HUT64394A - Protein of human zona pellucida zp3 - Google Patents

Description

The insemination! During this process, the first interaction between mammalian gametes is mediated by the binding of sperm to a species-specific receptor in the pellucid (ZP) surrounding the female gametes. ZP is an extracellular stock containing three glycoproteins called ZP1, ZP2 and ZP3, of which ZP3 has been identified as a sperm receptor (Wassarman, Development, 108: 1-17 (1990)).

Numerous in vitro and in vivo studies on both porcine and mouse ZP proteins suggest that ZP3 may be an important target antigen candidate for experimental strategies to develop immune contraception [Henderson et al., J. Reprod. Fert., 83, 325-343 (1988); and references therein]. Cloning and characterization of the murine ovarian cDNA expression gene library with anti-mouse ZP3 antibody has been an important step in achieving this goal (Ringuette et al., Developmental Biology, 127: 287-295 (1988)). Subsequently, ZP3 cDNA probes were used to isolate the corresponding ZP3 chromosomal DNA (Chamberlin and Dean, Developmental Biology, 131, 207-214 (1988); Kinloch et al., Proc. Natl. Acad. Sci. USA 85: 6409-6413 (1989)].

The possibility of using ZP3 as a contraceptive has been highlighted in studies that have shown long-term infertility in female mice following vaccination with an oligopeptide derived from the murine ZP3 amino acid sequence [Millar et al., Science, 246, •

1989, 3, 3535-938.

Mouse polypeptides are not suitable for human contraceptive use because ZP3 is species specific for the sperm receptor. In addition, non-human polypeptides elicit an undesirable immune response in humans. Therefore, the development of a safe and effective contraceptive vaccine based on the human sperm receptor (or a portion thereof) requires the availability of information from the human ZP3 polypeptide and the human ZP3 polypeptide.

Of course, it is not possible to isolate sufficient amounts of human ZP3 polypeptide from female gametes. However, we have been able to identify the human gene and clarify its sequence. This opened the possibility for the production of ZP3 polypeptides and / or ZP3 polypeptide fragments by recombinant DNA technology or solid phase polypeptide synthesis.

Accordingly, the present invention provides a novel recombinant DNA molecule encoding at least a portion of the human ZP3 polypeptide. Said DNA molecule comprises at least a portion of the sequence of Figure 2.

The invention also encompasses a polypeptide encoded by at least a portion of said DNA molecule. Said polypeptide may comprise at least a portion of the amino acid sequence of Figure 2.

Of course, functionally appropriate derivatives and fragments of the polypeptides of the invention are also within the scope of the present invention.

Functionally Suitable Derivatives of a Polypeptide · ·

We mean 4 days in which one or more amino acids are chemically substituted.

The point, of course, is that they still show human ZP3 antigenicity. This means that when administered (preferably with an adjuvant), antibodies that recognize human ZP3 will be formed.

The polypeptides of the invention may be synthetically produced or by recombinant DNA technology. Sogging methods for the production of synthetic polypeptides are well known in the art and do not require further discussion.

The production of polypeptides by recombinant DNA technology is a well-known procedure, but it offers many possibilities for slightly different results. The polypeptide to be expressed is encoded by a DNA sequence, or more specifically, by a nucleic acid sequence. This nucleic acid sequence must be transcribed (optionally) and translated into the desired polypeptide. To accomplish this goal, the nucleic acid sequence is generally cloned into a vector with which a host cell is transformed. The vector may be capable of self-replication or may be incorporated into the host cell DNA.

Different host cells lead to different polypeptides. Prokaryotes lack the organelles necessary for glycosylation. The polypeptides they produce will not contain carbohydrate side chains. Eukaryotic cells have the ability to glycosylate, but yeast cells produce glycosylation other than mammalian cells.

Advantageous for the polypeptides of the invention

· The * expression vector system is the one that gives the most natural glycosylation pattern. To achieve this, mammalian cells are most preferred.

