HU229967B1 - Method for determining the sequence of fragmented nucleic acids - Google Patents

Abstract

The invention relates to new sequencing methods for the efficient and reliable identification of the nucleotide sequence of fragmented or degraded nucleic acids, primarily in biological samples. Furthermore, the present invention relates to the spacer molecules used in such methods and to the kits required for carrying out such methods.

Description

Procedure for determining the sequence of a fragmented nucleinsswk

FIELD OF THE INVENTION

The present invention pertains to the molecular diagnostic domain of the present invention for sequencing methods that provide efficient nucleotide sequences for degraded degraded nucleic acids and make them available, particularly in biological samples. The invention also relates to spacer molecules used in combs and to kits for use in methods.

aunts or oh identification in the above procedure-

In many cases, biological samples in which these nucleic acids are fragmented are only available for determining the nucleotide sequence and sequence of DNA and RNA molecules. The most common examples for this diagnostic purpose are the removal of tumor tissue samples which are fixed with paraffin and . It is well-known that fragmentation (fragmentation) of nucleic acids in a sample is inevitable even when the samples are recorded and stored. There is a growing need to determine the sequence of each of the targeted sections of nucleic acids extracted from such samples. However, at a later point in time, the detection of these nickel acids is problematic due to their small size and amount. ).

However, explosive developments in molecular diagnostics in recent years have tended to be more nucleic acid sequencing assays than dideoxl sequencing, such as high resolution melting analysis _; Nexf general ion mixing (NGS) technology, focuses on the development of real-time PCR (RT-PCR) based methods (see, e.g., Borras, E. ef al., BMC Cancer, 2011 Sep 24, 11: 406: Solassol d. Etal) : Int. J. Mot, Salt '2011.12 (5): 3191-3204: Knapp Lüt et al .: Genes 2010. 1 (2): 227-243).

...... 'jal young people look at the problem of Article and Sensitivity, but do not suggest a solution to these problems. The only widely used development is the insertion of the M13 sequencing primer binding site into the target sequence with an amplifying primer that also contains the M13 primer in the form of an overhang (Querings S. ef ah: PLoS One. 2011 May 5; 6 ( 5): el 9601 s However, this enhancement does not improve efficiency and sensitivity, but only makes sequencing more economical because it is not necessary to obtain a separate sequencer for each target sequence and to optimize the sequencing reaction. the widespread method is that the PCR primer extended by the protruding Mi 3 binding site is more prone to oligonucleotide formation and that this degrades the efficiency of POR: reduce the exam animal sensitivity.

The techniques disclosed in WO 9743449 (Hagiwara Kolehi et al.) And WO 9908904 (Lto Qiang et al.) And in WO 99/84624 by Wailace Andrew et al. Aim to combine multiple target sequences in a single sequencing reaction. can be sequenced simultaneously. This was expected to give Hoqv the cost and efficiency of dideoxy sequencing. However, these technologies were not widespread in practice due to the problems outlined below. In these methods, overlap fusion between target sequences was solved by two separate PCR reactions. In the first, each target sequence was amplified separately with primers having overlapping ends with the other target and amplifying primer sequences, and in the second PCR reaction, the products of the first PCR reaction were mixed and fused together. Although the fusion product is created, the following problems occur; a) POR amplification of the target sequences in the mixture continues to compete with the fusion product b) Long primers reduce the efficiency of PCR, c) Overlap primers form dimers during fusion PCR, d) Sequence noise in the primers synthetic errors also appear as noise during sequence evaluation; (e) two separate PCR reactions do not reduce overall costs.

WO02 / 07/025340. Publication Publication (Keith S, et al.) discloses a procedure for noise-free and non-discriminatory amplification of a set of sequences, which consists of two amplification steps. This method can be used to advance the small-scale DHS-msWk system. The resulting increased amount of sample can be well applied in subsequent analyzes for multiple oeissecveocla assays. However, this technique does not increase the size of the fragments but only the amount thereof. This will keep the grass short DRS sequences from sequencing! to participate in the reaction.

WO 2009/124085. (Ohmba D.S. et al.) disclose a method for reducing noise in a nucleic acid sequencing reaction. According to the method, the false-stranded products generated in the amplifier prior to sequencing are sequenced. it is selectively degraded during the reaction. Sequencing the short sequences! technology is not solved by this procedure

The disadvantage of the Ddeoxy sequencing method is that it is not possible to determine the exact sequence of the first 30-50 nucleotides, or it is difficult to evaluate analytically poorly in both directions. The most commonly used solution to this problem is to amplify the sequence to be tested by amplifying it by 70-70 bp (prm length e 50 bpj longer sequence length, so that the test portion is of high quality,

For samples containing fragmented nucleic acids, the extension of the POR target sequence results in only fewer copies of the appropriate size of nucleic acid available for POR amplification. In this case, the sensitivity of the detection is reduced, in many cases the detection is ineffective or, if successful, the probability of allele discrimination (i.e., random amplification of only one sequence variant) increases during PCR. In a sample containing both a mutant and a normal allele, it is common for the mutant allele to appear at a frequency of 10% or 0%. The latter case is of great clinical importance, as the test results are false negative. Fewer starting nucleic acid copy numbers also translate into higher amplification requirements, which increases the likelihood of PCR artifact mutations.

Another commonly used method to solve the above problem is to use overhang primers beyond the target sequence during PCR amplification! a shorter edge sequence also produces a longer PCR product. The disadvantage of this method is that in the synthesis of long primers, many primers have one to two nucleotide errors, in many cases, nucleotide deletion. The sequence of this DNA strand yields a nucleotide deletion. The target sequences of such slipped sequences make each other noisy with respect to each other. sequence image ("segoence noiee").

A solution to the above problem may be provided by inserting a DNA molecule of at least 70 bp in length after the target sequence.

A previously found method for joining two DNA molecules is the "overlap extension PCR" (abbreviated as "OEP"), U.S. Patent No. 5,023,171. (Ho Steffan et al.) discloses that the overlapping oligonucleotides at the S 'end of the single-stranded DNAs to be hybridized serve as primer markers for the production of the double-stranded fusion DNA molecule.

SW

It a lka k tra q Líu

The original and legg product of the method is fused by j and Andrew wallace (o The method is followed by two consecutive PCR reactions. The first PCR uses primers containing binding sequences to produce overlapping DNA strands which serve as primers for each other during the second FUR. , The linker primers used in the first PCR are complementary to the template DNA at their 3 'ends and complementary to their adjacent DNA at their S-ends. The disadvantage of this method is that when amplifying the template sequence, bouring DNA complementary to ^5;. part greatly the sensitivity decreases Further, primer dimers formed during the first stage PCR, could significantly impair the POR efficiency for a small amount of DNA mlnták A · p ⁱ formed is methyl dimer, if not ^removed,.! fusion in the same way as in the second PCR reaction as in the template sequence sequencing The resulting non-phosphatic DNA strands produce noise during sequencing. It also follows that the sequence differences in the linker primers are incorporated into the fused strand, or in the case of deletion or deletion. Sequence appears as a continuous noise on an elec troferogram with amplitude equal to the ratio of primers containing insertion / deletion These disadvantages greatly inhibit the use of the OEP-based methods developed so far for low and / or fragmented nucleic acid content

It is an object of the present invention to overcome the drawbacks of the above-mentioned methods by increasing the resilience of ceses in samples in which the nucleic acids are irradiated,

To solve the problems outlined above, we designed an overlap extension PCR-based technology to provide fusion of short PCR'terroids with the shortest possible primers, and designed a mutation-free adapter sequence that fused to the extreme POR fusion for the first 30 minutes of sequencing. Noisy sequence generated in -50 bp without the need to amplify a long PCR product,

Summary of the Invention

In the process of the invention; - with the aid of a single PCP - a long pre-engineered artificial spacer spool DNA DNA is inserted on both sides of the target sequence to allow the target sequence to be spaced sufficiently far from the sequencing primer binding site, thus enabling the method to be performed. that bi-directional Sanger sequencing can read from shorter DNA molecules is the same! a conventional method that does not use the target sequence as a fusion. All this is achieved without the need for delivery of the target sequence into lementer sequences prior to fusion, using other DNA strands, i.e., primers that destroy I in addition to the template DHS.

t. It is a particular advantage that the hybridization hybrid DNA at the primary binding site used for amplification of the target sequence, or a few nucleotides within it, is therefore not much more advantageous during the previous amplification, so that this sequence is ligated.

