HU219505B - Method for targeting plant derived intracellular proteins to the extracellular space and enhancing antipathogenic effect of such proteins - Google Patents

Abstract

The present invention relates to methods of directing plant-derived antracellular proteins into the extracellular space of a plant or plant and to enhancing the anti-pathogenic, primarily antifungal, effect of plants by directing the anti-pathogenic anti-cellular protein into the extracellular space. The 3 'terminal end of the open reading frame encoding the C-terminal for localization is modified. ŕ

Description

The present invention relates to methods for targeting intracellular proteins of a plant to the extracellular space of a plant or a cell of a plant and enhancing the anti-pathogenic, especially antifungal, effect of the plants on the extracellular space of the anti-pathogenic intracellular protein.

Plant proteins with antifungal activity are known in the art. Chitinase purified from beans inhibits the growth of Trichoderma viride (Schlumbaum et al., Natur. 324, 365-367 (1986)).

Mauch et al. Describe a pea salt chitinase which inhibits growth of Trichoderma viride in an agar plate assay (Plant Physiol. 88: 936-942 (1988)). However, this enzyme has only a limited effect on the growth of, for example, Cladosporium cucumerinum of the order of Ascomycetes, and has no effect on growth of, inter alia, Phytophthora cactorum, Ruthium aphanidermatum and Pythium ultimum of the order Oomycetes. Thus, one major disadvantage of this enzyme is that it has a limited range of action. In a similar study, p-1,3-glucanase was found to have similar growth inhibitory activity against Fusarium solani f. sp. for pee.

Young and Pegg describe a preparation which has a hydrolytic action on isolated cell walls of Verticillum alboatrum and which comprises a combination of endo-β-1,3-glucanase purified from tomato and exo-β-1,3-glucanase purified from fungi [Physiol. Plant Pathol., 1982, 21, 4111-423. None of the enzymes affects its own host.

Bohlman et al. (EMBO J., 7, 1559-1565 (1986)) describe a number of thionines, including thionine isolated from barley, corn, wheat, oats and various dicotyledonous plants, which have significant antifungal activity in in vitro assays.

Further, WO 89/02744 describes proteins that enhance the antifungal activity of antibiotics. These vegetable proteins are commonly referred to as synergistic antifúngal proteins (SAFPs). SAFPs are used in combination with polyoxins and nicomycins, which themselves are active against phytopathogenic fungi; in combination with SAFPs, they can increase their effect by 10 to 100 times. SAFPs alone have no antifungal activity.

In plants, the synthesis of chitinases and glucanases, as well as a large number of different pathogenesis-related (PR) proteins, is known to be accompanied by a hypersensitive response, initiated inter alia by an incompatible plant pathogen. This hypersensitivity reaction eventually results in the plant becoming resistant to a large number of pathogens. Similarly, the synthesis of PR proteins can be induced by a number of biotic and abiotic factors, such as fungal cell wall fragments, chemical inducers such as salicylate, and the like, which are also manifested in broad plant pathogenic resistance. This resistance, which can be induced by either an incompatible pathogen or a biotic or abiotic factor or chemical, is called "induced resistance". Although much remains to be learned about induced resistance and the role of these PR proteins, some classifications have already been made. In tobacco, treatment with tobacco mosaic virus (TMV) appears to induce at least 5 types of PR proteins. This classification is based on properties such as molecular weight, serological linkage, homology of amino acid sequence and, if known, enzymatic activity. Within these classes, further subdivisions can be made into intracellular and extracellular proteins, which, apart from their localization in the plant cell, correspond to each other based on the above-mentioned properties [Bol. J. F. et al., Annu. Port. Phytopathol. 28: 113-138 (1990)]. Because these proteins are believed to play a role in pathogen resistance in some way, great efforts have been made to identify potentially antipathogenic proteins in the PR protein family.

To date, screening, isolating and approaching antifungal proteins is screening for PR proteins based on known properties such as molecular weight, e.g., (isoelectric point), or enzyme activity. This is especially true for chitinases and P-1,3-glucanases, whose substrates are found in the cell wall or outer envelope of most pathogens and / or pests.

One disadvantage of this approach is that there is either no or very little correlation between enzyme activity (i.e., chitinase and glucanase activity) and antifungal activity, which often results in unnecessary isolation of proteins which are subsequently found to have no significant antifungal activity. The second disadvantage is that it is often more difficult to isolate PR proteins whose activity or function is known, which is the case with most PR proteins.

Therefore, there is a need for efficient and reliable methods and methods for amplifying the anti-pathogenic property of plants.

It has now been found that the antigenic activity of the antigenic proteins isolated according to the invention can be enhanced by targeting the intracellular protein having the antigenic activity to the extracellular space. The plant-derived intracellular protein has been shown to contain a C-terminal portion of 15-20 amino acids which provides for intracellular localization of the protein. Further, it has been discovered that modifying the 3'-terminus of an open reading frame encoding a C-terminal can prevent its protein from localizing in an intracellular space such as a vacuole. The anti-pathogenic intracellular proteins have predominantly antifungal activity, preferably chitinases, p-1,3-glucanases, osmotin-like proteins and PR-proteins such as PR-1.

The invention also relates to the production of transformed plant material containing a gene product and its secretion into extracellular space. The present invention also provides the use of recombinant polynucleotide sequences and vectors in the above methods.

HU 219 505 Β

The figures are described below.

Figure 1 shows AP20 and osmotin II from tobacco (Singh et al., 1989, supra) and osmotin I (Singh et al., 1987, supra) and osmotin (Tosm) from tomato (King et al. , 1988, supra).

Figure 2 is a schematic representation of the expression vector pMOG189.

Figure 3 shows the binary vector pMOG404; LB = left side of T-DNA, RB = right side of T-DNA.

According to the invention, the protein having an antigenic effect is produced from a plant by:

1) preparing an extract from a plant with induced resistance;

2) determining, in an anti-pathogen assay, whether the extract contains anti-pathogenic activity;

3) purifying the antigenic activity by fractionation of the extract by protein purification methods and an antigenic assay method;

4.) the protein nature of the pathogenic activity is demonstrated.

As used herein, the term pathogenic refers to any organism capable of causing disease or other effects on a plant, such as, for example, reducing growth, development, biomass, viability, nutritional value, or attractiveness of the plant. Such organisms include nematodes, fungi, bacteria, viruses, and pests such as insects.

An antigenic assay must include an assay to determine whether an extract or fraction has an antigenic effect by adding an aliquot of said extract or fraction to the culture medium or to the nutrient in which the pathogen is present. allowing germination and / or development and / or growth under conditions which permit germination and / or growth and / or development of the pathogen and evaluation of the anti-pathogenic effect resulting from the presence of said fraction.

The antifungal proteins of the present invention can be isolated from plants by the following steps:

1.) treating the plant with an incompatible pathogen, a biotic or abiotic factor, which causes induced resistance in said plant;

2) preparing a leaf extract from said plant;

3) desalting the leaf extract and incubating at 4 ° C;

4) centrifuging the incubated leaf extract;

5.) in an aliquot of the leaf extract supernatant obtained in step 4), assaying for antifungal activity by incubating said supernatant with the fungus against which the protein having activity is sought under conditions suitable for said fungus. growing and / or germinating and comparing the growth and / or germination of the fungus thus incubated with that of a fungus incubated without antifungal activity;

6) fractionating said supernatant by one or more non-denaturing protein fractionation methods; and

7.) selecting the fractions which exhibit antifungal activity by examining an aliquot of the fractions as described for the supernatants in step 5);

8.) further purifying said selected fraction using one or more non-denaturing protein fractionation methods;

9.) if necessary, repeat steps 7) and 8) until the antifungal protein is substantially free of other proteins.

During purification, the fungal activity of the antifungal activity may be assayed by heating and / or protease treatment and the like. If possible, after sufficient purification of the antifungal activity and determination of the protein, some physical parameters such as molecular weight, isoelectric point, hydrophobicity, enzymatic activity and the like can be determined to more selectively select the next fractionation or purification procedure. , and get the best cleaning results. The choice of the optimal combination (or combination) of protein purification techniques based on these physical parameters is well within the knowledge of one skilled in the art of protein purification. It is believed that, depending on the plant material used and the antifungal protein that is being purified, some effort may be required to select the optimal conditions, which is not an unreasonable, unnecessary experiment.

Once the antifungal protein is sufficiently pure, its activity range can be tested for other fungi, which may be other plant pathogenic fungi, animal or human pathogenic fungi, bacteria, nematodes, and the like. In each case, the optimum values for concentration, pH and ionic strength for stability and / or antifungal activity can be determined.

The method can be applied by using other plant material in step 1), including other parts of the same plant, such as roots, stems and the like, as well as another plant variant or species. Preferably, a plant line, variant or species that exhibits induced resistance should be selected.

