lie lie Gin 80 a/g aag cca cag gtg cag gag cac ggg cct tat gtg tac ag 49594 Gin Lys Pro Gin Val Gin Glu His Gly Pro Tyr Val Tyr Arg 90 gtgaggatgg agggggttgg gctgggactc aggtcatcac cccattttac agatgaggaa 49654 actgaggccc cttgcagaag ggctcattca gggccaatct gcttgctcca atccggtgct 49714 ccagtgcttg agacttggga atggctgcct ggctttgcca ctcagcaggt ctctgactat 49774 gggcaagggc ctttgctttc ctgtcctgca atgtcccctt ctgtaaaatg gggatgaccg 49834 tatccatggt ggagtggtta tgaggattgg atgagcttat gtggagccca gcacagtgcc 49894 tggcatgcag taagtgatca gtaaatgtta gttattaaca cattatcatt acctgagttt 49954 ggctgcttgc cactcaaaag gcaagtgttg ggatttccct ggcagtccaa cagctaagaa 50014 tgagcacttc cactgtaggg aacgcaggtt tgatccctgg tcaaggaact aagacaggaa 50074 cttcgaggtg tggccaaaaa gtttaaaaaa aaaaaaaaaa aaaggcaagt gctggttgga 50134 aaggaaagat tgctttattt aggaggccag caatgtgggg agaaggcgga ttcacgtcca 50194 aaaaccaact ctaaagattc tgctcaacca tgaaagtttt taaagggaga atcttttgga 50254 gaaaaggtca gggcctttat cttcttccac tgtgtgcaaa actttgttct gattggttgg 50314 tggtgcagtt aacagggagg tgttctggga gtcttctgct tggcagaggg taccatcctc 50374 caccttggtg ggggccttag ttcctgcaga agaactcaga gatactgttc tgtgtatccc 50434 ttgaggagga gccaggaccc tgccccaagg ctgcactatt ttttcctgac tgcccctcct 50494 ttgcttctgc gtcccctccc tcccctgata aacaactctt tgaatctgcc ccctggaact 50554 cagggaaggt caaagaggct gaatgaagtg tattccctac acaaaaactg gggacacgga 50614 aaaggatttt tacctgggag ggccccacag ggtcctgctg tctttcttta tgaccacagc 50674 tgtcacaact ttttcatttg atcattttct ttgggagggt gaagctctcc agtggctact 50734 gggctgcctg gcattggctg gagcagtttt ccaagagatg ctctgccaca aggctccaga 50794 agagctgcca ggtgccaacc tgcatcacag actccacagg gacattgggg aaggggctcc 50854 ctggaataca agacccaatt tctggtgctg cccattctgc cctcaggaaa ctgcaatcct 50914 ggcttagctc ataaagactt ctgcatcgaa gctgagcctg gtttgccaaa gttcttactt 50974 atctcttcat ttcataagcc tttatgaagt actgaacatc tcctgtatgc cagacactgt 51034 gccagttcac tgttaaaggc agacaagagc ccctgcctta cagagctgac attcccatcg 51094 ggagagaatg aacaagtgaa cagatgaggg gaaacccagc agcataagcg tggtgccaac 51154 aaagcaggtc aagccgtgga gagtgctgga ggcagggctt ggcgggggct ggtctaactg 51214 cagggtcagg gaggaccttg acaaaggggg acacttccct agacccagat ggtgagaagc 51274 gggcactgca gtgtgaggat ctggggggaa gtgagtcctg gacagaaagc agcgggtgcg 51334 aagggcctga ggcgggaagg tagtctagga ggggagaagg cgtgtgtggc tggtgtgtta 51394 ggagcgaggg gagagtgagt gggagagagg agacctgaga gttggacggg gccggatggt 51454 gaggaccctg gagcccacag aaggagctca gttttatcct gtgtgcaaag gagggtttgg 51514 gggagaggat gacgtgatct gatttcccct tttcaaagat tcttctggat gctctgcaga 51574 gaatggattg cagagcatga tggaataaag agaataacag caataaaaac tgcagctgat 51634 acatgctttt ctctgtgcat taggcaatcg ttttagttgc ttgacatgca ttagctcact 51694 caattctcac aagtagggac ctaatgacat aagtctgctt attactccca ttttattttt 51754 tttccttggc tgtacctcgt ggtatgcagg atcttagctc cccatcaagg gattgaaccc 51814 atgctccctg cagcggaagc atgcagtctt aaccacggac tgccagggaa atcccattac 51874 tcccatttta aacatgggaa aacaggcttg agtagtaagt gatggagaca ggattcgggc 51934 cccctacctt ctgtcttcag agtgcatatt cctacccacc atcctcgccg cctccctcag 51994 ,iaaagctagg atgcccaggg ggagggtgat gagggacgga gggatggtgg cagcttgccc 52054 agggggaggg agcatatggg atttggtgac aagaggcttc tgtgcttgtc ctgcagtagg 52114 tgggcttccc aggtggctca gtggtaaaga atccgcctgc cgatgcagga gacccaggag 52174 acccggcttc gatccctggc tcaggaagat cccctggaga aggaaatggc aacctaatcc 52234 agtatttttg cctggaagat cccatggaca gagaagcctg gcaggcccca gtccatgggg 52294 tcctgaagag tcggacacaa ctgagtgact aatactttca ctttaagagg atcctggagg 52354 gctacataca gtccttgggg tcacaaagag gcgactaagc acataccaca gtgggtgggt 52414 ggtggaacag acgtgtagga ggcagtcaag cttggcagac agacagccga ggggcccccg 52474 ggctcctggc agctgaccca ccagcttcct cccccacag g gag ttc agg cac aag 52529 Glu Phe Arg His Lys tf- 7 ., > 8 6 <0807«! 100 age aac ate acc ttc aac aac aat gac aeg gtg tee ttc ctg gag tac Ser Asn He Thr Phe Asn Asn Asn Asp Thr Val Ser Phe Leu Glu Tyr 105 110 115 i ’ age tac cag ttc cag ccg gat aag tee ege ggc cag gag age gac Arg Ser Tyr Gin Phe Gin Pro Asp Lys Ser Arg Gly Gin Glu Ser Asp 120 125 130 tac ate gtc atg ccc aac ate ctg gtc ttg gtgagatacc cctggtcgtc Tyr lie Val Met Pro Asn He Leu Val Leu 135 140 52577 52625 52675 tctccgcctg gactcggcgg ggcttttccc ttccactgca tctagactct tgtggtgttt aagtagctgg gttcactgac tagtttggta ggtgaccaga cggtgattta tcagcgccta atctgcgttc aggaageggt tetagagaga ctagtgtgtc ggtactatta tatetaaagt gaggctgcca tcagcagctg cctgcgaagt ctgctgcctc aattaggttg gacactgtcg tgaagtgatt aatgtgtcct atttcagcaa atctactgca gggtgtcgtg tgcccctact cacgtgcttg gttttaggct gcaaaagcag ggcctgggtt tgcatgcctc aaagaagccc gtggatatac c. 'tttcttt aggccatggg cctgcaggaa aggagggtca catctaagag acaggtttga nnnnnnnnnn ttcccctttc gtctgactat ccccttgcac gcttcctggg ttttcaatct ggggtacgcg ccaaaaggga ggagggagat gcttactgcc teattegtag gagtggaagg cgcaggcttc tgaccacaca gtgggtattt caggaaagca gggagccctc actgtctcag aggcttcaca ttttctgttt cactcaacta ctctgtggca tgtgccccgg ctgttgggtg cctcagagtc gcaaagactg ttaggaaegg ttcgatgtaa cttggtagaa cgttttcaga gacgagcagt aagcagtctc tactgtttct tacatgcctt ttgagggcta gggcttccct cgacccctgg aactaagact aagacaaaaa tgaaatgtga caaccatttg ttggctttgg tactcaagaa caggttagag acttccctgg tctctggccg nnnnnnntct tacaggtaga ttgtgaccgc tgggcggtcc tgcaccttgg gcaaatctag ggttaaaccc gtacttgtgg tgtggacagg tgcctgccat cgctcgcagg aggcagaaga cagagccacc caggtaggtc attgggggct ggtggtacag ctaacatcag gtctgctgtg catactacct gtagaagagg gcaggtagca ctcagcctcc ggctggcccc gacaggatga agatgtgcgt tgtgataaat aactggtatg attgcatgtg taacacatgt gcaaacatct ggattagtat ttagttatgt gaaggagaaa gaccagctgg gatgttctct ggtggtccag tcagggatgg tgaagcagcc caaatgagtg gtttcatata aaaacataca cccgtggacc cccagagcag agggactttt tggtccagta gggaaccnnn atggaatcag gattagatac atggactgta ettgaggget tctctggttg ggacttccct ctaatcgtgt gaagctgaat atgtccattc gtgtgccggg acccggcgta gaatccacag tcccagggga tcccctacca tgteaeggag tccaggcaca gatctcagac tgagcatctt gtttacttgt aaaactgaag ggttagggtt cattcaatcc aggctgggct aagctcagat gtttaggcag gcccagggcg agctgttgga cccctgactt gggcaaagat actgatcatc acatccagca ctaactaagg taettgeatg gctttttcta gttgcagctg tggetaagge cgcctggtta aaataaataa ggcgtggcta attttcatgt gaacatctta aeggettget tgggttgtct actgtatatc gttaagaatc nnnnnnnnnn acctttacgt tggatgtgtt gcccaccagg caatcggtgg ggagcattgg ggtagtccag gcaacaacaa gggggtgctg tctgcaggta gcccccaaga tatggttgtg agggaaaggg gtcacgcttc ggaatgetea acgccctctg gtgaacccct gccagcaagg gctgacacta cagcaatccc aacagagagg ttgaaactag tctgtccacc caggatcaga aaatacagcc tgaagtcact taggagegtt aggtaatttt cagaagtttc gtttgttctc atggggagtt aaaggaggca aaaatcgaac catgcacaca taaagggcca ttcaaatctg tccgagctcc tatgctgtaa ataaatattt tatgccaaga ttttcatacg gctcctggac gacttctggc tgggggagga cttttacgat caccttgcag nnnnnnnnnn ttaagaaaat tgtgcttatt ctcctctgtc ctcctgggtt teaaagteat tggttaagac caaatacaaa tgtgcttgtc agagtcacag ccacccccag ctcttggctg cacgtgggat attccttgag ctacagagac cctggcacgg cttatcagtt gccaggcctt cgtgttagaa acgatcatta ttaggtgact tttggtctat cagttgaggg tgtgaatgca tgaagccttg ttcccccacc tgtgggaaca caacttaaat cataggtagg aaggatgttt atgttgtgat gggctgcaga acaagcatag ctcacttaca gataacagat ccattataat caatataggc tgaaggatcc ttaaaatgea gacctatttc gtettettet tgtaaaaagc gttgatgttt gattaggaag ttttaaaaac tgtagggaat nnnnnnnnnn gctggttccc gttcagtcgt cttggggatt 52735 52795 52855 52915 52975 53035 53095 53155 53215 53275 53335 53395 53455 53515 53575 53635 53695 53755 53815 53875 53935 53995 54055 54115 54175 54235 54295 54355 54415 54475 54535 54595 54655 54715 54775 54835 54895 54955 55015 55075 55135 55195 55255 55315 55375 55435 toβ0744 ctccccgcaa gaatactgga gtgggttgcc atgccctcct gcaagggatc ttcccaaccc agggattgaa cccaggtatt ctgcattgca ggtggattct ttaccatctg agccaccagg gaacccaagt atactggagt gactagcata ttccttctcc aggggaactt accaacccag gaatcgaacc aacgtctcct gctttgcagg cagtttcttt accagctgag ctaccaggga agctcagata ctggatgttc agttcagttc agtcgctcag tcgtgtccga ctcttcgcga ccccgtgaat tgcagcacgc caggcctccc tgtccatcac caactcccgg agttcactca gactcacgtc catcgagtca gtgatgccat ccagccatct catcctctgt cgtcctcttc tcctcctgcc cccaatccct cccagcatca gagtcttttc caatgagtca attctttgca tgaggtggcc aaagtactgg agttgcagct tcagcatcat tccttccaaa gaaatctcag ggctgatctc cttcagaatg gactggttag atctccttgc agtccaaggg actttcaaga gtcttcttca acaccacagt tcaaaagcat caattcttcg gcgctcagcc ttcttcacag tccaactctc acatccatac atgaccacag gaaaaactat agccttgaat agatggacct ttgttggcaa agtaatgtct ctgcttttca atatgctatc taggttggtc ataactttcc ttccaaggag taagcgtctt ttaatttcat ggctgcagtc accatctgca gtgattttgg agcctagaaa aataaagtct gacactgctt ccactctttc cccatctatt tcccatgaag tgatgggacc ggatgccatg atcttcgttt tctgaacgtt gagctttaag ccaacttttt cgctctccac tttcactttc atcaagaggc ttttgagttc ctcttcactt tctgccataa gggtggtgtc atctgcatat ctgaggttat tgatatttct cccgacaatc ttgattccag cttgtgtttc ttccagtcca gcgtttctca tgatgtactc tgcatataag ttaaataagc aggatgataa tatacagcct tgacatactt cttttcctat ttggaacagt ctgttgttcc atgtccagtt ctaactgttg cttcctgacc tgcatacaga tttctcaaga ggcaggtcag uLggtctggt attcccatct ctttcagaat tttccagttt attgtgatcc acacagtcat tggatgaggc acctttaaaa agtaaaccaa gtgccaagat ggtatctcca gaggaaaaca aaaattcgaa aataaattca cccatattct aagcacccag atactaggta gaactggtgc ttggggctct tggagtttgg aagggagatg ctaaggaagt agagtacagt ctgcattaag attctttgcc tataaggtga cagtgaaagg tactctaaat tggcgtaagt aaaaagggca tttatgggct catgttactg aaagggcagg agttggcctg gtttcaggtg tggcttgatc cagagtgcaa atgaggttgc ccagatttgt gtcggttcca tgttctggta gatccactcc tcagggtggc tgcagtctta cacacaccac gttcaaaggc agccagagcc accttccctc tctaccccat aaccccagct ggtttgctcc ttgtggcttg ttggttctga tggggctgca tacatattcc cagaccaatc actgaagcca gagagaggaa ggtttctgat taaccagggc taaggcacac gactgcctct ggggctcggg gtggagttaa gtcggcctga acccgagagc acaggtggtc ctgttactga aggatcaggg gatggttccg gatgccccag atgcccactg cagggatcct tctaggcctg accacgtccc gggatggctg tgccttgaag cttggcttga ggtccaggga gggcagacaa gctgtgtcta gcctctaacc tgtggtgtcc