Epitopes that may have a contraceptive effect have also been identified on the human ZP3 polypeptide. These epitopes contain at least a portion of one of the following sequences:

-ThrLeuMetValMetValSerLys-, -SerArgArgGlnProHisvalMetSerGln-, -GluValGlyLeuHisGluCysGlyAsnSerMetGlnValThrAspAspAlaLeu-, -PheSerLeuArgLeuMetGluGluAsnTrpAsnAlaGluLysArgSerProThrPhe-, -CysGlyThrProSerHisSerArgArgGlnProHisValMetSerGlnTrpSer- or

-SerGlnTrpSerThrSerAlaSerArgAsnArgArgHisValThrGluGluAla AspValCysValGlyAlaThrAspLeuProGlyGlnGluTrp-.

Small-sized polypeptides such as these are easier to synthesize. They may also be linked to the same or different epitopes to produce a larger polypeptide with better antigenic properties.

One of the aims of developing all of the polypeptides of the invention is to provide a contraceptive vaccine for use. Vaccination can be by passive or active immunization.

For active immunization, the polypeptide of the invention (optionally with an adjuvant) is administered to the female. The administration leads to an immune response in the female body. Olyan * «· · · •« »• 9

- 6 antibodies are formed that recognize human ZP3 on the egg. These antibodies specifically bind to the binding site of the sperm receptor, and thus the sperm are unable to bind to it or are blocked by spatial inhibition.

The essence of passive immunization is essentially the same. Instead of the antigen or its mimics, antibodies raised against it are directly administered. Thus, antibodies must be raised against the polypeptides of the invention.

This can be achieved by the active immunization scheme of a suitable mammal. The mammalian B-lymphocytes are harvested over a reasonable period of time and made continuous by fusion or transformation. Methods for doing this are well known in the art. The antibodies can be isolated from a culture of continuously growing lymphocytes.

However, there is a problem with antibodies of animal origin. Upon repeated administration, the immunized woman will elicit an antibody response. Therefore, it is preferable to use humanized antibodies, or small portions of antibodies that do not elicit an immune response.

Methods for humanizing antibodies, such as the CDR-graft method, are known (Jones et al., Natura, 321, 522-525 (1986)). Methods are also known for producing antibody fragments that are still specific for the parent antibody antigen [Udaka et al., Molec. Immunol., 27, 25-35 (1990)]. Alternatively, the use of human antibodies or fragments or derivatives thereof may be avoided to avoid an immune response to antibodies raised against the polypeptides of the invention.

Human antibodies can be produced by in vitro stimulation of isolated B lymphocytes or isolated from (immortalized) B lymphocytes collected from a woman immunized with at least one of the polypeptides of the invention.

Another object of the present invention is the use of the ZP3 polypeptide and antibodies raised against it in diagnostic kits.

Several antibodies against human ZP3 were prepared. It will be within the skill of the person skilled in the art to produce anti-idiotype antibodies that recognize the antigen-binding site of the antibody and therefore correspond to internal mirror images of the antigen.

These anti-idiotype antibodies are very useful for vaccination and diagnostic purposes.

The attached figures illustrate the invention.

Figure 1: Restriction maps (A) of the EMBL clones II, D1 and E1 and the chromosomal localization of the human ZP3 gene. Exons are marked with black areas. Restriction sites: S, Sali; B, BamHI.

Figure 2: Nucleotide and amino acid sequence of human ZP3. At position 1064, G and C nucleotides were found in the chromosomal and cDNA, respectively. This apparent polymorphism results in Thr and Arg, respectively. The arrows indicate exon junctions. The exon numbering is given in the circles. The polyadenylation mark is underlined.