If the antifungal protein is substantially free of other proteins and / or other materials, the (partial) amino acid sequence of the antifungal protein may be determined. By converting the amino acid sequence to a nucleotide sequence, a probe set can be chemically synthesized to isolate cDNAs or genomic clones that encode the antifungal protein (or a portion thereof) and which can in principle be used to produce plants that f

EN 219 505 Β are less sensitive. For this purpose, an open reading frame, i.e., a cDNA or DNA fragment encoding an antifungal protein (or portion thereof), is suitably linked to elements required for expression in the plant cell. If the antifungal protein is an intracellular protein, the open reading frame is altered such that the protein is released into extracellular space after expression.

For illustration purposes, isolation and identification of an osmotin-like protein and subsequent cloning of cDNA encoding that protein are shown. In addition, this typical method provides a method for producing a transgenic plant less susceptible to fungi by high expression of an open reading frame encoding said osmotin-like protein in said plant. Furthermore, it is shown how this normally intracellular osmotin-like protein can be directed to the extracellular space by the method of the present invention and thereby provides an increased antifungal activity in the plant in which it is produced.

Obviously, where osmotin-like proteins are named, they are merely illustrative of the method and results of the present invention and are not intended to limit the scope of the invention to osmotin-like proteins. Therefore, the use of other antifungal proteins of the present invention is within the scope of the invention.

It has been found that by treating plants with an incompatible pathogen, thereby inducing a hypersensitivity reaction, a few days after inoculation, leaf extracts can be prepared which yield fractions having a strong antifungal activity. It has been found that in many fractions derived from tobacco and tomato, the fungal inhibitory effect is not due to β-1,3-glucanases or chitinases, since no further glucanase or chitinase activity could be detected in the further purified fractions having antifungal activity. The antifungal effect proved to be sensitive to heat. The tobacco-derived active component was found to have a basic isoelectric point (pl) of a hydrophobic protein having a molecular weight of about 24 kD and was designated as AP20 (also referred to as AP24). After purification of AP20 and determination of its amino acid sequence, this part was found to be identical to the corresponding part of osmotin, a known protein found in tobacco (Singh, N.K. et al., Plant Physiol., 85, 529-536 (1987); Sing, N. K. et al., Plant Physiol., 90, 1096-1101 (1989)] and is one of the proteins known as osmotins, also known as osmotin-like proteins. Osmotin-like proteins are named for their ability to synthesize, among other things, osmotic adaptations of plant cells to media containing high concentrations of sodium chloride, potassium chloride, or polyethylene glycol, but the osmotinic process is a protein-dependent protein. Accumulation does not occur in the presence of (some) non-osmotic agents, such as cadmium chloride [King et al., Plant Mol. Biok., 7,441-449 (1986)].

In tobacco, two osmotins have been described, osmotin-I, a water-soluble form, and osmotin-II, a detergent-soluble, relatively protease-resistant form. Osmotin from both tobacco has a molecular weight of about 24 kD, very similar in amino acid composition, and similar to a 24 kD protein from a tomato (Lycopersicon esculentum) and other proteins, including thaumatin from Thaumatococcus daniellii, tobacco-related pathogenesis. protein (PR-S) and a bifunctional maize trypsin / α-amylase inhibitor. Osmotin-like proteins, all serologically related and having molecular weights of osmotinins isolated from tobacco and tomato, have been described, inter alia, in millet, soybean, beet (Daucus carota), cotton, potato (Solanum tuberosum) [Singh et al., Proceedings Sciences, USA, 84, 739-743 (1987)], alfalfa (Medicago sativa) and beans (Phaseolus) (King et al., Im.).

Until now, the effect of osmotin was unknown. In general, it has been suggested that the function of osmotins is to provide plants with osmotic resistance at low water content (see, e.g., Grosset et al., Plant Phys., 92, 520-527 (1990)).

Similarity in physical parameters, i.e., almost identical molecular weight, amino acid sequence identical to tobacco-derived osmotin-II, and nearly identical to tobacco and tomato (NP24), is also the corresponding pI-value. , it was concluded that the AP20 antifungal protein is in fact an osmotin. To test the hypothesis that the antifungal activity is a common property of osmotin-like proteins, we tested whether a tomato-derived osmotin-like protein, known as NP24, could inhibit P. infestans. NP24 has also been found to have antifungal activity.

It is therefore concluded that osmotin-like proteins derived from tobacco and tomato have antifungal activity and are therefore suitable for use in an antifungal composition. Given the high homology between osmotin-like proteins in the plant world, other osmotins other than tobacco or tomato are presumed to have antifungal activity.

Osmotins or osmotin-like proteins are those whose amino acid sequence homology to tobacco-derived osmotin is more than 70% or more, preferably greater than 80%, and their synthesis is correlated with the adaptation of plant cells to high concentrations of NaCl, and at least one fungicide. The antifungal activity is defined below as any single fungus

EN 219 505 Β germination, growth and / or differentiation, and any effect that diminishes the viability and / or infectivity of the fungus.

Osmotins are produced by exploiting the possibility of inducing the synthesis of these proteins, for example by infecting the plant with an incompatible pathogen, which may be a virus, bacterium or fungus. However, it is not necessary to infect the plants with pathogens. Other methods of inducing osmotin synthesis may be used, such as exposing the plants or cultured plant cells to sodium chloride and / or polyethylene glycol. This results in high concentrations of osmotin in the cells; accumulation can be up to 12% (Singh et al., Plant Physiol. 85: 529-536 (1987)). Osmotin synthesis can also be induced by treating plants or plant cells with ABA (Absic acid) (Singh et al., 1987, Proceedings of the National Academy of Sciences, USA, 84, 739-743).

Plants from which osmotins can be isolated include millet, soybean, cotton, tomato and potato (Singh et al., 1987, Proceedings of the National Academy of Sciences, USA, 84, 739-743; King et al., Plant Mole. Biol. 10, 401-412 (1988)], but osmotins (osmotin-like proteins) from plants other than those mentioned above are also satisfactory if they exhibit proper homology to the osmotin of the tobacco or can be compared with the physical parameters of the osmotin of the tobacco. In a preferred embodiment of the invention, the material of tobacco plants (including cell cultures) subjected to a stress factor such as an osmotic agent, drought or a pathogen, preferably tobacco mosaic virus (TMV), is used to isolate osmotin-like proteins. ), or from plant material that has been infected with Phythophthora infestans or treated with arachidonic acid.

Isolation of osmotin-like proteins may utilize commonly known protein fractionation techniques (or combinations thereof), such as centrifugation, chromatography, electrophoresis, and the like. For preparative purposes, techniques employing non-denaturing conditions are preferred. In a preferred embodiment of the invention gel chromatography and ion exchange chromatography are used in combination with hydrophobic interaction chromatography, whereby elution is followed by UV spectrophotometry. The resulting fractions can be tested for growth inhibitory activity of pre-germinated or non-germinated fungal spores, which fungi are sensitive to osmotinic proteins such as fungi of the genus Phytophthora, preferably Phytophthora infestans. The spores (1 and 100 spores per microliter, preferably 5 and 20 spores per microliter) can be assayed on a suitable nutrient medium such as potato glucose agar (PDA) and the like. The development and growth of the fungus can be easily determined by staining the mycelium at intervals after addition of the fraction; the presence of the antifungal factor can be determined in comparison with the fungal spores incubated with the control preparation. Fractions that show a thermosensitive antifungal activity can be analyzed for their osmotin-like protein, molecular weight (using electrophoresis), and / or immunoblotting techniques such as those derived from tobacco-derived osmotin or pathogenesis. protein (PRS). Osmotin-containing fractions may be further fractionated, for example, using hydrophobic interaction chromatography (HIC) or high performance liquid chromatography (HPLC); these techniques achieve almost complete purity. By the method described herein, it is possible to isolate osmotin-like proteins from any plant containing said proteins.

By inhibiting fungal growth, osmotins can be used, for example, for preserving foods, cosmetics, or pharmaceuticals or pharmaceuticals, dissolved in water, for spraying houseplants and agricultural crops, and for preserving fruits, vegetables, and other crops for a limited period of time. should be inhibited under conditions suitable for osmotins. Thus, osmotine may be administered alone or in combination with a suitable carrier or, if desired, in combination with other antifungal agents in the form of powders, granules, aerosols, solutions, gels, or in combination with other solvents or carriers.

A combination of osmotins and other antifungal agents, such as classical antifungal antibiotics, SAFPs, and chemical fungicides such as polyoxins, nicomycins, carboximides, aromatic carbohydrates, may also be used in formulations such as to broaden the field of action. , carboxins, morpholines, inhibitors of steroid biosynthesis, organic phosphorus compounds, enzymes such as glucanases, chitinases, lysozymes and the like. When used alone or in combination with other active ingredients, osmotin is used in a concentration that achieves its ultimate goal, generally at a concentration of 1 pg / ml to 100 mg / ml, preferably 5 pg / ml to 5 mg / ml, 3.0 to pH 9.0. In general, the use of buffered formulations is desirable, for example at a concentration of 1 mM to 1 M phosphate buffers, preferably 10 mM to 100 mM, particularly preferably 15 mM to 50 mM, although at low buffer concentrations it is desirable to add salt to increase ionic strength, e.g. chloride at a concentration of 1 mM to 1 M, preferably at a concentration of 10 mM to 100 mM.