BRIEF DESCRIPTION OF THE DRAWINGS Figure t: Nucleic Acids Sequence by Molecular Fusion (Invented Method)

Figure 2: The spacer molecule

Figure 3: Location of the PCR primer prior to the fusion PCR and hybridization site of the spacer molecule

Figure 4: Schematic of a two-step PCR procedure for Nt resistance mutations in the H1N1 influenza virus

Figure 5: Proof of the Effectiveness of the Method of the Invention 1977-2008

Figure 8: Demonstration of the Effect of the Method of the Invention on H1N1 Ni-Resistant Mutations

In the study of mutations in R 1 -resistence

Figure 7: Sequences of amplicons for the exon 21 EGFR assay in the known method and the present invention

Figure 8: Allele according to hias wall

Proof of I reduction

DETAILED DESCRIPTION OF THE INVENTION

In the method of the invention, the target sequence to be tested by a single PCR is of sufficient length on both sides. a previously synthesized "spaceC" molecule was inserted, which allows the test of the sequence to be sequenced to be the primary 3 ^! is sufficiently distant for silent Sanger reading, so that amplification prior to dideoxy sequencing can only occur with nucleic acid more than about 2 x 20 bp (2 x primer length) above the target sequence. Small initial therapy with a nucleic acid array prior to the spacer molecule-matching PCR can be performed to amplify the target sequence to provide the appropriate template copy number. For this, it is sufficient to use primers that contain only the template complementary sequence. In this case,>. 2 x 30

(2 x primer length e 2 χ 10), only nucleic acid progressing the target sequence can occur.

It has also been hauntingly demonstrated that the amplification of the double 70 bp extra sequence required for known dideoxy sequencing can be replaced by a shorter sequence, thereby reducing the size of the PCR amplicon, which increases the sensitivity of the sequencing detection of carrier ONS sequences and reduces allele production in DNA samples derived from myormaline fixation tissues (see Example 8).

The spacer molecule used in the method of the invention, which may be single-stranded or double-stranded DNA, comprises the following (see Figure 2):

- a region complementary to a template or an amplicon at one end of the target sequence (about 20 bp),

- an intermediate DNA region of at least 20 bp (but less than 120 bp) which, together with the former, ensures that the 3 'end of the sequencing primer is adequate, spanning more than 40 bp (but less than 140 bp) comes from the edge sequence,

- sequencing primer! complementary section (15-40 bp),

- Amplifying the printer! complementary region (15-40 bp).

Accordingly, in one aspect the invention provides a method for determining the sequence of fragmented nucleic acids by PCR amplification of a target sequence and subsequent dideoxy sequencing comprising the following steps:

a) separating the cells containing the nucleic acid or nucleic acid to be sequenced b) performing a PCR reaction to fuse and amplify the edge sequence using one or more artificial spacer molecules comprising at least one template nucleic acid complement at one end of the edge sequence; bp spacer section, a sequence complementary to a sequencing primer and an ampile primer! a complementary section, and

c) sequencing the resulting PCR product, optionally after purification.

In a preferred embodiment of the above process, nucleic acid is biology! from a sample. In another preferred embodiment, this is a) Isolation! Steps may be omitted if appropriate polymerase is used. In another preferred embodiment, the cells containing the nucleic acid are isolated from the biological sample, preferably by laser microdissection.

The spacer DNA molecules are fused) as shown in Figure 1:

the spacer DNA molecule and the complementary 3 'ends of the DNA molecules containing the target sequence hybridize, so that the polymerase builds a single-stranded 2-stranded fusion

DNA molecule, At the same time, this happens on the other side of the target sequence. For a single-fused DNA molecule, the spacer DNA molecule on the other side also hybridizes to form a double-stranded DNA molecule that is complemented by fusion and reverse primers on both sides, thereby enabling amplification of the fusion molecule. The high initial concentration of the gas amplification primers ensures that the final concentration of the amplified fusion strand is significantly higher than the concentration of the parent and intermediate molecules. Ultimately, in this case, the PCR reaction is a multiplex reaction in which fusion priming is amplified in a single step.

If an RCR reaction is used prior to the fusion PCR, it is advisable to design this reaction such that the S 'end of the primers is complementary to the sequence at least 0-70 bp downstream of the nucleic acid as the sequence. the template-specific portion of the spacer DHS mofecula is watered 3 to avoid fusion of the primer dimers formed during the first PCR with spacer DNA molecules during the fusion PCR.

Accordingly, in another aspect, the present invention provides a method for determining the sequence of fragmented nucleic acids by two-step PCR amplification of a target sequence and subsequent sequencing of deoxy, comprising the steps of:

a) isolating cells containing the nucleic acid or nucleic acid to be sequenced from a biological sample,

b) performing a first PCR reaction to amplify the target sequence, followed by a second PCR for amplicon fusion and amplification, using one or more of the artificial spacer molecules comprising an ampliconrial complementary region of at least 20 bp spacer a region complementary to a sequencing primer and a region complementary to an amplification primer, wherein. amptlkonnal corresponding complementary sequence phase of therapy begins OHSE 0-70 bp farther 5 'direction _and as No. ampllfikáló primena complementary to the 5'-end portion, and

d) sequencing the resulting PCR products, optionally after purification.

In a preferred embodiment of the above method, the nucleic acid is isolated from the biological sample. In another preferred embodiment, isolation (a) is carried out. In a further preferred embodiment, the cells containing the nucleic acid are isolated from the biological sample, preferably by a laser microdissector.

If necessary, an additional nested PCR is performed in step b) after the first PCR

In the methods of the invention, the sequencing nucleic acid may be DNA or RNA.

According to the invention, fragmented nucleic acid to be sequenced is DNA, RNA or miRNA tragmented. The term "fragmented nucleic acid" as used herein means a nucleic acid of 30-100 bp in length, preferably 55-300 bp in length.

The method is advantageously applicable when the DNA sequence whose nucleotide sequence is to be determined is not part of a DNA molecule that is at least 70 bp longer than the target region. Thus, if the sequence of a 100 bp DNA or RNA segment is to be determined, it should be in the middle of a minimum 240 bp DNA fragment; must be located in order to be sequenced by known methods. A 200 bp sequence to be sequenced must be in the middle of a minimum 340 bp sequence. The upper limit is only the technical limit of dideoxy sequencing, which is about 1000 bp,

By biological sample is meant blops, tissue samples, cytological smears, blood samples, ascites fluid, spinal cord, urine, etc. Tissue samples are preferred for the methods of the invention. The nucleic acid extract may be derived from human, animal or plant tissue or cells. It is particularly advantageous to apply the method to a biological sample in which the size and size of the nucleic acid fragments are small, thereby significantly increasing the number of DNA fragments available for therapy in proportion to reducing the size of the target sequence. An example of such use is the tilting of histological specimens or cytological specimens when a laser microdissection microscope is used to inject one, two, one hundred, or two thousand cellular nucleic acids into a test tube, from which the nucleic acid is then either isolated or directly PCR amplified.

The spacer DNA molecule is synthesized or synthesized according to the target sequence, which must be known in advance. In addition to the tarpaulins, the spaoer molecule may comprise its amplifying primary binding site, the NT13 binding site, and the overlapping binding site.

In one embodiment of the sequencing method of the present invention, we use torn and reverse spacer molecules, which may be prepared as follows. The M13F primer portions of the framework of the i-forward spacer mock-ups are used: the M13F primer portions of the pCR24-TÖRO vector (Invitrogen) and the M13R primer portions of the re verse spacer molecule framework. On both sides, this frame is fitted with OEP using sequences specific for diagnostic systems. For the spacer backbone 3 'to the primer Ι7Γ13F or R, complementary nucleotides were inserted. which are required for subsequent restriction cleavage. On the other side of the spacer backbone, the sequences required to generate the same restriction enzyme cleavage site were inserted. The resulting artificial sequences were cloned with CionedET1.2 PCR Cloning Kit (Fermentas) and Topi. Following vector isolation from a clone that has been verified to contain the sequence, it is produced by restriction enzyme cleavage and gel isolation with the spacer molecules. For the two H1N1 influenza diagnostic systems, only fotwsrd spacer heads were used, for KRAS and EGFR diagnostic systems we used forward: and reverse: spacer molecules.

