HUT76558A - Prostate tumor suppressor gene located on human chromosome - Google Patents

Abstract

The present invention relates to a novel nucleic acid molecule encoding a prostate / colon tumor suppressor gene product. Other objects of the invention are means and methods for detecting mutations and / or allele losses of the prostate / colon tumor suppressor gene; methods for suppressing the tumor phenotype of cancer cells showing abnormalities in the prostate / colon tumor suppressor gene product; and devices and methods for treating cancer by administering a prostate / counter-tumor suppressor gene. bite. OvÁvec 55 11541 KO

Description

Novel prostate / colon tumor suppressor gene located on human chromosome 8

BACKGROUND OF THE INVENTION The present invention relates to products and methods for practicing broad-spectrum tumor suppressor gene therapy of a wide variety of human cancers generally in the field of tumor suppressor genes (anti-oncogenes). More particularly, the present invention relates to methods for treating tumor cells comprising (1) administering vectors comprising a nucleic acid sequence encoding novel proteins (hereinafter referred to as prostate tumor suppressor gene products (PTSG products)); or (2) administering an effective amount of a protein encoded by the nucleic acid sequence. The present invention further relates to certain cancers, such as diagnosis of prostate and colon cancer using the cloned nucleic acids of the invention.

Cancers and tumors are considered to be the second most common cause of death in the United States; they cause 547,000 deaths a year. One in three Americans develops cancer and one in five dies (Scientific American Medicine, Volume 12, Section I, 1987). While significant progress has been made in identifying the likely environmental and hereditary causes of cancer, statistics on the incidence of cancer deaths indicate the need for significant improvements in the treatment of cancer and related diseases.

11541 KO

Many hereditary forms of cancer have been associated with hereditary forms of cancer and numerous tumor cells studied in detail. cancer genes, which are genes that play a role in the etiology of cancer. Studying cancer genes has helped to provide some understanding of the process of tumor formation. Although not much is known about cancer genes, known cancer genes provide a useful model for understanding tumor formation.

Cancer genes are generally classified as oncogenes (which, when activated, promote tumor formation) and tumor suppressor genes (which, when damaged, are unable to inhibit tumor formation). While this categorization provides a useful way of understanding tumor formation, it is also possible to play a different role depending on the allele shape, regulatory elements, genetic background and tissue environment (in which it operates) of a particular gene.

One of the most widespread working hypotheses for cancer is: (1) most human cancers are genetic diseases; and (2) the expression of specific genes for these diseases (i.e., mutant variants of genes regulating normal cellular growth, or viral or other foreign genes present in mammalian cells that cause inadequate, inappropriate, or abnormal expression of other groups of vital growth regulating genes); / or due to an error in their expression.

According to the simplified view of the biological basis of neoplasia, cancer has two major groups. The first group includes mutated or otherwise abnormal alleles of normal cellular genes involved in cell growth or replication. These genes are cellular protooncogenes and, through their mutation, encode new cellular functions that impair normal cellular growth and replication. The consequence of these changes is the development of dominantly expressed tumor phenotypes. In this model of predominantly expressed oncogenes, which has been prevalent since the emergence of the concept of understanding tumorigenesis on the basis of genetics and mutations, the notion that survival of a single wild-type allele is not sufficient to prevent cancerous changes in cellular development or growth characteristics. Therefore, the genetic events responsible for the activation of such oncogenes can be considered as co-occurring phenomena. In Burkittlymphoma, activation of the tumor-forming activity of the gingiva, expression of the bcr-abl chimeric gene product in patients with chronic bone marrow leukemia, and activation of the H-ras and K-jras oncogenes in other tumors play such a transformative role. One approach to the genetic-based treatment of a dominantly expressed tumor-forming disease would presumably be to specifically stop or inactivate the responsible gene.

Tumor suppressor genes

The newly discovered family of cancer-related genes is called the so-called. tumor suppressor genes, sometimes referred to as anioncogens, growth suppressors, or cancer suppressors. Recent research strongly suggests that this group of genes is likely to play a role in the development of a large proportion of human cancers - more than a dozen human tumor suppressor gene candidates have been identified in several human cancers. Tumor suppressor cells involved in the pathogenesis of retinoblastoma (RB) (ophthalmic neoplasm), breast and other cancers (p53), Wilms tumors (wt 1, 2) and colon cancer (DCC) have been identified and cloned. Some aspects of their role in human tumor formation have been understood.

The retinoblastoma gene (RB) is a prototype of tumor suppressors. The RB gene encodes a nuclear protein that is phosphorylated on its serine and threonine radicals in a cell cycle-dependent manner (Lee et al., Natur. 329: 642-645, 1987; Buchkovich et al., Cell, S, 1097-1105, 1989 Chen et al., 1989, Cell 58: 1193-1198; DeCaprio et al., Cell 58: 1085-1095 (1989). The molecular mechanisms by which RB is involved in these cellular functions are not fully understood. In a current model, RB interacts with many different cellular proteins and functions through complexes with them. If the function of the RB protein is to keep cells in the G0 / G1 phase, the RB protein must inactivate and control other proteins that are essential and active for the GI phase (Lee et al., CSHSOB, LVI. 211 -217 (1991). This controlling hypothesis is in good agreement with recent observations that RB, in a negative way, strictly regulates one of the essential growth enhancing transcription factors, E2F-1 (Helin et al., Cell, 70, 337-350). , 1992; Kaelin et al., Cell,

70. 351-364, 1992; Shan et al., Mole. Cell. Biol., 12.

5620-5631, 1992; Helin et al., Mole. Cell. Biol., 13.

6501-6508, 1993; Shan et al., Mole. Cell. Biol., 14.

229-309, 1994). The protein of the present invention, PTSG, binds to the Rb protein and is thus involved in the regulation of mitosis.

The hereditary breast cancer gene (BRCA-1) was mapped by linkage analysis on the q21-22 region of chromosome 17. It is unclear whether this gene acts as a tumor suppressor or dominant oncogene.

The gene involved in hereditary human cancers (such as Li-Fraumen syndrome, p53) acts as a classical tumor suppressor; similarly, lack of the RB gene is associated with hereditary retinoblastoma (Knudson, 1993, p.

above).

complex steps and oncogenic collaboration

There are a number of additional mechanisms between the transforming oncogenes and the two extremes of purely recessive tumor suppressor genes, which obviously play a role in the development of cancerous changes in many human tumors. For a long time, it has been speculated that most human cancers are likely to result from complex, interrelated genetic defects, none of which are sufficient in themselves for the development of the tumor, which requires the combined presence of all of them. It is believed that the true role of cellular protooncogenes and growth regulator tumor suppressor genes in the formation of tumors in mammalian cells is to represent the complex integrity of the interactions between the two types of genes.

One current theory of cancer formation is that some tumorous diseases, such as in prostate adenocarcinoma, tumorigenesis occurs through the selection of several genetic alterations, each of which modifies the expression or function of genes controlling cell growth or differentiation (Nowell, PC, Science, 194, 23-28, 1976; Weinberg, Ε, Cancer Rés. , 42, 3713-3721, 1989). Although prostate adenocarcinoma is the first malignancy in males, second in mortality (Coffey, D.S., 71, 880-886, 1993), little is known about the molecular basis of this general disease. For example, genetic alterations in colorectal cancer have been extensively studied, and a model has been developed in which activation of oncogenes and decreased function of tumor suppressor genes correlated with progressive clinical and histological changes in colorectal , Β., Cell, 61. 759-767, 1990). Similar progressive genetic alteration processes have been suggested for prostate cancer (Isaacs, WB and Carter, BS, Cancer Surveeys, Vol. 11, pp. 15-24, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1991), but the exact location and mechanism of the underlying genetic transformation remains unknown.

1632-1637 _;

3369-3373, 1993)

It has been shown that it is not the known cancer genes that are primarily responsible for prostate cancer. Mutations of cancer genes (e.g., ras oncogenes or the p53 tumor suppressor gene) in early prostate tumors have only been detected at a low frequency (below 10%) (Carter et al., Proc. Natl. Acad. Sci. USA 87: 8751-8755, 1990). Gumerlock et al., Cancer Slit, 51,

1991; Bookstein et al., Cancer Sl., 53.

however, mutations in the latter gene have been detected in 20-25% of late-stage primary tumors, suggesting that the p53 gene may be involved in one of several alternative pathways for the development of prostate cancer (Bookstein et al.,

Cancer Res., 52, 3369-3373, 1993).

• "·· * ·· • ^·. · .. · • ·. * ···

Genetic mechanisms responsible for allele typing to detect prostate cancer have also been used and have been used to karyotype tumor cells. Cytogenetic studies of short-term cultures of primary prostate cancers have revealed more chromosomal abnormalities, such as. deletions of the lp, 7q, or 10q chromosomes (Atkin, NB and Baker, MC, Hume Gene, ZQ., 359-364, 1985; Gibas et al., Cancer Gene, C16, 301-304, 1985). Lundgren et al.,

Genes Chrom. Cancer, 4, 16-24, 1992), while the study of allele loss suggested slightly different sets of frequently lost chromosomal regions. Carter et al. (Proc. Natl.

Acad. Sci. USA 87: 8751-8755 (1990) was the first to report the presence of 10q and 16q chromosomes in about 28 tumors. 30% of non-accidental loss, while Kunimi et al.

(Genomics, H, 530-536, 1991) showed loss of the same regions as well as the p arm of chromosomes 8 and 10 in 50% of the 18 tumors they examined.

Allelic loss of the 8p chromosomal arm was detected in 65% of prostate cancer cases, the highest rate among all chromosomal arms. These ratios are similar to allelic losses of Rb in retinoblastoma (where there is a Rb mutation in all cases), suggesting inactivation of a tumor suppressor gene in chromosome 8p. Interestingly, the karyotypic deletion of 8p was observed in

LNCaP cell line in an androgen-insensitive subunit.

No previously cloned suppressor genes were found on the 8p chromosomal arm.

Bergerheim et al. (Genes Chromosom. Cancer, 3, 215-220, 1991), alleles of the NEFL locus on the 8pl2-p22 chromosome were lost in seven out of eight patients with cancer, while alleles at the lipoprotein lipase locus (8p22) were missing in six patients. Alleles of the PLAT locus (8pl2-qll) have been retained in some tumors in which the more distal 8p loci are lost, suggesting that the putative suppressor locus on the 8p arm is located distal to PLAT. The distal distal marker, D8S7, was absent in three of six tumors. The exceptionally high allele loss of LPL and NEFL, and the fact that no allele loss distal to these loci has been observed suggests that the suppressor locus is relatively close to LPL or NEFL.

Thus, in order to effectively diagnose and treat susceptibility to prostate cancer and related cancers, the tumor suppressor genes responsible for these diseases need to be identified and localized.

The present invention provides a solution to these needs.

The present invention is based on the discovery of a novel nucleic acid molecule encoding a prostate / colon tumor suppressor gene product (PTSG protein) having tumor suppressive properties. The nucleic acid molecule is located in the p22 region of chromosome 8. The fact that the PTSG product is expressed in normal prostate and colon tissues and is absent in some prostate and cancer cells supports the role of said nucleic acid tumor suppressor gene. The full-length cDNAs described herein encode two new 348 and 347 amino acid proteins. The present invention is the first to describe that PTSG or the PTSG product is responsible for prostate adenocarcinoma, colon cancer, and other related cancers.

The present invention describes diagnostic procedures using said nucleic acid and PTSG. One aspect of the invention is oligonucleotide fragments capable of hybridizing to the PTSG gene and assays using such fragments. These oligonucleotides can consist of only 5 nucleotides, however, the approx. Oligonucleotides of 20 to 30 nucleotides are preferred. Said oligonucleotides may optionally be radioactive isotopes (e.g., tritium, ³² P and ³⁵ S), enzymes (e.g., alkaline phosphatase and horseradish peroxidase), fluorescent compounds (e.g., fluorescein, ethidium, terbium chelate) or cinnamyl luminescent compounds (e.g. esters, isoluminol and the like). For the oligonucleotides of the present invention, the above and other markers, e.g. non-isotopic DNA in Probe Techiques (ed. LJ Kricka, Academic Press, New York, 1992; incorporated herein by reference). Tracers in conventional DNA probe assays (e.g. Southern and Northern biot analysis)

A description of these conventional methods may be used.

can be found,

E.g

Nucleic Acid Hybridization · * '· ί':

··· 9 »

Practical Approach, ed., B.D. Hames and S.J. Higgins, IRL

Press, Washington DC, mentioned). The said

1985; which is herein referred to as being capable of hybridizing under stringent conditions to the PTSG gene. Oligonucleotides may also be used as primers in polymerase chain reaction (PCR) (see, for example, PCR Technology, H.A. Ehrlich, Stockton Press, New York, 1989, and similar sources).

The diagnostic method of the present invention detects loss of wild-type PTSG. The loss is due to deletion and / or point mutation events. It has not been deleted

PTSG alleles can be screened for point mutations, i.e. missense and frameshift mutations. Both types of mutations result in a dysfunctional PTSG product. Point mutation events can also occur in regulatory regions, such as in the PTSG promoter, resulting in a decrease or loss of PTSG mRNA expression.

To detect loss of wild-type PTSG in a tissue, it is preferable to isolate the tissue from surrounding healthy tissues. Methods for proliferation of tumor cells in a tissue composition are known. The tissue can be isolated, for example, from paraffin or frozen sections. Cancer cells can also be distinguished from normal cells by flow cytometry. The above and other techniques for separating tumor cells from normal cells are well known. If the tumor tissue contains a large number of normal cells, it is more difficult to detect mutations.

Point mutations can be detected by molecular cloning of the PTSG allele (or alleles) in tumor tissue and by sequencing the allele (s) by well known methods. Alternatively, using a polymerase chain reaction, a

PTSG sequences can be amplified directly from the genomic DNA composition derived from the tumor tissue, and the DNA sequence of the amplified sequence can then be determined. Polymerase chain reaction is well known in the art (see, for example, Saiki et al., Science, 239,487, 1988; and U.S. Patent Nos. 4,683,203 and 4,683,195).

Specific deletions of PTSG can also be detected. For example, restriction fragment length polymorphism (RFLP) probes for PTSG or marker genes surrounding the allele can be used to evaluate the loss of the PTSG allele. Other known techniques for detecting deletions may also be used.

Loss of wild-type PTSG can also be detected by loss of wild-type PTSG expression product. Such expression products include the mRNA or the PTSG protein product itself. Point mutations can be detected directly by sequencing the mRNA or by molecular cloning of the cDNA produced from the mRNA. The sequence of the cloned cDNA can also be determined in detail using well known DNA sequencing techniques.

The cDNA polymerase chain reaction (PCR) can be sequenced, which will be described later

Alternatively, mismatch detection may be used to detect point mutations in PTSG (or its mRNA product). Although these techniques are less sensitive than sequencing, they can be performed more easily in large numbers of tumors. An example of a mismatch cleavage technique is the RNase protection method (Winter et al., Proc. Natl. Acad. Sci., USA, 82, 7575, 1985; Meyers et al., Science, 230, 1242, 1985). In the practice of the present invention, the RNase protection method is performed using a labeled RNA probe (riboprobe) complementary to human wild-type PTSG. The RNA probe and the mRNA or DNA isolated from the tumor tissue were hybridized and then digested with RNase A, which is capable of detecting mismatches (non-complementary) in the duplex RNA structure. When a mismatch RNase is detected, RNase is detected. A cleaves RNA at the mismatch, so that the hybridized RNA preparation is separated on the electrophoretic gel (if there is a mismatch detected and cleaved by RNase A), the gel shows a smaller RNA product than the RNA probe. , and full-length duplex RNA generated by hybridization of PTSG mRNA or DNA. The RNA probe does not need to have the size of the full-length PTSG mRNA or gene; it is sufficient if it consists of a segment of one of these.

By • ·

- 14 - ..........

The probe consists of a single segment of the PTSG mRNA or gene, and many of these probes are required to screen the entire mRNA sequence for mismatches.

Similarly, DNA probes can be used to detect non-complementary base pairs (mismatches) by enzymatic or chemical cleavage (see, e.g., Cotton et al., Proc. Natl. Acad. Sci. 1988; Shenk et al., Proc. Natl. Acad. Sci. USA, 72,989, 1975). Alternatively, mismatches can be detected by shifting the electrophoretic mobility of non-complementary base-paired duplexes relative to complementary base-paired duplexes (see, e.g., Cariello, Human Genetics,

42. 726, 1988). Cellular mRNA or DNA, which may contain a mutation, can be amplified by PCR (see below) using either RNA probes or DNA probes before hybridization.