Figure 3: Reducing the size of the ZP3 gene for insertion into a mammalian expression vector. A 2.7 kb ZP3 minigene was assembled from the following three fragments: A) Exon 1 and exon 2 linked by PCR to the reading frame, resulting in an Eco RI-Xba I fragment; B) a chromosomal XbaI-SalI fragment comprising exons 3 and 4 and a portion of exon 5; C) FIGS. a SalI-HindIII ZP3 cDNA fragment containing exons (provided with artificial 3 'BamHI and Hindin restriction sites). The three fragments were cloned into pGEM vector (Promega) opened with EcoRI and Hindin, followed by a

As a 2.7 kb EcoRI-BamHI fragment, it was inserted into a mammalian expression vector behind the SV40 promoter.

Figure 4: Detection of ZP3 mRNA in total RNA (15 g) from CHO mass culture transfected with ZP3 DNA and poly (A) ⁺ RNA from human ovary (5 g).

Lane 1: CHO; Lane 2: CHO ZP3 transformants; Lane 3: Human ovary. Total ZP3 cDNA inserted into pGEM was used as a probe.

Figure 5: Construction of beta-Gal-ZP3 fusion polypeptides in E. coli strain POP2136 containing the pEX plasmid containing ZP3 cDNA inserts.

A) Coomassie staining of polyacrylamide gel (10%) and B) Western blot assay with anti-ZP3-341-360 antiserum (1: 150 dilution). From left to right, the following samples were loaded on the gel (-, before induction; +, 2 hours after induction): control pEX; pEX-ZP3A (KpnI-BamHI fragment; whole cDNA); pEX-ZP3B (KpnI-SalI framer; cDNA encoding amino acid 1-241 at exon 5); pEX-ZP3C (KpnI-Sphl fragment; cDNA encoding amino acid 1-102 at the end of exon 1); pEX-ZP3D (Smal-BamHI fragment; 3 'end of exon 5 + exons 6, 7 and 8 encoding amino acids 257-372). Molecular weight markings (M) are on the left (in kilodaltons). The bacteria were cultured at 30 ° C Odgon ⁼ 0.5-1 is reached, and then induced for two hours at 42 ° C. Equal volumes were removed, centrifuged, and total cell lysate assayed.

Figure 6: Binding of various antibodies (see Materials and Methods) to human ova. The amount of FITC-labeled second antibody was measured using an exposure meter and expressed as a percentage of control (100% = dark, 0% = fluorescent oocytes). 1: control; 2: antiserum to human zone pellucida; 3: antiserum to KLH; 4-8: antisera against ZP3 (93110), ZP3 (172-190), ZP3 (327-344), ZP3 (341-360) and ZP3 (362372); 9: antiserum to beta-Gal-ZP3; 10: mixed serum of three mice immunized with recombinant ZP3 in CHO; 11: Mixed serum from three control mice. The average exposure time as a percentage of the control and the standard error of the mean are given.

Figure 7: Inhibition of sperm-zone binding by anti-ZP3 antibodies (see Materials and Methods). 1: control; 2: antiserum to KLH; 3: antiserum to human zone pellucida; 4: a mixture of antisera against ZP3 (93-110) ZP3 (172-190), ZP3 (341-360), and ZP3 (362372); 5: Mixed serum from three mice immunized with recombinant ZP3 in CHO. The mean number of sperm bound to the whole zone pellucid and the mean standard error of the mean are given.

The following examples illustrate the isolation of the human ZP3 DNA sequence, the human ZP3 amino acid sequence, a method for expressing a recombinant polypeptide having ZP3 antigenicity, and a method for producing a synthetic polypeptide having such antigenicity. These examples are intended only to illustrate the invention and are not to be construed as limiting the scope thereof.

EXAMPLES.

Materials and Methods

All recombinant DNA techniques are well known in the art (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition, CSH-Laboratory Press, 1989).

Restriction enzymes and DNA modifying enzymes were used as recommended by the manufacturers.

The human ovarian gt10 cDNA gene library was obtained from Stratagene.