cctggctctg cag agt geg tea Ser Ala Ser atg atg atg gag aac agg ccc ggg etc ttg Leu Leu 155 aag Lys ctg Leu Met Met Met Glu Asn 150 Arg Pro Gly 145 atg atg acc ttg geg ttc age aeg ett ggc cag cgt gee ttc atg aac Met Met Thr Leu Ala Phe Ser Thr Leu Gly Gin Arg Ala Phe Met Asn 160 165 170 ege act gtt ggc gag ate atg tgg ggc tat gat gac ccc tta ate cac Arg Thr Val Gly Glu He Met Trp Gly Tyr Asp Asp Pro Leu lie His 175 180 185 etc ate aat cag tac ttc cca aac teg etc ccc ttc aag ggc aag ttc Leu lie Asn Gin Tyr Phe Pro Asn Ser Leu Pro Phe Lys Gly Lys Phe 190 195 200 205 55495 55555 55615 55675 55735 55795 55855 55915 55975 56035 56095 56155 56215 56275 56335 56395 56455 56515 56575 56635 56695 56755 56815 56875 56935 56995 57055 57115 57175 57235 57295 57355 57415 57475 57535 57583 57631 57679 57727 ggc tta ttt get gag gtaagtgtgg cccagtgaga agttcagggc cgctgtcttg Gly Leu Phe Ala Glu 210 tcccccactg acacagcctg gaaaccagtt accagcttgc ttttggagct ggcagaggcc ccaggagctg tgggttgtca gtgacagaaa acctaactga aactggctta agccaaagcc agtttcagtt aaattetatt tattgattta ttggttcata taactgaaaa ctgtagggag attcaggcac agcttgatcc aggctcaaat gatgtgactg gggctgagct tagatggttg gaggttggtg ctggaagaaa ggggaatggc tgctggggag gcaggtcaaa aatgccaact 57782 57842 57902 57962 58022 58082 ο IB 0 8 0 7 β β' .rttgctttgc tctgagttgc ctgctttatc ttaatcgtga tccctcataa cctagtggtg 58142 tcagtgattg ggatcctgag tcatgatctg atgtagagtt ggatccctga cctctgatcc 58202 ctgaccttgg ctccctcaat cacagattgt aaacagccct ctgagttgct ccagcctgag 58262 tttccttttg gggctctgct gatctggtgt tgggggtagt aggagggaga aatcatgatt 58322 cagttatagg catgtgatcg ctgctcagta catttttgag caggatgaca ggttctgggt 58382 gtgtgggtaa gttgacaggt ttaaggtaag tgacatgatt cttgtcaaag caaactgtaa 58442 actggtaaac aaatgaaagt tattagagat tgagtcacat gcttataaac tatttttgac 58502 taggtatagt ggaaattcca aagcaatagc ccagcagtgt tggtgtggtg gcttcccact 58562 cttcagggat ctagaatttt actactctgc tctccccacc ttagagtgtg gtttccatac 58622 tcaagattac tgcatggtcc aagaggctgc tggggcacca gctatcacac tcactttcca 58682 ggtagcagca ggaaggaaga agtggtaggg gattcagggg cagtcggggg agttgaggac 58742 aaagcaacat gccctggctg tttccctctt tgggacggag aaaaccaatt tccacttgtt 58802 ttccgttagc cagaactaga cctgtggcta cacttagctg caagggaagc tggaaaatgt 58862 taacttacag ctagtgtgtt gatgctctga gtaaggtttg ggttttgata tgaaggagaa 58922 aggggagaat ggactctggg gagtaactag aagtctctga tacacttggt tataattatt 58982 atgatagtat tattttgggt gagcatttat taataataat aacagcaata ataaaaataa 59042 aggctagcat ttggagatgt tactatttct taggcactat cctgaacagt ttttacacat 59102 taggtctttt aacactccca gtgtctcttt gtagtggtgt ctgttactgt ctctttatac 59162 tggctgaagt ttgggctctt aaagctctga atggacaaat gacagggcac actgatatca 59222 ggaagctaga gtaggctttg aacttaggcc ctgttggctt acccagtcag taatcaatgt 59282 agctatttgg ccggtaaaca acccctactg agttcctcac gggtgctgta ccttacatta 59342 tacggcatcc tcagaagtaa aagggtgctt tctaaatttt acccagcggc cactgatttt 59402 tttgtgtgtg ctttgcacag ttttgctttg aattagaaat ctttttctaa gaaattccct 59462 cagggtgcca aagcctggac tttctgtctg gaaagaactt gataaacatc aagttctctt 59522 tgcctgtatg tttcaggata ggccgggtta agcagccccc agatctccat ggcttagaat 59582 agcaaaggtt aatttcttac ttgtatgcca ggtctagtgt gggtgaccag ggctcctctg 59642 ctctttgtgg tcactcaggg acccaggctg agggaggctt ctgctggata catgcttctc 59702 tggtctcgat agcagtgata gaaagcacag tgacatgtgc atgatcagct cttaaagctc 59762 rcacccggaa gtgacattat cctttctctc ctttttcact gatcgaagag gtcacgtggc 59822 nLgctttct tgtaatttgg tgaatgggat ggggtgaccc taccgttcac ctgagaggag 59882 aaccagactt tcctggagtt aggaagggaa aatgggacgt tttctaggac ggatgtggtg 59942 ttcagaggag tgtccctcct agaaagccct caagtcctcc tcctctcgac tcccccagtg 60002 ctggacttgc agcggtgaac aagacaatga ggcccctgtt ctctgggtga agggggagca 60062 gcctgtgggg ggcctgagta ttgactcccc atgtccttta cctccatcct ggggcttaaa 60122 gatgtcattc tctgctgttg tctgcag etc aac aac tee gat tet ggc etc ttc 60176 Leu Asn Asn Ser Asp Ser Gly Leu Phe 215 acc Thr Π/ gtg ttc aca Val Phe Thr ggg gtc aaa aac ttc age agg ate cat etc gtg gac 60224 Gly Val 225 Lys Asn Phe Ser Arg 230 lie His Leu Val Asp 235 aag tgg aat gga gtc age aag gtgagggcaa gaggtgacag ccatcctgtg 60275 Lys Trp Asn Gly Val Ser Lys 240 cagggaccag atgggggtgg caagggctgg gatccaccgc ccagagcacc ttcttcctct 60335 taaaacagga gtttgggatt gacgtgtaca cactgctata tttaaaacag acaaccaacg 60395 aggatctcct gtgtagcaca gggagtgctg ctcaatattc cttaataacc taaatgggaa 60455 aagaatctga aaaagaatag atacatgtgt atgtaaagtg gaatcacttt gctgtacgcc 60515 ugaaactaac acaacattat aaatcagcta tgcttcagtt aaagaaacaa aacagaggag 60575 gggattgeat ctgtagggga gatgetettg agtcccagac cttatctgtg tttaaggctc 60635 aactagagaa ggcaatggca ccccactcca gtactcttgc ctggaaaatc ccatggatgg 60695 aggagcctgg taggctgcag tccatggggt egetaagagt tgggtacaac tgagegaett 60755 cactttcact ttcatgcatt ggagaaggaa atggcaaccc actccagtgt tcttgcctgg 60815 agaatcccag annnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60875 ngaccccatt gtttctttcc tttggtgctt cacttacaag aatgcttcaa aaatattaca 60935 ctgaagatac agccatcctt tgtactaaaa gattgagtaa aaaaaaaaaa ttgcactaga 60995 aacacaggaa gacattcaca ttaaaaaata aaataataga gacagatata aagtgcactt 61055 tgtatgtctt cacacgccca gccccattcc cacccgaact acagaggaaa cccacagtta 61115 ΙΕθ β ¢7 fr? 4 ? η g tcagtattgg gtatattctt cctgtgtatt tttatccatt tgaggtgcga tttttttttt 61175 tttcttctag gagcagaatg aaatcatact gtgtgcattg ttttgcaact tgcttttttc 61235 acctgagtgg cctttcagca tttctcatga aaatgattat gtggtggtgg tgcccacacc 61295 ttccaaacgc tcatcagggt gacggttgca gagagggctg taatagatta tcctctgggc 61355 tgagggctgg ggacagatta tcccccatca gggcccggac tgacaggatt accatcgcaa 61415 ccagtaataa ccattctgaa tggacactgt gggaattctc tttggcttgc tttctcaaga 61475 taaaaatgta cagggacttc tcaggtggtc cagtggttag gactctgagc ttccactaca 61535 gggggcccgg gttcagtctc tggtcgggga attaagatcc cacatgcagc atggtgtggc 61595 caaaatatgt gtgtgtgtat atgtatgtgg ttgttgtgta gtctctaagt catgtcaatt 61655 cttttgcgac cccatggatt gtacccacca ggctcctctg tccattggat ttcccaggca 61715 agaatacctg agtgggttgt caattccttc tccagaggat cttcccgacc cagggatcaa 61775 acctgtgtct cctgcattgg caggtggatt ccttgccact gagccaccag ggaggcccaa 61835 t-atgatgtac atatatacac acacacacat acacacatac gcacatatga acatatgctt 61895 aaaaaccttc tactgggaca gatgggtaaa aagtgagaag tttttttttt ttctgtccga 61955 gtgtcactct ccagaagcaa ctacggtttt tgtaatctcc tggtagcgac cattatgatt 62015 ttaaatattt tacttatgga actaccttct cacttgactg ttttgatgac gtgtctgccc 62075 acttcctgtc tgagaggcga tgatgtctgt ctctcccgct cactgtgctc cttggaggtg 62135 tgagtgacag gtccgcttta cagatgaagt tactgagtcc ccagcaaagt tgtacgttca 62195 gigacgcacg gtcagggaat ggggagctgc catcgatagt ctctctggct gtctgtctac 62255 acagcctgat ctccttgcac caggacgtct atccaggagg actggcttct ctcaattggg 62315 tggtgacttc acatggtgtg tgaagttgga gctccaagtc acgtgggcag tgtccaagtc 62375 tttatgagtt cttgcttgac taagaggctg tgtttaaatg cttccccaca g gtc aac 62432 Val Asn tat Tyr 245 tgg cat Trp His tee gat cag tgc aac atg att aac gga act tee ggg cag Gin 260 62480 Ser Asp Gin 250 Cys Asn Met He Asn 255 Gly Thr Ser Gly atg tgg gca cca ttt atg acc cct gaa tee teg ctg gaa ttt tac age 62528 Met Trp Ala Pro Phe Met Thr Pro Glu Ser Ser Leu Glu Phe Tyr Ser 265 270 275 cct gag gcc tgc eg gtaatcgccc tgatgtgtga cagggcctcc ttctgctttg 62582 Pro Glu Ala Cys Arg 280 tggatgetea gagctgaacc aagtggcttg tggcgtgtgc ttggaaagcg cctggctctt 62642 ctgcatgtcc actggcccct ggcgcccgct tgaattetet ttggctgctc catgaagagc 62702 cgaactccaa ctggtggtgc ttttgcaagg cccagggagg ctgctggcgg ttgttggggc 62762 ttggtggtgg tgatggacag aaaatgggca agatggcaag gggccgtgga ataaggcaac 62822 gatgggctcc ctgggccagc tgccctgttt ccagttgggt getgagagge ccggatgcct 62882 ctcttgcagc ccctccactt tccagagtac agcctcggag gtcagcttgg ggctaaacaa 62942 ttccagtggc cccggcagag ggatgagaag agacagcggc tcctagagcc gttctctggg 63002 tgtttccctg tcctcggctc ctctgttgag gccactctgg aaaaatcctt tgcttgggat 63062 ttcactgatg tgaattcaag agactcacct gccaccctag cagatcttga cacagccctg 63122 tetgegagag gcactggggt ccctgcagag acaggatggc cgggtccttg gtccctgggg 63182 gttgtgtcct ggcaggggac tcaggcccat ggacctgcag gggagggtca gagagtggag 63242 gtgtttctgt tctgtgtgtg ttcacttcct gaaattagaa atttcaactt agagaagtgt 63302 tcccagaaag tgcagttttc tctgcatttg ctgttgttta aaatgtcgct aagtcgtgtt 63362 tgattctttt gtcaccccgt ggactgtagc ctgccaggct cctctgtcca tgggattctc 63422 .:,. igcaacag tactggagtg ggttgccatt tccttctcca ggggannnnn nnnnnnnnnn 63482 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 63542 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 63602 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 63662 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 63722 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 63782 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnggctgcat taaggaaaaa tcaggtaaag 63842 tcattttaat gatgttttat tggacccagg agatccaaaa tggtatcatg tcacagtggg 63902 taaacaaatg tacaatacta aagacggact tgcctgggcg tccagtggtt gagactccac 63962 iitHO/86 #00798 acttccactg cagggggcat gggttctgtc cctggccagg gaagttccac aaactgtgca 64022 gtgtggcaaa aaaaaaaaaa aaaaagagag agagaaaaat attgaagagc tgttttcaat 64082 tgtttaccca attgtttgga ggtatcaagc cataggaatc tggagtgtat ttgacatagc 64142 cacatcccaa cttggactgg ccccatttca agggctccaa ggccatgtat gctgagtgga 64202 ccccgtggat aggacaggtg ggctggttct catccacagg ccatgttcaa gtttagaagt 64262 gcctttgagc aataaggcca ggtgaacgga aagagggtga atgggggtgg gtgatggtgc 64322 tgctccctgc ggaggtgaca gcagaaacgg gacctgagtg aagaactgaa gtctgatgtg 64382 ggaataagag ggaggaacat tccaggcact gggagcagca ggtacaaagg ccctggggca 64442 ggagggagca tgtgggaaga atggccagga ggcccctggg gtgcagtaca tggtgttgcc 64502 gggttattgt tcagttgcta aagttgtgtc cgactctttg cgaccccacg gactgcggca 64562 cgctaggttc ctctgtcctc cactatctcc cagagtttgt tcacattcat gtccattgaa 64622 igtgatgc tgtgaaacca tctcatcctc tgcggccccc ttctcctttt gctttcaatc 64682 tttcccagca tcagggtctt ttccagtgag tcagctgttt gcatcaggtg gctgaagtat 64742 tggagcttca gcttcagcat cagtccttcc agtgaatatt cagggtggat ttcctttagg 