In a specific embodiment of the present invention, transgenic plants are obtained which have reduced fungal susceptibility due to the constitutive expression of a gene encoding one or more osmotin-like proteins in one or more plant parts.

It is either expressed constitutively at the same time as an osmotin gene and, for example, a glucanase and / or a chitinase gene or the like is extracellularly expressed in one or more parts of the plant. In addition to the genes found in tobacco (Singh et al., Plant Physiol. 85: 529-536 (1987)), and in tomato, i.e. the gene encoding NP24 (King et al., Plant Mol. Biol. 10, 401-412 (1988)], osmotin genes are found in millet, soybean, potato, tomato, beet, cotton and others and can be used for such purposes. By employing known techniques, one of ordinary skill in the art will be able to isolate genes or cDNAs encoding osmotin-like proteins from various plant species using a polynucleotide probe, such as an osmotin gene fragment from tobacco, or a synthetic oligonide based on a known sequence of an osmotin gene. By employing well-known techniques, one of skill in the art can amplify the resulting osmotin gene fragment, determine the nucleotide sequence of the DNA fragment, and then clone the gene fragment or cDNA into a vector containing the appropriate sequences for the gene fragment in one or more parts of the plant. expressed. If such an expression construct is appropriately added to plant material, it results in transformed plant material, which can then be used to regenerate complete transformed plants that express a gene or gene fragment encoding an osmotin protein, or a portion thereof, in a plant or portion thereof.

A preferred method for isolating a DNA fragment containing an osmotin gene or a portion thereof is the use of the polymerase chain reaction (PCR) technique described by Maniatis et al., Molecular Cloning; Laboratory Manual, Cold Spring Harbor Laboratory Press, 2nd Edition (1989)]. Starting from a published sequence of an osmotin gene or a nucleotide sequence determined from a known amino acid sequence of a purified osmotine, any desired gene fragment can be generated, for example, by means of synthetic oligonucleotides complementary to the 5 'and 3' regions of the desired fragment. If these oligonucleotides are allowed to hybridize in vitro to the plant DNA or to a cDNA library (preferably derived from plant cells subjected to pathogenic or osmotic stress) as a hybridization starter molecule and carry out some polymerization cycles, can be selectively amplified. The primer molecules may be synthesized to include internal restriction sites which correspond to the ends of a linearized cloning vector to ensure easy ligation of the amplified fragments into the vector. The isolated fragment can then be cloned and further manipulated. Thus, combinations of fragments from genes of different osmotin-like proteins, including fully synthetic fragments of such genes, can be linked together to form a single open reading frame encoding a chimeric osmotin-like protein.

For expression of the newly introduced protein in a plant, a transcriptional promoter must be inserted into the expression construct; may use, inter alia, the CaMV 35S promoter, the so-called T-DNA promoter or plant promoter, optionally with one or more enhancer fragments. Generally, strong constitutive promoters are used which are functional in all or most parts of the plant, although tissue-specific or differently regulated or otherwise regulated or inducible promoters can be used. A controllable, i. E., Tissue-specific promoter may be advantageous if, for example, the phytopathogenic fungus affects only certain parts of the fungus or infects only certain parts of the plant. In addition to the plant-based promoter and coding sequence, other regulatory sequences are required in the expression construct, such as transcriptional enhancers, translational enhancers such as the leader sequence of the TMV RNA genome [Gallie, DR et al., Nucleic Acids Research, 16, 883-893. (1988)], mRNA stabilizing sequences such as the RNA4 leader sequence of mucosa virus (A1MV), introns, a transcription termination and polyadenylation signal such as the nopaline synthase terminator (Tnos). It is known how these elements can be utilized in an expression construct to effect the desired expression of a gene. To further optimize gene expression, it may be desirable to use a genomic clone instead of a cDNA clone. Alternatively, if necessary, a synthetic intron may be inserted into the cDNA sequence.

In order to obtain all of the fungal inhibitory effects, it is sufficient, in principle, to achieve strong constitutive or specifically regulated strong expression of an osmotin-like protein gene in the transgenic plant or parts thereof. The wild-type osmotin-like protein is thought to accumulate in vacuoles of the plant cell. It has been found that when the wild-type osmotin-like protein is expressed, an antifungal activity is observed.

In the method of the invention, the intracellular osmotin (like) protein is targeted to the extracellular space by altering the gene encoding it. A possible way to achieve this is by removing about 20 C-terminal amino acids from the wild-type primary translation product encoded by the osmotin mRNA, which is likely responsible for intracellular localization. Removal of the C-terminal portion of the protein can be achieved, for example, by incorporating a translation stop codon into the gene to prevent transcription of the codons located at the 3 'end. Alternatively, the C-terminal portion of the osmotinic protein may be altered relative to the wild type to inhibit its proper function. The open reading frame can also be extended to provide wild-type osmotin-like protein6

EN 219 505 Β to prevent the C-terminal from working properly resulting in extracellular orientation. The method by which the protein is released from the cell per se is not critical to the invention as long as the modification of the protein does not diminish its antifungal activity.

In tobacco leaf discs, for example, it has been found that altering the targeting of the osmotin-like protein results in a significant enhancement of the antifungal activity of P. nicotianae var. nicotianae fungus.

In some cases, it may be desirable to produce plants containing both a wild-type gene encoding an intracellular osmotinic protein and a gene encoding an osmotinic protein in the extracellular space to further enhance the antifungal activity.

Accordingly, one object of the present invention is a method of directing an intracellular attachment of a plant to an extracellular space of a plant or a cell of a plant, wherein said intracellular protein comprises a C-terminal portion that provides for intracellular localization of its protein. the 3 'terminal end of the open reading frame encoding the C-terminal portion of its intracellular protein is modified to prevent the intracellular localization of the intracellular protein normally provided by the C-terminal portion.

Preferably, the intracellular protein is an anti-pathogenic or antifungal protein.

A further object of the present invention is to provide a method of enhancing the anti-pathogenic effect of an intracellular, anti-pathogenic protein derived from a plant comprising directing its intracellular protein into the extracellular space. Preferably, said alignment is achieved by modifying the 3'-terminal end of an open reading frame encoding an intracellular protein. The intracellular protein is preferably a kininase, P-1,3-glucanase or an osmotin-like protein.

The invention further relates to a method for preventing extracellular transfer of a target peptide, which comprises expressing a cunar peptide derived from said target peptide and Gln-Ala-His-ProAsn-Phe-Pro-Leu-Glu-Met-Pro-Gly It was prepared from a C-terminal peptide having the sequence Ser-Asp-AgluVal-Ala-Lys or a portion thereof. The DNA sequence or vector encoding the chimeric peptide may also be used in this method.

A still further object of the present invention is a method of delivering a protein having a sequence which is naturally directed to the vacuole at its C-terminus, which naturally directs its protein into the plant vacuole, into an extracellular space of a plant comprising:

a) isolating a DNA sequence comprising an open reading frame encoding said protein together with the vacuolar leader sequence at its Cterminus;

b) removing the DNA sequence encoding the vacuolar leader sequence from the open reading frame by generating a modified DNA sequence encoding the protein without the C-terminal amino acids;

c) introducing the modified DNA sequence obtained in step b) into a suitable plant expression vector;

d) transforming the product of step c) into a suitable plant; and

e) cultivating the plant thus obtained under appropriate conditions while the protein encoded by the modified DNA sequence obtained in step b) is expressed and secreted.

Such proteins are preferably pathogenesis-linked proteins such as chitinase, glucanase, PR-1 protein and osmotin, more preferably osmotin, most preferably osmotin in tobacco. Preferably said plant is a tobacco or potato plant.

Preferably, the above procedure is performed by removing in step b) the DNA sequence encoding the 15-20 amino acids of the C-terminal from the open reading frame, preferably by inserting a translation stop codon at the 3'-terminal end of the DNA sequence. Preferably, the product of step c) is the pMOG405 expression plasmid vector.

The present invention also provides a method for producing transformed plant material comprising a gene product having a vacuolar directing sequence at its C-terminus and secreting the gene product into an extracellular space, comprising:

a) isolating a DNA sequence having a vacuolar directing sequence at its C-terminus which naturally directs the protein into the plant vacuole;

b) removing from the said DNA sequence the coding sequence for the vacuolar leader sequence, thereby generating a modified DNA sequence encoding the protein without the C-terminal amino acids;

c) introducing the modified DNA sequence obtained in step b) into a suitable plant expression vector;

d) transforming the product of step c) into a suitable plant; and

e) cultivating the plant obtained in step d) under appropriate conditions while the protein encoded by the modified DNA sequence obtained in step b) is expressed and secreted into the extracellular space; and

f) screening the resulting plant material and isolating the positive transformants.

Preferably, the gene product is a protein linked to pathogenesis of chitinase, glucanase, PR-1 and osmotin, more preferably osmotin and most preferably osmotin in tobacco or potato.