Oligonucleotide synthesis

The oligonucleotides were prepared on an Applied Biosystems 381A DNA synthesizer and used directly for cloning purposes.

peptide

The oligopeptides were prepared by solid phase peptide synthesis according to the procedure described by Fields and Noble, Int. J. Pept. Prot. 35: 160-214 (1990). The following ZP3 peptides were synthesized (the three-letter code of the amino acids):

-ZP3 (93-110): GluValGlyLeuHisGluCysGlyAsnSerMetGlnValThrAspAlaLeu

-ZP3 (172-190): PheSerLeuArgLeuMetGluGluAsnTrpAsnAlaGluLysArgSerProThrPhe

-ZP3 (327-344): CysGlyThrProSerHisSerArgArgGlnProHisValMetSerGlnTrpSer

-ZP3 (341-360):

SerGlnTrpSerThrSerAlaSerArgAsnArgArgHisValThrGluGluAlaAspVal

-ZP3 (362-372): CysValGlyAlaThrAspLeuProGlyGlnGluTrp.

Production of antibody

Polyclonal serum was prepared with various antigens:

- Full human zone pellucida. Salt-stored human zone pellucidates were solubilized with heat and mixed with Freund's adjuvant to immunize rabbits. Antiserum titers were assayed on 96-well microplates coated with porcine ZP proteins.

- Beta-Gal-ZP3 fusion protein. Utilizing its insolubility, the fusion protein was partially purified from ultrasonically treated bacteria and separated by SDS polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were transferred to a nitrocellulose filter by electrospray technique. The hybrid protein carrier portion was excised and dissolved in DMSO. This was mixed with Freund's adjuvant 1: 1 and used to immunize rabbits.

- ZP3 produced by CHO. A similar procedure was followed for ZP3 protein produced by Chinese hamster ovary (CHO) cells. The concentrated culture medium was separated by SDS-PAGE. The 40-60 kilodalton portion was excised and used to immunize mice.

- Oligopeptides. The synthesized peptides were physically bound to hippopotamus hemocyanin (KLH) and inoculated into rabbits. As a control, some rabbits were immunized with KLH only. Sera were analyzed on peptide-coated 96-well microplates.

Fluorescence examination of human ovum

Salted non-fertilized human ova were incubated with antiserum (1:50 dilution in buffer A [PBS + 5% BSA]) after 48 hours incubation with sperm in an IVF program. After three washes, the ova were harvested with a second antibody (porcine FITC-conjugated anti-rabbit or anti-mouse, 1: 100 dilution in buffer A) and incubated for 1 hour at 37 ° C. After three additional washes, fluorescence was measured with a Nikon microscope and exposure meter. Unstained (negative) control ova remain dark at long exposure times, whereas the zone of positive staining cells has a shorter exposure time.

Human sperm zone binding assay

Human ova (see above) were incubated in rabbit serum, washed three times with buffer (BWW + 3% BSA), incubated with buffer (control) and antibody (undiluted, 37 ° C, 1 hour), washed three times with a drop of human activated sperm (10 ^7). sperm / ml, 37 ° C, 16 hours). Loosely adherent sperm were removed from the ova by repeated pipetting. The bound sperm were fixed and stained with BWW containing 1% glutaraldehyde and Hoechst (H33258, 20 g / ml) and the number of bound sperm counted by fluorescence microscopy.

RESULTS

Synthesis and construction of the mouse ZP3 probe

A 135 bp mouse ZP3 probe was constructed by linking eight (27-51 bp) synthetic oligonucleotides. This fragment, which contains a portion of exons 5 and 6 of the mouse gene (positions 771-909, Ringuette et al., Developmental Biology, 127, 287-295 (1988)), was seen with unique 5 'BamHI and 3' Hindin restriction sites. and cloned into plasmid pGEM3 (Promega). Subsequently, the nucleotide sequence was verified.