64802 attgactgat ttgatctcct tgcagtccaa aggactctca agagtcttct ccagttagca 64862 ggggctgaat cctatagaag cctgtggcca tggtgatgac gttggatttt attctagact 64922 ggaagtagtt gcagtcttat gcggggttgt tgtgatatat tttgtccttg ttttaaagct 64982 tgtggagaat ggattggtgt aggtggtgga ggcagggaga cacataagga ggttgttgta 65042 atFtgccagg gagagacgga gcaaactggg acgaggcggg ggaacggggg tggccatgcc 65102 ‘ 7 Ser Met Lys Leu Val Tyr Lys Glu Gin Gly 285 290 gtg Val ttt gga ggc ate ccc acc ttt cgc ttc gtg get ccc Pro age acc tta 65262 Phe Gly Gly 295 lie Pro Thr Phe Arg 300 Phe Val Ala Ser 305 Thr Leu ttt gee aac ggg tec gtc tac ccg ccc aac gag ggc ttc tgc ccc tgc 65310 Phe Ala Asn Gly Ser Val Tyr Pro Pro Asn Glu Gly Phe Cys Pro Cys 310 315 320 egg gag tec gga ate caa aac gtc age acc tgc agg ttc a gtacgtgtcg 65360 Arg Glu Ser Gly He Gin Asn Val Ser Thr Cys Arg Phe 325 330 335 tccctgtggg agggcgggag gtggggcccg tgccgggggg cttgtctgtc tctttaatgc 65420 ctggcctctg tacctttgat aattccatta gtccagagat agtgaggggc caggaagata 65480 actcaaaaaa aaaaaatgtg ccgtgtgtat ctgttgctgt cgtaataaat tcccacaaac 65540 ttggtggcct ggaatagcac aggtttacga tcttaaggac tcctgtggtt tagaagtccg 65600 acacaggcct ccccatgcta agagccaggt gtcagcaggc tgcattcctt tctggaggta 65660 gaaggggtgt ctctgtttcc ttgccttttt cagcttctag tttttgttgt taagtcactc 65720 agttgtgtcg gactctttgc aacctcatgg actgcagcac tccagtctcc tctgtgcttt 65780 gctgtctccc ggagttttct ctaattcatg tccattgagt cggtgatggt atctaaccat 65840 cttatcctct gccacccact tctcctcctg ccctcaatct ttcccagcat cagggtattt 65900 tccagtgagt cagctcttca catcaggtgg ccaaagtatt ggagcttcag catcagtcct 65960 tccaatgaat attcaggact gatttccttc attattgact aatttgatct ccttgcattc 66020 gaagggactc teaaaagtet tctccagcac cacacttcca aagcatcaat tcttcagcac 66080 tcagccgcct ttatggtcca actctcatgt gtggatggtc catccgtaca tgactactgg 66140 aaaaaccata gctttgacta gatggacctt tgttggcaaa gtgatgtctc tgctttttaa 66200 taccttgtct aggtttgtca tagetttget tccaaggggc aagcatctct taattgeaag 66260 ; ?rjeagtea ccatccgcag tgacttggag ccccagaaaa gaaaatctgt cactgcttcc 66320 agcttccaga gacccctaga attcctcgct cagggttccc ttcctccatc ttcaaaacca 66380 gcaacatcag agctctctga tcccactcct gtggtcacat ttctttttct gatacatttg 66440 tgcttccttt ttccagtttt aagggccctg gagactctat ctggcctacc tggacaatct 66500 aggccacact cctattttag gctgattggc agccctcacc cctcctgtag cctaattccc 66560 tttgtgaccc ttgtaatcca caggtcctag ggcttaggaa gcagacatct ttgggaaggg 66620 catcattctg cctccccggc catgatgggt agettaaaat gaggcatcgt agggaggacc 66680 tttcccctca tctggggagg aaaggaaget ggcaacggcc tgagttccgt gaaatettgt 66740 teagegtegg acttccctgg ctgtccagtg gttaaggctc cgcacttccg ctgcaggggg 66800 IC ® 8 0 7Ί 6 ICO Ο7Ί| ? f 75 ctcaggttcg atccttgatc aggaaactaa gatccagcat gcctgtcgca tggcatggcc aaaaaaccac aaaagataat taattaaaaa aaacttgttc agtggcgtgc agttacgggc ttgggtgtgg ccgctggcgc tgccgcattg tcctctagca tcgtcagtgt tttctggttg tgtgccagtc ctcgaggcac cccgcctcat gtgcttactg tggagacttg gatgtcagcg caatctccct atcctgaccc tcatccaggt cactggcaag cccggccttc aaattaattc ctgagtcctt cctgtcttcc tgctgcctca tggtccaggg cccttcagtt ggccttcctc ttgcattgtg gctaccctct gtgccaccca tttctcagaa ttcgcagtgt gttcccctta cgtggctatt taaattgaaa tcggtgactt ccctggtggc ccggtggtta aggcttccac tccaaggggt gtgggttcga ttcctggtcg gggaactaag atcctgcata tgacatgaca tggccagaaa aaaaaaaaaa agaaatcaat aaattgaaat tggtttgatt gaaatcaaat taaaaaagca gtgccttatt gcattggcca tatttcagat ggtccccacc ttcatgtgct gagtcgaatg actgtcctat gggatgaaca gtacagaaag agaatatttt cattatcata ggaagttcta ttggacatgg ttccagccag ccgcccaggg ggcctttccg agactctgac tggcaaccca accgttttct ttaaatgtcc aacccatgcg tgtagagcga agtccttaca gggggcccac tgttgtcggg atgtggcctc tgctggtctc tctaatgtga tttcttcccg tactttcccc ttaactattc tttagcccca ctgcctttgc cctctttcta agatatatct agtttggtcc tgcctcaggg cttttgtgtc agctattccc caggctgctg tagatctcta tgggtctttc cctcacctcc tcctggtcta ttccaatggc acctcctcca gcaggcctgc tctgatttgc cactctaaag ttgctctccc caccccacct cccaaatact ctgtctttca ccctttatta tcatcctggt gctcatcacc ccctgaaatc actgaaagtg tctccactgg acggtaaaca ctgtaggcag gtctgtgtcc tcagcttcta gaattgtgct cggtatgtag tggggactca cgcagtgtgt aaacgtaggg atgtgtgagt gtatcttact taggaaattg aggctcaagg ctggggtgtg actgagctca tagggctggt aggacaagaa gccattcctc atctttctag gtcttgtctt ttggggcctg tttgattaga gccacgttgt cagctggaga tggggatttg ggaggggttg tttgcaggag ggtttggagg agggactgtc agcaggttgg acggtttccc caagttcagg cagaatgagg tacttcatgt ttgaagctgg gacctggaag tgcccatttc tggcatggcc gtttctggcc ctcctgccct tttcctctgt ttgcttcttt cttcactggt gtctatggga atttctgctt gtaggtgagc tgacagtgca gagacctggt aggctgtgtg ctacacagtt gccatagcaa gtggcagatg ctataccagc ctgattaggc cgaaaagggc acttcttggt ttatctttgt attaggcatg gctccagagc tcagctgtgg tccaaagctg ccttttgcca tgggccagct cgattttcct ctggactggt ttcattgcca gggaggcttt tggctccagg gtccaggctc acctcctccc agcagaaaag ggttctgtgg ctcctctgta gtccagcaaa agtcccagag tttgctctga ttgggctggc ttatatcaca tgactggctg tgagccaatc agtggccaag ggtgggctat gcagattggg caggctgtag caggtgctca gcccctggtt ccagtgagtg gagccagcac ccacatggca agaggctgaa agtaggggag gggcttaatt gaagcctggg ttctaggaga tggtgcatac ggggcaggca caaacaacat atccatccac tgccaagggc taggcttgag aattacactg cctcatctta gcacgtgtgc caaaagaact tcagaagtgc aagggaatta cgtatgcatt atgtaaatac aattttttct tttacattga aataatatat acaagaaaga tacccaactg atatacgcac tttgaaagtc cacaaaggga tggagaaaga gcaggagtga tcctctcagc cgctggcctc acttccagca ccacggcttt gcctgccttt ggtctttatg taaatggagt cataaagcat gtatttcttg ttctctactt ctggcttctt tcacccattt tcgaattggt gaagtccgtc cccattgttg tgagagctct tttcattgct gtatagtatt tcagtgggac cgcacttcca tttccttacc tcttgtactg ttcatgggca tccaataaga ttctgctcat tgaccattac tttagtagcg ctaggaatgt tctcatacat gtttttgggt gcacttgtgt gtgtatttct gtggtatttt atctgaagat aagaaatacc cactcatttc cctttctggg ccttgaggag ttcttggact cagaaaactg tctctcctcc aacctccgtg ctgtgtaagg tcctgaaact tgctcactgg agccccttaa ttgtaatcca tggtgatcct gggcaattag gtctggttag atgtgtcata aagctataaa ttaattacca cttattacct gggcgttgtc tctctcaatc tgtttggaaa taaaatagaa aaaacatgta catgtgtaca tactattaaa aaaccaagca agctgaagca agagcaggtg atggcaaatt ggtctagccc atctcagtct cccccgagcc ttgcaggcgt gatggagctt gtttgaggtt catcatcttc tagggcctgg ctcagtgact jcttccctta ccaaggggga ggcgttcctc gtgtgtttgc tccgttgatt tcctctcatg gtagagatgg gagaatggga agcaaggttt ttcaaattgt gaaaccttgt ccttggtggt gcccaagacc ccaaaggttc aaggaggcag ctttaaataa aattgactta catggtgcga gggggtcttc tggggtggct caactggtaa agaacccacc tgccaatgca ggagatgcaa gaggggaggg ttcggtcctt ggctcaggaa gatctcctgg agaaggaaat ggccacctgc tccagtattc ttgcctggaa aatctcatgg atagaggagc ctggtgggct acagtccacg ggatcacaga gtcagacaca attgagtgtg tgcaggcgcg cagatagggt gagatacggc ttctgttttc cattcttttt ctcctcctga ctatctccag gagaaagtgt tggtgctaag 66860 66920 66980 67040 67100 67160 67220 67280 67340 67400 67460 67520 67580 67640 67700 67760 67820 67880 67940 68000 68060 68120 68180 68240 68300 68360 68420 68480 68540 68600 68660 68720 68780 68840 68900 68960 69020 69080 69140 69200 69260 69320 69380 69440 69500 69560 69620 69680 69740 69800 69860 69920 69980 70040 70100 70160 70220 70280 70340 70400 II® β 87$ f agggcttgag tgcctttcta acactcatgt gtcctttttg acagagaaaa agcaagtctg 70460 agggtgccag actcttcttt tcatgcaggt aacagtctct ggatagaatc tacagcattc 70520 atttgttcac attgtattta ttcctgtatt tattttctaa ttccatcagg tgtttaccag 70580 ttatgcctca gatagcaagc atctttaaaa tatagctgtt gaaataaagc agtagcagct 70640 gcttcaaaga agcacattat gtaacagtgc agggggtatc cggatatggc aacacatcag 70700 agagatactg ggaagaataa attaatgttg agaaacttga agacaatgga tgggaaagga 70760 vctgggaaa aatgaagtca gacagcagtg aaaccccagc ttttatttta aaccggtgct 70820 tggctttgct aagaaaagca gaaagaacct agacatttga ggttgccagg cacacacaaa 70880 caggaatgtg ggtcacttgg ctggcagttg atgggctgct ggttttaggg gacgagacct 70940 tgtgagtttt gttctttctt ttttttcgca tcatggtgaa gttcctgtaa tatccagtta 71000 accattttaa agtttacgat tcggtgacgt ttagtacatt caaaatgttg tgcagcgtcc 71060 gccgcggtct agttccagag cgttctcatc aaccccagag gagccccagt gccccttagc 71120 actccccatc tttgctcttc ccggcccctg tcactgccgg ctgtgctctg tctctgtgat 71180 ttgcccattc ttgacctttg ccggtttctg ggggaggctt attcttttcc tccttgactc 71240 actgtccgtc aggcttgtct gttgtcctga gcacatgagg atgccctggt gtttgcctct 71300 ctcggtcggt tgacggagag gttcagcttc aggtatctgg gtgtgaattc ctcactcgga 71360 gggatccgag tcagggtctg ttctcacaca ctggccttca tcccacagac cagctgctgg 71420 gagagaagga acgaagcagg tgtgtcttct cccctcccgt ggacgttagg gagacctgag 71480 gtgtgcacac ccgaacaact ctgatcattg tattgcctgc cgaagacagt ccaggctgct 71540 tggcttggca atccagaggc ccttcctctc acccaagttc aagtctttct atcctcagtt 71600 tccatcattc cttccaggca ctgtctgctc catactcact gtgcgtttcc tcacctcctt 71660 gcattcacct ctgccgtccc ttcacctgga atgccatccc ctgaactcct ctgccggcat 71720 ctttgagcca gcatcttctc cttgctttga tttctcctcc tttaccattc ctatggcacc 71780 gagcttgtcc cttgctgggt gggttccagt tcctggcgcc tcttgggtgc ttggtaaata 71840 atcacacacc gaatgagttc tgtctagtta ctgctgtttg catcttgtca tcatcacgag 71900 tgggtgcact gcgggcagtg gctgtgtttt cgtcgcctgt gcctcccttc acccagctca 71960 gggcatgacg tgagcaggtc tctggatgtg caaacgtgct gcctttgtct gacaccccct 72020 ctctgcccct ttgctttcca g at geg ccc ttg ttt Phe etc Leu tee Ser cat His cct Pro 345 cac His 72070 Asn Ala Pro Leu 340 ttc tac aac get gac cca gtc ctg gca gag gca gtg tet ggc etc cat 72118 Phe Tyr Asn Ala Asp Pro Val Leu Ala Glu Ala Val Ser Gly Leu His 350 355 360 cct aac cca aaa gaa cat tee ttg ttc ctg gac ate cac ccg 72160 Pro Asn Pro Lys Glu His Ser Leu Phe Leu Asp lie His Pro 365 370 375 gtgagcccct gcctgtcagc ctgtgggtgg gggtgggggg aatttctgtt tggagcgcac 72220 tcaactttct cctctccctg ccaggtacca ggctgttcca gggtggggat gggaagcctg 72280 ggttcctttg gcattgatag cttctaggct atcaagtcat caaagtttgc cccgactcca 72340 tagtgcaagg actttattat ctctttataa gggaactgtc tctataaaaa gatcataata 72400 cagtaaatta attaggagtt atcaacctgt aaattagcca gaggcagccc tctggctgtg 72460 ccaacatacc ataaagatct ttagataccg acaagaacct ggcacgtctt gcagataaac 72520 tgggttcggg ggaatttgtc ctgtgtgatg