HU225375B1 - Reactive solid state carriers and production and application of them - Google Patents

Abstract

A method is described for the preparation of solid substrates suitable for immobilizing nucleic acids, proteins and oligonucleotides, via reactive groups found on links-forming branched molecules. These substrates may be employed in generation of various low and high density nucleic acid-, protein-, and oligonucleotide chips, as well as, for other molecular, biological and diagnostic applications.

Description

The present invention relates to a process for the preparation of solid supports capable of immobilizing unmodified nucleic acids, proteins and oligonucleotides through reactive groups located on branched linker molecules. The solid carriers of the invention are capable of covalently binding unmodified nucleic acids, proteins and oligonucleotides. The solid supports thus prepared can be used to generate various low and high density nucleic acid, protein and oligonucleotide chips, and for other molecular biological and diagnostic applications. The invention further relates to the solid supports thus prepared and their uses.

Solid carriers capable of binding nucleic acids, proteins, and oligonucleotides have become particularly important tools in various molecular biological research. Anchored single- or double-stranded longer DNA molecules or short synthetic oligodeoxynucleotides for gene expression assays (e.g., US 6,040,138), for detection of polymorphism (e.g., US 5,858,659), for DNA sequencing (e.g., US 6,025,136), for diagnosis of diseases, 5,861,242 or US 6,027,880 for the diagnosis of cystic fibrosis) and for the analysis of the gene pool. A number of bonding methods have been developed based on different chemical mechanisms and bonding strategies.

In order to allow covalent attachment of the oligonucleotides to the carrier, the oligonucleotides are usually provided with a functional group. (can be modified with a terminal mercapto, amino or carboxyl group at the 5 'or 3' position. More specifically, the addition of a mercapto, amino or carboxyl group allows, for example, that the oligonucleotide is a disulfide, maleimide, amino, carboxy, Binding is carried out on a support containing ester, epoxy, bromocyano or aldehyde, which is formed by the formation of disulfide, thioether, ester, amide or amine bonds between the oligonucleotide and the support. or the preparation of a polymer-coated solid support for small organic molecules and ligand arrays, wherein the polymer contains amine, carboxyl and / or hydroxyl functional groups.

EP 386 229 discloses a process for the synthesis of oligonucleotides on a solid support, wherein the oligonucleotide is stably bound to the support via a terminal phosphate group of a covalent phosphodiester linker.

Beier M. and Hoheisel J. D. [Nucleic Acids Sl. 27 (9), 1970-1977 (1999)] discloses the derivatization of solid supports to form a covalent bond on a DNA array or DNA microarray, which increases the surface of the support with a branched linker. Designing this linker requires a four step reaction. In addition, the functionalized surface containing the linker must be activated before immobilization with an activating reagent such as PDITC, DSC or DMS. Although PCR products, DNA oligomers, PNA oligomers can be effectively coupled to the surface thus formed, the stability of the bonds is very different and it can be deduced that only weak covalent linkage can be established via one of the internal amino groups of a DNA molecule.

High density oligonucleotide arrays (hereinafter arrays) linked to a solid support are disclosed, for example, in European Patent Nos. EP 373,203 and 619,321, U.S. Patent Nos. 5,744,305 and 5,445,934.

The binding of the molecules to be immobilized, called probes, can be of different strengths and stability. A number of substances have been studied which may be capable of targeting nucleic acids [e.g., Rasmussen S. R. et al. Biochem. 198: 138-142; Salo H. et al., Bioconjug. Chem. 10: 815-823 (1999)], but most commonly glass or plastic disks are used to create DNA and oligonucleotide based bands [McGall et al., Proc. Natl. Acad. Sci USA 93: 13555-13560 (1996); Beier M. et al .: Nucleic Acids Sl. 27, 1970-1977 (1999)].