DNA sequences of PTSG from tumor tissue (amplified by polymerase chain reaction) may also be screened by allele-specific probes. These probes are nucleic acid oligomers, each consisting of a region of a PTSG DNA sequence carrying a known mutation. For example, an oligomer has an approx. It is 30 nucleotides in length, which corresponds to part of the PTSG DNA sequence. The oligomer codon 175 encodes alanine, unlike the valine codon of the wild type. Using such a series of allele-specific probes, PCR amplification products are screened

the presence of a mutation previously identified in PTSG can be determined. For example, allele-specific probes can be hybridized with the amplified PTSG sequences on a nylon filter. Hybridization to a particular probe indicates the presence of a mutation identical to the allele-specific probe in tumor tissue.

The kit of the invention is useful for determining the PTSG nucleotide sequence by polymerase chain reaction. The kit consists of a set of single-stranded DNA primer pairs that can be hybridized to sequences within (or surrounding) PTSG to initiate PTSG amplifying DNA synthesis. The complete primer series allows the synthesis of all nucleotides in the PTSG coding sequence. A sequence of primers may also allow the synthesis of intron and exon sequences, but should facilitate the synthesis of all exon sequences.

It is a further object of the present invention to provide a wild-type PTSG tumor suppressor gene or protein for suppressing, abrogating or reversing the cancerous phenotype of established cancer cells lacking the endogenous wild-type PTSG protein. The wild-type PTSG gene can be used to suppress or reverse the tumor phenotype or properties of established human cancer cells lacking the wild-type PTSG protein. Said suppression of the tumor phenotype is the suppression of abnormal mass of cancer cells, i.e. tumors or

- 16 16 which may ultimately increase the chances of the treated animal to survive. Tumor properties (which are monitored and reversed) include the morphology, growth, and most importantly, the tumor-forming property of cancer cells lacking the normal PTSG protein. Thus, the reduction of tumor cell load in an animal is a consequence of suppression of the tumor phenotype after administration of a tumor suppressor gene encoding a wild-type PTSG product. The term tumor phenotype refers to phenotypic changes in cellular characteristics such as morphology, growth rate (e.g., doubling time), saturation density, soft agar colony formation and tumorigenicity.

Accordingly, the present invention further relates to vectors encoding PTSG and PTSG proteins for the treatment of tumors and cancers, and methods of producing PTSG proteins and vectors for use in treatment methods. Another object of the present invention is to provide assays for molecules that bind to and affect PTSG.

The invention further relates to methods for treating mammals, such as humans, and to methods for treating abnormally proliferating cells, e.g. treatment of cancer cells (such as those associated with prostate or breast cancer or other tumor cells) and suppressing the tumor phenotype.

In general, the present invention relates to the treatment of abnormally proliferating cells or mammals suffering from a disorder characterized by abnormal proliferation of cells by a suitable method known to facilitate the introduction of a host PTSG-encoding vector or PTSG protein derivative into a cell to be treated. suppressing one or more features of the tumor phenotype or suppressing overgrowth.

One object of the present invention is to provide a method for treating an abnormally proliferating cell disease in a mammal comprising administering to the mammal suffering from an abnormal proliferating cell disease an expression vector encoding PTSG, delivering the expression vector to an abnormally proliferating cell, in a cell showing abnormal proliferation, which inhibits the proliferation of these cells. The expression vector is introduced into cells by viral infection or transduction, liposome-mediated transfection, polybrene-mediated transfection, CaPC4-mediated transfection, and electroporation. The treatment is repeated as needed.

Another object of the present invention is to provide a method for treating abnormally proliferating cells of a mammal comprising introducing into said abnormally proliferating cells an expression vector encoding PTSG, wherein the PTSG product is effective in suppressing cell proliferation.

- 18 · · · · »· ··· ··· ·. The treatment is repeated as needed.

Another object of the invention is a DNA molecule capable of suppressing an abnormally proliferating cell. An example of a prostate / colon tumor suppressor protein is the PTSG protein having essentially the amino acid sequence set forth in SEQ ID NO: 1. In a more preferred embodiment, the DNA molecule is represented by SEQ ID NO: 1. has the DNA sequence shown in SEQ ID NO: 2 and is expressed by an expression vector. The expression vector may be any host cell compatible vector.

Preferably, the vector is a retroviral vector, an adenoviral vector, or a herpesvirus vector. In another more preferred embodiment, the DNA molecule is represented by SEQ ID NO: 2. has the DNA sequence shown in SEQ ID NO: 2 and is expressed by an expression vector. The expression vector may be any host cell compatible vector. Preferably, the vector is a retroviral vector, an adenoviral vector, or a herpesvirus vector.

Another object of the present invention is to provide a PTSG protein product having substantially the sequence, fragments thereof.

No. 2 as well as biologically active amino acids thereof

Another object of the invention

PTSG protein product, essentially as described in SEQ ID NO: 4. has the amino acid sequence as well as biologically active fragments thereof.

• · · · · ·

Another aspect of the present invention is a method of producing a PTSG protein product comprising inserting a compatible expression vector containing a gene encoding PTSG into a host cell and inducing the host cell to express the PTSG protein.

Another aspect of the present invention is a method of ex vivo treatment of abnormally proliferating cells of a mammal comprising removing a tissue sample comprising abnormally proliferating cells in need of treatment; contacting the tissue in need of treatment with an effective amount of a vector encoding PTSG; and PTSG is expressed in an amount effective to suppress their proliferation in abnormally proliferating cells. The treatment is repeated as necessary and the treated tissue sample is returned to the original or another mammal. Preferably, the method comprises treating blood or bone marrow tissue ex vivo.

Another object of the present invention is to provide a method of treating a disorder characterized by abnormal cellular proliferation in a mammal comprising administering to the mammal suffering from a disorder of cellular proliferation an amount of PTSG protein effective to suppress cellular proliferation to suppress cellular abnormal cell proliferation. In one preferred embodiment, the PTSG protein fragments or derivatives are encapsulated in a liposome and thus delivered to the cells to be treated.

Brief Description of the Drawings

Figure 1 shows the results of Southern biot analysis of KSR2 (8p22) from human prostate cancer. Purified prostate DNA (T) and non-cancer DNA (N) from the same subjects are shown next to each other. Patient 4 lacks the 1.9 kb allele, while Patient 5 and 6 lacks the 3.3 kb allele. Patient 7 did not provide information on this locus.

Figure 2 shows the percentage of loss of loci studied on prostate cancer on chromosome 8.

Figure 3 shows a homozygous deletion of MSR in human prostate cancer. Primary tumor 23 retained both alleles at the D8S201 locus, provided no information for the D8S163 and D8S39 loci, and lost the 6.3 kb allele at the MSR locus. In the N2 metastatic tumor, an allele at the D8S201 and D8S163 loci was lost, while the MSR sequences were completely lost. A re-test of the same imprint (biot) with the 15-65 probe of the DCC locus (18q) at 8 kilobases showed a strong signal confirming the presence of high molecular weight DNA in the tumor column (T). Both D8S39 alleles are present in the N2 tumor; the intensity of the lower allele tripled. In the figure, bp is a base pair; T and N have the same meanings as in Table 1.

Figs.

Figure 4 is a deletion map of the 8p chromosome of human prostate cancer tumors showing a loss of the 8p chromosome. 1-27. samples of primary tumors. In the figure, N1-N5 represent samples of metastatic prostate cancer; blank circles represent the remaining alleles, dark circles the loss of heterozygosity, and X the homozygous deletion.

Figure 5 shows a YAC (artificial yeast chromosome) and irradiation hybrid map of the loci of the 8p22 region, which is the general region of allelic loss in several human cancers.

Figure 6 shows homologous integration of the conversion vector resulting in amplification of a band of 1855 bp.

Figure 7 shows the result of a Southern biot analysis of yeast DNA by radioactive hygro gene probe, which shows the presence of the hygro ^R gene in the YAC arm.

Figure 8 shows a large restriction map of the YACs surrounding the markers in the 8p22 region. 946_c_9, 877_f_2, 932_e_9 and ··· embedded in agarose balls

766_a_12 DNA from YAC was digested with various rare site cleavage enzymes (A: Ascl, M: Myl, N: NotI, Nr: Nrul, Sf: Sfil) and partially isolated by PFGE as described in the procedures. Southern biot hybridization was performed with selected cDNA probes (italics) and genomic DNA probes (normal letters) to identify restriction fragments containing each probe. The probes removed by N2 tumor homozygous deletion (Figures 3 and 4) are indicated in bold and at the top of the figure the derived minimal (740 kb, thick line) and maximum (920 kb, thin line) tumor deletion. As can be seen, the N33 gene is located within the deletion.

Figure 9 shows the nucleotide sequence of selected restriction sites on the insert of plasmid pBS-N33C (7). Plasmid pBS-N33C (7) was obtained by inserting a 1.3 kb long EcoRI-EcoRI insert (SEQ ID NO: 5) from the lambdaN33C lambda phage clone (obtained by screening the human placental cDNA library with the N33 cDNA probe) into pBluescript vector. We cloned. The first approx. 20 base pairs are believed to have been introduced artificially into the cDNA library.

Figure 10 shows the double-stranded N33 cDNA sequence derived from the sequencing of phage N33C (7) and RT-PCR clones A4 and A5. Clone A5 lacks N33C (7)

A 65 bp segment between nucleotides 1186 and 1250 and

The Α4 sequence, such as N33C (7) and A4 clone, represents the longer mRNA form 1 and A5 represents the shorter mRNA form 2. The hypothesized alternative splicing results in the use of either of the two candidate translation stops. We also indicate a predicted translation start position preceded by a stop codon (*) within a reading frame.

Figure 11 shows an ORF (open reading frame) map of clone N33C (7) representing mRNA 1. The longest ORF ranges from nucleotide 158 to nucleotide 1202.

Figure 12: Translation of the longest open reading frame (ORF) (SEQ ID NO: 1) of mRNA form 1. The predicted 348 amino acid polypeptide has a molecular weight of 39674.13 Dalton (SEQ ID NO: 3). The last five amino acids differ from polypeptide 2.

Figure 13 shows an ORF map of the derived mRNA form 2. The longest ORF ranges from nucleotide 158 to nucleotide 1199.

Figure 14: Translation of the longest open reading frame of mRNA form 2 (SEQ ID NO: 2). The predicted 347 amino acid polypeptide has a molecular weight of 39556.18 Dalton (SEQ ID NO: 4).

seq.). The last four amino acids differ from polypeptide 1.

• «·

Figure 15 shows alignment of the N33 polypeptide forms 1 and 2 with the 37.7 kD hypothetical protein encoded by ZF686.3 ORF from C. elegans. For optimal alignment, four gaps were used in the N33 sequence. 42% of the radicals were identical in human and C. elegans (underlined)

We indicated). THE 37.7 kD. ZK686.3 Molecular weight of protein encoded by ORF Figure 16 selected J2, J28 and N33 cRNA probes hybridized, normal human tissues derived mRNA

(Clontech) Northern biota. The N33 mRNA has a size of ca. It is 1.5 kilobases long and is expressed in most tissues, including the heart, placenta, lungs, liver, pancreas, prostate, testes, ovary, and colon. Expression in spleen, thymus, small intestine and peripheral lymphocytes was low.

Figure 17 shows a Northern blot of mRNA from human tumor cell lines hybridized to selected N33, P10, J2 and P16 cDNA probes. Actin was used as a control for mRNA uptake. In 13 of 14 colon and colon cancer cell lines, no N33 expression was detected (SW480, SW837,

SW1417, HT-29, SW403, LS174T, DLD-1, CACO-2, EB, SK-CO-1,

RKO, HCT116 and COLO-302).

Figure 18: Tumor cell lines PPC-1, WI-38, H460, and A549 (columns 1-4), normal colon mucosa (column 5), * and Northern biotype of mRNA from SW837 and SW480 colon tumor cell lines. N33 was expressed in the mucosa excised from the colon.

Figure 19 shows the result of a reverse transcriptase (RT-) PCR assay in RNA from nine prostate cancer samples (columns 1-9) (C: PCR control). N33GEX-f and N33GEX-r were used as N33 primers. Primers for the p53, Rb and G2PD genes were used as controls for RNA / cDNA quality. The N33, Rb and p53 primers cross the exon boundaries and do not specifically amplify genomic DNA. 3, 6 and 9.

significantly reduced N33 expression. Both upper (Figure 1) and lower (Figure 2) mRNAs are seen in tissues expressing N33.

Figure 20 shows the predicted sequence of Form 1 of the N33 polypeptide. The conserved 16 C-terminal amino acid (boxed) was coupled to KLH and used to generate a polyclonal rabbit antibody.

Figure 21 shows antibody recognition of an N33-glutathione-S-transferase fusion protein in E. coli. Placental N33 RT-PCR products (N33GEX-1 and N33GEX-r primer) were cloned into pGEX-2T vector (Pharmacia). The

Isolated clones A4 and A5 represent mRNA forms 1 and 2, respectively. Protein expression was induced by IPTG, and cell lysates were separated by polyacrylamide gel electrophoresis and copied onto membrane. The Western blot was incubated with affinity purified anti-N33 peptide polyclonal antibody and the reactive bands were visualized with alkaline phosphatase-conjugated secondary antibody and NBT / BCIP substrate. In induced cells containing the A4 clone, an approx. A 57 kD fusion protein band was detected which was not present in A5 or other clones.

This invention relates to a novel gene encoding a protein called PTSG. The term PTSG refers to two proteins; one consisting of 348 amino acids and the other 347 amino acids, each having a molecular weight of approximately 40 kD.

As used herein, the term nucleic acid refers to single-stranded or double-stranded genomic DNA, cDNA, mRNA, or cRNA. The term isolated as used to denote the state of nucleic acids refers to nucleic acids that are free of at least a portion of the molecules that are naturally associated with them.

Another object of the invention is a recombinant expression vector or a recombinant replication vector comprising an isolated nucleic acid molecule corresponding to a tumor suppressor gene. Host cells containing such vectors, e.g. bacterial cells are also part of the invention.

The treatment of human disease by gene delivery is now a

from the theoretical phase to the practical implementation stage. The first human gene therapy trial began in September 1990, when the adenosine deaminase (ADA) gene was introduced into the lymphocytes of a patient who had a lethal defect of said enzyme, resulting in immunodeficiency. The results of this initial attempt were very encouraging and new clinical trials have been initiated (Culver, K.W., Anderson, W.F. and Blaese, R.M., Humm Gene. Ther., 2, 107, 1991).

To date, accepted human gene delivery experiments have been based on retroviral vectors suitable for gene transfer. Retroviral vectors are retroviruses from which all viral genes have been removed or altered to prevent the production of viral proteins in cells infected with the vector. Viral replication functions are provided by the use of retroviral packaging cells, which produce all viral proteins but do not produce infectious viruses. When retroviral vector DNA is introduced into packaging cells, virions are produced which carry vector RNA and are capable of infecting target cells, but the virus does not continue to spread after infection. In order to distinguish this process from natural viral infection, when the virus is constantly replicating and spreading, we will use the term transduction instead of infection.

Insertion of a nucleic acid delivery system, for example, ·· · · · · · · · * • σ '· _ν «•» · · · · · ·· "" used "inappropriate · 4» replikádéira retroviral vector. As used herein, the term retroviral refers to, but is not limited to, a vector or carrier capable of targeting or delivering nucleic acid to dividing cells. The term unsuitable for replication as used herein refers to the lack of ability to produce viral proteins, which prevents the vector from spreading to infected host cells.

Another example of non-replication-retroviral vectors is LNL6 (Miller, A.D. et al., BioTechniques, T, 980-990, 1989; which is incorporated herein by reference). The technique of using non-replicating retroviruses for gene retroviral mediated insertion of gene markers is well known (Correll, PH, et al., Proc. Natl. Acad. Sci. USA, 86, 8912, 1989; Bordignin, C., et al., Proc. Natl Acad.

Sci. USA, 89, 8912-8952, 1989; Culver, K., et al., Proc.

Natl. Acad. Sci. USA, 88, 3155, 1991; Rill, D.R. et al., Blood, 79 (10). 2694-2700, 1991; each of which is hereby incorporated by reference). Clinical studies have shown that viral vectors have little or no interference (Anderson, Science, 256: 808-813,

1992).

The main advantages of retroviral vectors for gene therapy are:

are particularly effective in introducing genes into replicating cells; the inserted genes are precisely integrated into cellular DNA; and sequences after gene transfer • ·

29 are no longer spread (Miller, A.D., Natur, 357: 455-460, 1992).

It is a concern that the production of retroviral vectors may lead to the production of a replication (helper) virus, although this problem has been solved in practice.