Cloning and characterization of the human ZP3 gene

A human EMBL3 chromosomal gene library was probed with the ³² P-labeled ZP3 probe (with the 13 5 bp fragment described above). Three overlapping EMBL clones showed strong hybridization and were characterized in more detail. A physical map of some of these clones is schematically shown in Figure 1. Restriction fragments from clones II and D1 were subcloned into pGEM vectors and M13mp18 / 19 and used for chromosomal characterization of the human gene. This included the localization of exons by a Southern P-labeled ³² P-labeled gonucleotide assay from the mouse ZP3 sequence and subsequent sequencing. As shown in Figure 1, the human gene consists of 8 exons distributed on approximately 20 kilobases of chromosomal DNA. Each identified exon is flanked by consensus splice donor and splice acceptor signals (not shown). Sequence analysis of all exons revealed the full coding sequence of the ZP3 gene (shown in Figure 2). The human ZP3 gene encodes a 372 amino acid polypeptide having a molecular weight of 41,437 Daltons.

Cloning of human ZP3 cDNA

The human ovarian cDNA gene library (gt10) is human ZP3

³² P-labeled fragments from exons 1, 5 and 7 were analyzed. This resulted in some cDNA fragments containing only the 3 'end of the coding sequence of ZP3 (exons 5-8).

Sequence analysis of three independent cDNA clones confirmed the accuracy of the previously determined chromosomal ZP3 sequence except for the single nucleotide in exon 7 (see Figure 2). At nucleotide position 1064, G and C nucleotides were found in the chromosomal and cDNA, respectively. In the encoded amino acid sequence, this results in an arginine and a threonine residue at position 345. This sequence mismatch probably represents the polymorphism in the human ZP3 gene and polypeptide.

Expression of recombinant ZP3 in CHO cells

For expression in CHO cells, the size of the ZP3 gene had to be reduced to such an extent that insertion into a mammalian expression vector was possible. Various ZP3 DNA fragments were assembled into the minigene shown in Figure 3. Exons 1 and 2 by PCR technology (Horton et al., 1989, Gene 77, 61-68; Yon and Fried, Nucl. Acids. Sl., 17, 4895 (1989)] and provided with 5 'EcoRI and 3' XbaI restriction sites. Subsequently, this DNA fragment was ligated into the third and third fragments

Exon 4 and a portion of exon 5 carrying a chromosomal XbaI-SalI fragment and a SalI-HindIII fragment

CDNA fragment containing 5-8 exons. The resulting 2.7 kilobase minigene contains a truncated intron between exons 2 and 3 and natural introns in ZP3 3 and 3.

Between exons 4 and 4 and 5. The integrity of the nucleotide information encoding the polypeptide of this ZP3 construct was fully verified by sequence analysis.

The ZP3 'minigene was then inserted into a mammalian expression vector in which the ZP3 gene is driven by the strong SV40 early promoter. This vector also had the beta-globin fusion and SV40 polyadenylation signals required for the correct RNA maturation of the expressed gene and the aminoglycosyl phosphotransferase [Colbere-Garapin et al., J.Mol. Biol., 150, 1-14 (1981)], which allows isolation of transformants stable at the bottom of the G418 resistance. CHO cells by the calcium phosphate precipitation technique (Graham et al., Eb, Virology, 52, 456-467 (1973); Wigler et al., Proc. Natl. Acad. Sci. USA 76: 1373-1376 (1979)] was transfected with the ZP3 expression construct. A large group of G418 resistant transformants (300-500 independent clones) were tested for expression of the recombinant ZP3 gene.

As shown in Figure 4, Northern blot analysis of total RNA from the transformants collected with ³² P-labeled ZP3 probe shows a relatively high level of expression of the transfected ZP3 gene (compared to the actin gene expressed at high levels). In addition, it has been shown that the minigene RNA undergoes a proper process of maturation into mRNA, which is slightly larger than the naturally transcribed mRNA in human ovarian RNA (see Figure 4). This difference in size is most likely due to the 5 'and 3' end flanking sequences present in the expression vector.

The correct cleavage and maturation of the recombinant gene was further confirmed by the isolation of G418 resistant CHO transformants as shown in Figs. also an exon carrying cDNA fragment. The sequence data for this cDNA were similar to the transfected DNA and support the conclusion that the introns were correctly cleaved from the ZP3 minigene transcript.