ttttgtctac aaacagggac caggagcata 72580 tcagacctgc acacgtgacc ctcccttggg catgtcttta ccctgttgct tcttctctta 72640 gggcctccat tcactgcaaa tttgcccttt tggacttggt ggctttatcg ttagttaaaa 72700 aaattctttg ggtttctgtt tctggagtgg acattcgtgg tctccctcca taggcctttt 72760 tggaagctct tctccttgat gctttttcat gctgttttcc ttggtgtact actcagattt 72820 ttagccac tgactcaacc cacagcccct agcactccac cttctagctc tctcttcttt 72880 citcactaaa aatccagact gggaattccc tggttaggga attccagtgg ttaggactcc 72940 atgccttcgc tgccgagggt gtgtcttcaa tccctgtttg gggaatgaag atcccgaaaa 73000 ttatatggct tggccaaatt aataaaataa aataaatctg ggttagtgaa gtcagccatg 73060 actgcacaca cttcacattc atatttctag aatgctcatt atgctccaga cataatccta 73120 ttcatccaca tgcaccaact catttaattt tcataatagt cggggaggtg ggcattgcca 73180 ttcccatttt acagatgggt aaactgcagc ccaaagaggt taagtgctcc agctagtaaa 73240 tggggttctt ggctccatca gggaaagagc tgttctgtcc tgttaattgc ttgaattcta 73300 gcggttagca cagaagtact tatatctcag taaacatggg tttgatttac tgagatccta 73360 gtggttgaga gtaagcaagg gataaggctg aattcaaaca taggtcttct tttttaatta 73420 aaaatttttt tgtcttttaa accgcgtcgg tacggagtct tagattagtt tttcccctgg *- egcttacg utgacctgta tgttctatcc cagctgatct ctcgaggatg gacaagtgta catggactgt g ugggttccc ctgcattggc agtgattcac ctatacaaac gaagtgggta u.. taaattca aaccagtttt gcactcccaa -'atgcggta tccacgttcg ctctgctgac ttctccccca ttttgcagca ggaggcagac tgggggtgga gcggcttctc atgtgggctc ctttgctcaa catatttcct caggatgtgt caggacccag acagtcagta cagagccttc agccagggac tggcacggac caaaccctct aacccaggat ccggatgaac tcaaactctc ccagaagacc gtgataacga cttgcagaaa cagctgagaa tttaaaaaaa cacagattct gaggcatgtg ggcagtttct ttctggtacc ttactgctta aaattggaaa gcttctaata aaaaaaaaaa cttttgctgt Lgcagtggag taaaattaaa ttggcatgag ccagccacgt tttatttcaa aaaataatat atcttagttc taaccactga ttaggcctac caccaagttt ctaggcttca tccaccattc atttatcccc tttgtatctc taacctttta taataagtgc agtctgccag gtttccttct aggcagattc aatttttaaa aggtctttta ttaatgaatt gtctttattg taaaaggctt tgcaagcgac tggccgaaag tttttagttc ttttctctgt cattgagaga gtgaatcagc agggagagga tctgctgatt tgtggcctgc atggggcaag gaagaggtgg ggggaaggaa cggggtctac caggtagtca aagggggaag tcctggggca gctcagtcag tccagactcc aggcccaggg cccagaggcc gctttttcac cccggtcatg tcaggatgct cgcagcgttt ccctacgagg gcagcagtct tttatttggc ctagttgtgg ggatcttagt taacccctgg accttcctgg aaaaacaaga ttaaaaattt caggggcaca ttctctccaa ggtggcctgg ccaaaaaaaa cataaagaaa ctctgttgaa ttacccggtg aatgtttttt actttgtttt ccttgaccag acctccaggg agataaactg gttacaatgg ctctgtgttg agtctcctaa cgactacctt tatagttctg aaaaaactga ttgtgctcag gctcctctgt ccaggggatc tttaccattg gtttatacta atgcccacta aagttgatca ttagacatgt ttattaggga acaggcttga aaaaaacaaa attcatttca tctcactggt gcaagttaag agatgcagaa agtggcctcg tctgttctca ttttctgctc tatctgttct ccagacagca gtggcccgag aggatcaccc cactcacttc gcacggcggg tcacacaggg gactcagcgc aggaaggaaa agcccctctt aaacaggggc acatggggga gcagcatggc gggctatgct atggccctga tgggcagagc gtcctcaaac tgcattgggt cacgggctca tcccccacca accacgagga tttttggttc tctcattaaa ctccaggact ggtttgatcc atggagagtt ggttcgatct aaaaacaaaa aagtatcact atagagattc gctcagtggt Ilo 8 C ctttaaacct ttgatgttgt ggatcaaacc aagtccccac agcagaaaat atgaatgaat ttcaggttta gaatggtttc ctacattcac ccttttccag agtataatta ttgcttcagt ccatgcgatt ttcctgaccc agtctcctgg cacttacagt ccttctgtcc taattaatat taaggctttt cttccctggt tccctggtca ggcttttatt cggcttctct gactttcatt tctgggaggc gtagtcttct gatttgttgt ttagctttga cggaaactgg gtggggttgg gctggaggga cagagacctc tcaaattgga tgtgatgtgt tgaagtctgc cacacttcgc ccagggtgtt gcaggtgtca atctgtcagg caccatgcca tctcactcac ctttggccag agaagataat gtgtggctgt tgtctccact ctagattcct cttgggtgca gtagctgtgg gggatcaaac aagtccctcc tagatgtgtg aaaaaaaaat tccctgacag ctggtcaggg cactggcagt atggtcgggg ggaaaaagat aaactctctg catgaaaatg aaagaatcct gagtatcatt tttgtttttt cttgccccct tttgtttttg acagagttcc gttgttatta tgggttttga actgccttca tcccatcaaa aatgtcatat atagaccgta cgtgtctgaa ttccaggcaa ggggatccaa gaagccccag tacttaattt tgtattaata gattctatta ccatattgtc ggtcctttgg gggaactaag agaaatctaa ctctctattc ttagcgtatg tggagagatg cctagttctc tgatttgggg aaacagaatg gggagggaaa gatgaggggg cagccaggga agcatgtaga ggatttgcta cacggtgaag ggggaccagg tccccgtgtg tattgcgggc gcataaacta gagagatggg ggagggcagc atcctgccag ttcctctgtg gcctgttccc cttgcatccc tttcagatga ttccattctc tcacgtggtc cacgagggtt ccgtgtcgcc agtctcattt tcacttctcc cctgtacaaa tccagtggtt aactaagatc ccagtggtta agctaagatt tttctctaag tgaaatatca tatttcagag cctgtcaatg tgcatatgtc gtttgaccat gcagtggaag ttttgttttt tagacctcgt actaacgtca caaatgcatg gaatcccgtg cccttggcag agttggaacc ttattcatat tgtgcggccc gaacactgga cctgggtctt tgtataatac aaagtattga ttcagttgat catgttctag ttaaactttt ttaaggctct attccaggtg caaatggttt ctttttttct gactttcttt caaagagtta atttcaggct aggatgagca cctcctggca cccctgacag agaggcaggg gggaaggaga gtctggagag gaagaattcc gacagaaagc cacaggctcc aggtgtcctc accctctgcc acctgtttta agccccctga ctcaggccca gttctcaagt ccctggggcc actggtgtct tgactttgcc gaaagagtct atttcctttc cttcatggta cagtcacccc tgcattgcaa cctgacacca cgttattgac ggaagctttc aagattctgc ccaaagccaa ggactccacc ctgcaagctg aaggttaaca tcgcctgccc gcactaggga caggagaagc 73480 73540 73600 73660 73720 73780 73840 73900 73960 74020 74080 74140 74200 74260 74320 74380 74440 74500 74560 74620 74680 74740 74800 74860 74920 74980 75040 75100 75160 75220 75280 75340 75400 75460 75520 75580 75640 75700 75760 75820 75880 75940 76000 76060 76120 76180 76240 76300 76360 76420 76480 76540 76600 76660 76720 76780 76840 76900 76960 77020 to8C7»e j .gtttgatc cctgggtggg gaagattccc ccggagaagg aaatggcaac ccactccagt attcttgcct ggaaaatccc atggacagag gaggctggtg ggctatagtc cacggggtca cagagagtcg gacacgactg agggagtaaa cagtagggac caggcatgct tcctgattca gactttctct ttcagatgct ggcaggaggg aatggagagg ggtggggggt tggagaagat agtgacttta tcaacgtgca aatctatttt atttggaggc tggagggaga ggcaatgact gagaaatatc cttctgtact caggaatgcc ttgtatgagt ggaaagatgg aaaggattat tttttcccat ccagagatag tctggttctc tggaggggtt ccctcaacgt tgtggacata agagccattt ggggaatatg tttttaccca tcaggggtta gagtgggtag aggagacccc agcagatggg cacttcacct gggacatgca ccttcttgaa tgggaccagg gagaggggga ctagaaggga ttcctggggg ttcaggaagg gctagtccct cactgtgctt gttgccgcag 77080 77140 77200 77260 77320 77380 77440 77500 77560 77620 77668 gtc acc gga ate ccc atg aac tgc tet gtg aaa ctg cag ctg age etc Val Thr Gly lie Pro Met Asn Cys Ser Val Lys Leu Gin Leu Ser Leu 380 385 390 ttc gtt aag tet gtg aaa ggc ate gg gtgagtgggg tctgtgagca Phe Val Lys Ser Val Lys Gly He Gly 395 400 77714 ggggctgcct actcaagtct cttagctctg ttgtcccccg 1 ί itaaaacc dcctgagggg ttgctttgtt tccttgggtt taaagcaggt cccaatctcc aatgtttgtg ccatatataa ctgtctctag agtaatattc acacacacac gcttctgtgt tctctgggta ttaagcacag taattcacac agttggacga ctgtaccatt ccatttctct cttctttcac tcagtccatc caactgatag atctttaaaa aggctttctc gttgcggtgg ggtgtaccgg gggtccccgg gaatatttat ttacagcaga gactgttatc . icatctcca tcagatggga aagatctcct ggacagagag aactttcact i . nnnnnnn tcgttgaggt agagggcaga tcccgaccag tgcggttgac ggggagggat agctgagtcc ttagtcagaa gtgtttgaaa ggagaggtgt tctgccctac tccttcccgt tctcactagt caactgattc tctctgtttc gtgttaatat gcccatccgt caatatatat acacacacag cttggctgca tatacccaag gttttctttt ggtaccaaac catcaccaca agccgtcact ggatttaccc ttagcctggg ttactgctga acatttgggc aagtttgtgt tggttgcagc cttctcttgt cttagttgcc cattggcagg gcctgagtat attgctgggt cagggcggct tgtcttcgcc atgaatcttg ggagtaggaa cctggtgggc cactcattca nnnnnnnnnn gcacaggctt ctcagtagtt ggattgaacc agatcgggga gtgggatttg agaccacatc tattctatcc atggaaactt ttttttatgt agcagagtga tcaggtcgcc tatctatttt cagctccctt tgcttttcaa acaacatttg gtctctgcaa atatatatat cacatcttta gtgagcactg agtgggcttg tctgtttttt tcacccttta gtccattttg ccccacttcc atttgggcca gttctcaggg ataatatgcc tgtttctgct ctttcgtttt gggcaggggc tgtggaggac ccttggcacg cagattctta gtggatgtat cctctggtgg acactatttc aactcttgct cctgcaatgc atggcaactc tacagtccat ggatagagcc nnnnnnnnnn ctcgttgcag gtggtgtgct tgtgtcgcct ctcagggaga gtccctgccc ctgacaccct aagctgtttc ggccaacctc ttttaattgc ctcagctctg atggagcact acacatagta ccttccttgg atagattcat tgtttctctt actgcacaat atatatatat tccattcttc gggtgcatgt ctgggtcata tgtttttcca agaacataca aaacttttcc ctcagcctca tcttatctga ctcatccatg attgcctggc ctttggccat tggctgtgct tactctctgg aggctctagg tcaagtcttc accactggac gttttcattt ccctatgttt acactcccac ataacatcac tggagacccg actccagtat gggatggcaa gggtgaggga nnnnnnnnnn tcacttagct ggcttagttg gctttggccg ctctggcctt cttgaactcc tgccttttct tcccttgaca attctctagt agtgtagttg tgtgtgcatt gagtacagtt tccattgtat aatccatacg ctgtcccatc tcttatttca ttcattcctt atacacacac tattgacgaa atctttttga tggtagacag gtaacagctt gtgcagtagg atcaacccac ggcaaccctt acagagttgt ttgtagcagg aagaccgtgc tatgaataat acgtctttat ttgcgttgca ctcacaggct ctggaccagg caccagagaa ctcttgggta aaccgtttga cagcagcgtg tatagcacag ggttcgatcc tctggcctgg agagttggac gcatgctgat nntaagtctt tgttgtagag ctcgacagca gtggattctt gttcttggga taaggagaat ctgttgacgt gggtagcaaa gagaccattc ccttacgatg catcccctct ccctgcgctg ttatgtcaat tttgttctct tttttagatt ttctgtgtga tttatgactg acacacacac catttgggtt attacggttt gagaaatttt catcaagatt atattcacag agaagaaacc aatttactta atgtgactgg tgtcagcact ttttattcat gctgctctaa tactgtgttc cagacttctc cagtagttgg gatgggacct gtcctgctct gatagatatc ggaaccgtca ggagggtgcc agctggtggc ctgggttagg agaattccat acaactgagc tgnnnnnnnn cgttgctgtc ttcgggctct agtggaatgt aaccactgga 77774 77834 77894 77954 78014 78074 78134 78194 78254 78314 78374 78434 78494 78554 78614 78674 78734 78794 78854 78914 78974 79034 79094 79154 79214 79274 79334 79394 79454 79514 79574 79634 79694 79754 79814 79874 79934 79994 80054 80114 80174 80234 -,, <0070 ccgccaacga gtccaagctt tccatcttta ccttttgagt ctgctcagag agtttgttcc tgaagtgttt gtggctggtg agacagcccc atgttgggcc ttaggcgtct gctgctcagg ctggagttcc ggagggcccc ccatcactca atgcctggtc tgctaacttc atgctcaggg cgggcaggtg actaggacag aggaaccgga caggctgggt ggggacgggc caagggccag tctctgtaga gcaccagggg cctcgggctc agtgtggcca catccgatgc atttgcaaac