To date, all FDA-approved retroviral vectors have been made using PA317 amphotropic retroviral packaging cells (Miller, A.D. and Buttimore, C., Molec. Cell Biol., 3, 2895-2902, 1986). Using vectors in PA317 cells that show little or no overlap with viral sequences can eliminate the development of helper viruses, even under stringent conditions that facilitate extension of such events (Lynch, CM and Miller, AD, J Virol. 65: 3887-3890 (1991). Other packaging cell lines are also available. For example, cell lines designed to separate different retroviral coding regions on different plasmids may reduce the chance of the development of helper viruses by recombination. Vectors produced by such packaging cell lines may also provide an efficient system for human gene therapy (Miller, A.D., Natur, 357, 455-460, 1992).

They can be used for gene therapy.

(Rosenfeld, M.A.

IF. et al., non-retroviral vectors

One such possibility is the adenovirus et al., Cell, 68, 143-155, 1992; Jaffe, Proc. Natl. Acad. Sci. USA, 82, 6482-6486,

1992). The main advantages of adenoviral vectors are: they can carry large DNA segments (36 kb genome); very high titer (10 ^{1: L} / ml), ability to infect tissues (especially lungs) in situ. The most notable application of this vector to date is the introduction of the human bladder fibrosis transmembrane conductance (CFTR) gene into the respiratory epithelium of rats by intratracheal instillation (Rosenfeld, MA et al., Cell, 66, 143-155, 1992). Herpes viruses may also be useful in human gene therapy (Wolfe, JH et al., 1992, Naturre Genetics, 1, 379-384). Of course, any suitable viral vector may be used in the gene therapy of the present invention.

Another human FDA-approved goblet delivery method involves in situ delivery of liposome-encoded plasmid DNA directly into human cells (Nabel,

SKY. et al., Science, 249: 1285-1288, 1990). Unlike retroviral vectors, plasmid DNA can be readily authenticated for use in human gene therapy since it can be purified to homogeneity. In addition to liposome-mediated DNA delivery, there are several other physical DNA delivery methods (such as the method for directing DNA to receptors on cells in its complexes with plasmid-DNA proteins)

It is shown that promisingly applicable the human gene therapy (Wu, G.Y. and others. , J. Bioi. Chem. , 266, 14338-114342, 1991; Curiel, D.T. and mci., Proc. Natl. Acad.

Sci. USA 66: 8850-8854 (1991).

• · · ·

The PTSG of the present invention can be transformed into an expression vector, e.g. plasmid or virus expression vector. The plasmid expression vector is introduced into a tumor cell by calcium phosphate transfection, liposome (e.g., LIPOFECTIN) mediated transfection, polybrene mediated transfection, electroporation or any other DNA delivery method.

The viral expression vector may be introduced into a target cell in a form that can be expressed by infection or transduction. Such viral vectors include, but are not limited to, retroviruses, adenoviruses, herpes viruses, and avipox viruses. When PTSG is expressed in any abnormally proliferating cell, the cell's replication cycle is interrupted, leading to cellular aging and cell death, and eventually the weight of the abnormal tissue (i.e., tumor or cancerous tissue) is reduced. A vector capable of introducing the gene construct into a target cell and capable of expressing H-NUC in an amount that inhibits cell proliferation in the target cell can be administered by any effective means.

For example, an effective concentration of a physiologically acceptable solution containing the topically active vectors may be administered intraocularly, parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously or in any other effective manner. The vector may be injected directly into the targeted cancer or tumor tissue in an amount effective to treat the tumor cells of the target tissue.

Alternatively, if the cancer or tumor in the body cavity - e.g. the gastrointestinal tract, the urinary and genitourinary organs (e.g., the bladder), the lungs, etc. - a direct physiologically acceptable formulation containing an effective concentration of active vectors, such as sterile saline, buffer, suspension or emulsion.

catheter tube can be used,

Any effective means of localizing the target tissue and guiding the needle or needle, such as an x-ray machine, sonogram, or fiber optic visual display system.

not directly accessible or containing a concentration of a solution for the treatment of cancer or tumor

Alternatively, the non-anatomically isolated active vectors are administered into effective physiologically acceptable blood circulation.

Alternatively, the targeted tumor or cancer cells are treated by introducing the PTSG protein into the cells by any known method. For example, liposomes are artificial membrane vesicles capable of delivering drugs, proteins, and plasmid vectors to target cells (both in vitro and in vivo) (Mannino, RJ et al., BioTechniques, 8, 682-690, 1988; Newton, AC and Huestis, 1988). WH, Biochemistry, 27, 4655-4659,

1988; Transwell, A.K. et al., Biochimica et Biophysica Acta, 1044. 269-274, 1990; and Ceccoll, J. et al., Journal of Investigative Dermatology, 22, 190-194, 1989). The PTSG protein can be incorporated into liposome vesicles with high efficiency, which can be delivered to mammalian cells both in vitro and in vivo.

Intraocularly, intratracheally, at a dose that can be administered topically, parenterally, intranasally, intrabronchially to the liposome, liposomes are so effective in treating abnormally proliferating cells of the target tissue. Liposomes can be administered in any physiologically acceptable composition containing an effective concentration of the PTSG protein encapsulated.

The term "host-vector system" refers to host cells transfected with vectors produced using recombinant DNA techniques. Introduction of the vector or DNA by microcell transfer, retroviral mediated gene transfer, transfection, cell fusion, etc.

can be implemented. The vectors and methods described herein can be used in a variety of host cells derived from a variety of prokaryotic and eukaryotic organisms. The invention further describes a cell transformation method comprising contacting a cell with a vector or DNA of the invention under appropriate conditions.

Reference is made to standard molecular biology manuals which describe definitions, methods, and tools for carrying out the basic techniques used in the present invention (see, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989); and the links listed there). This source and the aforementioned publications are expressly incorporated by reference in the description of the invention.

Current recombinant DNA techniques include polymerase chain reaction (PCR), which, when combined with synthetic oligonucleotides, allows for the easy reproduction of DNA sequences. PCR can be used to amplify exponentially approximately 6,000 base pairs of DNA from a single gene copy. In the PCR procedure, a denatured DNA sample is incubated with two oligonucleotide primers that direct DNA polymerase-dependent synthesis of new complementary strands. Successive cycles of synthesis result in doubling of the target sequence. Each cycle is controlled by varying the temperature, allowing denaturation of the DNA strands, hybridization of the primers, and synthesis of the new DNA strands. As a result of the use of heat-stable DNA polymerase, the reaction does not require the addition of new enzymes in each cycle, which allows for fully automated DNA amplification. Twenty-five cycles of amplification will increase the target sequence amount by approximately 10 to ⁶ fold. The PCR technique is described in U.S. Pat. Nos. 4,683,195, 4,800,159, 4,754,065, and 4,683,202.

State patents.

It will be appreciated that the primary sequence of the tumor suppressor gene of the present invention may be modified to a limited extent without impairing its biological function, and that only a portion of the entire primary structure is required or required for activity. It should also be understood that minor modifications of the primary amino acid sequence may result in proteins that function substantially the same or better as compared to the molecule within the pBS-N33c (7) vector. These modifications may be intentional, e.g. site mutagenesis or may be random, e.g. due to mutations in the hosts. The above modifications should only be allowed as long as tumor suppressor activity is maintained. Nucleic acid fragments of at least 10 nucleotides are suitable as hybridization probes. The probes are useful in detecting the predisposition to cancer caused by the malfunctioning of a particular gene. Isolated nucleic acid fragments are also useful for the production of new peptides, which are useful in generating polyclonal or monoclonal antibodies for use in the diagnostic procedures described below. Methods for preparing and using probes and immunogens are well known; these are briefly described below.

The invention also relates to nucleic acid molecules

which hybridize under stringent conditions to an isolated nucleic acid molecule encoding a tumor suppressor protein of the invention. Such hybridizing nucleic acid molecules or probes may be prepared, for example, by random priming of this nucleic acid molecule. See Methods for making such fragments. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, p. 1.98-1.104, 1989.

Another object of the invention is a purified tumor suppressor polypeptide or protein. These polypeptides and / or proteins are useful in the production of antibodies useful for diagnostic purposes. These polypeptides or proteins can be prepared by recombinant expression of isolated nucleic acid molecules using well-known molecular biological techniques.

Purified term used to describe the state of a protein, polypeptide, or antibody means that the protein is free of some of the other proteins or molecules that are naturally associated with the tumor suppressor polypeptide, protein, or antibody. As used herein, the term "natural" refers to a form of a protein, polypeptide, antibody, or fragment thereof that is isolated from nature, or to a form that does not contain intentional amino acid substitution.

As used herein, the term antibody or immunoglobulin refers to a protein produced by immunization with an antigen that specifically reacts with the antigen. Antibodies include polyclonal and monoclonal antibodies. This term includes human and mammalian antibodies, e.g. mouse, rat, rabbit and goat antibodies. The most commonly produced human antibody is the IgG isotype, which has two light and two heavy chains linked by disulfide bonds. IgG has a serum antibody of ca. 80%.

Anti-tumor suppressor antibodies can be generated as follows. Fragments of the DNA fragment in vector pBS-N33c (7) were fused to glutathione-S-transferase protein and the fusion proteins expressed in E. coli. Transfused E. coli cells are cultured in LB medium containing ampicillin. The culture medium is diluted with LB medium from 1:10 to 1: 150, preferably 1: 100, and ampicillin is added. For the preparation of recombinant plasmids, see p. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, p. 1.98-1.104, (1989). For restriction fusion of the fragments at the restriction enzyme recognition sites, see vector. Proc. Natl.

Acad. Sci., £ 3, 4685-4689, (1986).

Fusion of glutathione S-transferase (GST) with the PTSG DNA fragment using the procedure described above.

38 proteins were prepared according to Sambrook et al. (Molecular Cloning: The Laboratory Manual, Cold Spring Harbor Laboratory, New York, pp. 1.98-1.104, 1989) and Harlow and Lane (Antibodies: The Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988). Purification by preparative SDS polyacrylamide gel electrophoresis (SDS-PAGE). The fusion protein was eluted by overnight extraction and sodium dodecyl sulfate (SDS). The soluble acrylamide can be removed by dialysis. The proteins were then concentrated. The purified fusion protein can be used as an antigen to form a specific anti-PTSG antibody.

To produce the antibody, rabbits were injected with 1-20 Ng, preferably 10g of purified fusion protein (mixed with complete Freund's adjuvant) (first injection), followed by injections of the same amount of fusion protein mixed with incomplete Freund's adjuvant (repeated injections). The complete Freund's adjuvant is usually composed of antigen (in this case fusion protein), saline, a mixture of an emulsifier (e.g. Arlacel A) in mineral oil and an emulsion of mycobacteria. The incomplete Freund's adjuvant composition is the same except that it does not contain mycobacteria.

Injection was repeated until a sufficiently high level of anti-fusion protein antibody, which reacts with both glutathione S-transferase and fusion protein, was detected. This is approx. two months later. Two or more affinity columns were prepared using the procedure described by Harlow and Lane (Antibodies: Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988) to amplify antibodies that exclusively recognize prostate tumor protein determinants. Glutathione S-transferase (GST) was coupled to at least one column and at least one column was filled with a fusion protein. Both columns were properly equilibrated. The antibody was first passed through a Sepharose column packed with fusion protein and then eluted with glycine buffer (pH 2.3). The eluate was neutralized and passed through the GST column several times to remove antibody specifically to GST. The purified anti-prostate tumor suppressor protein is useful for immunoprecipitation or immunostaining and for the localization of the prostate tumor suppressor protein and for the diagnostic identification of PTSG in mammalian and human tissue samples. Accordingly, purified proteins are also part of the invention. Purified proteins can be labeled with detectable markers such as radioactive isotopes, dyes, enzymes and biotin.

The above methods may be modified using any standard method such as those described by Harlow and Lane (Harlow and Lane, Antibodies: Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988).

Fusion proteins can also be used to generate monoclonal antibodies. Thus, the invention also relates to monoclonal antibodies directed against epitopes on the prostate tumor suppressor protein or polypeptide. In one embodiment of the invention, the monoclonal antibody is a mouse monoclonal antibody. In another embodiment of the invention, the monoclonal antibody is a human monoclonal antibody.

To isolate the mouse monoclonal antibody, eight-week-old mice (complete volume ratio) were exposed to ca.

purified polypeptide (prepared).

Freund's adjuvant 1: 1; (prostate tumor suppressor as described above)

The mice were subsequently given monthly booster vaccination using a prostate tumor suppressor polypeptide mixed with incomplete Freund's adjuvant. The mice received blood through their tail veins. On days 4, 3, and 2 before fusion, mice were challenged with 50 µg of polypeptide in saline. Spleen cells were fused with non-secreting myeloma (bone marrow tumor) cells according to known methods. After some time, approx. two weeks later, the hybridoma supernatant was screened for binding to a prostate tumor suppressor as described below. Positive clones were isolated and propagated.

Another object of the present invention is a monoclonal antibody conjugated to therapeutic agents as described above. Suitable therapeutic agents for the purposes of the present invention include, but are not limited to, radioactive isotopes, toxins, toxoids, and chemotherapeutic agents. The invention also relates to a monoclonal antibody conjugated to a detectable marker as described above. Suitable detectable markers include, but are not limited to, enzymes, radioactive isotopes, dyes, and biotin. Another object of the present invention is the monoclonal antibodies described above conjugated to an imaging agent. Suitable imaging agents include, but are not limited to, radioactive isotopes, e.g. ³² P, ^3e S, and ¹³¹ I.

The invention further relates to pharmaceutical compositions comprising the purified prostate tumor suppressor polypeptide or protein described above, alone or conjugated to a detectable marker, therapeutic agent or imaging agent. The present invention relates to pharmaceutical compositions comprising the described monoclonal antibody alone or conjugated to a detectable marker, a therapeutic agent or an imaging agent. As used herein, the term pharmaceutically acceptable carrier includes any conventional pharmaceutical carrier, such as phosphate buffered saline, water, emulsions (oil / water emulsions), and various types of wetting agents.

further above

The term antibody used herein also includes fragments of. ·· ·· antibodies. Antibody fragments retain at least part of the antibody's ability to selectively bind to antigen. The invention includes antibody fragments synthesized by recombinant or chemical methods which retain the ability to bind to the antigen of the corresponding natural antibody. The ability to bind to an antigen or hapten is determined by known antigen binding assays (such as antibody capture assays) (see, e.g., Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988). ). Antibody fragments that retain a certain degree of binding affinity include, but are not limited to, Fab (a monovalent antigen-binding fragment produced by digestion of an antibody molecule with papain by a complete light chain and a portion of one heavy chain); Fab '(a fragment of an antibody molecule produced by treatment and reduction with pepsin containing a complete light chain and a portion of a heavy chain [yielding two Fab' fragments per antibody molecule); (Fab ') z (fragment of antibody produced by treatment with pepsin but without subsequent reduction);

F (ab ') 2 (which is a dimer of two Fab' fragments held together by two disulfide bonds; Fv and single chain antibodies (SCA) are subject to CDR-grafted "

The present invention and chimeric antibodies that retain the ability to bind to a prostate tumor suppressor protein.

··· · »

As used herein, the term chimeric antibody refers to an antibody in which variable regions of one type of antibody are mixed with constant regions of another type of antibody. Chimeric antibodies are made by recombinant DNA technology (see, e.g., Shaw et al., J. Immun., 138, 45338, 1987; Sun, LK et al., Proc. Natl. Acad. Sci. USA, 84, 214-4). 218, 1987; Neuberger, MS, et al.

314. 268, 1985; Boulianne, G.L. et al., Natur, 312,

643-646, 1984; and Morrison, S.L. et al., Proc. Natl. Acad. Sci. USA, supra, 6851-6855 (1984).

Said CDR-grafted antibody refers to an antibody in which the amino acid sequence of one or more CDRs of the light and / or variable domain has been replaced by an analogous portion of an CDR sequence derived from an antibody having a different binding specificity to a particular hapten or antigen. Analogous CDR sequences are transferred to the substrate or recipient antibody (see European Patent Publication No. 0 239 400). The donor antibody is the antibody providing the CDR sequence, and the substrate antibody is the antibody accepting the substituted sequences.

It is a further object of the present invention to provide a method for detecting the presence or absence of a protein in a sample that is associated with a tumor. In the method used to detect the protein, the cell is stained with an antibody raised against the protein. During the procedure

as a first step, a suitable sample is taken from a patient. Suitable samples include, but are not limited to, prostate tumor tissue, colon tumor tissue, lymph node tissue, and bone marrow cells. The method involves contacting the sample with a tumor-suppressor protein-specific agent under conditions favorable to the formation of the agent-protein complex and detecting the presence of the complexes formed. The absence of the complex indicates a protein deficiency associated with a cancerous condition, such as prostate adenocarcinoma. As such, this procedure is useful in the diagnosis of prostate adenocarcinoma. Tracers suitable for the purposes of the invention include radioactive isotopes such as ³² P, ³⁵ S and ¹³¹ I; and (but not limited to) dyes and enzymes.