Preferably, the above procedure is carried out by removing in step b) the DNA sequence encoding the 15-20 amino acids of the C-terminal protein of the protein from the open reading frame, preferably the 20 amino acid encoding sequence by inserting a translation stop codon at the 3'-terminus of the DNA sequence. Preferably, the product of step c) is the expression vector pMOG405. Preferably said plant is a tobacco or potato plant.

HU 219 505 Β

The invention also relates to the use of recombinant polynucleotides in the above methods, comprising:

(i) a plant-operable promoter;

(ii) an open reading frame encoding an intracellular pathogenesis-associated protein under the control of said promoter, wherein the open reading frame is modified to direct its intracellular pathogenesis-associated protein into the extracellular space, creating a translational stop codon 3. at the end, resulting in the deletion of the Cterminal amino acids required for intracellular control of the protein involved in intracellular pathogenesis; and (iii) a terminator operably connected to said open reading frame.

Preferably, the recombinant polynucleotide encodes a chitinase, glucanase, osmotin or pR-1, more preferably an osmotin which is naturally directed to the vacuole of the plant cell. Using the modified recombinant polynucleotide allows targeting from the vacuole to the apoplast.

Expression levels of newly introduced gene constructs can be determined by analyzing proteins in extracellular fluid or by analyzing all proteins using Western biotech. Similarly, a known method can determine the relative amount of mRNA using the Northern biot technique using a probe for hydridization of osmotin mRNA. Transformed plants that appear to express high levels of gene constructs encoding either the wild-type or the directed osmotin-like protein are then examined for resistance to the fungus by infecting the plant with a phytopathogenic fungus and developing symptoms. rate, severity, and non-transformed plants are compared. Another method to investigate fungal resistance is to investigate fungal effects on leaf discs of transgenic plants instead of whole plants. The advantage of this method is that it is relatively easy to judge the development of symptoms in a more or less quantitative manner.

Microorganisms can be transformed with an osmotin-like protein, or a portion thereof, to produce an osmotin-like protein to encode an osmotin-like protein to obtain an osmotinic protein for use in antifungal preparations. Preferred microorganisms include bacteria such as Bacillus species and yeasts. Alternatively, microorganisms transformed with a gene or gene fragment encoding an osmotin-like protein that produce an osmotin-like protein can be used to save plants if they are able to grow on or in said plant. Preferred microorganisms are, for example, Pseudomonas or Rhizobium species. Expression of a cDNA fragment of an osmotin-like protein in Escherichia coli has already been achieved.

Most embodiments of the invention in which plants are transformed with a gene construct to be expressed in a plant require the use of a number of commonly known microbiological, molecular biological, recombinant DNA, plant transformation and plant tissue culture techniques, all of which are known to those skilled in the art. Standard techniques for isolation, manipulation and amplification of DNA as well as vectors for replication of recombinant DNA, appropriate bacterial strains, selection markers, media and the like are all known and described in Maniatis et al., Molecular Cloning, A Laboratory Manual, DNA Cloning: I and II. Volume 2, Cold Spring Harbor Laboratory, D.N. Glover Ed. (1989); and From Genes to Clones, E. L. Winnacker ed. (1987)].

Known vectors for bacterial cloning, such as pUC18 (see generally From Genes to Clones) and pEMBL (Dente L., Nucleic Acids Research, 11, 1645-1655). The latter plasmids have the advantage of containing the replication orgae of certain single-stranded bacteriophages of DNA, and thus these plasmids can be used directly for DNA sequencing. Sanger et al. Sanger et al., J. Mol. Biol., 14, 161-178 (1980)].

Several techniques are known for introducing recombinant genes into the plant genome, such as transformation with Agrobacterium, bombardment of plant tissue with DNA-coated particles (Klein et al., Natura, 327, 70-73 (1987)), direct DNA uptake. , e.g., calcium / PEG (Krens FA et al., Natura, 296, 72-74 (1982)), and microinjection of DNA into protoplasts (Crossway A. et al., Mol. Gene. Genet. 202: 179-186 (1986)] and the like. For a general overview of plant transformation techniques, see, for example, Lichtenstein et al., In: Genetic Engineering, Vol. 6, pp. 104-182. Rigby, (1987). In two preferred embodiments, the binary vector system of Agrobacterium is used. The principle of the binary vector system is described by Hoekema et al., Natura, 303,179-180 (1983); Bevan et al., 1984, Nucleic Acids Research 12: 8711-8721.

Once the genetic material has been introduced, an entire new plant can be generated from the transformed cell (protoplast) or transformed tissue. Alternatively, the pollen cells may be transformed and used to pollinate a host plant. Selection of transformed plants can be accomplished by, for example, having a marker gene on the same DNA fragment that contains the gene to be introduced. Marker genes may encode, for example, herbicide or antibiotic resistance, or enzymes capable of catalyzing a color reaction, or encoding an easily observable (e.g., directly visible) property. Plants expressing the marker gene are likely to contain the gene for the introduced osmotin-like protein. The selected plants can be assayed for expression of the osmotin-like protein using Western or Northern biotech techniques known to those of skill in the art.

EN 219 505 Β. Fungal resistant plants can be selected from those that express well by exposing the plants to any fungus that is pathogenic to the same variant plant.

There is, in principle, no limit to the practical application of the invention to the selected host plant using the above transformation techniques. Both dicotyledonous plants (i.e., tomatoes, potatoes, beans, soybeans, rape, cotton, and the like) and monocotyledonous plants (corn, wheat, barley, Asparagus, rice and the like) can be successfully transformed with recombinant DNA and then fully grown, regenerating into seed plants, which grow into plants expressing recombinant DNA.

In preferred embodiments of the invention, tobacco, potato and tomato plants can be transformed with a tobacco-derived osmotin gene. However, it is to be understood that the invention is applicable to any crop which is sensitive to a fungus to which osmotin has an inhibitory effect.

The publications cited herein indicate the level of skill required to practice the invention. All publications, whether the invention or otherwise, mentioned hereinbefore or later, are hereby incorporated by reference.

The following examples are provided for illustrative purposes only and are not to be construed as limiting the scope thereof.

Example 1

Isolation of AP20 from TMV induced tobacco plant

Leaves of 7-8 weeks old tobacco (Nicotiana tabacum cv. Samsun NN) are inoculated with tobacco mosaic virus (TMV) according to methods known to those skilled in the art. Seven days after infection, 400 g of leaves were harvested and homogenized at 4 ° C in 600 ml of 0.5 M sodium acetate, 15 mM 2-mercaptoethanol and 4 g of activated carbon in a Waring blendor. The homogenate is filtered through gauze and then the filtrate is centrifuged at 5000 g. The supernatant was then centrifuged for 50 minutes at 22,000 g and desalted on a Sephadex G25 column (Pharmacia) having a length of 60 cm, a width of 11.5 cm and equilibrated with 20 mM sodium acetate, pH 5.2. The protein-containing fraction was stored overnight at 4 ° C and then centrifuged at 22,000 g for 45 minutes. The supernatant was passed through a S-Sepharose "woody flow" (Pharmacia) column, 5 cm long, 5 cm diameter, equilibrated with 20 mM sodium acetate, pH 5.2 at a flow rate of about 15 ml / min. Unbound proteins are harvested. The bound proteins were solubilized by applying a linearly increasing sodium chloride gradient (0-500 mM) in the above-mentioned buffer, with a flow rate of 3 ml / min and 4.2 ml fractions. Every second fraction was subjected to electrophoresis using 12.5% polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS) using molecular weight markers of 20-66 kD as reference. Another part of the same fractions is tested for antifungal activity.

A microtiter plate assay was developed for antifungal activity. Both 24-well and 96-well microtiter plates can be used. Subsequently, 250 µl (24-well plate) or 50 μΐ (96-well plate) potato glucose agar (PDA) is pipetted into each well. The spores of P. infestans were suspended in water and added to the wells: 500-700 spores (50 μΐ volume) for the 24-well plate and 100-200 spores (25 μΐ volume) for the 96-well plate. Portions of the fractions to be assayed were dialyzed against 15 mM dipotassium hydrogen phosphate / potassium dihydrogen phosphate pH 6.0, filtration sterilized (0.22 µm filter), and added to the spore suspension ( 100 and 50 μΐ, respectively, depending on whether 24 or 96 well plates are used). A low phosphate concentration appeared necessary because P. infestans proved to be sensitive to high phosphate concentrations; 15 mM potassium phosphate was sufficient and had no effect on P. infestans growth. Addition of sodium chloride is required to stabilize the antifungal activity at low phosphate concentrations. As controls, the same fractions were boiled for 10 minutes after dialysis. Subsequently, these plates were incubated in the dark at 20 ° C for 4-5 days. The first signs of fungicidal activity can be observed under the microscope after 20 hours. The fungal inhibitory effect occurs as a lysis of germinating spores and growing germ tubes of hyphae. In a later stage, inhibition of micellar growth can also be observed.