Media of growing mass cultures were analyzed by Western blot for the presence of recombinant ZP3 polypeptide. Polyclonal antiserum raised against deglycosylated porcine ZP3 (Henderson et al., 1987, Gamete Research, 18, 251-265) was able to detect recombinant ZP3 polypeptides in the culture fluid. This signal was missing from the medium of untransfected CHO cells.

Expression of recombinant ZP3 in E. coli

For expression in E. coli, a full-length ZP3 cDNA was first prepared from CHO transformants isolated by PCR technology as shown in Figures 1-5. cDNA containing exons and a partial cDNA clone (exons 5-8) isolated from the human ovary cDNA library. Four sections of the ZP3 cDNA were cloned into the E. coli LacZ gene, coincident with the reading frame, into pEX plasmids (Biores), which produced the beta-galactosidase-ZP3 fusion polypeptide as described by Stanley and Luzio [1984] EMBO J. 3: 1429-143. )]. Expression of the fusion polypeptides in E. coli was investigated by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot. The results of these experiments are shown in Figure 5. Following heat shock induction, all four Lac-ZP3 constructs resulted in fusion polypeptides, although to a much lesser extent than the LacZ gene. The molecular weight of the hybrid polypeptides, as observed on coomassie stained gels (see Figure 5A), was consistent with the expressed ZP3 moieties. This was further confirmed by anti-beta-galactosidase antibodies (not shown) and linked to KLH by ZP3 341-360. by Western blot analysis with rabbit antiserum raised against the amino acid sequence (Figure 5B). Only the fusion polypeptides carrying this region, i.e. ZP3-A and ZP3-D, were recognized by the antiserum. The antiserum produced against KLH gave a similar result to the background staining shown in Figure 5B (not shown). Beta-Gal-ZP3 fusion polypeptides were also recognized by anti-serum (not shown) against the whole human zone pellucida.

Binding of ZP3 antibodies to human ova

A human egg cell fluorescent assay was developed to characterize the binding of various ZP antibodies to the human zone pellucid. The results of three different experiments are illustrated in Figure 6. Serum against KLH and normal mouse serum did not give fluorescent staining, whereas high to moderate fluorescence was observed for all antisera against ZP components. From the data presented, it can be concluded that against ZP3 (93-110), ZP3 (172-190), ZP3 (327-344), ZP3 (341-360) and ZP3 (362-372) antisera produced recognize human ova.

Effect of ZP3 antibodies on sperm oocyte recognition

The contraceptive effect of ZP3 antibodies was studied in a human sperm zone binding assay. The results of this test are shown in Figure 7. Antibodies raised against whole human zone pellucida inhibited sperm binding by 75%. The antisera produced against KLH did not inhibit sperm binding. In contrast, a mixture of antibodies raised against ZP3 peptides (ZP3 (93-110), ZP3 (172-190), ZP3 (431-360) and ZP3 (362372)) showed a 35% relative inhibition of sperm binding. Antibodies to recombinant ZP3 from CHO cells reduced sperm binding by 55%.

Claims (15)