Although several methods for linking oligonucleotides and proteins to different surfaces have been reported, these methods are both costly and time consuming. Modified oligonucleotides are always used to covalently attach preformed oligonucleotides to modified glass surfaces in order to increase the reactivity and selectivity of the oligonucleotide towards the surfaces. As mentioned above, typical modifications include the introduction of amino groups or mercapto groups at the 3 'and / or 5' sites. For example, Stimpson et al., P.N.A.S. 92, 6379-6383 (1995)] discloses covalent coupling of 3'-amino oligonucleotides to epoxysilylated surface by acid catalysis, but only a low density is achieved by this method. Lamture et al., Nucleic Acids Slit. 22, 2121-225 (1994)] described a method for coupling 3'-amino oligonucleotides to epoxysilylated glass plates in 0.1 M KOH. Heterobifunctional crosslinks are used to link 3'- or 5'-mercapto-modified or amino-modified oligonucleotides to aminopropylsilane surfaces by Chrisey et al., Nucleic Acids Sl. 24: 30311-3039 (1996) and Guo et al., Nucleic Acids Res. 22: 4556-4565 (1994). However, the above procedures all require modified oligonucleotides.

U.S. Patent No. 5,919,626 discloses a method for coupling unmodified nucleic acids to silanized solid phase surfaces. In this case, the surface of the solid support is coated with mercapto-silane or epoxy-silane and the unmodified nucleic acid molecule is linked to the surface bearing the silane-coated thiol or epoxy groups via the terminal 3'-OH or the terminal 5'-OH group, or creating ether bonds. The oligonucleotide coated surfaces can be used ge2

EN 225 375 Β1 for net analysis and other screening procedures such as protein-DNA binding assays.

A disadvantage of the above procedure is that in methods where terminal 3'-OH groups are required, since they are partially blocked, the sensitivity of the method is reduced. A further disadvantage may be that the near-surface portion of the probed nucleic acids bound by this procedure is difficult to access for the sample to be tested, e.g., by hybridization, and consequently the number of specific bonds may be reduced.

Recently, Smith et al. Have described a method where chemically synthesized oligonucleotides are linked to a hydrogenated silicon surface via 10-aminodecene using a heterobifunctional chemical linker [Nucleic Acids Slit. 28: 3535-41 (2000). However, in this process chemically modified (thiol modification) oligonucleotides are used and the use of the solid support used requires special tools, fluorescence detection methods are difficult to carry out.

It is an object of the present invention to provide a process for the production of a generally usable, inexpensive solid support which can be used in techniques, sequencing, and identification of polymorphic sites based on various hybridizations. The present invention accomplished this task by attaching a branched linker molecule to the silazinated surface and attaching reactive groups thereto. Thus, the active surface of the support is increased, while spacer linker molecules provide better probe accessibility to the sample, and it is possible to form stable covalent bonds between the active surface and the probe molecules.

Thus, the present invention provides a novel immobilization process suitable for the rapid and cost-effective immobilization of unmodified nucleic acids, protein molecules and oligonucleotides on a solid support. The nucleic acids thus fixed can be used for hybridization-based sequence detection, sequencing of the tested nucleic acids by hybridization, genetic analysis, gene expression studies and combinatorial analyzes of interactions between different nucleic acids, proteins and low molecular weight molecules.

In the process, the solid support is derivatized in three steps by reacting the first step with 3-methacryloxyalkyl trialkoxysilane to form acrylic groups on the surface of the solid support. In the second step, the acrylic silylated surface is reacted with tetraalkylene pentamine to form branched chain molecules containing primary and secondary amines. In the third step, the resulting surface is reacted with acrylic acid chloride to form a branched and amide bonded molecule with reactive acrylic groups in place of the amino groups. In the third step, it is also possible to form a hydrophilic or hydrophobic surface containing active epoxy groups on the support obtained in the second step. To form the reactive hydrophilic surface, the support obtained in the second step is reacted with 1,4-alkanediol diglycidyl ether or epichlorohydrin to form the hydrophobic reactive surface. This results in a branched-chain molecule that has reactive epoxy groups in place of the amino groups.