In each of the methods of the invention, a PCR is performed in which the spaoer molecules are fused to the target sequences. For this reakeloal freeze to contain, in addition to the components necessary for the action of golimerase, the following components: spacer molecules fusing to the ends of the target sequence in smaller amounts than the amplifying primers; and the fusion molecule, amplifying forward and reverse primers

If one or more of the precursor sequences are pre-amplified prior to fusion rupture

In a preferred embodiment, a spacer molecule is fused to both amplicons from both sides (see Examples 1-3), so that these systems are the subject of Figure 1. In another preferred embodiment, for example: in the analysis of the influenza neuraminidase gene, fusion occurs on one side only (see Figure 4), on the other side, overlap fusion with sequences between the neuraminidase 2 region regions provided with primers extending into the other region. generated during pre-fusion PCR amplification (see Examples 4-5).

The product obtained by the sponing and amplifying POR is subsequently sequenced either directly or after purification. If desired, the PCR product is loaded in a known manner, e.g.

The sequencing itself is done in a known way,

The method of the invention is. has the following advantages over prior art processes;

1) Sensitivity enhancement: This is done by contrasting to the traditional longer p: MS; -scascus initial procedure by increasing the template for sequencing;

The number of fragments that can be labeled, Compared to the methods using overlapping pnmers, the sensitivity is improved by the fact that it is not necessary to transfer sequences complementary to other DNA strands to the target DNA strand, although the use of such overhang primers is necessary also reduces the size of the template due to its increased tendency to dlmer formation and degrades PCR: efficiency.

2) Reduction of allele blas: This can also be explained by reducing the size of the template necessary for sequence analysis and thus increasing the number of available DNA fragments, thus reducing the chance that only one of the multiple sequence variants will be randomly generated. .

3} Decrease in Artefact mutations; Increasing the number of DNA fragments consumed in combination with reducing the size of the template required for sequencing also reduces the amount of amplification required, while Nlindez also reduces the chance of polymerase bugs occurring,

4) Noise Reduction: When using overlapping primers, the sequence differences appearing in these phmers are incorporated into the fusion product. fused in the same manner as the DNA strand formed from the template sequence. The resulting non-template fused DNA strands also cause noise during sequencing. A. The process of the present invention both eliminates its occurrence and achieves significant noise reduction. By producing space r-mole cola in bacterial clans, the occurrence of different sequence variants in them is excluded, and by selecting the hybridization site for the spacer12 molecule, it

The process of the invention is applicable in a number of fields. One of its applications is the identification of gene sequences in plant, animal or human tissue samples containing fragmented DNA, such as the method of the invention. mutations in the H1 Ni influenza neuraminidase gene can be detected to guide therapy,

The invention further provides for the determination of the nucleotide sequence of fragmented nucleic acids which optionally contain mutations and which can be reliably detected by accurate sequencing. One typical area for this is the detection of mutations in fragmented DNA samples from tumor tissue.

The sequencing method of the present invention is particularly suitable for the reliable examination of tissue samples containing formalin-fixed, stored and consequently degraded fragmented nucleic acid. Typical applications are in the diagnosis of cancer and in the identification of genetic markers that influence the mode of treatment. Examples include, but are not limited to, known mutations in EGFR exons 18, 19, 20 and 21, KRAS, HRAS and NRAS 2, 3 and

Mutations in exon 4, mutations in BRAF exons 11 and 15, mutations in HER2 exon 19, mutations in PI3KCA gene exons 1, 9 20, KIT Mutations in exons S, 11, 13, exon 1, mutations in exons 12, 14, and 18 of POGFR-A, and genes 20, 22, 22 of the ALK gene. Mutations of exons 23, 24 and 2S.

In another aspect, the invention relates to kits for carrying out the methods of the invention. The kit of the invention may comprise, in addition to the instructions for use, a method of the invention employing a single PCR; one or more spacer molecules; or one or more spacer molecules and amplifying primers. If desired, the kit may also contain polymerase reagents and reagents needed to perform the POR.

In addition to the instructions for use, the kit may comprise, in addition to the instruction manual, one or more spacer molecules; or one or more spacer molecules and amplifying primers are fusion

-to;

PCR primers and amplifying primers are the first ones

-to. Desired falling spacer molecules, amphiliceal primers in the fusion phage can also contain the diphtherases and reagents.

The invention is illustrated in detail by the following examples, without limiting the scope of the invention in any way.

Examples;

The method of the present invention is illustrated by amplification and sequencing of a δ nucleic acid sequence, in 3 cases the human gene sequence has been tested in whales. The KRAS exon 2 and the most relevant regions of the EBRR 19 and 21 emu, due to the presence of mutations, were sought. For these assays, the starting nucleic acid was DNA. The other two gene sequences in our procedure were two sections of the influenza neuraminidase gene, whose mutations were associated with different levels of resistance to the major neuraminidase inhibitors (NI). As for RNA virus, the RNA was used as the tempo of the study. In designing a study of the drug-acting genes for influenza H1N1 influenza, we started with the gene sequences of the HI Ni Influenza viruses from 1977 to 2005. The assay set this way is. Capable of detecting all influenza cases from 1977 to 2008 Examining the neuraminidase gene of the 337 variant of the new type H1N1 influenza released in 2009, we found a significant difference from the earlier variants. Therefore, using the 337 gene sequence, we designed an assay optimized for the detection of a new type of H1N1 Influenza, which contains a few nucleotide deviations from the components of the 2008 MINI assay in the primer relay and template-specific portions of the spaer,

Is a Parameter of Diagnostic Systems Based on the Methods of the Invention? as shown in Table 1.

la: 'MMW Ípscsriáíw in amps to ho : "·; <·, A $: -, n''Sjsiasax 8S5S2Í: WsfeiSröfslıfJil · nta & nic acid hashali Íalifis lyrite ·, Ί KfíAS svon,> üartelápism: 3S5 SkiSiSiSiSiRiOr? 128 Sbff »SP- 2S2bfj L i 56R ÍSKW 19 · Horn f> f ' SSÖSlíÍisíÍ3: rí? M? H i;? · 77 bp bp X lyric SiOf '. 21 • «eme Sapiens eagle to "rf8sísSSa: skiing! 287 888? S & IIS 79SSP 4:; Itmotti v3í; iíW; i «915 cíwlsWí'sf Wii * "V ö? SFT 5th Ü · ÍÍÖUSU rfi & i W ivStfiS S9S sgyfcsS & Rs ;.? Ssp iVbjs aSáls

Table 1 Parameters of s // price, ken e / apo / h d / agnosos systems /. In the case of / náe-enza, the * ~ pa /, / e / δ / t W-ppp-sequence is not amplified, but rather the other / pén pén / / / / / 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14.

Effectiveness of Epace mmofekufa; For the diagnostic system A. we produced a forward and a reverse spacer molecule: "spacer"^> . For the forward spacer molecule backbone, we used the primer region M13F of the pCR2,1-TQPQ vector (Invitrogen) and for the reverse spacer molecule backbone the pENTR / HDTO vector (Invitrogen) backbone M13R,

Serve as the backbone of forward spacer molecules of pCR2,1-TQPO vector, SEQ ID MO: 1 (104 bp, gray shaded portion corresponding to forward amplification primer, black weekly portion on M13F sequencing primer: matching sequence) :

rVf-ATAGAGGGGGGrAACXiC'CAGGóWTZCCCAGrCACGAGGT AATTGTAATACGACTCACTATAGGGCGAAT'IWSCC-CTCTAG

AAAACGACGGCCAGI

Sequence sequence of SEQ ID MO: 2 (110 bp, gray shaded region corresponding to reverse amplification primer, black segmented on white with Mf 3R primer) as the backbone of pENTR / HI / TÖ vector:

GTG-G \: GA0-GTAACATG; v5AGATT-T ^? rGAGACACGGGCCAGAGC? GC ^ M ^^^ MOgM ^ .ITAATACGZiCTGACTATAöGGGATATCAGCTGGATGGGAAATAATG On both sides, QEP was fitted to this framework using diagnostic system-specific sequences. The vector sequence was inserted in the 3 'direction of the M13F or R primer complementary to the KRAS gene, followed by additional nucleotide sequences required for subsequent restriction cleavage. For forward spacer molecules, the reverse primer (SEQ ID MO; 3) used was (gray shaded: restriction enzyme cleavage site, underlined: sequence identical to the KRAS gene fragment, italics: complementary to the vector sequence pCR2, 1-7PÖÖ):

GATGGCCACAAGTTTAGATTGAGTCAÓGTTATAATCTAGAGgGGCCAZlTlWG

For reverse spacer molecules: For the following reverse primer (SEQ ID MO:

4) (gray shaded: restriction enzyme cleavage site, underlined:

Complementary to KRAS gene fragment, italics: sequence corresponding to vector pENTR / HI / TÖ):

GAlOeAAGAGTGCCTTGACGATACCWAGTTGGCATCCAGCTG

For the spacer molecule, the sequences needed to construct the same restriction site as the previous one were inserted on the 53 pages of the spacer molecule. For the forward spacer molecules, the following forward primer (SEQ ID NO: 5) was used (gray shaded: restriction site, italic) sequence corresponding to vector pCR.2,1TOPO).

CTPOGCCAGCGATTAAGríGGO-TAACGC

In the case of reverse spacer molecules, the following forward; primer (SEQ ID NO: 6) (gray shaded; restriction enzyme cleavage site, deletion: sequence complementary to the pENTR / H1 / TO veMon moiety):

esylate || G || II

Alignment was performed by PCR for forward and reverse spaeer molecules separately. The two reactions differed only in the primers used. The amphiphilic cleavage was performed in solutions containing pCRS-VTOPÖP and pENTR / H1 / TO vectors, AccuPrime Taq HIFI DNA polymerase (invitrogen, 0.02 U / pl), Ix t AccuPrime PCR buffer and 0.4 / vM forward and reverse primers. The POR contained the following cycles:

1. Cycle: {Ixj 1st step 64 ^s ü 1 ρ OOmp 2, cAlus-.DOx) 1st step Step 2 94 ^; 'C · üp 20mp 63' C0p 20mp Each cycle is stone sowing this cycle is 0.68 Step 3 U of 1 decreased 68 “C Op 40mp Cycle 3: (30x) 1st step Step 2 Step 3 94'C Op 20mp 63 ^c C Op 20mp 68'C Op 40mp Title 4: (30xj 1st step 6S ' ^: C Sp OOmp Cycle 5: (1x) 1st step 4 ° C ®

The resulting artificial sequences were cloned by ClonedET1.2 PCR with Clonino cooked (Fermenfas) and Top10 (Invstrogen). The pdETI.2 vectors containing the spacer molecules were isolated with MidiPrep. The forward spacer molecule was cut from the vector by the Mlu Nk reverse spacer molecule from the vector using restriction enzyme Ávlll (both Roche, 0.4U / pi incubated at 37 ° C for 16 hours) using the E-Gel SizeSelect (invitrogen) system, spacer molecules from gel We isolated.

The sequence of the spacer spacer molecule formed after restriction cleavage (SEQ 10 NO; 7) (137 bp, the gray shaded part corresponds to the forward amplifier primer, the part in black on white is the corresponding section of the W113F sequencing primer, the underlined KRAS gene sequence complementary to one part):

ISSAAGTGTAATAGGACTCACTATAGGGCGAATTGGCeCCTCGAGATTAr & AGAttXIACTGAA

TATAAACTTGTGG

The reverse spacer molecule generated after restriction cleavage (SEQ ID NO: 8) (134 bp, gray shaded part corresponding to reverse amplification primer, black underlined section corresponding to M13R sequencing primer, underlined KRAS gene) sequence complementary to the fragmentGTGCAATGTtWCZVfCAGAGATTyTGAGhGAOGGGCGAGAGCTGG ^^ BBWW ^ ggM || STAATAGGACTGAGyA? AöGGGA7ATGAGCTGGA7GGCAAA7AATGGTATCGTCAAGGCA

GTCTTGG

Samples containing fragmented DNA isolated from an immobilized sample were subjected to PCR amplification prior to fusion. The PCR conditions were the same as the Aforward primer sequence (SEQ ID NO: 9) used for the pre-killing of the spacer molecule:

GACATGTTCTAATATA.GTCACATTTTCATTA.TT, reverse primer sequence (SEQ ID:

10): TCTGAATTAGCGGTATGGTCAAGG VOtt.

As a result of the PCR, the following 120 bp amplicon (SEQ ID NO: 11 /) (gray shaded sequences matching the forward primer and reverse primerref, underlined) is the template specific part of the spacer spacer molecule and complementary to the template specific part of the reverse spacer molecule. black on white: locations of major KRAS mutations):

GAGATGGTCTAATATAGTCACATTTTCATTATTTTyATTATAAGATGACTGfekTATfekAGTT

GrrGG7AGTTGG ^ AGCTÍ | 7 ^ GTAGGCfi.AGAGTGCCT ^Í 7GACCATACAGe7AA ⁱ rTGAGA

Spacer-mo / ecu / s fezfená / fefesa: The forward and reverse spacer molecules were fused to the previous amplitude using PCR. In addition to the amplicons, the PCR solution contained the following components. AccuPhme Tag HIFI Self Polymerase (Invitrogen, 0.02 Ufel), Ix1 AccuPhme PCR Buffer and 0.4 pM Conc17 Forward Primer (SEQ ID NO: 12) (attaagttgggtaacgccagggttt) and Reverse Primer (SEQ ID NO: 13) ) (agattttgagac.acgggccag? \), forward and reverse -meleky padlock PCR okfat assembles Otherwise, one fifth of the volume is. WOx dilution of the PCR solution containing the snails and another fifth was the gel isolate of the spacer molecules. The PCR solution thus contained -0.012 pM-nyl forward and the same number of reverse spacers. The PCR contained below:

1, cycles: (1x)

2, tag: (Sx)

3, cycles: (35>

Cycle 4 x)

Cycle 5: (1x)

1st step

1st step

Step 2

Step 3

1st step

Step 2

Step 3 Step 1 Step 1

Mp 57 ° C 30sec 1min Oompa 6S ° C 94 ° C 30 sec 62 ° C Mp Mp 68C 30sec 68 ^° C 1min Oompa 10p Oompa 4 * 0 '

During the reaction, if the KRAS gene section of the sample did not initially contain a mutation in the following 288 bp fusion product (SEQ ID NO: 14) in the east hand (gray shaded forward primers matched and reverse prtmerref complementary sequences, black on white): sequences of M13E sequencing subspecies and those complementary to MISE prlmer, underlined: corresponding to the tempo-specific portion of the forward spacer molecule and complementary to the template-specific portion of the reverse spacer molecule, in black on white: most important KRAS mutations

ATTAAGTW'3GTAACdO ^ A? OmTTTCCC.? <4TCACQACGTSieSei ^ SSSöArt-T ηη / '- Γρ \ x · -: * -a .-' yx x, A. ► '-' • 'Τ'Ά nn Λ> v <. rw ^j AA · _Λ , -p _: v <-A <; ». y>, · y. xa A A.RX7vrtt A i Vri. (i Ainub '\ JVUAíü λ L. i 1 £ I

CTTGZGG ^, f7 \ G ^t r ^f rGGÁGC'I ^^ T ^^ CG'TAGGCAAGAGTGCC'TTGACGATACCATTA.T ^Í r ^! t ¹ GCCA ^, T

IggagoIIII

ATGGTCATAGCTÖTS'TCCTi

CCAGCTGATATCCCCTATAGTCAGTCGTATTAC

GCCCGTGTCTCAAAA ^ GT

Sequencing of fusion plateaus; Following fusion, the fusion product was purified with Exo-SAP-IT (USB) enzyme mixtures and subjected to bidirectional terminal reaction for BígDye Terminalor v3.1 Seguencing Kitel (Applied Biosystems) and M13F Primer (SEQ.