gcaggtttca gaatctggat tttaacacct cagtttcacc tgttgagagt tcattctgac aaatgttgcc caagccagcg gtcagtctct ctgggtggct ggattctact tgttggtggc cacacactgc tactttgatc tctctggggc tctgtgtccc cagctgttca gagctgctgt gggctggggt ggtggtctca aagatggtgt ttatcaacat ccctgagggc tgttgaggaa ccagtgtggg caaagtctag aaacacagct gttccagaaa cagagccatc aagctgtgac ttctccgagg aacttctgtg ctgtttggtc acaagataga ggcacgaggg ttgcacggtc tgtgcattta attgacatca gttcttagaa actcagatga aagaggccaa agtgaaggtg gacccccctt gtatttctag aatgttttcc atgtctgtct cctctgcagg tgatactgtg taaattcatt tcactaccca gcactctcct taataagtga tctttgagaa ttgtgattga ggatttgggc cttttgtgcc gactctagtg cctgtccccc tagtgggttc catctcccct ccagctgtgc cttctttaag cagactcagg aaggtgaagt tacggaatat ttgtttgttc tcttgtttcc tggcatttaa cagctgcatg ctcagtcgct aggtcatgtc tgactcttta gaacactgtg gactttaacc ctccaggttc ctctgtccat gcagttttcc aggcaagagt actggaatgt attgccattt cctcttccag gggatcttcc caacccaagg gttaaacctg tgtctcctga gtctcctgta ctggcaggca aattctttac catggaacca cccacctgga aagccattta acaactagac aacagtaata aacactgaac actttctata tgctgggtat ttttcatgta tccacattca gtcctcacta gaaccctgtg gggaattcat tataatcccc atttttcaga ggaagcacag agagggtaag gggcatgccc gaggtcacac agcttgttgg -;actgactg tgtcgggggt tcccaggacc actctcaggt tcgatgattc actgggaaga ctcggctgtg atttattata tagaaaatat tcaaaacata accagcaaag gggacaggct cacagggtga agtctggggg aaccagacag aggcttctag agctctctct taggggagtc acataggaca tgtttcctcc tcccagtgat gagttgtgat atgtgtgaag tgtcccctac cagggatgcc cagtagaaac tcttcccagg ggatgtttac tgggggctgg tcacatcggc yctttctgcc tggtatgcac ccaaattcca gactccctga aggaaagcag gggatcagca taaaccacat tgtttgttag ctgggtacat tgccatcctg caaaaaactg gcattctgtt tcaaagagga agaaatgcac atcagctagg tccctggcag cacctaccac atagaagaca tgaagttttc atttaaaaag atattgtcag attgtcaggt tgcttcccgt caggagatac ccattcctca agaccacgcc gatatagtcg ttgtagaatc acaggtccag agctgtctga cctgaggcac cctgacaaaa cttctcactt gcttgatctc ccttatttcc ag a caa Gin act ggg aac ate cag cca gtg gtc ctg ccg eta atg tgg ttc gaa gag Thr Gly Asn lie Gin Pro Val Val Leu Pro Leu Met Trp Phe Glu Glu 405 410 415 gtaaggctgc ctccctctcc ctgggtatca ggtacttgtg gtcatgtgtc tgatgcctca gtgaggaget gatgtgggca tttgaggcaa gaggctgtgt gtggtgggga ggcgggactg ggtggctgga ctctgtgatg cagaacagtc tattagaaat ttcgccctct ccaagcacct tatgteaate acgccactgg actgaaaggc teaettgaga tgagaaagac gaagctgcct gagattgtaa agtccctggt cagggtataa aataattttg etaatgeatg tgaccacttc tccaaagatg aagggaagtt cgttttcagt gtgtcagctt tttattgaac ttccttttct cccagctttt caagattcct tctggcttag ttcattttaa ttcagggtga gctaacagcc ggaacagaca gtctccaaat gteaaatteg cttcctgctc acatcacagt ctgatggagg ggggaggtgg agctctgctc catgcagaca tttggggaca tctgggctcc ttccatcgtt tggtcctgac ettteggaga tcctcagaat ccatttccat tcagtaaatt ggcaaagaga tergagagaat cacatgggag ccaggcgtgg aaattgtaac atccttgtgc ccacatccca 1: ygccagaa gaagtcacat gggcctgcct agetgeaagg gagtctggga aatatagtcc tgttgtgtgg ccctggagga catagaggct ggctaatggc atgctttggc cagtggtcat gggatgggga agggatagag tggcatctgc accctcagct tatagcatgt ggccctagtc gatctgtttg tccttcttcc ccag agt gga gca atg gag ggt gag acc ett Ser Gly Ala Met Glu Gly Glu Thr Leu 420 425 gag aeg ttc tat ate cag ctg gtg ttg atg ccc aaa gtg eta cac tat 80294 80354 80414 80474 80534 80594 80654 80714 80774 80834 80894 80954 81014 81074 81134 81194 81254 81314 81374 81434 81494 81554 81614 81674 81734 81794 81854 81914 81974 82034 82094 82154 82214 82270 82318 82378 82438 82498 82558 82618 82678 82738 82798 82858 82918 82978 83038 83098 83158 83209 83257 A. * R 6 IE ο β ¢: 80 Glu Thr Phe Tyr lie Gin Leu Val Leu Met Pro Lys Val Leu His Tyr 430 435 440 gcc cag tat gtg etc ett gcc ctg ggc tgc gtc eta ctg etc ate ccc Ala Gin Tyr Val Leu Leu Ala Leu Gly Cys Val Leu Leu Leu He Pro 445 450 455 ate ate tac caa ate egg age caa gtaagtagtg gtcagagcat ggcctgggct lie lie Tyr Gin lie Arg Ser Gin 460 465 83305 83359 jdgtggtccc tcccttcctg gcagtcctag gcaccttctg caccgcagtg agctgctggc ' Tttgatggg , acagaag eagtgctgtc taatagccac atatccaaaa ttatgttttt attgggactc acagtatcca gaggttgaat ggtggaggaa atcctgccac qi.aggtcatt actggaagct cggcgatttt ttgcaatcaa tcttcaaccc tcactttctg acattgtctg acagtcagag acaatgtgtc ccttaatgaa tcaattttaa ttttttaaac ggtttaagga atgagaaagc ttggaccaga atctgccatt cttttctttc agttccccaa ctggactgcc nnnnnnnnnn ggcctgggcc cacccgcttt ggcagattgc • aacctgg ggaaaaggtt acgttgggga tgtttggaat ggatgactcc cacaggcggg gccagacagc aagggggagg gttccccaag ttgcttgcct ctgtgcccat gtctctactt ttaccacttc gttttggatc tgccaggttc catgcgggga aagtgatttc caggacagat gttaggtaaa gattaccatt gagtgcagtc accccatttc gggaggttgg ttaggcttag tggccagtgc actagattgg cctggccctg tttaactcat tattttggcc tagttacccc actcctctgt catcaaaatc aatcagaact aaagtatctg attttgggga gcaaaccgtg gctctaacaa atgttaattc gaggagtgac agaagcaggg atgggagcaa caaagtctgg ttccttggtc ccagggattg atggaagtcc nnnnnnnnnn tcggaggggg cttgctttag atgcttgctt gctttcagac tgcactgatg ccctgtcctc gaattatgct ccaggcccag gggtgggggt ccccgccctc agactgagga tcccataaga ccttggggga ggacacagcc gggctgggga tctgcctgtt atgagacctg tggcaggtac ccagcattct accaatgata accacacgag agggaattaa tcaatctgca tttggaatcg aaagcctcca ggacagtgat atgtgaatgc aaaggccctg ctgtaggcgc taactcaggg tattgactgg agccaaaaat tgacacacct agaaacaaag aatcactaag atgttctgtc cctaaaattc aaattttacg agtgataatg cttcgcatgg actctctaaa tgggtcggtt ggaccagtgg gtattcagga aagaagatca tttttttccc aacctctgcc caaggaaaac nnnnnnnnnn gttgcccagc ctttggcaaa gcttgttggt ctttatcacc tgagggtacc tgtcactgtc ggaggacaga catcaccgtg gaggtggacg tgtcccctct tgcaggatgt ttattcatcc aggaggggct tgcaccctca gccatccatc ctgggaggct gtactcgaat agcgcgtaca agttggaaag aagatgatag ccacatgtgt tttcaatcat atcaatataa gtgtgtattt cagccacatt agcaataatg tcagcacaga aggcaggaat agcaggggag tgagcggctt ggaatttttg taattctgtt gtacagtctt gagcattctc gttttttgtc ttctgagaca accaaaaaat tttataatat acaatcataa tgatgttaat aacatgttga gacatgtggc ggaggcccag acaagagccc ggggacaaca tctgccttgc ccctgcagtg ccctttctga nnnnnnnnnn ttctctgctg cagccttttc agctggggcg atttctcttc agggcctctg ccagccagag ggggaccaga cgtttccagg gggccagggg gtctctctcc gaacacttcc tttctattaa taaatcagat gcctgcaccc actgcatcct agggggccca ggtttgttca acagtgaaca acaggtggga agaatgtgat gattttaaat atcttttatt aaaaattaag gacacttaca tggctgctag tcagaagagg gtcatggaaa gggtggggct gtggtatctc ggaactgatt cagaaacaaa atttgactgt ctcattttca tagcatcgtg tctttgttgg ctagtatata tattcttcac aaacaggatt gctgtataat tgtattaacg tacgtctctg aactattaat gtgagctagg tgaagaacca aataccccct ggcagggcat gaagcacata tttggcatca naagttttcc ccccctcggg tcttttgcct atattaaacc caaattcccc gtgtcttgag cagaagggaa ggccctagcc agtgaagaca aagcagctgg taatggtcta ctgcttcacc ttatggtgag tccccaactg acttcgagca tgcctttcct actttagagg tctagtcagc agacagttcc gtcaagtaac gggctcaggg ttaaatgttc taacctggat tacttttgca gcagatcttg actgggcgcc tttctctgaa gactgctgca gtattggagg agaggcagag ccaagggatg tgcctgtagc gtgtaggtta tgaaatgttg agttctgttt tctaatattc tgttgtgcag tcagaatttc ggaacaaaaa gagcccttaa tgtttttttt gtcaataata agaccttcca atactctggc gtcctggggc ttcttttttt gcaggctctt gtcttaacct tnnnnnnnnn tggagcccca ccacctgcaa ttttctcgga tttccaggct atccttcggg cccccaatga ctcccagtgg cccagtctgt tacacagcca tgagggcggg ttagaagggg ccccatcctt gctccctccc 83419 83479 83539 83599 83659 83719 83779 83839 83899 83959 84019 84079 84139 84199 84259 84319 84379 84439 84499 84559 84619 84679 84739 84799 84859 84919 84979 85039 85099 85159 85219 85279 85339 85399 85459 85519 85579 85639 85699 85759 85819 85879 85939 85999 86059 86119 86179 86239 86299 $ * 8 ' / 8 δ IB Ο cacaggttat agtggaggct caatcaatga aatttatccc attgtgtgtt ttggacagag 86359 gagcctggca ggctacagtc tatgaggtcg caaagagctg gacacagctg aatgacaaac 86419 acgtgtaatt tttggtttag caagggttag gccttttgtg tttttatata tttcccctgg 86479 gggaaaaaaa aaagaatggc acgtcgttaa actcaacata ttttaatttc tcttcaaaga 86539 cgtttttttt gttcaagtca tttttgaaaa aaaaattgtt ttaaacagaa acacctctgt 86599 ttctggtcta tttaaaatgc cacctgctgg ctcagtcagt acagcatgaa attctccaca 86659 tgccacttgc tcacctctct gagactaggc cgagccgcca tgagcaccat agcccatctg 86719 ccctgctcaa cttggcctaa attctcaggc cgaaagaccc tttttagttt gcccatctga 86779 ccaaatgtgt ttcctgaaga tgctggtgta cgtgtcttgg gtgaagggca ctatcacttc 86839 ccagatctcc caactgcaaa tcattaatgg tggttggacg tgaaagttct gtaccccacc 86899 ctctgctttt tgaagaaccc tgcaaattga agaaacctat aaaacccgtg tgtgttcagc 86959 tgcgacggca actataaatt agcttggtta tcttctag gag aaa tgc tat tta ttt 87015 Glu Lys Cys Tyr Leu Phe 470 tgg Trp att agt lie Ser 475 ttt aaa aag ggc tea aag gat aag gag gcc gtt cag gcc 87063 Phe Lys Lys Gly 480 Ser Lys Asp Lys Glu Ala 485 Val Gin Ala tat tct gaa ttc ctg atg aca tea get ccc aag gga act gta ctg caa 87111 Tyr Ser Glu Phe Leu Met Thr Ser Ala Pro Lys Gly Thr Val Leu Gin 490 495 500 505 gaa gca aga ctg taggtgggta ccaggtaatg cccccccact ccccacctcc 87163 Glu Ala Arg Leu tcccgtagtg agtagaactc tggcaccctt aaaggctttg gatctcatcc atctcttcag 87223 cctgcacttc acctgtctac agactgaaaa tgtgtacttt gctgtcttct tacattctga 87283 gtgatcccag atgtggtagg ggatggaggg cgattagtag ggctggtgtc ttattttcaa 87343 gtttgtctta aaaaggcagg atcgaggttt aggtcagctg cttctcagac ttccggtgca 87403 attgactctt ctggggaagt ctgctaaaaa tgaagatctg aggacattct tctaaacctc 87463 ctgaaataga atcatggaca ggccccggga atgtgttatt ttaatcccct ggtgactcag 87523 tggtaaagaa tccgcctgcc agtgcaggag acgtgggttt gatccctggg ttgggaagat 87583 cccctgaaga aggaaatggc atcctgctcc agcattcttg cctgggaaaa ccccatggac 87643 agaggagcct ggtgggctac cgtccatggg gccgcaaaga gttagacacg actaagcgca 87703 cacgaaccaa ggggattatg agtagattgg tctatttatt tatttttggc tgcgccctgc 87763 ggagtgtagg atcttagttc cccaaccaga aatcgaaccc acgtccctgt attggaggcg 87823 tggagtctta gccactggac tgccagggaa gtccctgata tagattggtt taagtgaatc 87883 tgggatgact gaccaaggaa gaaacaattt agacatcacc tgggcaccca gtatatatcc 87943 aggactcagt ctgaaggtag gattgccaga ttgagcaaaa acaaaccaaa aaaactccca 88003 agaaataaca gcagcaaaga gatgctcagt taaatgtgaa ttttaggtaa acagtgaatg 88063 attttttgcc taagtgtgtc