PATENT CLAIMS CLAIMS 1. A pure polypeptide or a functional derivative thereof having human ZP3 activity or at least partially human ZP3 antigenicity. 2. A polypeptide according to claim 1, characterized in that it is made recombinantly. The polypeptide according to claim 1 or 2, characterized in that it comprises at least a portion of the following sequence: MetGluLeuSerTyrArgLeuPhelleCysLeuLeuLeuTrpGlySerThrGluLeuCys TyrProGlnProLeuTrpLeuLeuGlnGlyGlyAlaSerHisProGluThrSerValGln ProValLeuValGluCysGlnGluAlaThrLeuMetValMetValSerLysAspLeuPhe GlyThrGlyLysLeuIleArgAlaAlaAspLeuThrLeuGlyProGluAlaCysGluPro LeuValSerMetAspThrGluAspValValArgPheGluValGlyLeuHisGluCysGly 101 AsnSerMetGlnValThrAsnAspAlaLeuValTyrSerThrPheLeuLeuHisAspPro 121 ArgProValGlyAsnLeuSerlleValArgThrAsnArgAlaGluIleProIleGluCys 141 ArgTyrProArgGlnGlyAsnValSerSerGlnAlalleLeuProThrTrpLeuProPhe 161 ArgThrThrValPheSerGluGluLysLeuThrPheSerLeuArgLeuMetGluGluAsn 181 TrpAsnAlaGluLysArgSerProThrPheHisLeuGlyAspAlaAlaHisLeuGlnAla 201 GluIleHisThrGlySerHisValProLeuArgLeuPheValAspHisCysValAlaThr 221 ProThrProAspGlnAsnAlaSerProTyrHuisThrlleValAspPheHisGlyCysLeu 241 ValAspGlyLeuThrAspAlaSerSerAlaPheLysValProArgProGlyProAspThr 261 LeuGlnPheThrValAspValPheHisPheAlaAsnAspSerArgAsnMetlleTyrlle 281 ThrCysHisLeuLysValThrLeuAlaGluGlnAspProAspGluLeuAsnLysAlaCys 301 SerPheSerLysProSerAsnSerTrpPheProValGluGlyProAlaAspIleCysGln 321 CysCysAsnLysGlyAspCysGlyThrProSerHisSerArgArgGlnProHisValMet 341 SerGlnTrpSerThrSerAlaSerArgAsnArgArgHisValThrGluGluAlaAspVal 361 ThrValGlyAlaThrAspLeuProGlyGlnGluTrp The polypeptide of claim 1, 2 or 3, characterized in that it is at least partially glycosylated. A polypeptide according to claim 3 or 4, characterized in that it comprises at least one of the following sequences: -ThrLeuMetValMetValSerLys-, -SerArgArgGlnProHisValMetSerGln-, -GluValGlyLeuHisGluCysGlyAsnMetSerGlnValThrAspAspAlaLeu-, -PheSerLeuArgLeuMetGluGluAsnTrpAsnAlaGluLysArgSerProThrPhe-, -CysGlyThrProSerHisSerArgArgGlnProHisValMetSerGlnTrpSer- or -SerGlnTrpSerThrSerAlaSerArgAsnArgArgHisValThrGluGlu AlaAspValCysValGlyAlaThrAspLeuProGlyGlnGluTrp-, A polypeptide having human ZP3 activity or at least partially human ZP3 antigenicity, comprising at least a portion of the sequence: -SerGlnTrpSerThrSerAlaSerArgAsnArgArgHisValThrGluGluAlaAsp Val-. The nucleic acid sequence of any one of claims 1-6. A protein encoding at least a portion of a polypeptide according to any one of claims 1 to 6. Nucleic acid sequence according to claim 7, characterized in that it comprises at least a portion of the following sequence or functional derivatives thereof: 10 20 30 40 5060 GAGGCGGCTGCCTGCTGCTCTGCAGGTACCATGGAGCTGAGCTATAGGCTCTTCATCTGC 70 80 90 100 110120 CTCCTGCTCTGGGGTAGTACTGAGCTGTGCTACCCCCAACCCCTCTGGCTCTTGCAGGGT 130 140 150 160 170180 GGAGCCAGCCATCCTGAGACGTCCGTACAGCCCGTACTGGTGGAGTGTCAGGAGGCCACT 190 200 210 220 230240 