To create DNA chips or arrays, the unmodified nucleic acid, protein, oligonucleotide or oligopeptide is coupled to the carrier thus activated.

The covalent bond formed between the solid support and the binding molecules results in high stability. The method allows the binding of synthetic oligodeoxynucleotides, oligoribonucleotides and oligopeptides to a solid surface containing a reactive acrylic or epoxy group. The reactive groups are attached to the solid support at high density through branched linker molecules, which allows the formation of high concentrations of the immobilized probe. The carrier of the present invention is covalently bound to the desired nucleic acid or protein molecules so that they have a high stability and a constant probe concentration on the surface.

Furthermore, unlike most conventional methods of covalently attaching probes to the surface of a solid support, there is no need to modify the nucleic acids or PCR products or oligonucleotides to be bound. Therefore, this method makes it much cheaper to produce large volumes of samples.

A further advantage of the process according to the invention is that no further chemical reaction is required during the immobilization, such as the reduction used in the known processes. This has the additional advantage that probes containing reduction sensitive groups (e.g. various fluorescent compounds) can be attached to the solid support without any damage or modification. Thus, nucleic acids containing at one or both ends redox-sensitive fluorophores or other signaling molecules can be readily fixed by the present invention.

The process of the invention can also influence the hydrophobicity of the surface of the solid support, which can directly influence the density of the array to be formed. In the case of a hydrophilic surface, application of a probe to a robot results in higher points, which results in a relatively lower density (1-2 thousand points / cm ² ), but this may be advantageous in subsequent hybridization. In the case of a hydrophobic surface, the probe can be applied to the substrate at smaller points but with a higher density (3-6 thousand dots / cm ² ), but this is less advantageous than hybridization.

SUMMARY OF THE INVENTION The present invention relates to a process for the preparation of a solid support for the covalent bonding of unmodified oligonucleotides, nucleic acid and protein molecules, to a solid support so prepared and to its uses.

The process of the present invention comprises (a) reacting a chemically prepared solid support with 3-methacryloxyalkyltrimethoxysilane, washing and drying at 90-130 ° C,

(B) reacting the thus-acrylic silylated support with tetraalkylene pentamine, then (c1) reacting the thus obtained support with acrylic acid chloride in the presence of an acid scavenger, or (c2) alkanediol diglycidyl ether or epichlorohydrin in the presence of an acid scavenger, washed and dried.

The invention further relates to a process for the preparation of DNA chips comprising the steps of (a) - (c): (d) attaching an unmodified nucleic acid, protein or oligonucleotide molecule to a carrier thus activated.

Suitable solid supports for the process of the present invention are glass plates, polystyrene or polypropylene plates, preferably glass microscope plates. Commercially available plates containing reactive aldehyde groups (Arrayit, USA) or poly-L-lysine coated plates (SIGMA) were used as control solid supports. Preparation of the plates involves etching with sodium hydroxide and then simply washing it with water to neutralize.

In the first step of the process, it is preferable to react the etched glass sheets with a lower aqueous alcoholic solution of 3-methacryloxypropyltrimethoxysilane, such as 95% aqueous methanol or ethanol, followed by the alcohol and water used. washed and dried at 100-110 ° C.

In the second step of the process, tetraalkylene pentamine is used as tetraethylene pentamine. This reaction is carried out in an apolar solvent such as dimethylformamide or dioxane, preferably dimethylformamide, and the plates are washed and dried with dimethylformamide and a lower alcohol.

In the third step of the process, the resulting plates are reacted with acrylic acid chloride in the presence of an equivalent amount of an acid-binding base such as diisopropylethylamine, pyridine and the like in an apolar solvent, preferably dichloromethane, dichloroethane and the like. Finally, the plates are washed with the solvent used and dried.