ID NO: 18) (tgtaaaacgacggccagt) and M13R primer (SEQ ID NO: 16) (caggaaacagccagag), The terminal reaction product was purified using BigDye XTermlnator (Applied Blosystems) kit and DNA sequences ABi Prism 3130 Gemsöc capillary electrophoresis.

Sequence analysis was successfully performed on E1 from paraffin-embedded formalin fixed sample Isolate containing fragmented DNA was successfully performed.

daddy

Spa e nding; Here, too, a forward and a reverse spa scan were prepared for the diagnostic system, as described in the first example, with the following modifications. During the QEP reaction, for the forward spaeer molecules, the complementary region to the EGER gene from the M13F primer 3 'and additional nucleotides for restriction digestion to the reverse primer below is required! (8EG: ID NO: 17): Aligned with vector sequence pCR2.1-TORQ (gray shaded: restriction enzyme cleavage site, underlined: sequence identical to EGFR gene set, italic font: complementary to vector sequence):

GAGTTAACTTTCTGAC € T? CTGGGATCCACTAGAGGGCC3AATV ^: CGG

For reverse spaeer molecules, use the following reverse primer! (SEQ ID NO: 18) (gray shaded: restriction enzyme cleavage site, underlined: complementary to the EGFR gene fragment, dotted: sequence corresponding to vector pENTR / Ht / TO):

GACAGCTGCTGTGCTGTGTGOGGG ^; rr3A ^f r3 ^: ATyTGCCAyCC ^ igTG With the latter printer, one of the guanines in the pENTR / Hh-TO vector in the molecule was replaced with cytosine (in the former the sequence was replaced by a black letter on a black background to eliminate the CAGCTG restriction site herein marked by spacer). Molecular ol For forward spaeer molecules, the following forward primer (SEQ ID NO: 19) was used to construct the restriction enzyme cleavage site for the vector pCR2.1-TOPQ (gray shaded: restriction enzyme cleavage site, italics); vector sequence sequence):

CTGTGAAGGCGATGyutGTGGGGAkSCGC

The reverse was used for spacer molecules to the following forward primer (SE ¹ 20) (shaded gray szőrkén the restriction enzyme cleavage site, italic: pENTR / HI ZTQ vector portion complementary sequence);

CTCAGCT ^ dTÖCAATörAACATCAŐAÖATTTK?

For restriction digestion, you use the Hpal enzyme for the forward spacer molecule and the PvoII enzyme for the reverse spacer molecule,

Sequence of the forward spacer molecule generated after restriction cleavage (SEQ IÖ NÖ; 21) (1.31 bp), the screen-shaded portion is the nucleus forward of the forward amplification primer, the black weekly moiety is the M13F sequencer, underlined by the EGER gene sequence complementary to one part):

AACGCGÁT1 AAGGTGÖGGAACGCCAGÖGTTTGGGCAGTCZ ^ CCACG jgGAATTGTAATACGACGCACTATAGGGCGAATTGGG € CCTCTAG? GGA? CCCAGAAGG? GA

GAAAGTT

SEQ ID NO: 22) (133 bp, gray-shaded part: corresponding to the reverse amplifying primer, black on white; section corresponding to the M13R sequencing primer, underlined: EGER) sequence complementary to a portion of a gene on a black background: the nucleotides exchanged in the vector sequence during the OEP t'GGGTGCZGrTG tFWCAOCAGAGATGTTGAGAG AGGGQOCAGAGCTGr jGTAATACGACTCAGTÁTAGGGGATGGGGGGGGGGAT

Fugue / bf n Amp; Samples containing fragmented DNA isolated from paraffin-embedded formalin-fixed specimens were PCR amplified prior to fusion. The PCR differed only in the primers used in the first example. The sequence of the förward primer was tctctstcatagggactctgga

GCCATGGACCCCCACAC (SEQ ID NO: 23), reverse

MO; 24), The PCR resulted in the following 147 bp amplicon (SEQ ID NO:

25) formed (gray-shaded sequences corresponding to forward primer and complementary to reverse primer, underlined; sequences corresponding to the template-specific part of the forward spacer set and complementary to the reverse-spacer mofecia with the tail specific tail 20, black on white: 19 most significant EG) sites affected by exon mutations):

TCkteTGTCArtG ^ GGACTCTGGA3CGCAGAAGGTGAGAAAGTGAAAATTCGCGTCGCGATCg ^ CGAGGGGAGTTTCTGGT

GAATTAAGAGAAGCA

GC T'GTGTGGGGGTCCATGGCC

Spacer mp / ek / s · fusion transfer: The PCR reaction described for the spacer math was used during the fusion with no gene mutation, the first pet fl in the sample tested in the EGER1 315 long fusion product (SEE ID NO: 28} coded sequences corresponding to the forward primer and complementary to the reverse primer, in black italics with white italics:

Sequences corresponding to the M13F sequencing primer and to the MÓR primer complement, underlined: sequences corresponding to the template specific part of the spacer spacer molecule and complementary to the template specific part of the reverse spacer molecule, in black normal white: most affected by EGFR mutations.

ATT \ A? TGTTGGGTAA.GGGC.AGGG ^Í ? T ^: r ': rc: CCAGTr: AGGACG''ll ^ gSMMM ^^ R <S: -Gv ^, r

TGTAATACÖACTCACTATAGGGCGAATTGGGCCCTCTAGTGGATCCCAGAAGGTGAGAAAGT

Oztcgatgtgagtttg ^ gctttggtcwtgggggtcattatttgccatccacgtgatatcc

CCT.ATAGTGAGTGGTATTA

AGCTCTGGCCGGTG'TCTCtkA

AATCT

Bead Protein Beat: Sequence Analysis Sequence Analysis of the Isolated Protein Fixed Sample from Paraffin Embedded in Paraffin as described in Example 1 was successfully performed.

.a £ dááZzE Gfekutek_c / öákdasa?; The diagnostic reverse spacer molecule was set up first: t ts one or more forward and one described, with the following modifications During the OEP reaction, for forward spacer molecules, this is the 3 'complement to the EGFR gene and is required for restriction cleavage. additional nucleotides were inserted at the following reverse primer (SEQ ID NO: 27) into the vector sequence pCR2,1 (BOLD) (gray shaded: restriction enzyme cleavage site, underlined: sequence identical to the EGER gene fragment, italic font: complementary to the vector sequence) ):

GAGGGGGCGCTGGGCAAAATGTGTGATCTTGACATGGC7AGAGGGCCCAA ^ mGC For reverse spacer molecules, the following reverse primer (SEQ ID NO: 23) was used (gray shaded: restriction enzyme cleavage site, insertional / d) matching sequence):

CT ^ WGGATGCAGAAGGAGGCAAAGGTGGOTGGáGCGOAZAGCC

For forward spaoer molecules, the following forward primer (SEQ IP NO: 23) was used to construct the restriction enzyme cleavage site on the other side of the pOR2,1-TGF6 vector sequence (gray shaded: restriction enzyme cleavage site, vector) sequence):

CTGCGGCCGCTGGCCAGCGATWiGTWGGAaACGC

For reverse spacer molecules, the following forward primer (SEQ ID NO: 30) was used (gray shaded: restriction enzyme cleavage site, italic font: sequence complementary to vector pENTR / H1ZTO):

GATGGCCAGTGCAATGTZfeGAGCAGAGAGTTGG

For lattice cleavage, the lysylNi enzyme was used for both spacer molecules,

The sequence of the spacer spacer molecule following the restriction cleavage (SEO ID NO: 31) (131 bp, gray shaded part corresponding to forward amplifier primer; part, black part in white letters corresponding to M13F sequencing primer, underlined EGER gene) sequence complementary to one part):

CCAGrlCfeTmAAGTTGGGTJBvCGGGAGGGTmpTCCCAGTCAGGACG'TM ^ MgjMiM g5AATTGTAAT.AGGACTCACTATaGGGCGAA? TGGGCCGTCTAGGCATG7CAAGA7CACAG

Sequence of reverse spacer molecule generated after restriction cleavage of ATTT7GGA (SEQ

ID NO: 32) (127 bp, portion shaded on filter; corresponding to reverse amplifier primer, in black on white; section corresponding to M13R sequencing primer, underlined; sequence complementary to part of the EGFR gene);