In this method, said agent may be an antibody directed against the protein or a particular subregion of the protein, the absence of which is associated with prostate cancer.

Another object of the present invention is to provide a method for detecting the presence or absence of a tumor suppressor gene or nucleic acid in a sample, the absence of which gene or nucleic acid is associated with a tumor. As a first step in the process, a suitable sample is taken from a patient. To detect the presence of nucleic acid in cells, the nucleic acid of the cell is hybridized to a nucleic acid probe by methods well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: Cold Spring Harbor Laboratory, Laboratory Manual). , New York, pp. 1.98-1.104, 1989). Suitable samples include, but are not limited to, prostate tumor tissue, colon tumor tissue, lymph node tissue, and bone marrow cells. The method involves contacting the sample with an agent specific for the wild-type or normal tumor suppressor gene, under conditions favorable to the formation of the complex with the agent, and detecting the presence of the complexes formed. The absence of the complex indicates a deficiency of the wild-type gene associated with a cancerous condition, such as prostate adenocrcinoma. Accordingly, this method is useful for the diagnosis of prostate adenocarcinoma. Tracers suitable for the purposes of the invention include radioactive isotopes such as ³² P, ³⁵ S and ¹³¹ I; and (but not limited to) dyes and enzymes. Said agent may be a nucleic acid molecule corresponding to the tumor suppressor protein or a specific subregion thereof.

The present invention further provides a kit for detecting, diagnosing or prognosticating prostate cancer comprising reagents for use in carrying out the procedures described above and instructions for use. The kit can be used for direct genetic detection of pathological changes in the prostate tumor suppressor gene and may include, for example, oligonucleotides, primers for PCR analysis, reagents for SSCP, or sequencing. Kits, reagents, and methods are also useful in prognosis, for example, a deletion may indicate a less favorable prognosis for recovery.

Also included within the scope of the invention are compositions comprising at least one of the aforementioned nucleic acids, peptides or antibodies. Such formulations may also contain carriers or diluents, e.g. phosphate buffered saline, emulsions or various wetting agents.

The following examples are intended to illustrate the invention and not to limit its scope.

Example 1

Identification of allele loss

1) Tissue samples

Prostate cancer tissue samples were taken from August 1988 to November 1994 from a patient with clinically localized prostate cancer undergoing prostatectomy. None of the patients enrolled in the study had previously received chemotherapy or hormonal treatment. Prostate and seminal vesicle tissue was collected and PTSG was stored at -80 ° C (see Bova, GS et al., Homozygous deletion and fecal allelic loss on pf chromosome 8p22 loci in human *). · «·« ··· ··· 4 ·· «prostate cancer, Cancer Rés., £ 3, 3969-3973, 1993). Only palpable tumors were adequate and palpable tumors were collected only after surgical removal. For the 42 primary tumors included in the study, the mean Gleason score (Meilinger, G.T. et al., 1967) was 7.4 +

Was 1.1 (SD) (range 5 to 9). Concerning the 42 tumors examined, focal or capsular penetration was observed, so that in the current classification of tumor nodus metastasis for prostate cancer (Schroder, F.H. et al., 1992), all investigated tumors were in the Te category. Out of the 42 tumors examined, 16 (38%) had transmission to the seminal vesicle, and 11 (26%) had microscopic lymph node metastases.

The collected primary tumors were mounted on a slide and the 6 µm sections were stained with hematoxylin and eosin. For DNA analysis, 42 primary adenocarcinomas were selected that could be excised to contain more than 70% of the tumorous nuclei. Metastatic adenocarcinoma tissue was obtained from ten patients who had palpable enlarged pelvic lymph nodes at the time of the planned radical prostatectomy. The PTSG section at the time of surgery proved metastatic adenocarcinoma, so no radical prostatectomy was performed. PTSG sections of nodal tissue not needed for histological diagnosis were made and stored at -80 ° C until use in the assay.

Each patient was paired with cancer-free tissue (seminal vesicle, prostate, or lymphocytes). It's not cancerous

Seminal vesicle or prostate tissue as the source of DNA was examined for PTSG sections at 300 [mu] m and tissues containing abnormal or cancerous epithelium were discarded.

Monoclonal Immunradiometry (Hybritech, San Diego, CA) was used to measure the level of prostate-specific serum antigen prior to surgery.

2) Preparation of DNA samples

From the tissue surrounding the cancer tissue (containing benign prostatic epithelium, stroma, lymphocytes, etc.), the highest possible amount of prostate-specific antigen (PSA), more than 70, was isolated using cryostat section technique (Bős, JL et al., 1987). It contained% prostate cancer foci. All prostate cancer examined were of the conventional acinic type and had a diameter of less than 2 cm. Isolation and quantification of DNA Carter, B.S. and others. (1990) and Burton, K. (1968).

3) Southern analysis

DNA samples were restriction endonucleases (BRL and New

England Biolabs), using buffers recommended by distributors. For Mspl digestions, 10 units of enzyme per 1 µg of DNA was used, while for Taq1 digests 7.5 units of enzyme was used per 1 µg of DNA. Samples were electrophoresed on a 0.8% agarose gel and, after purification in 0.25 M hydrochloric acid for 10 minutes, were copied onto Nytran nylon membranes (Schleicher & Schuell) in 0.4 M sodium hydroxide / 0.6 M sodium chloride. After DNA was covalently bound to the membrane by UV irradiation (Stratagene), the membranes were pre-hybridized in ml of 1 M NaCl / 1% sodium dodecyl sulfate / 10% dextran sulfate at 65 ° C for one hour. KSR2, NF 5.1 and MCT 128.2 DNA probes were obtained from the American Type Culture Collection. See the description of probes CI8-1, MSR-32 (MSR: macrophage scavenger receptor), CI8-319 and CI8-277. Emi, M. et al. (1993). The probes were labeled with the Klenow fragment of DNA polymerase I (Amersham) using random hexamer priming and incorporating [alpha ³² P] dCTP (Amersham). Probes CI8-1, MSR-32, CI8-319 and CI8-277 were boiled in truncated human placental DNA (Sigma) (0.2 mg / ml), chilled briefly on ice, and then at 65 ° C overnight. hybridized. After hybridization, the membranes were washed in 0.1X standard saline / phosphate buffer / EDTA / 0.1% sodium dodecyl sulfate for 15 minutes and exposed to Kodak XAR-5 film at -80 ° C using magnifiers.

Allelic loss was defined as prostate cancer

The absence of an allele in DNA is a cancer-free, paired control

Compared to DNA. In some cases, when a residual signal from the normal tissue was present, densitometry was used for analysis. One sample was considered to have allele loss when the reduced allele had a 60% reduction (relative to its normal counterpart).

Using the MCT 128.2 probe, allele multiplication was defined as an increase in intensity of more than 100% of one of the two alleles present in tumor samples, or in homozygous cases (when pre-testing the same imprints [biot] in the tumor and normal bands) , the difference in intensity between tumor and normal alleles is greater than 100%.

4) Microsatellite analysis

Lipoprotein lipase (LPL) coding sequences (GZ 14) and

See Mfd 199 for a description of the primary series. Tomfohrde, J. et al.

(1992). One member of each primer pair (LPL GZ 14 and Mfd 199R) was polynucleotide kinase (Boehringer-Mannheim) and 5X kinase buffer (0.25 M Tris pH 9.0), 50 mM MgCl 2, 50 mM dithiothreitol and 0, 25 mg / ml bovine serum albumin] was terminated with [gamma- ³² P] ATP. 6 µl of primer (10 zad), 2.8 µl of 5X kinase buffer, 0.7 µl of kinase (9 units / µl), 1.5 µl of sterile deionized water, and 3.0 µl of [gamma- ³² P] ATP and incubated at 37 ° C for one hour. The products were purified on G-25 centrifuged (spin) columns (Boehringer-Mannheim). 1 µL of unlabeled primer (10 µL), 0.5 mL of deoxynucleotide triphosphate mixture (equal volume of 10-10 µM dATP, dCTP and dTTP), 5.5 µl sterile deionized water and 10X Taq DNA polymerase To the mixture of buffer (Perkin-Elmer) was added 1 µl of labeled primer, 10 µl of genomic DNA (2.5 µg / µl) was added and the mixture was heated to 94 ° C. After addition of Taq DNA polymerase solution (5 units), PCR was performed by repeating 30 cycles (denaturation at 94 ° C for 30 seconds; 62 ° C (LPL) or 58 ° C (Mfd 199) for 30 seconds). hybridisation; 30 sec chain extension at 72 ° C) followed by incubation at 72 ° C for 7 minutes. The products were mixed with an equal volume of stop buffer (95% formamide, 0.05% xylene cyanol, 0.05% bromophenol blue and 20 mM EDTA). Samples were denatured at 94 ° C and 3-3 ul of each sample was applied to 6% acrylamide gels containing 8.0 M urea. The gels were dried and exposed to Kodak XAR film. In this assay, allele loss by microsatellite analysis was determined using criteria similar to those described above for the Southern analysis described above.

5).-Immunohistochemical analysis of MSR protein in five patients examined primary prostate cancer tissue sections and adjacent non-cancerous prostate tissue sections (including benign prostatic hyperplasia and normal prostate). An autopsy liver tissue from a patient was used as a positive control for MSR staining. At autopsy, well-preserved central and peripheral prostate tissue from the same patient was obtained and stained for MSR protein. No evidence of malignancy was found at autopsy in this patient, and prostate tissue was normal macroscopically and histologically. The non-fixed, air-dried, 6 Jan sections of slides on slides were warmed to room temperature and fixed in a solution of 2% formaldehyde, 10 mM Tris pH 7.4, 150 mM NaCl and 2 mM CaCl2 for 10 minutes and then at room temperature for 20 minutes. Incubated in a mixture of 0.3% hydrogen peroxide and absolute ethanol. The slides were then rinsed twice with 10 mM Tris pH 7.4, 150 mM NaCl and 2 mM CaCl 2 and incubated at 37 ° C for 10 minutes in serum blocking solution (Zymed). Thereafter, rabbit anti-human synthetic scavenger receptor peptide IgG (donated by Dr. Tatsuhiko Kodama of the University of Tokyo; described by Kodama et al., 1988) (1:50) was added to each slide and the plates were incubated at 37 ° C. incubated for 30 minutes. Primary antibodies were detected with biotinylated secondary antibody-streptavidin-peroxidase conjugate (Zymed).

S.I .. £] 2.gdmé.nyek

Allele loss was investigated in 52 prostate cancer samples using 8 polymorphic probes for the short arm of chromosome 8. Of the 51 samples providing information, 32 (63%) •

showed allele loss on at least one locus of chromosome 8p. The most frequently deleted region is the 22-21.2 region of chromosome 8p. Loss of an allele on the 8p chromosome at the D8S163 locus in 14 of 23 tumors (61%) (12 of 19 primary tumors and 2 of 4 lymph node metastases) (Figure 1); at the LPL locus, 15 out of 32 tumors (47%) (15 out of 30 primary tumors and 0 out of 2 metastases), and at the MSR locus 20 out of 29 tumors (69%) (17 out of 26 primary tumors and 3 out of 3) experienced. Loss of an allele was identified on chromosome 8p21.3-21.2 at D8S220 locus in 16 of 27 tumors (12 of 22 primary tumors and 4 of 5 metastases) (Figure 2, Table I).

In addition to an allele loss at the MR locus in most tumors, a homozygous deletion of MSR sequences was observed in one metastatic prostate cancer sample (N2). Figure 3: Hybridization of the same imprint in the N2 tumor column with DCC 15-65 probe shows the presence of the same or larger intact DNA. N2 is DNA

Repeated digestion with Mspl, Taq1 and EcoRI and testing with MSR confirmed this result but at least one allele was present. The boundary of the homozygous deletion is thus designated by D8S163 and LPL ·.

In contrast to 8p22-21.2, a large proportion of loci in the telomeric and centromeric directions relative to this region were retained - in only 9 (19%) of the 48 information sites, we observed loss of one or more loci. Of the distal loci examined on the 8p23 chromosome, allele loss was observed in only 4 cases (11%) of the D8S140 locus and 3 cases (14%) in the D8S201 locus (Table I). Loci studied on chromosomes 8pl11.2 and 8q24 also seldom suffered deletion; allele loss was observed in 3 (12%) of the 26 informative cases at D8S194 locus and in 2 (12%) of 17 cases at D8S39 locus.

Evidence of 8q chromosome multiplication was found in 5 of the 32 tumors tested at D8S39 locus (4, 20, 21, NI and N2) (16%) (Figure 3). Signals obtained for one of the two D8S39 (8q24) alleles increased to 2-3 fold after correction for differences in DNA uptake. All tumors with 8q amplification showed 8p allele loss at at least one locus.

Figure 4 summarizes data from all primary and metastatic prostate cancer samples showing evidence of allele loss on chromosome 8p. In 15 of the 42 primary tumors examined (36%), and in 5 of the 10 metastatic tumors examined (50%), the 8 loci on the 8p chromosome were confirmed to be heterozygous or did not provide adequate information, these 20 cases were omitted from those shown in Figure 4. The 8p chromosome has allele loss, the

For the MSR locus, * * informative tumors each showed at least one allele loss at this locus. The D8S163 (KSR) locus of tumors 1, 18, 25 and N5 was retained, but proximal loci (including MSR) were lost. LPL locus of tumors 24 and 25 remained but more distal loci (including

MSR) have been lost. These results limit the smallest overlap region to the interval bordering the MSR locus between D8S163 and LPL loci. Emi et al. (1991), this band is 14 cM in males.

The homozygous deletion observed at the MSR locus prompted us to perform a preliminary evaluation of the macrophage scavenger receptor gene (as a potential tumor suppressor gene). Kodama et al. (1988) tested prostate tissue using a very specific polyclonal antibody to express MSR protein. No macrophage scavenger receptor protein was detected in prostate cancer cells or in the cancer-free prostate epithelial layer. The scattered cells in the stroma of each prostate section were positively stained, which is in good agreement with staining exclusively in macrophages.

To determine whether allelic loss on the 8p chromosome is significantly related to clinical parameters, we reviewed pre-operative serum PSA levels, determined Gleason values, and evaluated the final pathological status of each patient. There was no significant difference in mean Gleason between the group of patients with 8p allele and those without 8p allele; the former was 7.3 and the latter 7.6. Of the 42 patients whose primary prostate cancer tissue was examined, 34 had pre-operative PSA levels. Mean PSA levels for the whole group were 11.2 ng / ml (range 1.6 to 23.6 ng / ml). Patients with 8p chromosome allele loss had a mean pre-operative PSA level of 12.6 ng / ml, compared with 9.3 ng / ml in patients with no 8p chromosome allele (analysis of variance, P = 0.105). Seminal vesicle attack was observed in 11 (27%) of 27 patients with 8p allele loss and in 5 (33%) of 15 patients without 8p allele loss (A ² , P = 0.055). Microscopic lymph node metastases were found in nine (27%) of the 27, 8p allele loss patients, and in three (20%) of the 15 patients without the 8p allele loss (A ² , P - 0.35). Summarizing; in patients with prostate cancer with loss of allele on chromosome 8p, there is a trend toward higher preoperative PSA levels, more frequent lymph node involvement and more frequent seminal vesicle involvement, but this trend is not statistically significant.

Example 2

Isolation and mapping of 8p probes

1) Origin of probes, primers and somatic cell hybrids

Plasmid pABL-4 probe detecting the D8S21 locus was obtained from R. White (see Tsui, LC et al., 1989). Insert of the E. coli amber suppressor tRNA from ^T v ^v

It was determined by priming using 5'-GAATCCTTCCCCCAC-3 'oligonucleotide and designed for two primers to form a sequnce-tagged site (Table II). The lambda phage CRI-R191 detecting the D8S26 locus was obtained from the ATCC. The 4.2 kb Eco RI restriction fragment of this phage was subcloned and partially sequenced to form an STS (Table II). D8S233 detects locus

Cosmid CI8-487 was obtained from Japanese Cancer Research Resources Bank. The 2.2 kb Eco RI restriction fragment of this cosmid was subcloned and partially sequenced to generate STS (Table II). By partial sequencing of purified YAC DNA random subclones (see below), new STSs were generated (Table III). YAC end fragments (Table III) were obtained by the inverse PCR method of Albertsen and Thliveris (Joslyn et al., 1991). The PCR products were ligated and sequenced into TA cloning vector (Invitrogen) and prepared as STS (Table III). The other primary sequences are shown in Figure II. and III. from the sources shown in Table. Human Chromosome 8 X CHO Somatic Cell Hybrid Mapping Panel (Wagner et al., A • · · ·

- 58 - ·:. .. ·. ·· .. · hybrid cell mapping panel forum region localization of probes to human chromosome 8. ”, Genomics, ± Q, 114-125, 1991) provided by M. Wagner.