To form the surface containing the active epoxide groups, the plates obtained in the second step are reacted with 1,4-butanediol diglycidyl ether in a lower alcohol containing a base, preferably ethanol containing sodium hydroxide, and then washed with the alcohol used to obtain a hydrophilic surface containing epoxide groups. Alternatively, the plates may be reacted with epichlorohydrin in a base non-polar solvent, preferably pyridine-containing chloroform, to obtain a hydrophobic surface.

The reagents used in the process of the invention are commercially available.

The solid carriers produced by the method of the invention are particularly useful for generating oligonucleotide arrays (oligonucleotide-based DNA chips) which can be sequenced based on hybridization of nucleic acids, hybridization of sequences of tested nucleic acids, genetic analysis, for combinatorial analyzes. The properties of the microscope slides derivatized by the method of the invention allow high density, high order fixation of unique sequence synthetic oligonucleotides, longer nucleic acids or proteins and their use in DNA and protein chip technology.

The figures are briefly described below.

Figure 1 shows the detection of a single mutation (point mutation) or a single nucleotide mismatch by hybridization on an acrylic surface using the solid support of the invention;

Figure 2 illustrates the detection of PCR products based on hydration on the acrylic surface of the carrier of the invention and on the carbonyl surface of the commercially available carrier;

Figure 3 shows the relationship between immobilization efficiency and pH;

Figure 4 shows the immobilization of a protein (Cy3 cyanine fluorescent dye-labeled streptavidin) on a solid support of the invention on an acrylic surface;

Figure 5: Mass spectrometric analysis of the reaction of acrylamide with adenosine and cytidine;

Figure 6: Mass spectrometric analysis of the reaction of acrylamide with guanosine and thymidine.

Mass spectrometry was used to verify that the oligonucleotides were covalently attached to the surface. Acrylamide was used to mimic the surface and oligonucleotides were replaced with monomeric nucleosides. The reactants were incubated under protocol conditions.

Following the reaction, new peaks related to the product (acrylamide and the actual nucleoside together) appeared in addition to the starting materials (acrylamide, adenosine, cytidine, guanosine, thymidine) (Figures 5 and 6). These mass spectrometry experiments have shown that covalent bonding occurs between the reactive groups of the solid support and the nucleic acid bases.

By way of example, the activated solid carriers of the present invention can be used in the following assays.

1. Mutation analysis based on hybridization

The solid support of the present invention is capable of immobilizing synthetic oligonucleotides capable of detecting a single point mutation. Oligonucleotides having a defined sequence are capable of identifying them by hybridizing to complementary strands containing the point mutation (e.g., US 6,025,136). The probe oligonucleotides may be immobilized on glass or polystyrene plates. Single mutation or single nucleotide mismatch in hibri4

The detection of HU 225 375 Β1 by the solid support of the present invention is shown in Figure 1.

2. Detection of PCR products by hybridization

Covalently immobilized nucleic acid molecules can be used to detect specific PCR products by hybridization, wherein the "catch" probe is immobilized on the solid phase (Ranki et al., Gene 21: 77-85 (1983) and Keller et al., J. Clin. Microbiol 29: 638-641 (1991). The sample containing the putative target molecule, which may be a PCR amplified sequence - is then contacted with the solid phase, whereby the surface-bound probe oligonucleotide is capable of hydrating and thus identifying the target molecule in the sample. The method is suitable for the identification of single-stranded or double-stranded PCR products denatured with heat or alkali. Non-complementary fibers in the sample do not interfere with the reaction. The results of using the solid support according to the invention for this purpose are shown in Figure 2. It can be seen from the figure that using a conventional solid support which binds the modified oligonucleotides through the carbonyl groups produces a much smaller signal. The solid support of the invention allows for a much more sensitive reaction when detecting PCR products by hybridization. Preferred sequences for Chlamydia and human cytomegalovirus pathogens have been used in the present invention. The sequences of the oligonucleotides used as probes are given in Table 1.

3. Genetics Bit Analysis (GBA ™)

The solid support of the invention is capable of immobilizing synthetic oligonucleotides that can be used in the genetic bitumen analysis method (WO 92/15712) in which a single nucleotide mismatch (polymorphism) can be detected.