ccatgcaatt gtcgggacac gcttatattg aaaacctgtt 88123 cgttggttac ctgaaattca catttaacga gctgccctcc ctgtatctga caacctacct 88183 gcagaagaag taggctggtg ccttgtgggt tcaccttcct ctgggctgtg ttcctttagg 88243 tctgaggtct taggagagct aagtccagcc aggggaggtg acaggcagag ctcttagccc 88303 tactgttggg gtttgggcag gagtgagtca gtcgcactat ggttgtgcct ctgatcatag 88363 ctgttatttt ggtttctgaa aaatgtgccg ccctcgccag cttcttgggc tgtgcctgcc 88423 cgggtttaaa tagctttctt cagagctaag cctgaggacg agtcgacagc ccttctcttt 88483 ggggccagtt ggctgctcca gtttgcttcg actgccaggg ttggaggagg agagaaaacg 88543 gaacacgcca agtgctggcg tgggtgtgtt tgctggcagg cgctgccagt ccctgcgagg 88603 agcagaaggg agggacagct gtgtccccag ccagattctg gggggctcct cctgccgatc 88663 tggggataag agagcccgac cacgtcaggg ctgagtgtta agggggtgtc ctcctgagct 88723 tgggagcagg acatcctagc cagagatggg taccccgctt tccttcctct ctcccagaat 88783 tcctctggga cgccttctta ggtacagttt ggccccttgg atacccctcc cccttccagc 88843 caaaattccc ttctgcagaa acttgtttcg tgttctgggg gtgtaagggt gaggtcttcc 88903 tagaagggtg ttactggctt ttagcaaaga tagagctggt gattgtgagg tctcagccct 88963 gtggctatgc ctccctggac gcagccagga tatcctgccc accactccct gccccgcccc 89023 cctccaaaaa aaatccacac caaacattgg agtctcctct tgactttacc aacagaattc 89083 aagcttcaag ttatcaggga aggctttttt tttttttttt ttaatctttt gcccatacca 89143 ^•*^•758 Ιΐ98β7|| cacagcatgt gggatcttag ttccctgacc aggaatcgaa cctgcgcccc ctacattggc agtatggtct tatggaccac cagggaagtc ccagagaagt ttttgattaa agaggttcta ttgccttgcc ttctggaagg ctgagcccag atgagacccc tatccccagt catgtgtgct tggggaaggc agtgtcctgt tcatgctgtt ttagggggcc aggcaggcac ctgagaagtt gctagtggtc cagaagacct agaatccctt cagggaagcc tctaaccttt tttgaacacc tgggggagat cccacacctt gccttgcact tgggcatggg gtggccttta gctgctagcc cagaaagatg tctttatgtg agtaagaaaa atacagcccc tctgcgcaga catggcctgc cttaggactg aaggtttaga acacagaata caacccatgt atagccccct tggctgagtg cctttgtaca gtgatcaacc tggacaactg tactaggcag ccctgcaggg catgttcctg gatctttctt accttcttat gagtctcatt atttccaagt cctcattcct cagttaaagg acagtgttag ggaacaggag gaggaggagg aatctgtctc aggttctgct tccttgaggg tttgttacat gtgtctttct tgaaaaagca gtttcccctt ttcacttaaa aaaaaaatta attggaagct aattacttta cagtgttgtg gtgggttttg ccatacattc acatgaatca cccataggtg tacatgtgtt ccccatcctg accctccctc ccacctccct ccccaatccc atctctcagg gtcatcccag tgcaccagct ccgagcaccc tgcctcatgc attgaacctg gactggcgat ctgtttcaca tatgatagta tacatgtttc agtgctattc tctcaaatca tcccaccctt gccttctccc acagagtcca acagtctgtt ctttacatct gtgtctcttt tgctgtcttg catatagggt catcgttacc atctttctaa attacatata tatgggttaa tatactgtat tggtgttttt ctttctgact tacttcactc tgtataatag gctccagttt catccacctc attagaactg atcacttttg agcgaggctg tctccagtct tagttctttg gatccacatt gctgagaatc tgccctccac ccaccacccc gactgtcgcg tgctgcctgt atgtgggagt gtgggtcagc ggggggcact ggtcttgttc tgacaccata cccccaccac ctcccctcct tgctcctggc tggaatgtgg ctcagtgtgg gtagcctgag atcagtccca caggagagga gccgggagtt tcaccttccc cttggtcctg cccagagtgg agtttgattt ttccccaccc cgcagtgaag cagacctctg ggctttgtgc gcaaggtcca agcgggcagg ggttttgggg gttttccagc cacagctgct gggcaagaag gcatctctct ccattcttca aggcgaatga agatagaagg cttaggggga tgaaaagtta ccccagtttt tattatcaca gcttaccttt aatttttttt tttttgttgg agtatgattg ctttactatg ttgtgccagt atctgctgta caaccaagtg actcatctat atgcatgcat atatcccctc cctcctgagc t ccttccca cacccccatc tcacccgtct aggtcagcac agagccccga actgagctct ctgtgttatg cagcagcttc ccactggcta tctgttttac atatggcagt gcccacatcg gtcctggtgt cccagctcgg cccgccctcc ccttcccctg ggtccgcatg tctgctccct gcatctgctt ctctattctt gccctgcaaa tacgttcatc tgttccattt tttttctaga ttctacatac atgcgttcat atacgatatt tgtttttctc tctgacttac ttcactctgt ataaccagct ctaggtccat ccatgtctct ttaatttcat gaaatttcct taaattgtga aattaaaaaa aaaagtaaag ctagatgaac gacaccgagt tccctctcac ccagactcag cagcattaat tgttcacatc ttgtcccagt tctccatttc actgtgtgcc ctttgccccc accccaccaa gccccacagc ccctccccct atcccaagac agtcatttct aggaatttgg tgtgtgcctg ttttcccctt ctaaatctgt atccatgagc aacagatcag tttttgaaac atctctggag gacatgctat gtgaatcact ctgcagctgg ctttcccttt ctcgattttc .ytttgtgac agctgtgtag gttgactacc actttgcgac tctatgtttt tgatgcatta tgatatcagt ggacgtttag gcggtttcca attttcctgt gtcgacagta ttgcttatat aagccctgaa taccttgctc tgcccttttc tctgtattag gcgagtccct ttggacctca gtttccccat ctctaaaatg gggtgagggc agggcgggat ggtgtttcat gagatgggga gacccttgca gttgcggccc aggagtctgt aggtcactcc agtcttttct catctcaggc ttgattggtg gggactgctg atggggactc ccaggggggt ttccattctg gtggaggatg tgaaggggcg gggtgggttg tgggcggggc ttggcatggg cggggcttgg tggccggcct tagtgatgca gcgtgccctg ccttttctcc acagggttcc aaagatgcca tcagccagcc ctgtctggcc actcagccag accaacttcc cagcccctac accccgcttc ttcaggactc gctccgtgga cagcccacca gtcccaaagt ctgagccccc cacctcctgc acattgcacg cacgcacgcg cacacacaca cacacacaca catgcccctg gcacgtgtcc acacgtgtgc acaggtgtgt gcagatactc agggatggag ccgctgctga gagacttggg ggaaagactg gtcaacaagg gctgttctgg aaacttctct ccaagtaatc cacaggcctg accgtaggtg ctatgggcac ggggtcccct agcccaggct cttagtgact cacgtcacct ctccccagcg gcccgctcca tctgtgaaac actgcagccc cttcctggtg gctcatccat gcaggacagg gcatttgccc tgagaggccg ccactgtccc caaatccagc ctaggagtgc tgacttcttg tgcctgaacc tggtgggcaa ggttttgtgg ttcagcaccc agcccggacc aaagctgtag ccactggaca gccatctggg cctcagaaac ggagatgcat cctaaacccc ctgcaggatc atgggtttgg gtgtgcgggt cccttccctc cagcctaaac tgacatcatc ctgtatactg agctggtcac ttcctgactg gggtggcagg aagctgtgcc ctgagctgcc ccccaccaag 89203 89263 89323 89383 89443 89503 89563 89623 89683 89743 89803 89863 89923 89983 90043 90103 90163 90223 90283 90343 90403 90463 90523 90583 90643 90703 90763 90823 90883 90943 91003 91063 91123 91183 91243 91303 91363 91423 91483 91543 91603 91663 91723 91783 91843 91903 91963 92023 92083 92143 92203 92263 92323 92383 92443 92503 92563 92623 92683 92743 ftmm gtctgcagct ggtgtctggt tcttttctac ataaaccttt accaggtgcc caggagaccc tggaagaaaa ttaaaaagtg agggcagagg atctgtctgg actgaatatc a tagagaggct gactcctggt atcttttaaa ccgtctggga ctctgggaca aataattcac cgtcagcctg agcctctgtc aattgaagta 92803 92863 92923 92944 <210> 2 <211> 509 <212> PRT <213> Bos taurus <400> 2 Met 1 Gly Asn Leu Ser Arg Ala Arg Arg Val Thr Ala Ala Leu Gly Phe 5 10 15 lie Gly Leu Leu Phe Ala Val Leu Gly He He Met lie Val Met Val 20 25 30 Pro Ser lie He Lys Gin Gin Val Leu Lys Asn Val Arg lie Asp Pro 35 40 45 Asn Ser Leu Ser Phe Asn Met Trp Lys Glu He Pro Val Pro Phe Tyr 50 55 60 Leu Ser Val Tyr Phe Phe Asn lie Val Asn Pro Glu Gly lie He Gin 65 70 75 80 Gly Gin Lys Pro Gin Val Gin Glu His Gly Pro Tyr Val Tyr Arg Glu 85 90 95 Phe Arg His Lys Ser Asn lie Thr Phe Asn Asn Asn Asp Thr Val Ser 100 105 110 Phe Leu Glu Tyr Arg Ser Tyr Gin Phe Gin Pro Asp Lys Ser Arg Gly 115 120 125 Gin Glu Ser Asp Tyr lie Val Met Pro Asn He Leu Val Leu Ser Ala 130 135 140 Ser Met Met Met Glu Asn Arg Pro Gly Leu Leu Lys Leu Met Met Thr 145 150 155 160 Leu Ala Phe Ser Thr Leu Gly Gin Arg Ala Phe Met Asn Arg Thr Val 165 170 175 Gly Glu lie Met Trp Gly Tyr Asp Asp Pro Leu He His Leu He Asn 180 185 190 Gin Tyr Phe Pro Asn Ser Leu Pro Phe Lys Gly Lys Phe Gly Leu Phe 195 200 205 Ala Glu Leu Asn Asn Ser Asp Ser Gly Leu Phe Thr Val Phe Thr Gly 210 215 220 Val Lys Asn Phe Ser Arg lie His Leu Val Asp Lys Trp Asn Gly Val 225 230 235 240 Ser Lys Val Asn Tyr Trp His Ser Asp Gin Cys Asn Met lie Asn Gly 245 250 255 Thr Ser Gly Gin Met Trp Ala Pro Phe Met Thr Pro Glu Ser Ser Leu 260 265 270 iltl 7 8 6 Glu Phe Tyr 275 Ser Pro Glu Ala Cys 280 Glu Gin Gly 290 Val Phe Gly Gly lie 295 Ser 305 Thr Leu Phe Ala Asn Gly Ser 310 Cys Pro Cys Arg Glu Ser Gly lie 325 Asn Ala Pro Leu 340 Phe Leu Ser His Val Leu Ala 355 Glu Ala Val Ser Gly 360 Ser Leu Phe 370 Leu Asp lie His Pro 375 ;) c r 385 Val Lys Leu Gin Leu Ser Leu 390 Gly Gin Thr Gly Asn lie Gin Pro 405 Glu Glu Ser Gly 420 Ala Met Glu Gly Gin Leu Val 435 Leu Met Pro Lys Val 440 Leu Ala Leu 450 Gly Cys Val Leu Leu 455 Arg 4 65 Ser Gin Glu Lys Cys Tyr Leu 470 Ser Lys Asp Lys Glu Ala Val Gin 485 Ser Ala Pro Lys Gly Thr Val Leu 500 Wo 807H Arg Ser Met Lys Leu 285 Val Tyr Lys Pro Thr Phe Arg 300 Phe Val Ala Pro Val Tyr Pro 315 Pro Asn Glu Gly Phe 320 Gin Asn 330 Val Ser Thr Cys Arg 335 Phe Pro 345 His Phe Tyr Asn Ala 350 Asp Pro Leu His Pro Asn Pro 365 Lys Glu His Val Thr Gly He 380 Pro Met Asn Cys Phe Val Lys 395 Ser Val Lys Gly lie 400 Val Val 410 Leu Pro Leu Met Trp 415 Phe Glu 425 Thr Leu Glu Thr Phe 430 Tyr lie Leu His Tyr Ala Gin 445 Tyr Val Leu Leu lie Pro He 460 lie Tyr Gin He Phe Trp lie 475 Ser Phe Lys Lys Gly 480 Ala Tyr 490 Ser Glu Phe Leu Met 495 Thr Gin Glu Ala Arg Leu 505 <210> 3 <211> 1530 <212> DNA <213> Bos taurus <221> CDS <222> (1) .. .