CGAGI'GeAATGTAACATCAGiiiilliBiBeBiiOGBWGC'tGCi

HA Lóvkcíivi OAû. λ Al Α \ - ^ ίρΛ> ΑÍ7 * i-á CAGk- A i-Π AskA- λΛ.Λ .. j. 1-u A ksVM

Oh

Fusion / hr pre-PCR PCR amplification: Samples containing fragmented DNA isolated from paraffin-embedded formalin-fixed sample were pre-PCR amplified, except that the PCR used was different from the one used in the first example. The forward primer had the sequence gaaaacaccgcaggatgtg (SEC ID NO: 33) and the reverse primer had the sequence aaaggcacctccttactttgc (SEC ID no, 34). The PCR resulted in the following 107 bp amplicon (SEQ ID NG: 35) (gray shaded sequences corresponding to the forward primer and complementary to the reverse primer, underlined: corresponding to the forward part of the forward spacer molecule and complementary to the feed specific part of the reverse sequences with white letters on a black background;

sites of major mutations in EGFR exon 21);

gaaaacagcggagcatgtcaagai'cacagattttgggcBggcca.aacígctgggtgcggaag ΑΟΑΑΑαΑΑΤΑΰ € ΑΤ00ΑδΑ ^ 0 ^^ ΒβίΒΐΙΙΙΙβ ||| βΙ

Oafása; By replacing the spaeer molluscs, the PCR reaction described in Example 1 was used during the fusion. If the EGFR gene section of the sample did not contain a mutation, the following 288 bp long fusion product (SEQ ID NG: 26) was generated (gray shaded sequences corresponding to forward primer and complementary to reverse primer, black italics, M13F sequencing primer, sequences complementary to the M13R primer, underlined: corresponding to the template specific part of the forward: spacer molecule and complementary to the template specific part of the reverse spacer-molecule, black normal white: sites affected by the major EGFR mutations):

ATTáUkGTTGCklTAACGGCAG TTTTGCCAGTCAGGA.C ^ ^^ ^ rg ^ M ^ GGR MlíSART

GGTAATACGAGTGACTATAGGGGGAAPGGGGGGCTCTAGGCAmGTCAAGATCACAGATTTTG

GQCSgGCCAAACSgCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAA.GTTGCC '

ATCCAGCTGATATCCCCTATAGTGAGTCGTATTAC

3CAGCTC

TÖGCCCGTGTC7CA? ^ ATCT

Sequencing of False Product: Sequence analysis was performed as described in Example 1 f.

sequence isolation from paraffin-embedded formalin-fixed sample We successfully performed the sequence analysis.

When designing the study of influenza H1 Nt influenza gene mutations, we started from the gene sequences of H1N1 influenza viruses from 1977 to 2005. The assay configured in this way is capable of detecting all Influenza occurring from 1977401 to 2008. While in the first 3 examples we have fused a spaoer from both sides to the am pl icons (thus applies to these systems in Figure 1), in the study of the influenza neuraminidase gene: only one side (illustrated in Figure 4). . On the other side, an overlap fusion was performed with the overlapping sequences between the 2 neuraminylidase gene regions, which were generated with primers extending to the other region, even during the pre-fusion PCR amplification.

Preparation of the Spaeer Molecule: A forward spaeer molecule was prepared for the diagnostic system, as described in the first example, with the following modifications. During the OEP reaction, the 3 ^S- direction complementary to the NA gene and additional nucleotides for restriction cleavage were inserted with the following reverse primer (SEQ ID NO: 37) into the vector sequence pCR2,1-TOP0 (gray shaded: restriction enzyme). cleavage site, underlined: sequence corresponding to the NA gene fragment, italics: complementary to vector sequence); GATTTAAAAACATCTCCTTTGGAGCC CTAGAGGGCCCAA TTGGG

On the other side of the vector sequence pCR2,1-TOPO, the following forward primer (SEQ ID NO; 38) was used to construct the restriction enzyme cleavage site (gray shaded: restriction enzyme cleavage site, italic font) sequence);

CATTTAAAGCÖA / J'Z'AAGTTGGGr.AACűC

For restriction digestion, the enzyme Orsi was used. During gel isolation, the -6 µg (4 weil) spacer molecule was collected alone in 1 ml of aqueous solution.

The sequence of the spacer molecule generated after restriction cleavage (SEG ID NO: 39) (128 bp, gray shaded part corresponding to torward amplification primer, black part on white) corresponding to M13F sequencing primer, underlining one part of the HA gene sequence): .Vfo.GCGATTAAGTTOÖGTAlkCGCCAGGSTTTTCCCzSGTC / SC.GACGT ^ illlllllg ^ g IjGAATTGTAATACGÁeTeACTATAGGGCGAATTGGGGeCTCTAGGGCTCeAAAGGAGATGT

Fusion mapping / pre-PCR amp; After isolation of the RNA, RT-PCR was used. Using GneStep RT-PCR Klt from Gíagen, the reaction solution was a 1x buffer at 400 µg dNTP each,,, Q4 / Ayu! enzyme mix, 0.6-0.6 / Al forward and reverse primer, 0.1 U / µl RHasin Plus RNAse Inhibitory-1 (Promega). RT-PCR contained the following eictosokaf:

1, cycles x) Clklus 2 (1x) 1st step S ^? C 30p? 9?? Cl ^? Clk 3; (40x) 1st step 94 ° C Op 3mp Step 2 56 ° C Op 30mp Step 3 ? 4C Op 45mp Cycle 4 x) 1st step 2 ° C top Oömp Cycle 5 x) ί 5> ^4c C *

The two regions of the NA gene were amplified in a separate reaction. The following primers were used in the areplaphysis precursor of the first gene repair:

ard: AAGACAACAGCATAAGAATGGGGTGe (SEG IG NO Reverse (in bold italics: the other gene region is CTATTSATTTGGiAGCTTGACCTAGAGGACASCTCAtTA (SEG emeuter part): tO NO: 41), vard

Primers used for amplification of the second gene region:

Letter: HAATCAATAGAGT-TGAATCCACCCAAT (SEG IO; GGATTGTCACCGAACACTCGACT (SEG ID NO

As a result of the amplification of gς's first genus prime

Bkon (SEQ ID NO: 44) was formed (Solomon lsands / 3/2006 virus > live and reverse pseudon; gray shaded by the complementary sequences, bold italics: underlining the spacer molecule) sequences corresponding to that of the most important mutations causing resistance to the neuraminidase blockade):

^ ^ AAGACÁACAGCATAAgMTT TCCAAAGGAGATGTTTTTGTCATAAGTlS iCCTTTCA'rA

TCATGTTCTCACTTGGAATGCAGAACCTTTTTTCTGACCCAAGGTGCTCTATTÁAATGACAA.

^^^ ACvVimCAAATGGGACCGS'AAAr gAGTCCIGGVrAGGACCTTAATGAGCTGTCCTCTAG

TAG & GGGAJáGCTCCAAATCA

Amplification of the second gene region resulted in the following 196 bp revenge amplicon (SEQ ID NO: 45} (taken from the PN-S of Solomon ls! And $ / 3/2000) as a template; gray-shaded for forward primer and reverse primer. lementer sequences, bold italics: complementary to the other gene region, in black letters on a black background: sites of mutations responsible for the most important neuraminidase inhibitors):

TGAA ^ ^ ^ CTCeAíáAOCAATAGAGTGGAATGCkX'CCAATTTT gTATGAGGAATGTS'CCTG'r

TACCCAGACACTGGCACAGTGATGTGTGTATGCSjKBGMjSSfeGGCATGGTTCA & ATCGACC

T? GGGTGT € T? TT; <aTG.AAAAC? TGGAT ^: IATCAAATAGGATACATCTGCAG'TGGAGTOTGG

GTGZvCAATGC

Spacer mo / euu / e and two coin ampoules (nzfona / wooda; fusion PCR solution AccuPrime Tag HIFI DNA Polymerase (Invitrogen, 0.02 U / pl), Ix ß AccuPrime PCR buffer and 0.4 pM forward primer (SEQ ID NO: 46) (ATTAAGTTGGGTAACGCCAGGGTTT) and reverse primer (SEQ ID NO: 47) (cactccactgcagatgtatcctattt). f0X dilution of the PCR solution containing the amphiponite, and the third one was given by the gel isophathase of the spacer molecules, using the 448 bp long fusion of Solomon lsNnds / 3/2006 as template if the sample did not contain the N1 resistance mutation. product (SEQ ID NQ: 48) generated (gray shaded: sequences corresponding to the forward primer and complementary to the reverse pumerus, in black with white italics: corresponding to the M13F sequencing primer) , underlined; sequence corresponding to the template specific part of the forward spacer molecule, black normal white on white: locations of mutations causing major resistance to neuraminidase blockers):