2) Radiation treatment of hybrids

The only human component, the GM10156b human x hamster hybrid cell line containing human chromosome 8, was obtained from the NIGMS Mutant Cell Repository (Camden, NJ). The hybrid was irradiated with 5,000 of you at gamma radiation and Cox et al. (Cox et al., Science 250: 245-250, 1990) was fused to an APRT- and HPRT-deficient CHO-ATS-49tg Chinese hamster ovary cell line. A total of 97 hybrid clones were obtained after HAT selection. The presence or absence of six marker loci (D8S26, MSR, D8S233, D8S261, D8S21 and LPL) in the irradiated hybrid DNA is shown in Figure II. using the appropriate primers listed in Table II. Marker spacing and marker order were estimated using Statistical Package Forum Radiation Hybrid Mapping (Cox et al., Radiation hybrid mapping: constructing high resolution maps of mammalian chromosome somatic cell genetics, Science, 250, 245-250). a. The TWOPOINT program was used to evaluate recombination fractions and retention rates. The experimental maps were tested with the FOURPOINT program to confirm the order.

3) YAC directory screening

A copy of the YAC library (Albertsen et al., Proc. Natl. Acad. Sci. USA, fiZ, 4256-4260, 1990) was obtained from CEPH (Paris, France). The library can be found in the II. 10 loci, PCR, screened by hierarchical screening (Green, E.D. and Olson, M.V., Proc. Natl. Acad. Sci. USA, 1990, SZ 1213-1217). Pools of DNA were prepared from four plates, 8 rows, and 12 columns; 58 super pools represented 384 clones each. The clones identified as plate / row / column were plated in strips on AHCagar plates and either by direct PCR analysis of colonies or by PCR analysis of yeast DNA (Ausubel et al., J. Wiley & Sons, Inc., Current Protocols in Molecular Biology). , New York, NY, 1992).

4) Embedding yeast DNA in aearose beads

YAC clone strains were streaked onto AHC agar plates. The individual pink colonies taken from the plates were grown at 30 ° C overnight in 5 ml of YDP medium and incubated for an additional 24 hours, increasing the volume to 100 ml. Yeast cells were embedded in agarose beads by the method of Overhauser and Radic (Focus, 9 (3). 8-9, Bethesda Research Laboratories, Inc., Gaithersburg, MD, 1987) as follows: cells harvested from the culture by centrifugation in 20 ml of SE buffer (75). mM

· · ·

NaCl, 25 mM NasEDTA, pH 8.0) was washed twice and resuspended in 4 ml SE buffer. The cell suspensions were transferred to 125 mL Erlenmeyer flasks and heated to 45 ° C. Low-melting point agarose (1% in SE buffer) and mineral oil suitable for genomic DNA were independently heated to 45 ° C and placed in a 100ml ice-cold SE buffer and beaker with ice on a magnetic stirrer, and the mixer was set at medium speed. In each flask, 5 ml of agarose was added to the cells and the resulting mixtures were mixed.

The flask was then treated with 20 ml of mineral oil and vigorously stirred for 30 seconds to emulsify and immediately poured into a beaker containing ice-cold SE buffer. The beads formed within five minutes. The mixtures in each flask were transferred to several 50 ml centrifuge tubes and centrifuged at low speed to separate the aqueous and oily phases. The excess oil was removed and the residue was further centrifuged. The residual oil, SE buffer and floating beads were removed and the pelleted pellets (5-10 mL) were washed three times with SE buffer. The inside of the tubes were wiped to remove traces of oil, the beads were collected in a tube and resuspended in one volume of SE buffer and the cells were treated with 0.5 ml of 2-mercaptoethanol and 10 mg of freshly dissolved yeast lytic enzyme per 10 ml.

E / g, ICN) was digested at 37 'C for 2 hours. The beads were then centrifuged as above in 1% (w / v) sarcosyl, 25 mM NasEDTA, pH 8.0 and 50 µg / ml proteinase K in 20 ml at 50 ° C. incubated overnight. The supernatant was removed and the beads were washed with 20 mL of TE buffer containing 0.1 mM phenylmethylsulfonyl fluoride (PMSF), followed by two more washes with TE buffer.

5) Generation of YAC DNA with PFGE

A 0.6 cm thick 1% agarose gel (in 0.5X TBE) was poured into a 20 cm wide and 14 cm long gel form and 2 or 3 preparative wells were formed on the gel sheet. Low melting point agarose beads containing YAC DNA were filled into the wells and the wells were sealed with low melting point agarose. Yeast chromosomes in 0.5X TBE, 14 'C, 6 V / cm field field, with a switching time of 60-120 seconds, 120 ° inclination BioRad CHEF-DR III

PFGE was separated by 24 hour electrophoresis. The gel was stained in 0.5X TBE containing 1 ng / ml ethidium bromide for 30 minutes and the chromosomes were exposed to UV light. Slots 5-7 mm wide were cut on the gel parallel to and before each of the YACs to be isolated, and the gel was returned to its base. The excess buffer and gel pieces were soaked and the slots filled in 0.5X TBE with 1% low melting agarose (InCert, BioRad), which was pelleted. The gel was returned to CHEF-DR

III and equilibrated to 14 'C. The PFGE has a 180 second constant switching time of 4 hours

performed. The YAC bands were visualized by UV irradiation and excised from the low melting point gel.

The gel slices were equilibrated twice with IX β-agarase buffer (New England Biolabs; NEB), removed, and thawed at 65-70 ° C for 30 minutes. The thawed gel slices were cooled to 40 ° C and incubated with 5 units / g of β-agarase I (NEB) for 1 to 2 hours per weight of agarose, then cooled on ice and centrifuged to remove undigested agarose. Supernatant with excess TE buffer

It was poured onto Centricon 100 filters (Amicon) and centrifuged at 500 x g for 30 minutes to concentrate and purify the YAC DNAs. The resulting ca. 80 µL preparations were concentrated to 50 µL using Speed-Vac and the final supernatant was recovered.

YAC DNA (about 50 ng) was digested with BglII and standard methods (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 1.98-1.104, 1989). It was ligated into BamHI-digested pBluescript vector (Stratagene). The ligation mixture was repeatedly digested with BamHI to reduce non-recombinant background and to promote blue-white selection using X-gal and IPTG

DH10B was transformed into E. coli strain (GIBCO-BRL). White colonies plasmids for use as single copy probes of HindIII-digested human genomic DNA

screened (Sambrook et al., supra) and mapped on somatic cell hybrids and YAC clones as follows.

6) Biotin labeling of YAC DNA

Isolated YAC DNA (10-20; 1) was labeled with biotin (BioPrime kit, BRL) in the presence of 50 µl of biotinylated dATP with random primer extension as described in the kit. To confirm successful labeling, 5 µl of the reaction product was run on agarose gels and the faint spot was visualized by ethidium bromide and UV irradiation or by copying DNA onto a nylon membrane according to standard methods. The membrane was blocked similarly to Western blot and alkaline phosphatase conjugated directly to streptavidin was added without primary or secondary antibodies. The biotin-labeled DNA patch was visualized by BCIP / NBT substrate reaction.

7J_QligQnuklecf.idQ.k_linkers_ and PCR reaction

CGATCTAGACCAGCACAATGG synthesized 5'-3 '(primer 1) and 5 ^J -CCATTGTGCTGGTCTAGATCGCACA-3' (primer 2) oligonucleotides. Primer 2 with ATP and T4 kinase

5'-phosphorylated (37 'C, 30 minutes), heated to inactivate the enzyme, and equimolar to 1.

primer hybridized to provide the following link:

V «· · - - ··· * · '' **

CGATCTAGACCAGCACAATGG 5'-3 '

ACACGCTAGATCTGGTCGTGTTACC-3'-P-5 '

Xbal BstXI which is blunt-ended or phosphorylated at one end and non-self-adhesive at the other. DNA fragments flanked by these linkers can be amplified by PCR using primer 1.

8) Amplifiable. development of short, nonfree cDNA libraries

From tissues and cells, TriReagent (Molecular Research

Center, Inc.) according to the manufacturer's instructions

RNA was isolated. PolyA * RNA was selected from total RNA, biotinylated oligo-dT primers and streptavidin-conjugated paramagnetic particles (PolyATtract kit, Promega). Double-stranded cDNA was prepared from poly-A * RNAs and a sample of total RNA using random primers and M-MLV reverse transcriptase (RiboClone cDNA synthesis kit, Promega) according to the manufacturer's instructions.

Finally, blunt-ended cDNAs were obtained by T4 DNA polymerase. The cDNA prepared from whole RNA was set aside for later use as a probe for ribosomal DNA (rDNA). Excess linkers (see above) were ligated with T4 DNA ligase to poly-A * derived cDNAs. In a volume of 100 µl approx. 500 ng of cDNA (1-5) was amplified using primer 1 and other (standard concentration) PCR components. The PCR was performed with the following cycles:

• «Ε · * · · · · · · ν · • *« · · · · · · · ·

- 65 (95 ° C, 2.5 min) -> (94 ° C, 40 sec; 60 ° C, 40 sec; 72 ° C, 2.5 min) X 20 -> (72 ° C, 10 minute). The PCR products were purified on Wizard PCR Prep spin columns (Promega); elution was performed with 50 μΐ 0.5X TE buffer. The amount of DNA was determined using a DNA Dipstick (Invitrogen). Typically, 500 ng of purified product was obtained per 100 µl reaction volume. Amplified cDNAs were analyzed by agarose gel electrophoresis and ethidium bromide staining; approx. At 500 bp, a broad band of maximum intensity was obtained.

&.) "Blocking Repetitive Sequences of cDNA

The purified, amplified cDNA (1-2 µg) was mixed with an equal weight of Cotl DNA (GIBCO-BRL) and the reaction volume was adjusted to 80 ng / ml with 120 mM NaPO 4 buffer (pH 7) (e.g. χ / L cDNA was concentrated to 21 µl using SpeedVac, to which 1 χ / L Cot 1 DNA and 3 μ 3 1 M NaPO4 buffer (pH 7) was added (the presence of TE was not taken into account). The reaction mixture was layered with mineral oil and heated for 10 minutes at 100 ° C for denaturation and then incubated at 60 ° C for 20 hours (Cot = 20).

10) Hybridization of cDNA to YACs

With slight modifications to the hybridization, Morgan et al.

(1992). The biotin-labeled YAC DNAs (100 µg or about 10 µl of the labeling reaction mixture per hybridization) were heat denatured and filled with blocked cDNAs (1 µg except Cot 1 DNA) and 2 ml of 1 mM NaPCU buffer (pH 7) on a Centricon 100 filter. and approx. It was centrifuged at 1000 x g for 25 minutes. Wash with phosphate buffer and collect the residue (60-80 μl) in microcentrifuge tubes. The volume of hybridisation mixtures in SpeedVac was approx. It was reduced to 5 µl to give a concentration of 120 mM NaPO 4 (pH 7) and 1 mM EDTA (pH 8), and ca. A DNA concentration of 160 µg / ml (excluding Cot 1) was obtained (e.g., 7 µl)

1.1; ug). The reaction mixture was supernatant with mineral oil and incubated at 60 ° C for 60 hours (Cot = 120).

11) Capture, amplification, and cloning of selected cDNAs

The streptavidin-conjugated paramagnetic particles (Promega) were pre-washed with IM NaCl containing TE buffer and then incubated in 200 μΐ TE buffer containing IM NaCl at room temperature for 15 minutes with complete hybridization reaction mixture. The particles were collected by magnetic means and the supernatant was removed. The particles were washed by incubation for 15 minutes in 200 μί 0.1Χ SSC containing 0.1% SDS; twice at room temperature, three times at 60 'C, with magnetic collection between each wash. Bound cDNA was eluted from the particles with 100 μl of 50 mM sodium hydroxide for 15 minutes, washed with 100 μl of 1 M Tris-HCl buffer, pH 7.5, and placed in clean tubes. The supernatants were desalted and concentrated in 20 µl TE buffer using NaI and silica gel (Geneclean kit, Bio 101) according to the manufacturer's instructions. These cDNAs were amplified as described for the original libraries except that 5 µl of the templates were used and the PCR was performed for 30 cycles. The resulting products were purified and blocked with Cot 1 DNA in the same manner as described above. The cDNAs selected in the second round were captured as above and amplified again. The final PCR products were cloned directly into a T vector (Novagen) and transformed into Teta + Amp LB agar plates (for blue and white selection according to the kit instructions in the presence of X-gal and IPTG).

12) Screening of recombinant clones

The white colonies (about 75 / selection) were plated on Amp agar plates with duplicate toothpicks; one plate was covered with a circular nylon membrane and the other was left free. A unique pattern of short stripes and dotted lines was created to easily identify duplicate colonies on the plates. After overnight growth at 37 'C, the plain (original) plate was removed, the filter was removed from the other plate, and the filter was subjected to telephybridization screening (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring).

Treated with SSC. The (above link,

Harbor Laboratory, Cold Spring Harbor, NY, p. 1.98-1.104, 1989) with 10% SDS, denaturation, neutralization and 2X filters were dried, pre-washed 1.101. p.), pre-hybridized in 0.05 X BLOTTO, and then sequentially or simultaneously hybridized with nick-translated whole human DNA (Alu probe) and random-primed rDNA (ribosomal DNA probe). After washing and autoradiography, colonies that were negative for hybridization were removed from the original plate for further characterization. Mini DNA preparations were prepared and analyzed by BstXI (or HindIII + EcoRI) digestion and agarose gel electrophoresis. Inserts between 250 bp and 500 bp were excised from low melting point agarose gels and radiolabeled using random priming. The probes were hybridized to filters containing HindIII digested DNA from human YAC clones and triplets of human chromosome 8, human-mouse hybrid and mouse genomic DNA, so that human

Identify single copy probes localized on chromosome 8.

13) YAC Content Mapping

932_e_9, 767_h_8, 802_f_ll, 832_a_10, 821_f_7 and 885_c_8

YACs approx. 30 random subclones (Table VI) were isolated and mapped on Southern human chromosome 8 with the local region DNA of a human chromosome 8 x mouse hybrid cell line (Wagner sel or hybridization with a and m. Genomics, £ 1), 114-125, 1991). These rehearsals are • ·

- 69 - .....

Based on hybridization to HindIII-digested YAC DNA biotypes, we mapped within the YAC contig (note; Ele = E1). From the YACs 766_a_12, 843_g_3 and 932_e_9 respectively, three YAC end clones (YE766, YE843, and YE932) were isolated by the inverse PCR described above, and these were located on chromosome 8 and the YAC '' contig mentioned above. We mapped.

The CEPH megabase YAC library (approximately 22,000 clones) was screened by PCR (Figure 5, Table II) with primers for six single tandem repeat polymorphisms (STRP) and four RFLP-containing loci (Figure 5, Table II). About 30 YAC clones were identified. Examination of AluPCR and fingerprinting overlap tables (Cohen et al., Science, 250, 245-250, 1993) yielded additional clones. These clones were incorporated into the YAC map after testing for their STS content. The map was constructed from 31 markers (10 screening STSs, one more published STRP (D8S206), two expressed sequence tags (D8S294E and D8S297E) (Adams et al., Natur, 355. 632-634,

1992), 15 random YAC subclones and three YAC end clones (III.

Table A)) was used. The PCR and Southern biot methods were used sequentially to minimize false positive and negative results. The YAC map is based on the chromosomal location of the MSR and LPL (lipoprotein lipase) gene (8p22) (Matt et al., Cytogenet. Cell Gene, Q2, 45-46, 1993; Emi et al., J. Biol. Chem. 268: 2120-2125 (1993) and Wagner et al. (Wagner et al., Genomics, 10, 114-125, 1991) (Table III) at intervals A or B (where interval A is telomere relative to intevallus B) were linked to cytogenetic maps.

One large contig was formed from thirty-six YACs (Table IV, Figure 5). Poor STS content mapping dictated the unique order of the ten original screening markers:

telomer - D8S26 - D8S511 - D8S549 - MSR - D8S254 - D8S233 D8S261 - D8S21 - LPL - D8S258 - Centromer. Cosmid CI8-245 (D8S335), which contains a centromere border for one or more allele loss regions (Ohata et al., Genes Chromosome. Cancer,

Z, 85-88, 1993; Emi et al., Genes Chromosome. Cancer, Z,

152-157, 1993; Fujiwara et al., Cancer Res., 53.