(1530) <400> : 3 atg ggc aac etc tet aga geg ege Met Gly Asn Leu Ser Arg Ala Arg 1 5 ate ggg etc etc ttc gcc gtg ctg He Gly Leu Leu Phe Ala Val Leu egg Arg gtg acc geg geg ctg ggt Val Thr Ala Ala Leu Gly ttc Phe 10 15 ggc att ate atg ate gtg atg gtg Gly lie He Met lie Val Met Val 25 30 ICO 8 Ο 7 : 7 86 ccc tea ate ate aag cag Gin cag Gin gtc etc aag aat gtg ege ate gac ccc 144 Pro Ser lie 35 lie Lys Val 40 Leu Lys Asn Val Arg lie 45 Asp Pro aac age ctg tet ttc aac atg tgg aag gaa ate cct gtc ccc ttc tac 192 Asn Ser Leu Ser Phe Asn Met Trp Lys Glu lie Pro Val Pro Phe Tyr 50 55 60 etc tet gtc tac ttt ttc aac ate gtc aac cct gag ggg ate ate caa 240 Leu Ser Val Tyr Phe Phe Asn He Val Asn Pro Glu Gly He He Gin 65 70 75 80 ggc cag aag cca cag gtg cag gag cac ggg cct tat gtg tac agg gag 288 Gly Gin Lys Pro Gin Val Gin Glu His Gly Pro Tyr Val Tyr Arg Glu 85 90 95 ttc agg cac aag age aac ate acc ttc aac aac aat gac aeg gtg tee 336 Phe Arg His Lys Ser Asn He Thr Phe Asn Asn Asn Asp Thr Val Ser 100 105 110 ttc ctg gag tac ege age tac cag ttc cag ccg gat aag tee ege ggc 384 Phe Leu Glu Tyr Arg Ser Tyr Gin Phe Gin Pro Asp Lys Ser Arg Gly 115 120 125 cag gag age gac tac ate gtc atg ccc aac ate ctg gtc ttg agt geg 432 Gin Glu Ser Asp Tyr He Val Met Pro Asn lie Leu Val Leu Ser Ala 130 135 140 L C a atg atg atg gag aac agg ccc ggg etc ttg aag ctg atg atg acc 480 Ser Met Met Met Glu Asn Arg Pro Gly Leu Leu Lys Leu Met Met Thr 145 150 155 160 ttg geg ttc age aeg ett ggc cag cgt gee ttc atg aac ege act gtt 528 Leu Ala Phe Ser Thr Leu Gly Gin Arg Ala Phe Met Asn Arg Thr Val 165 170 175 ggc gag ate atg tgg ggc tat gat gac ccc tta ate cac etc ate aat 576 Gly Glu lie Met Trp Gly Tyr Asp Asp Pro Leu lie His Leu lie Asn 180 185 190 cag tac ttc cca aac teg etc ccc ttc aag ggc aag ttc ggc tta ttt 624 Gin Tyr Phe Pro Asn Ser Leu Pro Phe Lys Gly Lys Phe Gly Leu Phe 195 200 205 get gag etc aac aac tee gat tet ggc etc ttc acc gtg ttc aca ggg 672 Ala Glu Leu Asn Asn Ser Asp Ser Gly Leu Phe Thr Val Phe Thr Gly 210 215 220 gtc aaa aac ttc age agg ate cat etc gtg gac aag tgg aat gga gtc 720 Val Lys Asn Phe Ser Arg lie His Leu Val Asp Lys Trp Asn Gly Val 225 230 235 240 age aag gtc aac tat tgg cat tee gat cag tgc aac atg att aac gga 768 Ser Lys Val Asn Tyr Trp His Ser Asp Gin Cys Asn Met lie Asn Gly 245 250 255 act tee ggg cag atg tgg gca cca ttt atg acc cct gaa tee teg ctg 816 Thr Ser Gly Gin Met Trp Ala Pro Phe Met Thr Pro Glu Ser Ser Leu 260 265 270 6 »8 0781 gaa Glu ttt tac Phe Tyr 275 age Ser cct Pro gag gcc tgc egg tcc atg aag etc gtc tac aag 864 Glu Ala Cys 280 Arg Ser Met Lys Leu 285 Val Tyr Lys gag cag ggg gtg ttt gga ggc ate ccc acc ttt cgc ttc gtg get ccc 912 31«; Gin Gly Val Phe Gly Gly He Pro Thr Phe Arg Phe Val Ala Pro 290 295 300 age acc tta ttt gcc aac ggg tcc gtc tac ccg ccc aac gag ggc ttc 960 Ser Thr Leu Phe Ala Asn Gly Ser Val Tyr Pro Pro Asn Glu Gly Phe 305 310 315 320 tgc ccc tgc egg gag tcc gga ate caa aac gtc age acc tgc agg ttc 1008 Cys Pro Cys Arg Glu Ser Gly He Gin Asn Val Ser Thr Cys Arg Phe 325 330 335 aat geg ccc ttg ttt etc tcc cat cct cac ttc tac aac get gac cca 1056 Asn Ala Pro Leu Phe Leu Ser His Pro His Phe Tyr Asn Ala Asp Pro 340 345 350 c : ; - ct.q gca gag gca gtg tct ggc etc cat cct aac cca aaa gaa cat 1104 Val Leu Ala Glu Ala Val Ser Gly Leu His Pro Asn Pro Lys Glu His 355 360 365 tee ttg ttc ctg gac ate cac ccg gtc acc gga ate ccc atg aac tgc 1152 Ser Leu Phe Leu Asp He His Pro Val Thr Gly He Pro Met Asn Cys 370 375 380 tct gtg aaa ctg cag ctg age etc ttc gtt aag tct gtg aaa ggc ate 1200 Ser Val Lys Leu Gin Leu Ser Leu Phe Val Lys Ser Val Lys Gly He 385 390 395 400 gga caa act ggg aac ate cag cca gtg gtc ctg ccg eta atg tgg ttc 1248 Gly Gin Thr Gly Asn lie Gin Pro Val Val Leu Pro Leu Met Trp Phe 405 410 415 gaa gag agt gga gca atg gag ggt gag acc ctt gag aeg ttc tat ate 1296 Glu Glu Ser Gly Ala Met Glu Gly Glu Thr Leu Glu Thr Phe Tyr lie 420 425 430 cag ctg gtg ttg atg ccc aaa gtg eta cac tat gcc cag tat gtg etc 1344 Gin Leu Val Leu Met Pro Lys Val Leu His Tyr Ala Gin Tyr Val Leu 435 440 445 ctt gcc ctg ggc tgc gtc eta ctg etc ate ccc ate ate tac caa ate 1392 Leu Ala Leu Gly Cys Val Leu Leu Leu He Pro He lie Tyr Gin lie 450 455 460 egg age caa gag aaa tgc tat tta ttt tgg att agt ttt aaa aag ggc 1440 Arg Ser Gin Glu Lys Cys Tyr Leu Phe Trp He Ser Phe Lys Lys Gly '.65 470 475 480 tea aag gat aag gag gcc gtt cag gcc tat tct gaa ttc ctg atg aca 1488 Ser Lys Asp Lys Glu Ala Val Gin Ala Tyr Ser Glu Phe Leu Met Thr 485 490 495 tea get ccc aag gga act gta ctg caa gaa gca aga ctg tag 1530 Ser Ala Pro Lys Gly Thr Val Leu Gin Glu Ala Arg Leu 500 505 786 <23O> 4 <211> 509 <212> PRT <213> Bos taurus <400> 4 1!-y As:. Leu Ser 5 Arg Ala Arg Arg Val Thr Ala Ala Leu Gly 10 15 lie Gly Leu Leu Phe Ala Val Leu Gly lie lie Met lie Val Met 20 25 30 Pro Ser lie lie Lys Gin Gin Val Leu Lys Asn Val Arg lie Asp 35 40 45 Asn Ser Leu Ser Phe Asn Met Trp Lys Glu lie Pro Val Pro Phe 50 55 60 '. c ; Ser Val Tyr Phe Phe Asn lie Val Asn Pro Glu Gly lie lie 65 70 75 Gly Gin Lys Pro Gin Val Gin Glu His Gly Pro Tyr Val Tyr Arg 85 90 95 Phe Arg His Lys Ser Asn He Thr Phe Asn Asn Asn Asp Thr Val 100 105 110 Phe Leu Glu Tyr Arg Ser Tyr Gin Phe Gin Pro Asp Lys Ser Arg 115 120 125 Gin Glu Ser Asp Tyr He Val Met Pro Asn He Leu Val Leu Ser 130 135 140 Ser Met Met Met Glu Asn Arg Pro Gly Leu Leu Lys Leu Met Met 145 150 155 Leu Ala Phe Ser Thr Leu Gly Gin Arg Ala Phe Met Asn Arg Thr 165 170 175 Gly Glu He Met Trp Gly Tyr Asp Asp Pro Leu He His Leu lie 180 185 190 Gin Tyr Phe Pro Asn Ser Leu Pro Phe Lys Gly Lys Phe Gly Leu 195 200 205 Ala Glu Leu Asn Asn Ser Asp Ser Gly Leu Phe Thr Val Phe Thr 210 215 220 Val Lys Asn Phe Ser Arg lie His Leu Val Asp Lys Trp Asn Gly 225 230 235 Ser Lys Va 1 Asn Tyr Trp His Ser Asp Gin Cys Asn Met He Asn 245 250 255 Thr Ser Gly Gin Met Trp Ala Pro Phe Met Thr Pro Glu Ser Ser 260 265 270 Glu Phe Tyr Ser Pro Glu Ala Cys Arg Ser Met Lys Leu Val Tyr 275 280 285 Phe Val Pro Tyr Gin Glu Ser Gly Ala Thr 160 Val Asn Phe Gly Val 240 Gly Leu Lys Glu Gin 290 Gly Val Phe Gly Gly 295 lie Pro Thr Phe Arg Phe 300 Val Ala Pro : e r Thr Leu Phe Ala Asn Gly Ser Val Tyr Pro Pro Asn Glu Gly Phe 305 310 315 320 Cys Pro Cys Arg Glu Ser Gly He Gin Asn Val Ser Thr Cys Arg Phe 325 330 335 Asn Ala Pro Leu Phe Leu Ser His Pro His Phe Tyr Asn Ala Asp Pro 340 345 350 Val Leu Ala Glu Ala Val Ser Gly Leu His Pro Asn Pro Lys Glu His 355 360 365 Ser Leu Phe Leu Asp lie His Pro Val Thr Gly He Pro Met Asn Cys 370 375 380 Ser Val Lys Leu Gin Leu Ser Leu Phe Val Lys Ser Val Lys Gly He 385 390 395 400 Gly Gin Thr Gly Asn He Gin Pro Val Val Leu Pro Leu Met Trp Phe 405 410 415 Glu Glu Ser Gly Ala Met Glu Gly Glu Thr Leu Glu Thr Phe Tyr He 420 425 430 Gin Leu Va 1 I al Met Pro Lys Val Leu His Tyr Ala Gin Tyr Val Leu 4 35 440 445 Leu Ala Leu Gly Cys Val Leu Leu Leu He Pro He lie Tyr Gin lie 450 455 460 Arg Ser Gin Glu Lys Cys Tyr Leu Phe Trp lie Ser Phe Lys Lys Gly 465 470 475 480 Ser Lys Asp Lys Glu Ala Val Gin Ala Tyr Ser Glu Phe Leu Met Thr 485 490 495 Ser Ala Pro Lys Gly Thr Val Leu Gin Glu Ala Arg Leu <210> 5 3 u 5 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 5 gcacaggccc atgttttact <210> 6 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 6 gtgatagagg cagcgactcc <210> 7 <211> 10 β ft Π 7 <212> DNA <213> Artificial <223> Synthetic <400> 7 gcacaggccc <210> 8 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 8 ctcctcaccg cttcattcta aactgtt <210> 9 <211> 22 <212> DNA <213> Artificial <223> Synthetic <400> 9 agtctcaagc actggagcac eg <210> 10 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 10 aactctggag cagcatgtgt caacagc <210> 11 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 11 actccaggaa ggacaccgtg tcattgt <210> 12 <211> 25 <212> DNA <213> Artificial <223> Synthetic <400> 12 ctggagaagg aaatggcaac ctaat <210> 13 <211> 25 <212> DNA <213> Artificial <223> Synthetic <400> 13 aacttctcac tgggccacac ttacc <210> 14 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 14 •Β : β6 ιίΟ 8 0781 agggatcctt ctaggcctga ccacgtc 27 <210> <211> <212> <213> <223> <400> 15 27 DNA Artificial Synthetic 15 gctacacagg agatcctcgt tggttgt 27 <210> <211> <212> <213> <223> <400> 16 23 DNA Artificial Synthetic 16 tgactcccca tgtcctttac etc 23 <210> <211> <212> <213> <223> <400> 17 26 DNA Artificial Synthetic 17 gccacttggt tcagctctga gcatcc 26 <210> <211> <212> <213> <223> <400> 18 27 DNA Artificial Synthetic 18 gggcagtgtc caagtcttta tgagttc 27 <210> <211> <212> <213> <223> <400> 19 23 DNA Artificial Synthetic 19 cagcaacaga tacacacggc aca 23 <210> <211> <212> <213> <223> <400> 20 27 DNA Artificial Synthetic 20 gtggtggagg cagggagaca cataagg 27 <210> <211> <212> <213> <223> <400> 21 27 DNA Artificial Synthetic 21 cctggcaggg agaggagaaa gttgagt 27 <210> 22 <211> 27 80799 <212> DNA <213> Artificial <223> Synthetic <400> 22 gcttggtaaa taatcacaca ccgaatg <210> 23 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 23 aaatcccaca tccctcccca gacttga <210> 24 <211> 24 <212> DNA <213> Artificial <223> Synthetic <400> 24 gaccagggag agggggatta gaag <210> 25 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 25 tgaggcatca gacacatgac cacaagt <210> 26 <211> 26 <212> DNA <213> Artificial <223> Synthetic <400> 26 ccacattgtt tgttagctgg gtacat <210> 27 <211> 23 <212> DNA <213> Artificial <223> Synthetic <400> 27 cactgttgta cgcgctgtac ctg <210> 28 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 28 tgttgtgtgg ccctggagga catagag <210> 29 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 29 ΙΪΦ 8 Ο 7 β β aagcctttaa gggtgccaga gttctac <210> 30 <211> 22 <212> DNA <213> Artificial <223> Synthetic <400> 30 tcttgggtga agggcactat ca <210> 31 <211> 23 <212> DNA <213> Artificial <223> Synthetic <400> 31 gccacagtcc ataggatcgc aca <210> 32 <211> 27 <212> DNA <213> Artificial <223> Synthetic <400> 32 tcttttctca tctcaggctt gattggt <210> 33 <211> 21 <212> DNA <213> Artificial <223> Synthetic <400> 33 gtcaacccag gagccaccga t <210> 34 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 34 cccataaaca ggctgttaca <210> 35 <211> 19 <212> DNA <213> Artificial <223> Synthetic <400> 35 catctcaggc ttgattggt <210> 36 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 36 gggaatttat tacgacagca <210> 37 <211> 20 1080789 <212> DNA <213> Artificial <223> Synthetic <400> 37 gcagggagac acataaggag <210> 38 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 38 aacgccctcc agcctcggac 20 <210> 39 <211> 19 <212> DNA <213> Artificial <223> Synthetic <400> 39 cgccccttcg cccatgctc 19 <210> 40 <211> 18 <212> DNA <213> Artificial <223> Synthetic <400> 40 ccttgcccat agtcagag 18 <210> 41 <211> 20 <212> DNA <213> Artificial <223> Synthetic <400> 41 ccttttggag ccttgtggta 20 <210> 42 <211> 18 <212> DNA <213> Artificial <223> Synthetic <400> 42 tggtgccctc aatcatca 18 <210> 43 <211> 22 <212> DNA <213> Artificial <223> Synthetic <400> 43 catgttgaaa gacaggctgt tg 22 <210> 44 <211> 74 <212> DNA <213> Artificial <223> Synthetic <400> 44 1ΐ0 9ό78β »0 8 071« tggtgccctc aatcatcaag cagcaggtcc tcaagaatgt gcgcatcgac cccaacagcc tgtctttcaa catg