For further purification of the active component, the active antifungal fractions were combined, dialyzed against a solution of 1 M ammonium sulfate, 50 mM dipotassium hydrogen phosphate / potassium dihydrogen phosphate (pH 7.0) followed by a 0.22 pm pore size filter. The filtrate was loaded onto a hydrophobic interaction (HIC) column (Phenylsuperose HR 5/5, Pharmacia) previously equilibrated with dialysis buffer. All previous steps were performed at 4 ° C.

Bound proteins were eluted using a decreasing ammonium sulfate gradient (from 1 M to 0 M) in 50 mM dipotassium hydrogen phosphate / potassium dihydrogen phosphate buffer (pH 7.0). per minute at room temperature. The elution program is as follows:

- in 5 minutes, the initial ammonium sulphate concentration shall be reduced from 100% to 30%,

- elute for 7.5 minutes with 30% of the initial ammonium sulphate concentration,

- within 10 minutes the initial ammonium sulphate concentration decreases from 30% to 0%.

The antifungal protein from the column is approximately

Dissolves in about 5.5 minutes (about 2.7 mL) at 0% initial ammonium sulfate concentration; the antifungal protein in the peak fraction is about 95% pure. All of the above steps are performed at room temperature. For the purpose of antifungal ha9

HU 219 505 Β protein was obtained in 99% purity, these fractions were dialyzed against 1 M ammonium sulfate, 50 mM dipotassium hydrogen phosphate / potassium dihydrogen phosphate buffer, pH 7.0 and 0.22 micron filter and pass through the HI column again using the following elution program:

Decrease from 100% to 15% in 7.5 minutes;

12.5 minutes by 15%;

minutes from 15% to 0%.

The antifungal protein elutes from the column (about 2.7 mL) after 13 minutes; this eluate contains 99% pure protein. From 400 g of leaves, 400 pg of protein can be isolated in 95% purity and 200 pg of antifungal protein in 99% purity.

The protein with an estimated molecular weight of 24 kD was designated AP20.

Example 2

Detection of AP20 amino acid sequence

The amino acid sequence of the N-terminal portion of AP20 was determined by methods known to those skilled in the art. See, e.g., Matsudairo et al., J. Biol. Chem. 262: 10035-10038 (1987)]. Figure 1 shows a comparison of the partial amino acid sequence of AP20 with that of osmotin from tobacco and tomato. The figure shows that the 40 N-terminal amino acid of AP20 is completely identical to the N-terminal amino acid sequence of tobacco-derived osmotin II and exhibits very strong homology to the tomato-derived NP24 osmotin-like protein.

The exact molecular weight of AP20 was determined by one-dimensional polyacrylamide gel electrophoresis (1D-PAGE) using references between 66 and 20 kD. In this method, the molecular weight was determined to be 24 kD, which is very consistent with the electrophoretic mobility of other osmotins.

The isoelectric point was determined by isoelectric focusing chromatography, e.g., between 4.3 and 9.5. The mobility of AP20 in the gel / buffer system used did not allow accurate determination of pl, since AP20 appears to have a higher pI than most basic markers (pH 9.5); it was concluded that the AP20 had a pI of greater than 9.5. Comparison of physical parameters of AP20 and osmotins from tobacco and tomatoes (identical molecular weight, very basic eg, identity of the first 40 N-terminal amino acids) shows that AP20 is an osmotin. The same conclusion can be drawn from the antifungal activity of the osmotin (AP20) we isolated and the strong amino acid sequence conservation between AP20 and other osmotins. We believe that other osmotin-like proteins in the flora will have similar antifungal activity.

Example 3

Isolation of osmotin from tomato and investigation of its antifungal activity against P. infestans

The method used to infect tomato plants is described by Heller and Gessler [J. Pathology, 116,

323-328 (1986)].

Two-month-old tomato plants (Lycopersicon esculentum cv. Moneymaker) were inoculated with P. infestans zoospores. The zoospores were formed in a lxlO ⁵ sporangia / ml incubation medium in suspension. From this suspension, 6 drops of 10 μϊ were applied to each leaf. Leaves were incubated at 15 ° C with 95-100% air humidity and low light intensity until the lesions became invisible (about 5 days). Subsequently, the temperature was raised to 22 ° C, the humidity of the air was reduced to 75%, and the luminous intensity was raised to normal. After another three days, the leaves containing necrotic lesions were collected and stored at -80 ° C.

Isolation of osmotin from tomato leaves (including the P. infestans test) is similar to the isolation of AP20 from tobacco as described in Example 1.

Osmotin from tomato has a clear inhibitory effect on the growth of P. infestans. In control experiments, when osmotine was heated to 100 ° C in a buffer, lysis was not observed.

Example 4

Preparation of pMOG180

To achieve high constitutive expression of osmotin genes in transgenic plants, an expression construct containing a strong promoter was constructed. To this end, the expression cassette of pROKI (Baulcombe et al., Natur. 321, 446-449 (1986)) was cloned into pUC18 as an EcoRI-HindIII fragment. This cassette contains the CaMV 35S promoter on an EcoRI-BamHI restriction fragment and the transcription termination portion of nopaline synthase (nos) on a BamHI-HindIII fragment. The promoter fragment contains the portion of the CaMV genome from -800 to +1, where the + 1 position is the site of transcription initiation (Guilley et al., 1982, Cell 30, 63-33). It is known in the art that doubling the sequence between nucleotides -343 and -90 increases the activity of the CaMV 355 promoter (Kay et al., Science 236: 1299-1302 (1987)). The following cloning steps are performed to obtain a promoter fragment containing the double "expression enhancer" (enhancer). First, the sequence at position -512 just before the Ncol recognition site is removed and the recognition site itself is changed to an EcoRI recognition site. For this purpose, the expression cassette in pUC 18 is cleaved with NcoI restriction enzyme, and the resulting ends are filled with Klenow polymerase and Eco RI linkers are attached thereto.

The resulting plasmid was cleaved with the EcoRI restriction enzyme to cut the EcoRI fragment and fill the ends with Klenow polymerase. The charged AccI-EcoRV promoter fragment (between nucleotides -388 and -90) is then cloned into the linear plasmid, whereby a new EcoRI site is generated

21 219 505 Β at the intersection of the uploaded EcoRI and the uploaded AccI cleavage site. The newly obtained plasmid pM0G181 contains the CaMV 35S promoter, now with a double amplification sequence, in an expression cassette still on an EcoRI-HindIII fragment. Subsequently, pMOG180 was prepared from pMOG181. For this purpose, the vector was cleaved with BamHI, the resulting ends filled in with Klenow polymerase, and a synthetic double-stranded DNA fragment, designated SEQID 1 in the sequence listing, containing the RNA4 leader sequence of the lucema mosaic virus. was cloned. After selection for the newly formed BamHI restriction site, the 5'-GGATC-3'pentanucleotide around the transcription initiation site is eliminated by in vitro mutagenesis. The plasmid thus obtained was designated pMOG180.

Example 5

Cloning of osmotin-compatible cDNAs and production of the binary vector pMOG404

A tobacco cDNA library was constructed using a ΖΑΡ-cDNA synthesis kit (Stratagene Cat # 200400, 200401). Polyadenylated RNA was isolated from TMV-infected Samsun NN tobacco leaves and used to synthesize cDNA using standard techniques known to those of skill in the art. After digestion with EcoRI and Xhol restriction enzymes, the cDNA fragments were ligated with the ZAP-compatible lambda lobe.

The lambda ZAP tobacco cDNA library described above was probed with a sequence containing sequences homologous to the tomato NP24 gene [King et al., Plant Mol. Biol. 10: 401-412 (1988)]. About 7 recombinant phages were identified using the plaque hybridization technique (Benton and Davis, Science, 196, 180, 180-182). The inserts in the DNA of these phages were subcloned into pBluescript (SK-) using the in vivo excision method. The nucleotide sequence of the various cDNA clones was determined using the M13 sequencing method. These assays, when combined with the partial amino acid sequence of the AP20 protein, revealed that only 3 clones contain the nearly complete cDNA sequence. One cDNA clone contains the entire coding sequence for osmotin except for the adenine thymidine dinucleotide of the translation initiation codon (Singh et al., 1989). m.]. This clone is hereinafter referred to as an osmotin cDNA clone. The N-terminal amino acid sequence of the characterized AP20 protein corresponds exactly to that of osmotin, which can be deduced from the osmotin cDNA clone.

By PCR, a BamHI recognition site and an Adenin-Timin dinucleotide are inserted in front of the osmotin cDNA, thereby generating a translation initiation codon; a BamHI recognition site is inserted behind the gene. For these PCR reactions, the oligonucleotides SEQID2 and SEQID3 are used as the starter molecule (see Sequence Listing, SEQID2 and SEQID3).