1172-1174 (1994)) was not available at the Japanese Cancer Research Resources Bank and could not be applied to our map. This cosmid is tightly coupled to ΛΡΖ (and is obviously centromeric with respect to it) (Emi et al., J. Bioi. Chem., 268: 2120-2125, 1993a; Emi et al., Genomics, ± 5, 530- 534, 1993). The other RFLP marker, CTSB (cathepsin B), mapped to the 8p22-p23.1 region (Fong et al., Hûm. Gene. 10-12, 1992), was inserted into the hybrid A interval (MacGrogan et al. ., Genes Chromosom. Cancer, 1 £>, 151-159, 1994), and was omitted from the physically mapped D8S26 to D8S258 region due to the absence of this series of YAC clones (data not shown). Due to the lack of a sufficient number of YAC terminals, some additional markers (such as D8S206, D8S294E, and D8S297E) could not be clearly ordered. Incidentally, we discovered that the E1 probe (a random subclone of YAC 932_e_9) detected a HindIII RFLP with two alleles (12 kb and 8 + 4 kb) in human DNA.

The YACs were subjected to two types of rearrangements (chimerism and internal deletion) that could influence different aspects of physical mapping. Chimerism does not affect our mapping based on STS content and the derived order of loci, since all markers were independently mapped to chromosome 8. Against the effects of internal deletion, many confused, incremental probes and high contig depth (redundancy) provided protection. For example, in YAC 767_h_8, covering probes E15, YE766, E1, E3, MSR and E20, a large intermediate deletion was considered to maintain at least six other units of YAC. On the other hand, this apparent deletion provided two additional endpoints for deciding the order of two marker pairs.

Of the 97 irradiated hybrids, 17 retained one or more of the six genetic markers tested; the retention frequency for each locus was 0.12-0.17. In ten of the 17 hybrids, at least one breakpoint was detected. Distance estimates between locus pairs were made with the TWOPOINT program (Table IV). The marker sequence suggested by YAC mapping was tested by four-point (FOURPOINT) analysis of irradiation hybrid data (Figure 1). The * · * · · · · ·

The calculated odds of 72 inversions were greater than 1: 1000 for all adjacent markers except D8S261 and D8S21. Markers D8S261 and D8S21 were isolated based on one breakpoint only, or a calculated theta value of 0.05 or 5 cRaysooo. The order of the markers was thus the same in the genetic, YAC and irradiation hybrid maps. The distance between D8S26 and LPL on the genetic map is approx. It was 9 cM, while on the irradiation hybrid map it was 90 cReooo, which is approx. Refers to a ratio of 10 cRbooo / cM.

14) High-Range Restriction Mapping Selected DNA fragment (Table VII) was isolated and mapped on human chromosome 8 and YAC region. Selection was performed with YACs 932_e_9, 802_f_ll, 821_f_7, 877_f_2 and 946_c_9. A large-scale restriction map of a portion of the 8p22 region was prepared (Figure 8). The map shall be at least 25, the map of VI. and VII. includes a trial from Table. YAC DNAs are restricted to various rare restriction sites (Ascl,

Miul, NotI, Nrul or Sfil) was digested and isolated with PFGE as described above. Southern biot analysis was performed to identify restriction fragments containing each probe. The map was constructed using standard mapping methods (partial and double enzymatic digestion). One noteworthy discovery was that it was received from Dr. Y. Nakamura * · «·

Cosmid CI8-2644 was located telomeric and not centromeric from the MSR gene as in Fujiwara et al. (Fujiwara et al., Genes Chromosome. Cancer, IQ, 7-14, 1994).

15J_Δ_homozygote_delete_mapping_az_N2_tumor was examined by selected analysis.

DNA from a single metastatic prostate tumor with a homozygous deletion of MSR (Bova et al., 1993, Cancer Rés. 6, 3869-3873) was used to map the extent of the deletion using a number of newly isolated genomic and cDNA probes using Southern biot

For this tumor, the fully deletion probes (shown in bold in Figure 8) begin with MSR and go through the telomeric direction 877-15 and cCl8-2644. At the centromeric and telomeric ends, Ele and 877-13 are the closest remaining loci. Within the mapped restriction fragments, the minimum and maximum homozygous deletions for this tumor were determined to be 740 kb and 920 kb, respectively, based on the positions of the lost and remaining loci (Figure 8). The target tumor suppressor gene is believed to be located within this region and is inactivated by deletion. N33 was located in this region (Figure 8).

Significantly, the cCI-2644 probe was mapped near the telomeric deletion boundary, suggesting that · · ··· «··

74 that the common region of allele loss in colorectal cancer, liver cancer, and lung cancer (Fujiwara et al., Genes Chromosom. Cancer, IQ, 7-14, 1994) overlaps significantly with this region of homozygous deletion. As such, any gene within the homozygous deletion may be relevant to these cancers. The size of the allele loss region described in that article should be larger than what was found (600 kb) and larger than the homozygous deletion in this tumor, i.e. the homozygous deletion defines the smallest known critical region containing the putative tumor suppressor gene.

16) Sequence analysis of selected cDNA fragments

VII. Sequencing of selected cDNA probes listed in Table 1A revealed the following facts: 1) P3 and P28 are identical to the 5 'end of the MSR cDNA sequence, while P34 is derived from the 3' untranslated region of MSR. Isolation of fragments of known genes from the region indicated that the cDNA selection procedure was successful. 2) J28 overlaps with P27, L3, and N28 and contains a partial open reading frame (ORF) encoding a new predicted amino acid sequence (of which no close relative is found).

GENBANK or PIR). Other parts of this DNA sequence (based on random cDNA sequencing) were nearly identical to

Sequences deposited in GENBANK. 3) J12 contains sequences 95% identical to 2C

human protein phosphatase alpha subunit, a gene that has not previously been localized. Sequence differences were not conservative and we assumed that J12 represents a closely related gene or pseudogen. The J12 locus was then cloned and sequenced at the genomic DNA level and found to be lacking introns and containing a single-base insertion that could destroy the conserved ORF. By trial, it was concluded that J12 is a pseudogen of human protein phosphatase alfa type 2C. 4) L21, N21, N33, N36 and P14 overlap and C.

elegans has a very high degree of homology to the predicted gene identified by random sequencing of a genomic cosmid or cDNA clone (SWISS-PROT P34669; GENBANK M88869, T01933, L17337; PIR S44911). The function of the C. elegant gene is unknown.

17) Cloning and sequencing of longer N33 cDNAs

Based on preliminary expression data (see below), a N33 cDNA clone selected as a probe was used for screening the placental lambda phage cDNA library (Clontech). The LambdaN33C clone was isolated and the 1.3 kb EcoRI-EcoRI insert was subcloned into the pBluescript vector to give plasmid pBS-N33C (7). Sequencing identified a 1342 bp EcoRI site-inserted insert (9 and

10), which is a long one (from nucleotide 158 to 1202).

nucleotide) contains an open reading frame (Figure 11). Based on this sequence, the oligonucleotide primers N33GEX-f and N33GEX-r were synthesized (Figure 10) and used to amplify the N33 mRNA segment by RT-PCR of placental mRNA. Two closely spaced approx. A specific band of 950 bp was detected with a ratio of 1: 2 (upper band: lower band). To further characterize these bands, RT-PCR products were cloned into pGEX-2T vector (Pharmacia) and two clones (A4 and A5) were isolated. Clone A4 was collinear with plasmid pBS-N33C (7), whereas clone A5 (compared to other clones) lacked 1186-1250. nucleotide sequence (65 bp). Consequently, it was assumed that clones N33C (7) and A4 represent the longer (Figure 1) mRNA, whereas clone A5 represents the shorter (Figure 2) mRNA. The open reading frames encoded by the two shapes are identical through 343 residues, only encoding four or five different amino acids at the C-terminus.

Another feature of the sequences is that the N33C (7) clone contains nucleotide 1252, while the A4 and A5 clone contains thymine (Figure 10). This change does not affect the open reading frame of Form 1 encoded by clone N33C (7) since

It is located after stop codon 1. It is not known whether this difference represents a natural polymorphism or an artificial cloning product or is due to one or more mutations in clones.

The predicted polypeptide N33 clone both highly ο * < »· · * was homologous (ρ ^<_1 e °°) ZK686.3 C. elegans predicted cDNA. The alignment was optimized by inserting four gaps in the N33 sequence, which was approximately one-third between the human and the C. elegans gene. 42% resulted in the same radical (Figure 15). The three 12-21 radical subregions of N33 (eg ⁸¹ PRNYSMIVMFTALQP) show 90% identity with ZK686.3, indicating highly conserved functional motifs. On the other hand, the C. elegans gene lacks radicals homologous to the first 35 amino acids of N33, while N33 (relative to ZK686.3) lacks approximately 16 amino acids inside the sequence (Fig. 15).

figure). This suggests that there is considerable evolutionary divergence in the transcriptional units. N33 showed no closer affinity with other sequences in the collections of GENBANK, PIR, SWISS-PROT, or EMBL.

18) Its expression in tissues, tumors, and cultured cells

Contains mRNA from several different human tissues

Different selected cDNA clones were used as probes for Northern biotypes (Figure 16). In most tissues (heart, placenta, lung, liver, pancreas, prostate, testis, ovary, and colon), the N33 probes contain approx. 1.5 kb mRNA was detected. Expression in spleen, thymus, small intestine and peripheral lymphocytes was low. Expression detected with clone J2 was mostly observed in skeletal muscle and testis,

The two signals detected by clone J28 were predominantly in the placenta, testis and ovary. Expression of the tumor suppressor gene is primarily expected in tissues from the targeted tumor types, so that N33, not J2 or J28, has an expression pattern that is consistent with the suppressor gene of prostate, colon, and other cancers.

Northern analysis of mRNA from tumor cell lines showed N33 expression in three of three prostate cell lines, three of three lung cell lines, and only one of 14 colon and colon cancer cell lines (Figure 17). To determine the significance of this fact, the mucosa of the colon sample (precursor tissue of the colon adenocarcinoma) was excised from the colon wall and tested for N33 mRNA and specific expression was observed (Figure 18, column 5).

Small amounts of total RNA were extracted from nine fresh prostate cancer samples (7 primary tumors and 2 metastases). To reduce the presence of non-tumor cells in the primary samples, cryomicrotomy sections were used, but some level of infiltrating cells (usually about 20%) was unavoidable. Due to the limited amount of RNA available, RT-PCR with N33-specific primers was used to quantify N33 expression. To control RNA quality and cDNA synthesis from Rb, p53 and G3DP genes • ·

79 primers were used. Significantly reduced expression of N33 was observed in three cases (Figures 3, 6 and 9).

column); column 6 RNA was taken from the N2 tumor to confirm the proper functioning of the assay. THE

Columns 3 and 9 RNA were taken from primary tumors in which a certain amount of the N33 message is expected to be derived from non-tumor cells. These findings, together with the absence of expression in colon and rectal cell lines, supported the notion that as a prostate and colorectal cancer suppressor gene

Identify N33.

Mechanism of 19J_A_K3J2_expression gene termination in tumor cells and tissues

The basis for the lack of N33 expression in colon and rectal tumor cells and in prostate cancer tissues is the result of unknown but presumably somatic mutations (eg mutations affecting mRNA expression or stability), methylation changes or other epigenetic regulatory factors. While a prostate tumor is known to have a large homozygous deletion in the 8p22 band, the genetic status of the other primary and metastatic prostate and colorectal cancers has been determined by several methods. (1) Southern blots of tumor DNAs are hybridized with N33 cDNA probes and other 8p22 markers to detect homozygous deletions or genetic rearrangements. (2) the structure of the PTSG locus is determined at the genomic DNA level by cloning and sequencing using standard techniques. For example, the P1 clone containing the N33 gene is isolated and sequenced with primers from the cDNA sequence, detecting exon / intron boundaries and flanking intron sequences. PCR primers were synthesized to amplify each exon. Subsequently, tumor DNA is amplified and sequenced to detect the presence of small mutations or point mutations. (3) The presence of LOH is determined by comparing the alleles at the polymorphic markers in tumor DNA from each patient and normal DNA. (4) Southern biotypes of tumor DNAs digested with methylation-sensitive enzyme and non-methylation-sensitive enzyme are compared for specific DNA methylation assays. For example, DNA digested with Mspl and Hpall are compared. The VHL gene (a tumor suppressor gene for renal cell carcinoma) is known to in some cases be sympathically inactivated by methylation (Herman et al., Proc. Natl. Acad. Sci. USA 21, 9700-9704).

1994).

20) Improved tools for detecting N33 inactivation

Detection of N33 expression or lack thereof in tissue sections can be significantly simplified by immunohistochemical detection of N33 polypeptides. One form of the N33 protein produced reactive antibodies as follows: At the C-terminus of N33, a 16 amino acid conserved peptide (Figure 20) was coupled to KLH and used to immunize rabbits. After six weeks, rabbit blood serum was collected and the antibodies were affinity purified on a peptide column. The resulting polyclonal antibodies were tested by Western biot analysis of recombinant N33 fusion proteins expressed in E. coli (Figure 21). As noted above, clones A4 and A5 (partial N33 proteins fused to the glutathione-S-transferase gene in the pGEX-2T expression vector) were obtained, which represent the mRNA of either type 1 or form 2, respectively. Protein expression was induced by IPTG and cell lysates were separated by polyacrylamide gel electrophoresis (PAGE) and then transferred to membrane. Western biotypes were incubated with affinity purified polyclonal anti-N33 peptide antibody and the reactive bands were visualized using alkaline phosphatase-conjugated secondary antibody and NBT / BCIP substrate. In A4-containing induced cells, an approx. A 57 kD fusion protein was detected, whereas cells containing A5 or other clones were not present.

1) Fusion of the YAC clone with the hvgrcmicin resistance gene

Example 3

YAC intake in mammalian cells

The plasmid vector pLUSH (see map) containing the telomeric end segments of the YAC4 vector, bacterial Kan ^R gene, yeast Lys2 auxotrophy gene and mammalian hygromycin resistance gene (hygro ^R gene) (see map) was provided by Scripps Research Institute. PLUSH DNA was linearized by SalI digestion and linearized with 5-10 µg of the transformed YAC-containing yeast cells using an alkaline cation transformation kit (Bio 101, Inc.) according to the manufacturer's instructions. We used DNA. Cells were plated on triple drop-out medium (trp-lysis- ^_ ) to select clones containing both YAC and the conversion vector. Colonies were harvested after 3-4 days and grown overnight in 2 ml of YDP medium. Yeast DNA was prepared and tested for PCR homologous integration of pLUSH using primers 5'-CTTGAGATCGGGCGTTCGACTCGC-3 'and 5'-TGAACGGTGATCCCCACCGGAATTG-3' (Hermanson et al., Nucl. 4943-4948 (1991). Reactions were performed in volume of 100 ng of each primer using standard buffers + 10% DMSO.

The reaction conditions were: 95 ° C, 2.5 minutes; followed by 35 cycles (95 ° C, 40 seconds; 60 ° C, 40 seconds; and 72 ° C, 2 minutes); finally 72 ° C for 10 minutes. Homologous integration of the conversion vector results in amplification of the 1855 bp band (Figure 6). The presence of the hygro ^R gene was confirmed by Southern biot analysis of yeast DNA using a radiolabeled hygromycin gene probe (Figure 7).

2) Spheroplast fusion and selection of transformants

There are several methods for introducing YACs into mammalian cells. In the present invention, Silverman et al. (Mol. Cell. Biol. 12: 5469-5478 (1993)) used a spheroplast fusion method. Short; yeast cells cultured by standard methods were pelleted, washed, and resuspended in isotonic medium, and the cell walls were digested with yeast lytic enzyme to form yeast spheroplasts. The resulting spheroplasts were layered on top of seeded cultured mammalian cells (e.g., NIH 3T3 cells or human tumor cells) (50: 1 by volume) and incubated with polyethylene glycol 1500 (BoehringerMannheim) for 2 minutes at room temperature to induce fusion. Cells were diluted in tissue culture medium, incubated for 48 hours, and selection was started with 300 pg / ml hygromycin. The hygromycin-resistant colonies are ca. After 3 weeks they were clearly visible.

3) Genetic analysis of transformants

The presence of significant amounts of the YAC in question was confirmed by PCR amplification or by detection of Southern biot of genetic markers known in YAC (Table VIII). THE

Polymorphic markers were used to introduce YACs into human cells; allele sizes in YAC differed from alleles already present in the parental cell. These methods can also detect the retention of only portions of the introduced YACs and use the relationship between retained portions of YACs with phenotypic properties to localize a tumor suppressor activity within the YAC-covered subregion.