ATT ^ C ^ C ^ TAACvXOTGSOTTTCCCAGCCACGAC'ÍTHBBBBIHHBB ⁰ ^ '

TGTxAATACGAC ^: rCACTATAGGGCGAAT ^f PGG ^! GCCCTCG'AGGGCTCGAA, AGGAGATG ^, TT7T7G7 cataaga!

gCCTTTCATATCATGTTCTCACTTGGAATGCAGAACeWTTTTCTGACCCAAG ^{GTGGTgTATTAAATGACAAAGAT7GAAATGGGACCG:} rASAGgMÍfe.GTCCTTATAGGACC TTAATGAGCTÖTGCGCTAGGTGAAGCTCCAAATCAATAGAGTTGAATGCAGGCAATTTT TATGAG (SAATgTTCCTGTTACCCAGACAC GGCACAGTCATGTGTGTATGcMbA <^ BSTG GCATGGTTC, 4AATCGACCTTGGGTG7C TTTAATC; G7GN TTGGAT7ATCAAATAGGATAGA???

Λ X, i. Sequencing of Wk-itw ~ b-JI-iWi 4 .4 Fuser: The forward directional reaction with the M13F primer. while the reverse directs with the reverse primer used in product fusion

The other conditions of the assay were the same as those described in Example 1

The effectiveness of the sequence test was tested on 4 samples of influenza viruses: 2 sputum samples (according to nomenclature; ATI and AT samples) were taken from 2 patients infected with the influenza pandemic (caused by the Salmon-Slgetek virus variant in 2000) Specimens 3 and 4 are an injection of Son AB and Son P from Omninvest, which is an adsorbed suspension of three strains of an embryo grown on a hen's egg and one purified and concentrated strain of influenza inactivated on formaldehyde aluminum phosphate gel. The Son AB has a 2007 H1N1 (A / Brisbane / 59/2007), a 2007 H3N2 {A / Uruguay / 716/2007) and a 2008 tnfuenza containing 8 strains, the Son P has one contains a new type of HIV NI influenza A virus (A / Chifornia / 7 / 2Q9).

While pre-fusion RT-PCR was unsuccessful for influenza 2009, all three specimens containing H1N1 virus on or before 2008 (Figure 5). In all three cases, the merger was successfully completed. In the AB sample with the Boy, the sequence of the fused gene sequences was identical - downloaded from NCBI database - A / Brisbane / 59/200? base sequence of the corresponding gene regions of the neuraminylnidase gene. In the ATL and AT samples, there was only a few nucleotide differences in the homology with the neuraminidase gene of AZSolomon lslands / 3/2006, also downloaded from the NCBI database.

which has not been associated with resistance to the neuraminidase inhibitor (Ni);

Examining the neuraminidase gene of the 337 variant of the new H1N1 Influenza, released in 2009, we found a major difference from the earlier variants. Therefore, using the 337 gene sequence, we designed an assay compared to the assay described in the previous example.

Spacer Moisture / Transformation: During the OEP reaction, the 3 'complement of the M13F primer is complementary to the NA gene and additional nucleotides for restriction cleavage to the reverse primer below! (SEQ ID NO: 49) Aligned to vector sequence pCR2.1TOPO (gray; shaded; restriction enzyme cleavage site, underlined: NA gene fragments: identical sequence, dotted: complementary to vector sequence);

GATtb.VGKCACATGCOCCl ZuGAACCC'rA <? AGG? CCC.-t-dTeJC Iára a

The other side of the pCR2, t-TOPO vector sequence was the same as described in Example 4 for the construction of the restriction enzyme primer or spacer molecule.

The sequence of the spacer molecule following the restriction cleavage (SEQ ID 50) (128 bp, gray shaded part corresponding to the forward amplification primer, section in black on white, corresponding to the M13F sequencing primer, underlined in detail of the NA gene) , GCG.A7iódkdTTr? CkW.AS <GGCCAGGGTTTTGCCAGTCAC <.AAC: G ^Í r | eiili ^ Heil || GAAT7G: TAATAGGAC4'GACTATAGGGCGAA7TGGGGCeTGTAGGGTTCMAAGGíXíGATGT

GTTT

Fold / RCR Amplifier: RT-PCR on the RNA isolate differed only in the primers used in the first example.

The following primers were used in the amplification region of the first gene region;

Forwaró: AAAGACACAGAGAGAGAGAATCGGTTCCA (SEQ © NO: 51}

Reverse (in bold italics: the complement to the other gene region);

ÍGAA.CTTCA.CCAATAGGACAGCTCATTA (SEQ IQ Ni

Primers used in the amplification of the second gene region ·, forward (bold dot: part complementary to the first gene region):

Gksz ^ AASTTCCAAATCAGTCGAAATGAATGGGCC

Reverse: ggattgtctccgaaaatgcCzXCT (SEQ ID NO: 54)

As a result of the first gene region amphiphilic generator, the following 207 bp long amplicon (SEQ ID NQ: 55) was obtained (Cahfornia / 07/2009 vaus RNA as template): gray-shaded forward primer and reverse primer complementary sequences, bold italics complementary to the other gene region, underlined: sequences corresponding to the template-specific part of the spacer molecule, in black on white: locations of mutations that confer resistance to the major neuraminidase inhibitors):

AAAGAC2> ACAG ^f rGTAAGAATCGGT7GCAAGGGGŰATG? GT7? GTCA? AAGCgiCCA? TCA?

ATCATGGTCGCCCTTGíSAATGCAGAACCTTCTTCTTGACGGAAGGGGCCTTGCTAAATGACÁ

AACATT-CCtoVrGGAAGCATTAAA ^^ WlAGCCCATATCGAAGCCTAATGAGCZGTGCTATT

As a result of amplification of the second gene reticulum, the following 196 bp amplicon (SEQ ID NQ; 55) was generated (taken as template from Califnia / 07/2009 virus; gray shaded with forward primer and reverse primer complementary sequences in bold italics): complementary to the other gene region, in black on white: locations of mutations responsible for the major neuraminidase inhibitors):

rWdAArgTTCgAAATCAGTGGAAAGGAATCmCGCTAATTAllMTAZGAGGAATGCTGCGGT

RCCTGATTGTAGTGAAATCACA% T? G? ^ GTGTGC feA4 ^ STGGCATGGCGGGAATGGAGC

^^ GTGGGTGTeTTrGAACGAGAATCGGGAATAGGAGATAGGATAGATATGClI lllllli

ŰAGACAATCC mo / e.k, o7a and fbztenaitetas ampBon / á / oak; Fusion PCR only for reverse primer (aatgcgactgcagatgtatgctatcg) (SEQ ID NO:

57) was different from that used in Example 4. Taking the RNA of California / 07/2003 as a template, if the sample did not contain an NI resistance mutation, the following 448 bp long fusion product (SEQ ID NO: 58) is generated (gray shaded: forward primer and reverse primer complementary sequence) .

black italics: sequence corresponding to the M13F sequencing primer, underlined: sequence corresponding to the template specific portion of the fc-rward spacer molecule, black normal white: sites of major mutations conferring resistance to neuraminidase inhibitors):

TGTAATrXCŰACTCACTATAGGGCöAATTGGGCCCTCTAGGGTTCCAAaSGGGATGTGTTrGT CATAAC

ΟθηθΟΤΤΟΟ ^! ΓΑΆΑΤ (; ΑΓΑΆΑΟΑ ΤΖΟΑΆ η ··; ΑΑ <· Λ :: ΑΤΤΑΆΑ »ΆΟΓΟΓ ^^:? ΑΊ7 · ητ: ΟΑΆ € 0

GTAA7GAGCTGTGCGA7TGGTGAAG7C'eCAAATC: AGTCGAAATGAATGCCCGTAATTAT |||:

GArGAGGAATGCTCCTG? TATGCTGA? TGTAGGC: AA? G ^; ^ ^^ CACATGTGTGTGC FEAGA TG

GCATGGCTGGAATCGAGCGTGGGTGTGTTTCAACICHWZGkTCTGGAATATCAGATAGGATACA

TATGCAG'XSGGGATT. Sequencing of Fus Core: The forward terminating reaction was performed with the M13F primer and the reverse direction with the reverse primer used on the product side. Other conditions for sequence analysis were as described in Example 1.