4. Solid-phase DNA sequencing

The solid support of the present invention can also be used in the solid phase DNA sequencing method described by Khrapko, K.R. et al., DNA Seq. 1, 375-388 (1999)] and Drmanac R. and Crkvenjakov R. (Int. J. Genome Rés. (1991) 1.1-11.

5. Detection of point mutation by ligase reaction with so-called "Oligonucleotide Ligation Assay-OLA"

The solid support of the present invention is also suitable for immobilizing synthetic oligonucleotides that can be used in a so-called "Oligonucleotide Ligation Assay - OLA" method combined with a ligase reaction (Landegren U. et al., Science 241: 1077-1080 (1988)). This method allows even more specific nucleotide mismatch detection than GBA ™ due to the ligase reaction following hybridization.

6. Use of immobilized protein molecules

The solid support of the present invention is suitable for the covalent immobilization of synthetic peptides, higher molecular weight polypeptides, proteins which produce high density, ordered protein chips, protein-protein, protein-nucleic acid, protein-low-molecular-weight compounds. Biochem. 270: 103-111 (1999); Nucleic Acids Slit. 28: 3 (2000); Curr. Opin. Chem. 5, 40-45 (2001)].

The invention thus also relates to the use of a solid support according to the invention for the identification of PCR products, genetic bit analysis, genetic bit analysis by ligase reaction, and the generation of an oligonucleotide or DNA or protein array.

The invention is further illustrated by the following non-limiting examples.

Example 1

Preparation of a solid support containing reactive acrylic groups

Preparing discs

Commercially available microscope slides were allowed to stand for 24 hours in 1% aqueous NaOH (Molar Chemicals Ltd., Hungary; purity > 98.5%), followed by water, 10% aqueous HCl (Molar Chemicals Ltd., ) And then again with water until the wash solution was neutral. The plates were then dried at room temperature.

Step a) Creating an acrylic silylated surface

The etched glass slides prepared as described above were reacted with 3% 3-methacryloxypropyltrimethoxysilane (ICN Biomedicals Inc., Aurora, Ohio) in 95% aqueous methanol for 2 hours. The plates were then washed with methanol and water, dried and heated at 105 ° C for 15 minutes.

Step b: Formation of an aminosilylated surface

The acrylic silylated plates obtained in step a) were incubated for 48 hours in a solution of tetraethylene pentamine (Fluka, Germany) (0.033 mmol / ml) in dimethylformamide (Fluka, Germany) so that the surface to be converted was covered by the solution. The plates were then washed with dimethylformamide followed by methanol and dried at room temperature.

Step c) Creating a surface containing reactive acrylic groups

The plates obtained in step b) were dissolved in 60 ml of dichloroethane (Merck, Germany) with 2 mmol of acrylic acid chloride (ICN Biomedicals Inc., Aurora, Ohio) and 2 mmol of diisopropylethylamine (ICN Biomedicals Inc., Aurora, Ohio). ), Incubated for 2 hours, then washed with dichloroethane and dried at room temperature.

Example 2

a) Preparation of a hydrophobic solid support containing active epoxy groups

The plates obtained in Example 1 (b) were reacted with 30 mmol of epichlorohydrin (Fluka, Germany) dissolved in 55 ml of chloroform (Molar Chemicals Ltd., Hungary; purity> 99%). in the presence of 2 hours, then washed with chloroform and dried at room temperature.

HU 225 375 Β1

b) Preparation of a hydrophilic solid support containing active epoxy groups

The plates obtained in Example 1 (b) were reacted with 30 mmol of 1,4-butanediol diglycidyl ether 5 (Fluka, Germany) in 55 ml of ethanol (Molar Chemicals Ltd., Hungary; purity> 99.7%). It was washed with NaOH for 2 hours, then with ethanol and dried at room temperature.