4) Phenotypic analysis of transformants

The phenotype of tumor cells following insertion of tumor suppressor genes can be evaluated by joint assays, whether the insertion of the gene by microcell insertion, retroviral mediated gene insertion, transfection, cell fusion, etc. happened. To evaluate tumor suppressor activity (and hence vector and / or gene insertion), we can compare the in vitro growth rate of modified and native cells (based on ³ H-thymidine incorporation), growth of transformants in soft agar and tumor formation in nude mice.

The examples so far have been described by way of illustration and not by way of limitation. It is to be understood that various modifications of the invention are possible without departing from the scope of the invention.

Example 4

Testing for tumor suppressor activity of PTSG

PTSG tumor suppressor activity was evaluated in vitro in cell culture conditions and in a nude mouse model. For the evaluation of PTSG tumor suppressor activity, the 13 N33 colon cancer cell lines (SW480, SW837, SW1417, HT-29, SW403, LS174T, DLD-1, CACO-2, EB, SK-CO-1, RKO, HCT116 and C0L0) are shown in Figure 17. -302) can be used.

The effect of PTSG on proliferation of the above cell lines was evaluated following expression of PTSG using the adenovirus expression vector. ACN is a control adenoviral vector lacking a qDNA insert, whereas AC-PTSG is an adenoviral vector expressing PTSG products under the control of the human CMV promoter.

In vitro transcription and translation of PTSG

Plasmid pBS-N33C (7) was tested in a TNT Coupled Reticulocyte Lysate System (Promega, Madison, Wisconsin) for its ability to produce 39 kD protein. The T7 promoter in the Bluescript vector (Stratagene) allows transcription and translation of PTSG · · · in rabbit reticulocytes. One µg of mini-lysate DNA per reticulocyte reaction was used and incubated at 30 ° C for one hour. 10 µl of the reaction mixture was mixed with loading buffer and electrophoresed on a 10% polyacrylamide gel (Novex) at 165 V for 1.5 hours. The gel is dried and exposed to film overnight.

Preparation of adenoviral vectors containing PTSG

For the preparation of recombinant adenoviruses, the pBS-N33C (7) insert was recovered by digestion with EcoRI and inserted into the EcoRI site of pcDNA3 (Invitrogen) to give pcDNA3-N33 clones. The orientation of the insert was tested by KpnI digestion and antisense orientation clones were used in pcDNA3 relative to CMV. The

To form adenovirus 1, pcDNA3-N33 was digested with XbaI and BamHI and the insert inserted into the XbaI and BamHI site of the pAdCMVb vector to give plasmid pACN33-1. To generate adenovirus 2, plasmid pBSN33C (7) was digested with AvalII and EcoRI and the 5 'half (nucleotides 1-616) of the N33 insert was purified. Clone A5 was also digested with AvalII and EcoRI to release 3 'of the N33 Form 2 insert (from nucleotide 617 to EcoRI site). The two genes were ligated and cloned into the EcoRI site of pcDNA3. The orientation of the reconstructed insert was again tested by KpnI digestion and sequencing, then an antisense orientation clone was digested with XbaI and BamHI, and the insert was cloned into pAdCMVb vector as described above. to obtain plasmid pACN33-2.

The above plasmids were linearized with Nrul and co-transfected with a large fragment of a Clal-digested mutant dl309 (Jones and Shenk, Cell, IS, 683-689, 1979; herein incorporated by reference) using a calcium phosphate transfection kit (Stratagen). . Viral plaques are isolated and recombinant plaques are identified by digestion with restriction enzymes and PCR using primers against the PTSG cDNA sequence. The recombinant virus is further purified by borderline dilution and virus sections are purified by standard methods (Graham and van Der Erb, Virology, £ 2, 456-457).

1973; Graham and Prevec, Manipulation of Adenovirus Vectors, in: Methods in Molecular Biology, Number 7, Gene Transfer and Expression Protocols, Murray, E.J. (ed.), The Humana Press Inc., Clifton, N.J., Z, 109-128, 1991; both of which are incorporated by reference).

To ensure that the PTSG vector expresses a protein of sufficient size, the responding cancer cell lines are infected for 24 hours with control or PTSG-containing recombinant adenoviruses (increasing multiplicity of infection (MCI) per unit of viral plaque-forming units). Cells were then washed once with PBS and lysed in buffer (50 mM Tris-HCl [pH 7.5], 250 mM

NaCl, 0.1% NP40, 50 mM NaF, 5 mM EDTA, 10 µg / ml aprotinin, 10 µg / ml leupeptin and 1 mM PMSF). Cellular proteins were separated by 10% SDS-PAGE electrophoresis and then transferred to nitrocellulose membranes. The membranes were incubated with sheep anti-mouse IgG conjugated with anti-PTSG antibody followed by horseradish peroxidase. The exact expression of the PTSG protein is visualized by exposure to a Kodak XAR-5 film using a chemiluminescence (ECL kit, Amersham).

In vitro

N33-negative colon cancer cells (selected from the cell lines listed in Figure 17) were supplemented with Kaighn's F12 / DME supplemented with 1 x 10® cells / 100 mm dish with 10% FBS and 0.2 IU insulin (Sigma). medium (Irvine Scientific). The dishes were incubated at 37 ° C overnight with 7% carbon dioxide. The next day, the cells were placed in 10 ml of growth medium and infected with ACN control virus lysate (MO10) or AC-PTSG virus lysate (MOI 10) and incubated at 37 ° C. After three days, the medium was removed and the cells were fixed with acetic acid: methanol (1: 5). The cells were stained with 20% methanol-0.5% crystal violet for 30 minutes and then rinsed with tap water to remove excess dye.

A thymidine incorporation assay was also used to evaluate the effect of PTSG on cell proliferation. Short;

Approximately 3 x 10 ³ cells were placed in each well of a 96-well plate (Costar) and the cells were incubated at 37 ° C overnight at 7% carbon dioxide.

DME: Serial dilutions of ACN or AC-PTSG in F12 / 15% FBS / 1% glutamine and cells were infected with each adenovirus at a multiplicity of infection (MOI) of 10 and 100 (4 wells of each MOI). Twenty-four hours after infection, half of the medium was changed and repeated every 48 hours until the cells were harvested. 18 hours prior to cell harvesting, 1 µCi ³ H-thymidine (Amersham) was added to each well. Cells were harvested on glass fiber filters 5 days after infection and the incorporation of ³ H-thymidine into cellular nucleic acid was detected using a liquid scintillator (TopCount ^R , Packard Instrument). For each MOI, cell proliferation (cpm / well) is expressed as a percentage of the average proliferation of untreated control cells.

Ex carrier gene therapy

To evaluate the effect of PTSG expression on tumor formation, the above tumor cell lines were tested in a nude mouse model for tumor formation. Approximately 2 x 10 ⁷ cells were placed in T225 flasks and treated with sucrose buffer containing ACN or AC-PTSG adenoviruses (MOI = 3 or 30). After an overnight infection, cells were harvested and approximately 10 ⁷ cells were injected subcutaneously in the left and right flanks of BALB / c mice (four mice per group, previously injected subcutaneously with 176-estradiol). ACN-treated cells were injected into one of the mice and AC-PTSG-treated cells in the other flank (thus each mouse serves as its own control). As a further control of tumor growth, untreated cells are injected into the flank of some mice. Tumor size (length, width, height) and body weight of mice were measured twice weekly. Tumor volume is estimated for each animal by assuming a spherical shape (half of the average tumor size measured as the radius of the suspected sphere).

In vivo tumor suppression by PTSG

Colon cancer cell lines were injected subcutaneously into thymic deficient female BALB / c nude mice. The tumors were allowed to develop for 32 days. ACN (control) or AC-PTSG adenoviruses are injected once into the peritumoral space surrounding the tumor. Tumors after injection

Days 2 or 7 were excised and poly A * RNA was isolated from each tumor. Reverse transcriptase PCR (RT-PCR) was performed using PTSG-specific primers to detect PTSG RNA in treated tumors. Amplification with actin primers serves as a control for the RT-PCR reaction, while a plasmid containing the recombinant (PTSG) sequence serves as a positive control for the recombinant (PTSG) specific band.

In a separate experiment, the cancer cells were injected subcutaneously into the right flank of the mice and the tumors were allowed to develop for two weeks. The mice were then injected twice per week with a total of 8 doses of buffer or recombinant virus into the peritumoral space. Tumor growth, body weight, and survival time are monitored during treatment of control animals treated with ACN and buffer and animals treated with AC-PTSG.

While the present invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications may be made without departing from the scope of the invention. Accordingly, the invention is limited only by the claims.

• ·

- 92 TABLE I

Deletion map of the human 8p chromosome in prostate cancer (Chromosome 8 allele loss in prostate cancer)

locus polymorphisms type . Trial Enzyme Elhelyez- Kedesh cases number LOH / informative cases : all tumor me node tasztázisoki D8S140 RFLP * C18-1 Mspl 8p23.2- -23.3 49 4/28 (11%) 1/6 (17%) D8S201 Microwave oven- satellite Mfcl99 - 8p23 30 3/22 (14%) 1/2 (50%) D8S163 RFLP KSR2 Taql 8p22- pier 50 14/23 (61%) 2/4 (50%) MSR RFLP M8R32 Mspl 8p22 50 20/29 (69%) 3/3 (100% LPL Microwave oven- satellite GZ14.15 - 8p22 45 15/32 (47%) 0/2 (0%) D8S220 RFLP C18-319 Taql 8p21.2- -21.3 51 16/27 (59%) 4/5 (80%) NEFL RFLP NF5.1 Taql 8p21 12 2/6 (33%) no tested D8S194 RFLP C18-277 Mspl 8pll.21- -11.22 51 3/20 (12%) 1/4 (25%) D8S39 RFLP MCT128.2 Taql 8q24 43 2/17 (12%) 0/3 (0%)

* RFLP = restriction fragment length polymorphism

II. SPREADSHEET

Polymorphic loci on the 8p chromosomal arm containing the mapping framework

The locus is Chromosome. Primary Product Hybrid. Ref name inter- sequences size temp. for vallum Type (5 '-> 3') (Bp) (° C)

First D8S26 THE RFLP TAGCTCCTTCGAAACCCTCA 124 60 i-l Second D8S511 THE STRP TGGCAGGAAAAGCTCTCAAT TTGTCCCTGTTGGCACA kb.135 55 1 3. * D8S549 THE STRP TGATTTTTGTGTCCTGAAACTTA AAATGAATCTCTGATTAGCCAAC kb.170 55 1 4th MSR THE RFLP TGAGAGCCAACCTATTTCTACC TTCATCTATTGCATTCC 102 50 2 5th D8S254 B STRP CAAAATTTCAGCATGACAACTG TGCCGGACATACATTAGTGA approx. 70 55 3 6th D8S233 B RFLP TTGTAAACACCACAAGCAGG TTTGAGTAGCCAGAGTCCAG 84 55 H 7th D8S261 B STRP CGTACCATTTCCATCTGCT TGCCACTGTCTTGAAAATCC approx. 135 55 4 8th D8S21 B RFLP TATGGCCCAGCAATGTGTAT CACTGAGGAAGAGGTTGAAG 86 55 1-t 9th LPL B STRP ATCCATCACCAGGTTTGG ATCTGACCAAGGATAGTGGGAT about 130 60 5 10. * D8S258 B STRP CCTGGGTAACTGAGCGAGACT CTGCCAGGAATCAACTGAG about 150 55 4

For the definition of chromosomal intervals (A or B), see FIG. Wagner et al., (1991). All loci were used to screen the YAC kits.

* Sreening was performed in Genethon ¹ Description of the Invention

Within the RFLP trial, STS was prepared as described in the present invention. ² Matsumoto et al., 1990 ³ J. Weber, Personal Communication ⁴ Weissenbach et al., 1992 ⁵ Zuliani and Hobbs., 1990

III. SPREADSHEET

Sequence-tagged sites (STS) used to refine the physical map

Name of the locus / probe

Chromosome.

interval Type

Product Hybridization

Size of Primary Sequences Temperature (5 '-> 3') (bp) ('C)

First D8S206 THE STRP GAAAACCATGGCTGGGTG approx. 130 55 Second D8S294E B EST ACATGCATTAGCACTACCATGC TGACCTGAAATTACAAGGTA 82 55 Third D8S297E B EST AGCAGCTTGACAATCTTAAG CGTAGCTGCAGTTGTCCACG 67 55 4th El * THE random CATTCTGACTACTACTTTCAG TGACACACTTGCCATTTGAT 131 55 5th E3 THE subclone random TTCCATTAGTCCCAGTTGTC GCCTGTTTCATCGAACC 85 55

subclone CCTGGCATTCTTTACCTAGA .:. ··,. · \ - * • · · ··· «« · · · ·

III. TABLE (continued)

The locus / test name Chromosome. interval Type Primary sequences (5 '-> 3') Product size (Bp) hybridization: temperature CC) 6th E15 THE random GTTCTTGCCATGTGATGTG 86 55 subclone GTGGCATCTGCTTCTGG 7th E17 THE random CAAGGCATATCACAACTGC 121 55 subclone GATAATTGAACTGTCACCTCTG 8th E20 B random TGAATTTGCATAGTCTGCAG 107 55 subclone CAGCTCTAACAAGGCTCCTA 9th E31 THE random TCAGGGCCTCTTGCAT 97 55 subclone TGGGAACTTCAAGCATAGG 10th E56 B random TTTGTTGAGGACAAATACCC 170 55 subclone TGTCACGATGAGGATTGTTA 11th YE766 THE YAC end GACTCTTGCCACCTTGTAAA 89 55 AATCTCCAAACCTACTTCTCC 12th YE843 B YAC end AGCAAAGTGATGGTGGTAAC 82 55 GGACTAATTACCTCAGGCCT 13th YE932 B YAC end ATGGAAATGCACGGGA 173 55

CCATTCTGTCCCAATGATC

For the definition of chromosomal intervals (A v. B), see. Wagner et al. (1991). D8S206 (Hudson et al., 1992), D8S294E and D8S297E loci have been previously described; the other STSs were generated by partial sequencing of subcloned probes as described herein.

* Detects HindIII RFLP; EST: Expressed sequence tag.