CTGATGGTCATGGTCAGCAAAGACCTTTTTGGCACCGGGAAGCTCATCAGGGCTGCTGAC 250 260 270 280 290300 CTCACCTTGGGCCCAGAGGCCTGTGAGCCTCTGGTCTCCATGGACACAGAAGATGTGGTC • · · 310 320 330 340 350360 AGGTTTGAGGTTGGACTCCACGAGTGTGGCAACAGCATGCAGGTAACTGACGATGCCCTG 370 380 390 400 410420 GTGTACAGCACCTTCCTGCTCCATGACCCCCGCCCCGTGGGAAACCTGTCCATCGTGAGG 430 440 450 460 470480 ACTAACCGCGCAGAGATTCCCATCGAGTGCCGCTACCCCAGGCAGGGCAATGTGAGCAGC 490 500 510 520 530540 CAGGCCATCCTGCCCACCTGGTTGCCCTTCAGGACCACGGTGTTCTCAGAGGAGAAGCTG 550 560 570 580 590600 ACTTTCTCTCTGCGTCTGATGGAGGAGAACTGGAACGCTGAGAAGAGGTCCCCCACCTTC 610 620 630 640 650660 CACCTGGGAGATGCAGCCCACCTCCAGGCAGAAATCCACACTGGCAGCCACGTGCCACTG 670 680 690 700 710720 CGGTTGTTTGTGGACCACTGCGTGGCCACACCGACACCAGACCAGAATGCCTCCCCTTAT 730 740 750 760 770780 CACACCATCGTGGACTTCCATGGCTGTCTTGTCGACGGTCTCACTGATGCCTCTTCTGCA 790 800 810 820 830840 TTCAAAGTTCCTCGACCCGGGCCAGATACACTCCAGTTCACAGTGGATGTCTTCCACTTT 850,860,870,880,890,900 GCTAATGACTCCAGAAACATGATATACATCACCTGCCACCTGAAGGTCACCCTAGCTGAG 910 920 930 940 950960 CAGGACCCAGATGAACTCAACAAGGCCTGTTCCTTCAGCAAGCCTTCCAACAGCTGGTTC 970 980 990 1000 10101020 CCAGTGGAAGGCCCGGCTGACATCTGTCAATGCTGTAACAAAGGTGACTGTGGCACTCCA 1030 1040 1050 1060 10701080 AGCCATTCCAGGAGGCAGCCTCATGTCATGAGCCAGTGGTCCACGTCTGCTTCCCGTAAC 1090 1100 1110 1120 11301140 CGCAGGCATGTGACAGAAGAAGCAGATGTCACCGTGGGGGCCACTGATCTTCCTGGACAG 1150 1160 1170 1180 11901200 GAGTGGTGACCATGAAGTAGAGCAGTGGGCTTTGCCTTCTGACACCTCAGTGGTGCTGCT 1210 1220 1230 1240 12501260 GGGCGTAGGCCTGGCTGTGGTGGTGTCCCTGACTCTGACTGCTGTTATCCTGGTTCTCAC 1270 1280 1290 13001310 CAGGAGGTGTCGCACTGCCTCCCACCCTGTGTCTGCTTCCGAATAAAAGAAGAAA 9. A vector comprising the nucleic acid sequence of claim 7 or 8. 10. A host cell comprising a nucleic acid sequence according to claim 9 or a sequence according to claim 7 or 8. 11. A pharmaceutical composition, characterized in that it is one 1st-6th A polypeptide according to any one of claims 1 to 6. An immunological contraceptive vaccine, characterized in that one of claims 1-6. A polypeptide according to any one of claims 1 to 6 and an adjuvant. An immunological contraceptive vaccine, characterized in that one of claims 1-6. The antibody comprising the polypeptide of any one of claims 1 to 11. 14. Procedure 1-4. The preparation of a polypeptide according to any one of claims 1 to 3, wherein a vector comprising a nucleic acid sequence encoding such a polypeptide is transformed into a host cell, cultured in a suitable nutrient medium, and the polypeptide is isolated from the culture. 15. Procedure 1-6. For the production of an antibody to a polypeptide according to any one of claims 1 to 3, characterized in that w by inoculating a suitable animal with said polypeptide and adjuvant, after a suitable period of time, collecting B-lymphocytes of said animal, selecting for antibody-producing cells, culturing it, and then culturing and isolating the antibodies from the culture.