Example 3 10

Preparation of High Density Oligonucleotide Array

In one experiment, high density application of the oligonucleotide solution was performed using a MicroGrid Total Array System (BioRobotics, England) robot. In the other experiment, the application was done by hand using a pipette. The amount of fluid applied by the robot is approx.

100 µl, while the volume applied with the pipette was 0.4-1.0 µΙ. After test application, the plates were irradiated with ultraviolet radiation (700 mJ) using UV crosslinker (Ultra Lum). The prepared plates were stored in the dark at room temperature.

Example 4

Hybridization assays

Prior to hybridization, the plates were incubated at 42 ° C for 30 minutes in prehybridization solution (2 * SSC, 0.5% SDS, 1% BSA). The pre-treated plates were then washed with water and dried at room temperature.

Hybridization was performed under a microscope cover plate.

Fluorescent dye-labeled oligonucleotides were applied in 30 (10 pmol or 0.5 pg) hybridization buffer (50% formamide, 5xSSC, 0.1% SDS, 100 pg / ml salmon sperm DNA), which was pipetted under the cover plate. After hybridization, the cover plate was removed and the plates were washed with 1x SSC, 0.15% 35 SDS, 0.2xSSC, 0.15% SDS, 0.1xSSC. Each wash was performed for 5 minutes. Plates were then dipped in water, dried and read with a Scan Array Lite (GSI Lumonics) confocal fluorescent laser scanner at 10 µm resolution. Each plate was excited with a green laser (532 nm) (for Cy5 fluorescent labeling) or a red laser (for Cy3 fluorescent labeling) and the emitted light was read.

Example 5

Investigation of the relationship between immobilization efficiency and pH

To determine the optimum pH for immobilization of the nucleic acids, Cy5 fluorescently labeled oligonucleotides dissolved in various pH buffers were applied to the solid support prepared in Example 1. The results are shown in Figure 3. The optimum pH of the immobilization was 10. The application was done manually using a pipette (0.5 pl). Two different dilutions of oligonucleotide were applied to the vehicle: 0.25 pmol / μΙ and 0.062 pmol / μΙ.

Example 6

Immobilization of protein

To determine if the carrier of the invention is suitable for protein immobilization, 1 μΙ of a 0.5 mg / ml solution of Cy3 fluorescently labeled streptavidin was added dropwise in phosphate buffer at pH 7 and 10. The plates were incubated for 30 minutes in a steam-saturated atmosphere at room temperature and then washed with water and 1xSSC, 0.15% SDS for 5-5 minutes. The plates were scanned after each wash to determine the amount of molecules immobilized (bound) on the plates. The results obtained are shown in Figure 4. From the figure it can be seen that pH 10 η is very well bound to streptavidin and therefore the carrier according to the invention is suitable for immobilization of proteins.

Table 1

oligonucleotide

Oligo's name Sequence Features (length) AREV-M1 5'-CCTGTGTTAAATTGTTATCCGC-N H ₂ -3 ' 1 mutation [22] AREV-M2 5'-CCTGTTTGAAAT ΓΤΊ TATCCGC-NH ₂ -3 ' 2 mutations [22] AREV-M3 5'-CCTGTTTGAAATTTTTATCCTC-NH ₂ -3 ' 3 mutations [22] 3 'A-AREV 5'-CCTGTGTGAAATTGTTATCCGC-NH ₂ -3 ' No mutation [22] 5 'A-AREV 5'-NH ₂ -CCTGTGTGAAATTGTTATCCGC-3 ' No mutation [22] AREV CCTGTGTGAAATTGTTATCCGC 5'-3 ' No mutation [22] Cy5 AREV 5'-Cy5-CCTGTGTGAAATTGTTATCCGC-3 ' No mutation [22] AR17 GTGAAATTGTTATCCGC 5'-3 ' No mutation [17] MC-AR17 GTGAAATTCTTATCCGC 5'-3 ' 1 mutation G-> C [17] AR17-MA GTGAAATTATTATCCGC 5'-3 ' 1 mutation G-> A [17] MT-AR17 5 GTGAAATTTTTATCCGC-3 ' 1 mutation G-> T [17] AR17-M2 GTTAAATTTTTATCCGC 5'-3 ' 2 mutations [17] Cy5-REV GCGGATAACAATTTCACACAGG 5'-3 ' Complementary [22] C1 5'-NH ₂ -TATTGTACCATCAATTAATAA-3 ' Chlamydia test [21]