The modified cDNA sequence is screened for any unwanted mutations that may occur as a result of the PCR method. The sequence is shown in the Sequence Listing as SEQID4. The osmotin gene was cloned in the form of a BamHI fragment into the vector pMOG180 linearized with BamHI (construction see Example VIII; Figure 2). The resulting expression construct on a Sst-HindIII fragment contains the 35S promoter of cauliflower mosaic virus (CaMV) upstream of the osmotin gene, followed by the nopaline synthase (nos) transcriptional terminator. The expression construct was cloned into the binary vector pMOG23 (deposited with the Centraal Bureau voor Schimmelcultures te Baam, No. CBS 102.90 on 29.01.1990) after linearizing with SSTI and HindIII restriction enzymes. The resulting plasmid, designated pMOG404 (Figure 3), already contains both the osmotin gene and the NPTII gene, localized between the left and right T-DNA sequences. Plasmid pRK2013 was used to mobilize this binary vector from Escherichia coli DH5a to Agrobacterium tumefaciens strain LBA4404. The transconjugant LBA4404 (pMOG404) was isolated from this cross on medium containing 20 mg / L rifampicin and 100 mg / L kanamycin.

Example 6

Construction of an extracellular osmotin encoding vector pMOG405

Wild-type osmotin has been reported to occur intracellularly, particularly in vacuoles of plant cells (Singh et al., Plant Physiol. 85: 529-536 (1987)). To achieve osmotin secretion into the extracellular space, a translational stop codon was inserted into the wild-type osmotin cDNA on pMOG404, between codons 20 and 21 of the cDNA-encoded protein. Using a PCR technique known to those skilled in the art, the stop codon is constructed by inserting a thymidine (T) group between nucleotides 694 and 695. The nucleotide sequence number is based on the SEQID4 sequence shown in the Sequence Listing. The osmotin sequence so modified is screened for unwanted mutations resulting from the use of the PCR technique. The mutated cDNA encodes an osmotin lacking the 20 C-terminal amino acid of the primary translational product of wild-type osmotin mRNA. The resulting binary vector is designated pMOG405, the corresponding Agrobacterium transconjugant is LBA4404 (pMOG405). As shown in Example 8, the osmotin encoded by pMOG405 does indeed accumulate extracellularly.

Example 7

Production of transgenic plants

Transformation of potato (cv bint of Solanum tuberosum) with Agrobacterium LBA4404 (pMOG404) and LBA4404 (pMOG405) was performed according to the method described by Hoekema et al., 1989, Bio / Technology 7: 273-278.

HU 219 505 Β

The leaf disc method is used to transform tobacco (Horsch et al., Science 227: 1229-1231 (1985)). Leaf disks were co-cultured with Agrobaterium LBA4404 (pMOG404) or LBA4404 (pMOG405) and then cultured on standard selection media containing 100 mg / ml kanamycin. Transgenic shoots are regenerated into whole plants and the expression of the osmotin gene is examined. For this analysis, we use the so-called Westem blot technique, using antibodies against the pathogenesis-related protein (PR-S), and the Northem blot technique, using an osmotin cDNA fragment as a probe. Western blot analysis revealed that there is no difference in the size of the osmotin encoded by pMOG404 and pMOG405, although the osmotin coding regions in the two constructs differ by 20 codons. This suggests that wild-type osmotin undergoes C-terminal processing in the plant.

Example 8

Analysis of pMOG404 and pMOG405 Transgenic Tobacco Plants for Direction of Transgenic Product

In order to detect the extracellular orientation of osmotin in pMOG405 transgenic tobacco plants, the following experiment was performed. Leaves of F1 plants of the pMOG404 transgenic plant lines and pMOG405 transgenic plant lines expressing the newly introduced osmotin gene and leaves of non-transgenic plants are used for extraction of all proteins as well as extracellular proteins. For extraction of extracellular proteins, extracellular fluid was collected by the method of De Wit and Spikman, Physiol. Plath Pathol., 20, 1-11 (1982)]. After isolation of the extracellular fluid, the proteins are also extracted from the remaining leaf material. For analysis of the proteins in the whole extract (Total), the proteins contained in the extracellular fluid (EF) and in the leaves from which the extracellular fluid was removed (-EF), the so-called Westem blot technique, AP20-specific antibodies or protein linked to pathogenesis S) antibodies. The results in Table 1 show that osmotin is indeed directed to the extracellular space in pMOG405 transgenic plants.

Table 1

Targeting of osmotin to extracellular space in pMOG405 transgenic tobacco plants

Plant Fehéqeminta All EF -EF Not transgenic - - - pMOG404 + + + + - + + + + pMOG405 + + + + +++ +

-: None from AP20 + to ++ ++: Increasing amount of osmotin

Example 9

Investigation of resistance to fungal infections in transgenic tobacco plants

Phytophthora nicotianae var. nicotianae (Pnn) is an Oomyceta. It is a root pathogen of which tobacco is the host. Infection of plants occurs with wilting of leaves and / or rot at the base of the stem (black stem). The tobacco eventually dies from the infection.

Leaf disks about 1-2 cm in diameter were cut from pMOG404 transgenic, vector transgenic and non-transgenic tobacco plants. The leaf discs are floated upside down in a Petri dish containing sterile distilled water. 10 μΐ of the zoospore suspension (5000 spores / ml) were added to each disk. In each experiment, 10 discs were used three times, i.e. a total of 20 control discs per experiment. After about a day, the first signs of the onset of infection appear on the control discs. After three days, the control leaf discs become completely infected (soaked in water). Leaf disks from pMOG404 transgenic plants show milder symptoms after three days. The results of the experiment can be repeated several times. This example suggests that tobacco plants constitutively expressing an intracellular osmotin gene show reduced sensitivity to Phytophthora nicotianae var. nicotianae (Pnn), a natural pathogen of tobacco plants.

For the whole tobacco plant, P. nicotianae var. nicotianae were evaluated for fungal resistance and the following experiments were performed. Ten transgenic plants transformed with plasmid LBA404 (pMOG404) (those that express the osmotin gene well), ten plants transformed with a vector containing no osmotin (these are called vector transgenic plants), and ten untransformed plants are infected with suspension containing 2x10 ⁵ Pnn zoospore. Pipette this suspension onto the soil at the base of the stem. Water (100 ml) was then poured into the base of the stem. Thereafter, the symptoms of the disease develop over time. After two to three days, the control plants (non-transgenic and vector-transgenic plants) show the first signs of disease, that is, begin to wither. Some of the pMOG404 transgenic plants show a slower development of disease symptoms. However, better protection is needed. The effect of osmotin localization in plants was investigated in the following experiment.

Example 10

Examination of fungal resistance in transgenic tobacco plants expressing osmotin extracellularly

Agrobacterium tumefaciens LBA4404 (pMOG405) was used to produce transgenic tobacco plants expressing the altered osmotin gene, resulting in the targeting of the osmotin produced to the apoplast. Extracellu12

Plants that express well the osmotin gene expressing the osmotin gene, as described in Example 8, were tested for resistance to Phytophthora nicotianae var. nicotianae-re (Pnn).

The experiments were performed on 10-10 leaf discs obtained from one pMOG404 transgenic, two pMOG405 transgenic and one non-transgenic tobacco line. After three days, the results obtained with the non-transgenic plant (line 2 #), the well expressing pMOG404 (line 1 #) and the two plants expressing pMOG405 (lines 6 # and 9 #) were analyzed. The results are shown in Table 2.

Table 2

Investigation of fungal resistance on leaf discs from transgenic and non-transgenic tobacco lines tested on Phytophthora nicotianae

plant Line Infected area # 2 8 discs 100% 2 discs 60% pMOG404 # 1 7 discs 100% 3 discs <25% pMOG405 # 6 1 disk 100% 2 discs 60% 7 discs <25% pMOG405 # 9 3 discs 100% 2 discs 60% 5 discs <25%

Percentages represent the area infected with P. nicotianae, 3 days after infection.

The results in Table 2 clearly show an enhanced antifungal activity on leaf discs when osmotin is targeted to the extracellular space relative to intracellularly localized osmotin. We believe that the fungal resistance shown here on leaf discs is also expressed in whole plants.

To estimate fungal resistance in plants, the fungal resistance of said lines is tested as described in the previous example. We believe that pMOG405 transgenic tobacco plants are much more resistant than plants transformed with pMOG404 vector.

From the observations of the antifungal activity with osmotinic whites, it is concluded that the antifungal activity is achieved when the antifungal protein is expressed at high levels in the plant, such as in the present case, CaMV 35S, a constitutive promoter. under your control.

It has also been found that when the synthesis of an intracellular antifungal protein is directed into the extracellular space, a significant enhancement of the antifungal activity is observed. Recent similar studies with chitinases and β-1,3-glucanases confirm this observation. More importantly, the observation that osmotin-like proteins, which are intracellular proteins, exhibit antifungal activity, is complementary to an image that is becoming more complete, and will be explained below.