* · · ·

ARC. SPREADSHEET

• g V) £ O 2 O 2> -Z _ _ to _ in Ο O GJ O Ld z zFz £ oo z z VJ £ VJ £ O ul Ο O Z> zz G 2

Ο ο

Ο Ο Ο Ο Ο Ο Ο Ο ο ο ο V V V V Ο Ο ti ti η η - ű ti - ti ti - - - - - ti ti - ű - ti ti ti ti - - - > OM «» · - rNfNOfiih * - οογνοο - οκ> - - fsrujiûocnr '- —— - - - - - - - VLC - Γ-ΟϊΟ— Λ - LOCOVÍ - - - —— —— —— - - - - -

> - m £ £ ζζζζζζζζζζπ.α? 'Εϋ · ín VJ vi ».«? ·. ·? ·;> ' g £ ^Z ZZZZKZ22ZZÍ2ZZ2 ^^ CD 2 <5 2ZZZ ZZZZZZZZZZZWitfttSZZZ ffl ' VJ Λ »·. ·: ·. '; ·. * - *. v £ o. ™ zz zz ζ zzzz ζ ζ ζΛ ' ^:? α: ·> α-: vj _ω zzzz zz zzzzzzzzzzzzzxlq; q..qA: ^ZZ2 £ £ zzzz z z z z z z z z z CL CL tvxízzz Z ID uj i / j · *. '.? '·' uj .. ··. ·. · .. · <·> ','. · ►- Cft ZZZZ ZZ ΖΖΖΖΖΖΖ Z'Q. &. * NEW flí CL'.Z Ζ Ζ Ζ Z CD VJ ÍN 2 ......... ·. ·. vj kj · · «-. .. · VJ _Λ K) ZZZZ ZZZZZZ ZrCL'CL 0. QQ · ZZZX CD Γ7 ^q <n ZZZZ zzzzz Z Z-CLQ. 0-0. Q.:z ZZ ZZ z v * vj ' n '·· »' ·. '·'>'2<5 zzzz zz 22 ^ 0 .: 2222 ^ 0 {^ 0 :: 22222 ^x >' · ·? ·. ^: . ^ι ί · ..Λ £ 2 Z z zz ζΰ.Γώζ) Μ. ^; β.ΐα ·% ζζζχζζ zm 2 £ zzzz ζζ = ζζζζα · Εο..ζ0.'ι'α. · Ο..ο .: ζζζζζζζζζζζ m VJ '·.: ...; ·. ··>. ··; ·; .Ί -, J3 ZZZZZZXZZZZZZZZZO. 0. 0. Z n_'a.'QÍ CL ¹ Ol. zzz zzz z £ 22222Ζ222ΖΣ2222Ζ10.0 · 2α0.1βια · ΖΖΖ ZZZ Z .2! z zizzzzzzzzzzo.n.tL'QÍi-ii.'ii.'izz ζ z □ 2 2 ζ ζ ζ ζ ζ ζ ζ ζ z za. α. α. ο. ζ.α. α. α.ζ ζ ζ z λΣ2 ζ ζ z Z z z z z z z z zz z 0. 0. cl q. ο. ο -'- ά. * ά · ζ z zz z z zzz z '• [j z Z Z Z Z Z Z Z Z Z Z Z Z 21 G. 0. 0. 0. G. fi. Q.Z z z z z z zzz z h2 ftS ^{2 2 2} _ y _. ·· COCQQ Z z zz zz zz · _ £ ^a £ Z ζ z ^{2 2 20} -ca g. ol ol zz ζ ζ zz zz ® £ _a S zz _{rZ2 .n} = QQixn;: zzz2ZZ z _ £ S zz ^zzz . °: z.ao.aa.zzzzzz z ° £ αίη ^{2222 2} Ζ z ttiva · Z ol Ü. 0. _r ': Z Ζ Ζ Ζ Ζ Ζ Ζ Z ZZZ Z <vj 3 * -z - z zz a. ca. zx OOHZ ζ ζ ζ ζ z zz zzz z - OK. KJ Z ZZ - Z CL'0.0. «'ZZZZZZZZ ZZZ <ν» u ^{2 2} ·. . za cl cl U'X ζ ζ ζ ζ ζ z VJ - - ZZ n Q- nCL 0. Q..Z ZZZZZZZZ £ Ul zz. ..: "-. O.a.ii.; zzzzzzz z < «Η ...- ··:; ·. ··;. · ... - zzzz ζ z z clcl oj; z a a cl z zzzzzzzz zzz z < VJ UJ,. ·. · vj _Λ vj ζ ζ ζ ζ ζ zz zzz; o. ο. a.'za Q. z ζ ζ ζ ζ ζ zz S ⁰ · - ζζζζζζζζζο.αο.: ζο.ο.: ζζζζζζζζ z Í2 Ct— ZZZZZZZZZ ²² Z'® ^lCui ^^ * '® ^, ' ^ ^2222222 ZZ ² - - zz H. a- zzz ^ zzzzz _zz z _{Q. Q. Q. c} . _a a..zzzzzzz ^zz z zz ^{2 2} < 0.22 ζ ζ χ ζ ζ ζ ζ ο ο. the. ο_'α ^; α? ο. · ε .: ζ a. á.tz ζ ζ ζ ζ ζ ζ ζ z zzz z 5 ZZZZXZZZ CL a. Q. a. G. QA: ² ° ·· ^{2 2 2 2 2 2 2 2 2 2} zzz z VJ _{Λ ZZ} ZZZZZ ZCL'G. ' c / d ΟΧΖ Z 20. CL'Z Ζ Ζ Ζ Ζ _ Z _ S ^a 2 • ^cz; zzzzzz.q.ü.c. ^q -.q _; ^{222: q} - ^q - ^2222222 ? η® z z a. She. q.cl aa * z ζ ζ ζ ζ ζ ζ z Q ZZQ.Q.CLQ.0.C.ZZZZZZZ Z “C: ζ ζ á ΐοΐ'ΐία. cüz ζ ζ ζ ζ ζ ζ z zzzzz ^a 5 zzkaSo-o. η. z zzzzzzzz zzzzz £ ζζζο.αΑο.ΑαάοΙ'ζζζζζζζζζζ '^ ζ < vj V) <Λ ν-, - (Ν Ζ Ζ Ζ O. Q - '. Z Z Z: Q- 0. 0. Ζ Z ° tj ζ ζ z a. ü. je z z o. a a. ζ z "Ζα.'αα. * Ο>: ζζζζ2ζχχζ ^{2222 22} % ΖΑαϊοΙ-ζζζζζζζζζζζζζ. zz E ° zz zzz zzz zzzzzzzzzz zz zzz < VJ ···.; .-. 2aS nji'a-tzzzzzzz zzz ζ z zzzz zzzzzz ζ ζ z t V) VJ ·. . .

- _ o ___00O - - VJ ^ -VJ - M - _ h- Ό X

- oo o - kj cn r- eo - - o »fx - '

III ·· u ο α *

I I

O · _ oSSSSwcn '^ ooeüooo ^ oiSrxejcorowotoeoBar ^ ooowoOTcno,' J Jx ¹ JJ JJJJJJJJ jo 'JJ J2J J Jj JUJ J JJ JJJJ | , 'J d iJrJ <o - ¹ cJo cn d id cJ JrJ - <J- »o rJ> ddrJrJ djJrJiJd σ! D dal p Ξ £ - £ Sj ajkj - σι« η - · * «η -r E k < aj - * · iu »ι '• i ~ —xm r.-» r »» m {tg in <nm rs. rr »« r »ra m λκ -. X * V *

TABLE V

Six markers per pair! analysis in the irradiation hybrid panel

marker Clone watched number THE B ++ + - - + - sum. theta cRbooo LOD D8S26 MSR 11 5 3 73 92 .3115 37 7.17 D8S26 D8S233 9 6 2 74 91 .3394 41 5.99 D8S26 D8S261 9 6 2 75 92 .3463 43 6.08 D8S26 D8S21 10 6 1 75 92 .2948 35 7.21 D8S26 LPL 10 6 3 73 92 .3595 45 6.08 MSR D8S233 11 3 1 77 92 .1741 19 9.87 MSR D8S261 9 6 2 76 93 .3563 44 6.06 MSR D8S21 10 5 2 76 93 .3026 36 7.20 MSR LPL 10 5 4 74 93 .3675 46 6.10 D8S233 D8S261 9 3 1 79 92 .1995 22 8.31 D8S233 D8S21 10 2 1 79 92 .1444 16 9.89 D8S233 LPL 9 3 4 76 92 .3147 38 6.45 D8S261 D8S21 11 0 1 81 93 .0496 5 12.91 D8S261 LPL 10 1 4 78 93 .2305 26 8.46 D8S21 LPL 11 1 3 78 93 .1786 20 9.89

Statistical data were calculated using the TWOPOINT program. cRsooo: centiray 5000 At your irradiation.

• ·

- 98 VI. SPREADSHEET

genomic ! subclones Probe fragment 8. human Detected HindIII series name kb (enzyme) chromosome fragments (kb) 932E9 E 1c 1.6 (EcoRI) Yes 8 E juice 1.0 (EcoRI) Yes (4 + 8), 12 ** E 2d 0.85; 1.0 (EcoRI) Yes 7.5 E 2 0.8 (EcoRI) Yes 5.5 + 3.8 E 3 0.5: 4; 5; (EcoRI + NotI) Yes approx. 12 E 6 * 1.2 (EcoRI + NotI) Yes 3.8 E * 10 0.25: 3.0 (EcoRI + NotI) Yes 7 E 15 0.9 (HindIII + SacII Yes 1.2 E * 17 0.3; 1.2 (EcoRI + NotI) Yes 5 E 18 JLJQ; 1.8; 4.5 (HindIII) Yes 1.0 E * 20 1.5: 1.9 (EcoRI + NotI) Yes 7 E * 23 1.6 (EcoRI + NotI) Yes 8 E * 31 1.9: 2.5; 3 (EcoRI + NotI) Yes 3.5 E 32 0.2; 0.5: 1.0; 2.1 (EcoRI) Yes approx. 8 E 56 0.2; 0.4: 1 (EcoRI + StyI) Yes 5.6 E 58 0.8: 1.2: 1.8 (EcoRI + SacII) Yes 8.5 767H8 H 23 1; 1.3: 2.1 (EcoRI + SacII) Yes 6 H 25 0.5: 1.7 (Pstl + SacII) Yes 1.6 H 29 1.0; 1.5 (EcoRI + SacII) Yes 4.2; 2.4; 1.3 ?? H 31 0.45 (EcoRI + SacII) Yes 7

VI. TABLE (continued)

Genomic Subclones Probe Fragment 8 Human Detected HindiII fragments (kb) series name kb (enzyme) chromosome 802F11 F 4 0.5; 1.6 (EcoRI + SacII) Yes 1.6 832A10 THE 33 0.35 (EcoRI + SacI) Yes 1 THE 37 1.1: 3.2 (EcoRI + SacII) Yes 12 821F7 and 885C8 G 2 0.5; 6 (HindIII + SacI) Yes approx. 1.2 G 4 0.4 (Smal) Yes 3.2+ great background G 10 0.25: 6 (EcoRI + SacII) Yes approx. 12 G 14 0.4: 1.6 (EcoRI + SacII) Yes approx. 2 G 18 * ^** 1.2 (EcoRI + SacII) Yes approx. 10 YAC end clones YE1-766A12 Ω.25 (EcoRI) Yes 5 YE1-843G3 Yes YE1-932E9 0.6 (EcoRI) Yes 1.8 PAI Ele subclones HEAD A2 Yes PAIN A3 Yes HEAD B3 Yes

* Does not contain Alu ** polymorphism; we used an Alu-free phrase

100

VII. SPREADSHEET

selected detected Identification cDNAs Trial Fragment 8. human Hind III v. homolog Series No. bp (enzyme) chromosome fragments (Kb) 802Fll-g for selecting J 2 approx. 325 (BstXI) Yes 2.5 J 10 approx. 350 (BstXI) Yes 4 J 12 approx. 350 (BstXI) Yes** approx. 10 * + 6 ** with PP2Calfa homologous J 28 approx. 400 (BstXI) Yes 4 (+3, weak) new ORF P 3 approx. 350 (BstXI) Yes approx. 12 MSR (1-280bp) P 10 approx. 400 (BstXI) Yes 2 P 14 approx. 450 (BstXI) Yes 3.5 P 16 approx. 1 bar (BstXI) Yes 2.2 P 25 approx. 300 (BstXI) Yes 4 P 27 approx. 450 + 350 (BstXI) Yes 4 Overlapping with J28 sequence P 28 approx. 400 (BstXI) Yes 12 (+ 5.2) MSR (1-450 bp) P 34 approx. 250 (BstXI) Yes 3.8 MSR (3 'UTR) and HSDHEHC01 W 17 approx. 400 (EcoRI + HindIII) yes 3.5+ background

Selected with 821F7 or 877F2

K 26 approx. 350 (EcoRI + HindIII) Yes > 12 K 27 approx. 500 (EcoRI + HindIII) Yes > 12 K 36 approx. 250 (EcoRI + HindIII) Yes 2.7

101

VII. TABLE (continued)

Selected cDNAs series

Trial fragment bp (enzyme)

8. human chromosome

detected

HindIII fragments

Identification

v. homology (kb)

Selected with 946C9

L 3 approx. 400 (EcoRI + HindIII) yes 4 overlaps J28-at L 5 approx. 325 (EcoRI + HindIII) yes 0.5 L 12 approx. 300 (EcoRI + HindIII) yes 3.8 L 14 approx. 550 (EcoRI + HindIII) yes 6+ little backgrounds L 21 approx. 450 (EcoRI + HindIII) yes 5.4 + 4 + 3 L 30 (EcoRI + HindIII) yes 4.5+ little background L 31 (EcoRI + HindIII) yes 7 N 1 (EcoRI + HindIII) yes 4.8+ great backgrounds N 7 (EcoRI + HindIII) yes 3+ background N 14 approx. 600 (EcoRI + HindIII) yes 2.6 N 18 approx. 250 (EcoRI + HindIII) yes > 12 N 19 approx. 600 (EcoRI + HindIII) yes 1.6 N 21 approx. 800 (EcoRI + HindIII) yes overlies L21-et N 27 approx. 500 (EcoRI + HindIII) yes 3+ background N 28 approx. 550 (EcoRI + HindIII) yes 4 overlaps J28-at N 33 (EcoRI + HindIII) yes 12, 11; 4; 3,2; 2 overlies L21-et N 35 (EcoRI + HindIII) yes approx. 12 N 36 (EcoRI + HindIII) yes 12, 11, 4, 3, 2 overlap N33-t X 3 approx. 500 (EcoRI + HindIII) yes approx. 12 X 6 approx. 500 (EcoRI + HindIII) yes 1.8

102

VII. TABLE (continued)

selected detected Identification cDNAs Trial fragment 8. human Hind v. homology Series No. bp (enzyme) chromosome fragments (Kb)

Selected with 932E9

Q 30 kb. 500 (EcoRI + HindIII) yes 3.5

Selected with 946C9 and 932E9

Υ 1A1 U and L bands yes

Υ 1A8 yes

Y 1C8 yes * polymorphic ** the 6 kb band is not on chromosome 8.

103

Claims (31)

Claims An isolated and purified DNA sequence encoding a prostate tumor suppressor protein consisting of the nucleotide sequence of SEQ ID NO: 1. 2. An isolated and purified DNA sequence encoding a prostate tumor suppressor protein consisting of the nucleotide sequence of SEQ ID NO: 2. A recombinant vector comprising the isolated and purified DNA of claim 1 or 2. The recombinant vector of claim 3, which is a cosmid or plasmid or is derived from a virus. An expression vector comprising a DNA molecule according to claim 1 or 2, which is capable of introducing said DNA molecule into a mammalian host cell and expressing the protein therein. An expression vector according to claim 5 which is a plasmid or a viral vector. An expression vector according to claim 6 which is a retroviral vector or an adenoviral vector. An expression vector according to claim 7, which is 104 is an adenovirus vector. 9. A host-vector system for the production of a polypeptide or protein having the biological activity of a PTSG protein or a biologically active derivative thereof, characterized in that a suitable host cell comprises 5, 6, 7 or A vector according to claim 8. 10. A host-vector system according to claim 9, wherein the host cell is a prokaryotic cell. 11. A host-vector system according to claim 9, wherein the host cell is a eukaryotic cell. 12. A pharmaceutical composition comprising the vector of claim 5 and a pharmaceutically acceptable carrier. 13. A pharmaceutical composition comprising the vector of claim 6 and a pharmaceutically acceptable carrier. 14. A pharmaceutical composition comprising an AC-PTSG vector and a pharmaceutically acceptable carrier. 15. A DNA probe of at least about 15, as defined in FIG. Complementary to the DNA sequence of claim 1 It consists of 105 nucleotides. 16. A DNA probe of at least about 15, as defined in FIG. A nucleotide complementary to a DNA sequence according to claim 1. 17. An isolated and purified mammalian protein which is a protein of claim 3. is the amino acid sequence. 18. An isolated and purified mammalian protein which is a protein of claim 4. is the amino acid sequence. A process for the production of a protein according to claim 17 or 18, characterized in that: a) introducing into a host cell a compatible expression vector comprising a gene encoding a protein according to claim 17; and b) causing said host cell to express said protein. 20. The method of claim 19, wherein said host cell is a prokaryotic cell or a eukaryotic cell. 21. The method of claim 20, wherein said host cell is a mammalian cell and said expression vector is an expression vector compatible with said mammalian cell. • ·· · * · 106 22. A method of suppressing a cancerous phenotype of a cancer cell lacking an endogenous PTSG protein, comprising introducing into said cancer cell an effective amount of the DNA of claim 1 or 2. 23. The method of claim 22, wherein the PTSG gene is introduced by a recombinant vector. 24. A method for suppressing a wild-type host cancer cell; into a cancer cell as shown in FIGS. let's bring it in. endogenous tumor analyzed, claim The PTSG product does not have the phenotype that protein as such 25. An antibody which binds to a PTSG peptide consisting of a sequence of the protein of SEQ ID NO: 3. 26. The antibody of claim 3 which binds to the protein of SEQ ID NO. PTSG having the amino acid sequence 27. An antibody which binds to a PTSG peptide consisting of a sequence of the protein of SEQ ID NO: 4. 28. An antibody according to claim 27, which binds to a PTSG protein having the amino acid sequence of SEQ ID NO: 4. «« · «· 107 29. A method of detecting the lack of PTSG protein in tumor cells, characterized by: a) obtaining tissue sections from a tumor; b) contacting the antibodies of claim 23 or 24 with said tissue sections; and c) detecting the presence or absence of said antibodies that bind to said tissue sections. 30. An RNA probe of at least about 15, as shown in FIG. A nucleotide complementary to a DNA sequence according to claim 1. 31. An RNA probe of at least about 15, as shown in FIG. A nucleotide complementary to a DNA sequence according to claim 1.