HU 225 375 Β1

Table 1 (continued)

Oligo's name Sequence Features (length) C2 5'-NH ₂ -ATCTACGGCAGTAGTATAGTT-3 ' Chlamydia test2 [21] R2 5'-NH ₂ -GATCGATTAAGTTCCTCGTTCGC-3 ' Random [23] M1 5'-NH ₂ -GGCGCCTTTAATATGATGGGAGGA-3 ' CMV test1 [24] M2 5'-NH ₂ -CCTTTCGAGGAGATGAA-3 ' CMV test2 [17] CPF 5'-Cy5-TTACAAGCCTTGCCTGTAGG-3 ' Cy5-Chlamydia 5'-primer [20] CPR GCGATCCCAAATGTTTAAGGC 5'-3 ' Chlamydia 3'-primer [21] MPF CGGCATAGAATCAAGGAGCACATGC 5'-3 ' CMV 5'-primer [24] MPR 5'-Cy5-AAGGCTGAGTTCTTGGTAAAGAAC-3 ' Cy5-CMV 3'-primer [24]

Note: bold underlined characters denote altered nucleotides in mutant oligonucleotide sequences.

Chlamydia probes include Ranki et al., Gene 21: 77-85 (1983) and Keller et al., J. Clin. Microbiol. 29, 638-641 (1991).

Claims (12)

A process for the preparation of a reactive solid support comprising: (a) reacting a chemically prepared solid support with 3-methacryloxyalkyl trialkoxysilane, then washing and drying at 90-130 ° C; reacting, washing and drying the acrylic silylated support with tetraalkylene pentamine, (c1) reacting the resulting support with acrylic chloride in the presence of an acid scavenger, or (c2) the resulting support with 1,4-alkanediol diglycidyl ether or in the presence of a solvent, washed and dried. 2. The process of claim 1, wherein the solid support is glass or polystyrene or polypropylene sheets. 3. The method of claim 2, wherein the solid support is glass microscope slides. 4. The process of claim 1, wherein the chemically prepared solid support in step a) is a glass microscope plate etched in sodium hydroxide and washed neutral. 5. A process according to claim 4 wherein in step (a) is 3-methacryloxypropyltrimethoxysilane, in step (b) tetraethylene pentamine and in step (c1) acrylic acid chloride and diisopropyl. as soon as we apply. 6. A process according to claim 4, wherein in step (a) 3-methacryloxypropyltrimethoxysilane, in step (b) tetraethylene pentamine and in step (c2) 1,4-butanediol diglycidyl ether and sodium hydroxide are used. The process of claim 4, wherein 3-methacryloxypropyltrimethoxysilane is used in step (a), tetraethylene pentamine in step (b) and epichlorohydrin and pyridine in step (c2). A reactive solid support for immobilizing an unmodified nucleic acid, protein, or oligonucleotide as defined in any one of claims 1-7. A process according to any one of claims 1 to 6. 35 Use of a reactive solid support according to claim 8 for the preparation of nucleic acid, protein or oligonucleotide arrays or streaks. Use of a reactive solid support according to claim 8 for mutation analysis, detection of PCR products, genetic bit analysis or genetic bit analysis by ligase reaction. Use of a reactive solid support according to claim 8 for use in gene expression assays, disease screening or diagnostics. 12. A method for immobilizing nucleic acids, proteins or oligonucleotides, characterized in that (i) amino acids 1-7. A process according to any one of claims 1 to 6, for preparing a reactive solid support, and (Ii) an unmodified nucleic acid, protein, or oligonucleotide molecule is attached to the support thus activated.