The method of testing the gene regions of the novel H1N1 neuraminidase gene was tested on RNA isolated from the Boy P vaccine produced by Omnimvest. The vaccine contained an inactivated horseradish of the new type A / Celororaa / 7 / 2Q9. The test method worked well in this case as well (Figure 6). The virus-specific sequences of the fusion product were identical to the base sequence of the corresponding regions of the neuraminidase gene A / California / 7/2009, downloaded from the NCBI database.

In the method according to the invention, the reduction of the allele bias and, consequently, the increase of the sensitivity were demonstrated in the following model.

Method:

According to pathologist's advice, DNA was isolated from FFPE-million cells containing 30% tumor ratio. In the sample, sequence analysis after 2 independent (conventional) PCR reactions revealed a median frequency of the tree mutant allele of the exon 21 exon 2573T> G = LS58R of the EGFR gene. The sample was subjected to the traditional step (g) (ΙΟχ) dilution of the dilution, the diluted sample was subjected to conventional (nested PCR following normal PCR) and f10-10 parallel mutation assays using the new method of the invention.

For conventional PCR, the following primers were used for the first amplification: forward: tact-tggaggaccgtcgcttg (SEQ ID NO ', 59), reverse (SEQ ID NO: 60): ggzgcctggtgtcaggaaaaL · Following the reaction, the solution was diluted to 25x, maid in a volume of one-fifth of the nested PCR mix. The following primers were used for nested PCR; forward (SEQ ID NO: 61): AGCCRGGAAGGTACTGGTGAAAAC, reverse: GCTGGCTGACCTAAAGCCACCT (SEQ ID NO: 62). The other two parameters of the PCP solution were the same as those described for the preparation of the spacer molecule of Example 1. In the tests with the new method, the procedure described in Example 3 was followed. The sequences of the amphiphones produced by the two methods are shown in Figure 7. The sequences of the final products of the two methods are identical The signal intensity of the allelic variants is given by the values read from the preprograms.

The results of the assay screening assay are shown in Figure 8. In conventional nested PCR, 8/10 tubes showed gel product after the first PCR, and nested PCR resulted in gel images in all 10 tubes. Using the new technique, all 10 tubes produced a gel image after the pre-amplification PCR. All 10 products were successfully fused in Step 2.

The 10-10 products of Method 2 were successfully sequenced from both directions. In the conventional method, the mutation appeared in 5/10 cases (in 4 cases at 100% allele ratio), thus the sensitivity was 56%. It was 42%, and the standard deviation was 50%. With the new method, the mutation appeared in 9/10 cases, which corresponded to 90% sensitivity. While the average allele ratio of the mutant signal was 42%, the standard deviation was only 23%.

Claims (19)

Patent Claims A method for determining the sequence of a fragmented nucleic acid by an POR ampile sequence of an edge sequencer and subsequent sequencing of dldoxox, comprising the following steps; isolating cells containing the nucleic acid or nucleic acid to be sequenced from a biological sample e) Thus, our FCR reagent performs fusion and amplification of the target sequence using one or more artificial 70-220 bp spanning-73 molar pathways. mugatta kommemenk · mm-mm, egv isgaiabo 3e contains up to 120 bp spacer region, a sequencing primer complementary region and an amplification primer complementary sequence, and the resulting PCAt products are optionally sequenced after purification. The method of claim 1, wherein in step b) a spacer molecule is used wherein the template complementary region is 20-30 bp, the sequencing primer is 15-40 bp and the amplifier primer is 15-40 bp. 3. A method for identifying fragmented nucleic acids by two-stage amplification of a sequence of PCA and subsequent field deoxygen sequencing, comprising the steps of: j) sequencing the cells containing the nucleic acid or nucleic acid from a biological sample. b) carrying out a first PCR PCR to amplify the target sequence, followed by a second PCR to fuse and amplify the amine. wherein one or more artificial 70-220 bp long epaeer OES molecules are used which, in the 'm' direction, comprise a complementary stretch of amplicon, a spacer region of at least 20 bp up to 120 bp, a sequence complementary to a sequencing primer, and a sgy amplifier. contains a primer complementary region, wherein the ′ end of the sequence corresponding to the amplitude of the AmpiAonnean complement region begins at the template enMS Ö -7 ö more distant in the ′ -min, the ′ end of the amplifying primer complementary region, and dl PCiá producteh optionally after purification. szekvenaüuk. The method of claim 3, wherein a spacer molecule is used in the ej step. wherein the complementary section of the Templars is 20-30 bp. the sequence complementary to the sequencing primer is 15-40 bp and the complementary region to the amplifier is 15-40 bp. 5, 1 or 3, On demand method wherein a In step j, the nucleic acid to be sequenced Iz collapse can be neglected. 6 claim 1 thousand procedure, abof that step a) s ze kvená 1 a ndö n oki e irma va t Isolate it from the biological sample 7. The 1st or 3rd, According to claim 1 procedure where that step a) cells containing the nucleic acid to be sequenced are separated from the biological sample 8. The method of claim 7, wherein the bleaching is performed using a laser mlcrodisector, The process of claim 1 or 3, wherein the spaser molecule used in step bt or ej is single-stranded or double-stranded: DNA. 10. The method of claim 1 or 3, wherein a single spaoemmoethel is used in step bj or c). The method of claim 1 or claim 3, wherein step bt or ej is applied with two, one tonne and one reverse spacer nvdecul. The method of claim 3, wherein in step b) a second, nested PCR is also performed. 10. The = -12. The method of any one of claims 1 to 4, wherein in step d, sequencing is performed on the PCRA Children's Pest. 14, Spaoer Molecules 1-13. Process according to any one of claims that 70 - 220 bp comprising successively and ^3S -5 ^S direction: - a nucleic acid or amplicon complement (20-30 bp) complementary to one of the vegenium mutants of the food sequence, a DNA stretch spanning at least 20 - up to 120 bp. which comes first; section ensures that the S 'end of the sequencing primer matches, more * ν \ ο' η ^Λ raa χ e-? ' t \? mm \ m? . ? ' er - a sequence complementary to a sequencing primer ( 15-40 bp) and - an amplifying complementary region (15-40 bp) complementary to the primer, p. The antenna spaoeram melecola of claim 14, which is single-stranded or quilted The spaoenolayer according to claim 14 or 15, which is a forward or reverse packet molecule, 17, pp. 1-13. using a method according to any one of claims 1 to 6 for the identification of genotypes in plant, plant or tissue tissues containing fragmented DNA. 18. Use according to claim 17, for the identification of the neoramyrididase gene of influenza HI.Nt in a human tissue sample containing fragmented DNA. Use of the method according to any one of claims 1 to 13 for the identification of molars in fragmented DbIS specimens derived from the fibula, 94 Saturation of Ά yes; rt> mknim, to identify om Kro $ 'omoruvian mutations, The use of claim 19 for the identification of a workshop in exoma 3GFR 19 and / or 21, The use of claim 19, wherein the DNA is formatted by formatting. 23. A reagent preparation for carrying out the process of claim 1, comprising the following, together with an instruction manual; one or more spacolymers according to claim 14; obsession - one or more spacer and amino acid primers for use in the PCR according to claim 14, and, in appropriate cases, the polymerase and reagents necessary for the PCR. A reagent kit for carrying out the method of claim 3, comprising, together with an instruction manual, the following; • 49? or more of the spacer molecule of claim 14: or one or more spacer molecule of claim 14 and the amylphase primer for the fusion PCR; obsession one or more spacer molecule amplifiers of claim 14 for the fusion PCR and amplifier primers for the first amplifier PCR; and, in particular, the polymerases and reagents required for the PCR reactions.