It has been known for some time that certain chitinases and glucanases have antifungal activity. Detecting the antifungal activity of some plant chitinase and glucanase in the plant (i.e., in transformed plants) proved difficult. The reason for this is now clear, as recent studies have shown that only those varieties of these enzymes that have intracellular activity have antifungal activity. This is now confirmed by a third class of antifungal proteins, namely osmotin-like proteins, which are intracellular proteins, while PR-S, which is highly homologous to osmotin-like proteins and produced by resistance but which is an extracellular protein, has no antifungal activity. The fourth category, the so-called pathogenesis-related protein category (chitinases, glucanases and osmotin-like proteins in the other three groups), also fits into this picture.

However, if not done, the expression of intracellular antifungal proteins in plants transformed with said genes is likely to produce only a very mild effect as these proteins do not reach the point where they should be exerted.

From these observations we deducted the following.

1. The intracellular form of all proteins produced by the induction of resistance, including at least chitinases, glucanases and osmotin-like proteins, exhibits a significantly higher antifungal activity than their corresponding extracellular form. It is believed that most, if not all, of the PR protein groups have low extracellular forms or show no antifungal activity.

2. As shown in our experiments on pMOG405 plants, the extracellular space is an advantageous attack point for an antifungal plant, regardless of where it originally resides.

3. In the successful control of a fungal infection, the use of intracellular proteins in an antifungal preparation which is produced during the induction of resistance is strongly recommended.

4. If our goal is to obtain plants that are less susceptible to fungi, said plants must be transformed with an open reading frame that encodes an intracellular antifungal protein that, at its production, targets its target attack site, the extracellular is focused on space.

However, the above statements should not lead to the conclusion that all intracellular proteins that are involved in the hypersensitive response

HU 219 505 Β is synthesized, has a truly antifungal effect. Therefore, the "reverse approach", that is, starting from the antifungal activity rather than the enzymatic activity, is very useful in selecting only those (intracellular) proteins that actually have antifungal activity. The effect of these proteins on fungal resistance in the plants is then examined by transforming a susceptible plant with an open reading frame encoding said antifungal protein, preferably after the open reading frame has been modified to provide orientation to the extracellular space.

Example 11

Analysis of fungal resistance in transgenic potato plants

The pMOG404 and pMOG405 vectors transformed potato plants in order to examine the sensitivity of the 20 best osmotin transgenic plants expressing the fungus Phytophthora infestans spores are sprayed with a wet lxlO ^5. P. infestans is a potent pathogen for potato plants. As a result, the leaves wither, the stalk is damaged and the plant is completely destroyed. As a control, 20 untransformed plants and 20 plants transformed with a vector containing no osmotin gene (vector transgenic plant) were sprayed with the same amount of spore. The plants were grown at 18 ° C and 95-100% humidity. The development of the disease is evaluated on days 7 and 14 after spraying by determining the leaf area affected by the fungus. The affected leaf area is expressed as a proportion of the total number of leaves counted. 8-10 (lower) leaves are counted per plant; we count the average number of leaves of each plant. Table 3 below gives an estimate of the results.

(+ 0-25% of total leaf area affected + + 25-50% affected + + + 50-75% affected + + + + 75-100% affected).

Table 3

Estimated susceptibility of potato plants to P. infestans

7 days + ++ +++ + + + + Not transgenic - - 15 ± 10% 85 ± 10% V is vector transgenic - - 15 ± 10% 85 ± 10% pMOG404-transgenic 25 ± 10% 25 ± 10% 20 ± 10% 30 ± 10% pMOG405-transgenic 25 ± 10% 30 ± 10% 30 ± 10% 15 ± 10% Day 14 + ++ +++ + +++ Not transgenic 10 ± 10% 90 ± 10% V is vector transgenic 10 ± 10% 90 ± 10% pMOG404-transgenic 20 ± 10% 10 ± 10% 10 ± 10% 60 ± 10% pMOG405-transgenic 20 ± 10% 25 ± 10% 30 ± 10% 25 ± 10%

Non-transformed and vector-transformed plants are highly infected with the vaccine used in the experiment on day 7. At day 7, only about 30% of the pMOG404 plants are highly infected; about 70% of pMOG404 plants develop infection much more slowly (+ to + ++) than control plants. On day 14, it is expected that only 10-50% of pMOG404 plants show a mild to moderate (+ or + +) infection, while 10-30% show only mild or no infection (+). . Extracellularly directed osmotin (i.e., pMOG405 plants) further delays infection development than pMOG404 transgenic lines.

SEQUENCE LIST

SEQ ID NO: 1 Sequence type: nucleotide Sequence length: 34 Thread: double Topology: linear

HU 219 505 Β

Molecule Type: Synthetic Origin

Organism: Lucas mosaic virus

Clone: Properties: lucema mosaic virus RNS4

TTTTTATTTT TAATTTTCTT TCAAATACTT CCAG 34

SEQ ID NO: 2 Sequence type: nucleotide Length: 32 Strands: single

Topology: linear Molecular type: synthetic

Origin

Organism: Clone: 10 Properties: PCR primer with homology to osmotin cDNA

GCCGGATCCA ATTCGGCACA TGGGCAACTT GA 32

SEQ ID NO: 3 Sequence type: nucleotide Length: 26 Strands: single

Topology: Linear Molecular Type: Synthetic Origin

Organism: Clone: SEQ ID NO: 4 Sequence Type: Nucleotide Sequence Length: 883 Strand: Double

Topology: linear Molecular type: cDNA Origin

Organism: Nicotiana tabacum Clone: pMOG404

Properties: homologous to osmotin cDNA 25 PCR primer encoding osmotin-like protein

GTTTATTACA GCAAGGATCC TGACTT 34

GGATCCAATT CGGCAC

ATG GGC AAC TTG AGA TCT TCT TTT GTT TTC TTC CTC CTT GCC 58

Met Gly Asn Leu Arg Ser Ser Phe Val Phe Phe Leu Leu Ala

TTG GTG ACT TAT ACT TAT GCT GCC ACT ATC GAG GTC CGA AAC 100

Leu Val Thr Tyr Thr Tyr Ala Ala Thr Ile Glu Val Arg Asn

AAC TGT CCG TAC ACC GTT TGG GCG GCG TCG ACA CCC ATA GGC 142

Asn Cys Pro Tyr Thr Val Trp Ala Ala Ser Thr Pro Ile Gly

GGT GGC CGG CGT CTC GAT CGA GGC CAA ACT TGG GTG ATC AAT 184

Gly Gly Arg Arg Leu Asp Arg Gly Gin Thr Trp Val Ile Asn

GCG CCA CGA GGT ACT AAA ATG GCA CGT GTA TGG GGC CGT ACT 226

Ala Pro Arg Gly Thr Lys Met Ala Arg Val Trp Gly Arg Thr

AAT TGT AAC TTC AAT GCT GCT GGT AGG GGT ACG TGC CAA ACC 268

Asn Cys Asn Phe Asn Ala Ala Gly Arg Gly Thr Cys Gin Thr

GGT GAC TGT GGT GGA GTC CTA CAG TGC ACC GGG TGG GGT AAA 310

Gly Asp Cys Gly Gly Val Leu Gin Cys Thr Gly Trp Gly Lys

CCA CCA AAC ACC TTG GCT GAA TAC GCT TTG GAC CAA TTC AGT 352

Pro Pro Asn Thr Leu Ala Glu Tyr Ala Leu Asp Gin Phe Ser

GGT TTA GAT TTC TGG GAC ATT TCT TTA GTT GAT GGA TTC AAC 394

Gly Leu Asp Phe Trp Asp Ile Ser Leu Val Asp Gly Phe Asn

ATT CCG ATG ACT TTC GCC CCG ACT AAC CCT AGT GGA GGG AAA 4 36

Ile Pro Met Thr Phe Ala Pro Thr Asn Pro Ser Gly Gly Lys

TGC CAT GCA ATT CAT TGT ACG GCT AAT ATA AAC GGC GAA TGT 478

Cys His Ala Ile His Cys Thr Ala Asn Ile Asn Gly Glu Cys

CCC CGC GAA CTT AGG GTT CCC GGA GGA TGT AAT AAC CCT TGT 520

Pro Arg Glu Leu Arg Val Pro Gly Gly Cys Asn Asn Pro Cys

ACT ACA TTC GGA GGA CAA CAA TAT TGT TGC ACA CAA GGA CCT 562

Thr Thr Phe Gly Gly Gin Gin Tyr Cys Cys Thr Gin Gly Pro

TGT GGT CCT ACA TTT TTC TCA AAA TTT TTC AAA CAA TGC 604

Cys Gly Pro Thr Phe Phe Ser Lys Phe Phe Lys Gin Arg Cys

CCT GAT GCC TAT AGC TAC CCA CAA GAT GAT CCT ACT AGC ACT 646

Pro Asp Ala Tyr Ser Tyr Pro Gin Asp Asp Pro Thr Ser Thr

TTT ACT TGC CCT GGT GGT AGT ACA AAT TAT AGG GTT ATC TTT 688

HU 219 505 Β

Phe Thr Cy s Pro Gly Gly Ser Thr Asn Tyr Arg With Ile Phe TGT CCT AAT GGT CAA GCT CAC CCA AAT TTT CCC TTG GAA ATG 730 Cys Pro Asn Gly Gin Al a Hi s Pro Asn Phe Pro Leu Glu Me t CCT GGA AGT DAM GAA GTG GCT AAG BROAD AGTGGCTATT 767 Pro Gly Ser asp Glu With Al a Lys