Claims (25)

1. A method of determining genetic merit of a bovine with respect to milk or tissue colour or β-carotene content or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, which comprises the step of determining the SCARB1 allelic profile of said bovine, and determining the genetic merit of the bovine on the basis of the SCARB1 allelic profile.

2. A method as claimed in claim 1, wherein the milk β-carotene content is milk fat βcarotene content.

3. A method as claimed in claim 1, wherein the allelic profile is determined with respect to DNA, mRNA and/or protein obtained from said bovine.

4. A method as claimed in claim 1, wherein the allelic profile is determined by determining the presence or absence of the C allele at the C-321G promoter polymorphism of the bovine SCARB1 gene.

5. A method as claimed in claim 1, wherein the allelic profile is determined by determining the presence or absence of the G allele at the C-321G promoter polymorphism of the bovine SCARB1 gene.

6. A method as claimed in claim 4 or claim 5 wherein the allelic profile of the C-321G promoter polymorphism in the SCARB1 gene is determined by the use of one or more polymorphisms in linkage disequilibrium with this polymorphism.

7. A method as claimed in claim 1 wherein the allelic profile is determined by determining the expression or activity of a SC ARBI gene or gene product.

8. A method of identifying or selecting a bovine having a desired SC ARB 1 allelic profile comprising determining the allelic profile according to the method of any one of claims 1 to 7 and identifying or selecting said bovine on the basis of the determination.

9. A bovine selected by the method of claim 8.

10. A method of determining genetic merit of a bovine with respect to milk or tissue colour or β-carotene content, or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, the method comprising providing data about the SC ARBI allelic profile of said bovine, and determining the genetic merit of the bovine on the basis of the data.

»0 8 07 8 «

11.

12.

13.

14.

15.

16.

17.

A method for identifying or selecting a bovine with respect to milk or tissue colour or β-carotene content, or with respect to capability of producing progeny that will have one or more desired milk or tissue colour or β-carotene content traits, the method comprising providing data about the SCARBI allelic profile of said bovine, and identifying or selecting the bovine on the basis of the data.

A method as claimed in claim 10 or 11, wherein the the SCARBI allelic profile comprises data indicative of the presence or absence of one or more alleles at one or more polymorphisms which affect expression from the SCARBI gene or the expression or activity of a SCARBI gene product or which are associated with increased or decreased expression from the SCARBI gene or with increased or decreased expression or activity of a SCARBI gene product, or one or more polymorphisms in linkage disequilibrium with one or more of said polymorphisms.

A method as claimed in claim 12, wherein the one or more polymorphisms is in the SCARBI gene.

A method as claimed in claim 12 or claim 13, wherein the one or more polymorphisms is one or more polymorphisms selected from the group comprising the C-321G promoter polymorphism in the SCARBI gene, or one or more polymorphisms which are in linkage disequilibrium with the C-321G promoter polymorphism in the SCARBI gene.

A method as claimed in any one of claims 10 to 14, wherein the milk or tissue colour or β-carotene content is increased milk colour or increased milk β-carotene content.

A method as claimed in any one of claims 10 to 14, wherein the milk or tissue colour or β-carotene content is increased tissue colour or increased tissue β-carotene content.

A method as claimed in claim 15 or claim 16 comprising determining (a) the presence of the C allele at the C-321G promoter polymorphism in the SCARBI gene, or (b) the absence of the G allele at the C-321G promoter polymorphism in the SCARBI gene, or (c) both (a) and (b), and identifying or selecting the bovine on the basis of the determination.

Κθ 8 0 786

Κο β07Μ

18. A method as claimed in any one of claims 10 to 14, wherein the milk or tissue colour or β-carotene content is decreased milk colour or decreased milk β-carotene content.

19. A method as claimed in any one of claims 10 to 14, wherein the milk or tissue colour or β-carotene content is decreased tissue colour or decreased tissue β-carotene

5 content.

20. A method as claimed in claim 18 or claim 19 comprising determining (a) the absence of the C allele at the C-321G promoter polymorphism in the SC ARBI gene, or (b) the presence of the G allele at the C-321G promoter polymorphism in the

10 SC ARBI gene, or (c) both (a) and (b), and identifying or selecting the bovine on the basis of the determination.

21. A method as claimed in claim 14, further comprising the step of amplifying at least a fragment of the bovine SCARB1 gene sequence to determine the presence or absence

15 of one or more polymorphisms associated with increased or decreased expression or activity of a SC ARBI gene product.

22. A method as claimed in claim 21, wherein the primers used in the amplification are selected from the group consisting of SEQ ID NOs: 5 to 44.

23. A method as claimed in claim 12 or claim 13 wherein the presence or absence of one

20 or more polymorphisms associated with increased or decreased expression or activity of SCARB1 gene product is determined by determining the expression or activity of a SCARB1 gene or gene product.

24. A probe or primer comprising a nucleotide sequence having about at least 12 contiguous bases of SEQ ID NO: 1 or SEQ ID NO: 3.

25. 25. The probe or primer of claim 24 comprising a cytosine at the position corresponding to the C-321G promoter polymorphism in the SCARB1 gene, or comprising a nucleotide capable of hybridising to a cytosine at the position corresponding to the C-321G promoter polymorphism in the SCARB1 gene.

26. The probe or primer of claim 24 comprising a guanine at the position corresponding

27. 30 to the C-321G promoter polymorphism in the SCARB1 gene, or comprising a nucleotide capable of hybridising to a guanine at the position corresponding to the C321G promoter polymorphism in the SCARB 1 gene.

Kyo7ll

A probe or primer having about at least 12 contiguous bases of one of SEQ ID NOs: 5-44.

A probe or primer as claimed in claim 24 comprising a nucleotide sequence having at least about 12 contiguous bases of SEQ ID NO: 1 or SEQ ID NO: 3 wherein the about 12 contiguous bases comprise or are within about 1 to about 2000 nucleotides of the C-321G promoter polymorphism in the SCARB1 gene.

A pair of primers comprising two primers as claimed in claim 28.

A bovine identified by the method of any one of claims 11 to 23.

A bovine as claimed in claim 9 or 30, wherein the bovine is a bull.

Collected semen produced by a bovine as claimed in claim 31.

A bovine as claimed in claim 9 or 30, wherein the bovine is a cow.

A method of selecting a herd of bovine, comprising selecting individuals by the method of any one of claims 8 or 11 to 23, and segregating and collecting the selected individuals to form the herd.

A herd of bovine selected by the method of claim 34.

A herd of bovine comprising two or more bovine, wherein the bovine are the progeny of one or more bovine selected by the method of any one of claims 8 or 11 to 23.

Collected or pooled milk produced by bovine as claimed in claim 33.

Collected or pooled milk produced by bovine as claimed in claim 35.

Collected or pooled milk as claimed in claim 37 or 38 having increased or decreased milk colour or increased or decreased β-carotene content when compared to milk produced by a bovine having a SC ARBI gene comprising the nucleotide sequence of SEQ ID NO: 1.

A dairy product made from the milk as claimed in any one of claims 37 to 39.

A kit for genotyping a bovine with respect to one or more milk or tissue colour or βcarotene content traits, comprising a probe or primer as defined in any one of claims 24 to 28 or a pair of primers as defined in claim 29.

An isolated, purified or recombinant nucleic acid molecule comprising nucleotide sequence selected from (a) at least 12 contiguous nucleotides of SEQ ID NO: 1 and comprising the C-321G promoter polymorphism; or (b) any one or more of SEQ ID NOs:5-44; or :0 δ Π

43. 5 44.

15 45.

46.

47.

48.

49.

25 50.

51.

(c) a complement of (a) or (b); or »080780 (d) a sequence of at least 12 contiguous nucleotides and capable of hybridising to the nucleotide sequence of any one of (a) to (c) under stringent conditions.

A vector comprising the nucleic acid of claim 42.

A method of determining genetic merit of a bovine with respect to milk or tissue colour or β-carotene content, or with respect to capability of producing progeny that will have increased or decreased milk or tissue colour or β-carotene content, the method comprising determining milk or tissue colour or β-carotene content of the bovine, determining the SCARB1 allelic profile of the bovine, comparing the SC ARBI allelic profile of the bovine or the milk or tissue colour or β-carotene content of the bovine with that of a bovine having a known SCARB1 allelic profile;

determining the genetic merit of the bovine on the basis of the comparison.

A method substantially as hereinbefore described with reference to the accompanying examples and drawings.

A bovine substantially as hereinbefore described with reference to the accompanying examples and drawings.

A probe or primer substantially as hereinbefore described with reference to the accompanying examples and drawings.

A pair of primers substantially as hereinbefore described with reference to the accompanying examples and drawings.

Collected semen substantially as hereinbefore described with reference to the accompanying examples and drawings.

A herd of bovine substantially as hereinbefore described with reference to the accompanying examples and drawings.

Collected or pooled milk substantially as hereinbefore described with reference to the accompanying examples and drawings.

A dairy product substantially as hereinbefore described with reference to the accompanying examples and drawings.

A kit substantially as hereinbefore described with reference to the accompanying examples and drawings.

52.

53.

ΙΕΟ 8 07 8 9

100

54,

An isolated, purified or recombinant nucleic acid molecule substantially as hereinbefore described with reference to the accompanying examples and drawings.

A vector substantially as hereinbefore described with reference to the accompanying examples and drawings.