TCTGTAATAA GATCACCTTT TGGTCAAATT ATTCTATCGA CACGTTAGTG 817 TAAGACAATC TATTTGACTC GTTTTTATAG TTACGTACTT TGTTTGAAGT 867 GATCAAGTCA GGATCC 883

SEQ ID NO: 5 Sequence type: nucleotide Sequence length: 884 Strand: double

Topology: linear Molecular type: cDNA

Origin

Organism: Nicotiana tabacum Clone: pMOG404

Characteristics: Encodes an os motin-like protein without 20 C-terminal amino acids

GGATCCAATT CGGCAC

ATG GGC AAC TTG AGA TCT TCT TTT GTT TTC TTC CTC CTT GCC 58 Me t Gly Asn Leu Arg Ser Ser Phe With Phe Phe Leu Leu Al a TTG GTG ACT TAT ACT TAT GCT GCC ACT ATC GAG GTC CGA AAC 100 Leu With Thr Tyr Thr Tyr Al a Al a Thr Ile Glu With Arg Asn AAC TGT CCG TAC ACC GTT TGG GCG GCG TCG ACA CCC OVER THE GGC 142 Asn Cys Pro Tyr Thr With Trp Al a Al a Ser Thr Pro Ile Gly GGT GGC CGG CGT CTC DAM CGA GGC CAA ACT TGG GTG ATC AAT 184 Gly Gly Arg Arg Leu asp Arg Gly Gin Thr Trp With Ile Asn GCG CCA CGA GGT ACT AAA ATG GCA CGT GTA TGG GGC CGT ACT 226 Al a Pro Arg Gl y Thr Lys Me t Al a Arg With Trp Gly Arg Thr AAT TGT AAC TTC AAT GCT GCT GGT AGG GGT ACG TGC CAA ACC 268 Asn Cys Asn Phe Asn Al a Al a Gly Arg Gly Thr Cys Gin Thr GGT GAC TGT GGT GGA GTC CTA CAG TGC ACC GGG TGG GGT AAA 310 Gly asp Cys Gly Gly With Leu Gin Cy s Thr Gly Trp Gly Lys CCA CCA AAC ACC TTG GCT GAA TAC GCT TTG GAC CAA TTC AGT 352 Pro Pro Asn Thr Leu Al a Glu Tyr Al a Leu asp Gin Phe Ser GGT TTA DAM TTC TGG GAC ATT TCT TTA GTT DAM GGA TTC AAC 394 Gly Leu As p Phe Trp asp Ile Ser Leu Va 1 asp Gly Phe Asn ATT CCG ATG ACT TTC GCC CCG ACT AAC CCT AGT GGA GGG AAA 436 Ile Pro Me t Thr Phe below Pro Thr Asn Pro Ser Gly Gly Lys TGC CAT GCA ATT CAT TGT ACG GCT AAT OVER THE AAC GGC GAA TGT 478 Cy s Hi s Al a Ile Hi s Cys Thr Al a Asn Ile Asn Gly Glu Cys CCC CGC GAA CTT AGG GTT CCC GGA GGA TGT AAT AAC CCT TGT 520 Pro Arg Glu Leu Arg With Pro Gly Gly Cy s Asn Asn Pro Cys ACT ACA TTC GGA GGA CAA CAA TAT TGT TGC ACA CAA GGA CCT 562 Thr Thr Phe Gly Gly Gin Gin Tyr Cys Cy s Thr Gin Gly Pro TGT GGT CCT ACA TTT TTC TCA AAA TTT TTC AAA CAA AGA TGC 604 Cy s Gly Pro Thr Phe Phe Ser Lys Phe Phe Lys Gin Arg Cy s CCT DAM GCC TAT AGC TAC CAA CAA DAM DAM CCT ACT AGC ACT 646 Pro asp Al a Tyr Ser Tyr Pro Gin asp As p Pro Thr Ser Thr TTT ACT TGC CCT GGT GGT AGT ACA AAT TAT AGG GTT ATC TTT 688 Phe Thr Cys Pro Gly Gly Ser Thr Asn Tyr Arg With Ile Phe

TGT CCT 694 Cys Pro

TAATGGTCAA GCTCACCCAA ATTTTCCCTT GGAAATGCCT GGAAGTGATG 744 AAGTGGCTAA GTAGAGTGGC TATTTCTGTA ATAAGATCAC CTTTTGGTCA 794 AATTATTCTA TCGACACGTT AGTGTAAGAC AATCTATTTG ACTCGTTGTGTGTGTGTGTGTT

HU 219 505 Β

Claims (32)

PATENT CLAIMS A method for directing an intracellular protein of a plant to an extracellular space of a plant or a cell of a plant, wherein said intracellular protein comprises a C-terminal portion which provides for intracellular localization of its protein, characterized in that the C-terminal portion of the intracellular protein is present. the 3'-terminal end of the coding open reading frame is modified to prevent intracellular localization by the C-terminal portion of the intracellular protein. The method of claim 1, wherein the intracellular protein is an anti-pathogenic or antifungal protein. 3. A method for enhancing the anti-pathogenic effect of an intracellular anti-pathogenic protein from a plant, wherein the intracellular protein is targeted to the extracellular space. The method of claim 3, wherein said alignment is accomplished by modifying the 3'-terminal end of an open reading frame encoding an intracellular protein. 5. A method according to any one of claims 1 to 6, characterized in that the intracellular protein is a chitinase, p-1,3-glucanase or an osmotin-like protein. 6. A method of preventing extracellular transfer of a target peptide, comprising expressing a chimeric peptide derived from said target peptide and Gln-Ala-His-Pro-Asn-Phe-ProLeu-Glu-Met-Pro-Gly-Ser- It is prepared from a C-terminal peptide having the Asp-Glu-Val-Ala-Lys sequence or part thereof. Use of a vector encoding a chimeric peptide according to claim 6 in a method for inhibiting extracellular transmission. 8. A method of delivering a protein having a sequence which is naturally directed to a vacuole at the Cterminal end which naturally directs the protein to a vacuole, into a extracellular space of a plant, a) isolating a DNA sequence comprising an open reading frame encoding said protein together with the vacuolar leader sequence at its C-terminus; b) removing from the open reading frame the DNA sequence encoding the vacuolar leader sequence, creating a modified DNA sequence encoding the protein without the C-terminal amino acids; c) introducing the modified DNA sequence obtained in step b) into a suitable plant expression vector; d) transforming the product of step c) into a suitable plant; and e) cultivating the resulting plant under appropriate conditions while the protein encoded by the modified DNA sequence obtained in step b) is expressed and secreted. The method of claim 8, wherein the protein is a protein linked to pathogenesis: chitinase, glucanase, PR-1 or osmotin. The method of claim 8 or 9, wherein in step b) the DNA sequence encoding the 15-20 amino acids of the C-terminal osmotinic protein is removed from the open reading frame. 11. The method of claim 10, wherein, in step b), the DNA sequence encoding the C-terminal 20 amino acids of the osmotin protein is removed from the open reading frame. The method of claim 11, wherein the DNA sequence encoding the 20 C-terminal amino acid is removed from the open reading frame by inserting a translation stop codon at the 3'-terminus of said modified DNA sequence encoding said protein. 13. The method of claim 12, wherein the product of step c) is pMOG405. 14. A 9-13. A process according to any one of claims 1 to 3, characterized in that said osmotin is naturally occurring in tobacco. 15. A 8-14. A process according to any one of claims 1 to 3, characterized in that said plant is a potato or tobacco plant. 16. A method for producing transformed plant material comprising a gene product having a vacuolar directing sequence at its C-terminus and secreting the gene product into an extracellular space, characterized in that: a) isolating a DNA sequence for the gene product protein which has a vacuolar directing sequence at its C-terminus and naturally directs the protein into the plant vacuole; b) removing the coding sequence for the vacuolar leader from said DNA sequence, thereby generating a modified DNA sequence encoding the protein without the C-terminal amino acids; c) introducing the modified DNA sequence obtained in step b) into a suitable plant expression vector; d) transforming the product of step c) into a suitable plant; and e) cultivating the plant obtained in step d) under appropriate conditions while the protein encoded by the modified DNA sequence obtained in step b) is expressed and secreted into the extracellular space; and f) screening the resulting plant material and isolating the positive transformants. 17. The method of claim 16, wherein the protein is a protein linked to pathogenesis: chitinase, glucanase, PR-1 or osmotin. 18. The method of claim 16 or 17, wherein, in step b), the DNA sequence encoding the C-terminal 15-20 amino acids of the osmotin protein is removed from the open reading frame. 19. The method of claim 18, wherein, in step b), the DNA sequence encoding the C-terminal 20 amino acids of the osmotin protein is removed from the open reading frame. 20. The method of claim 19, wherein said DNA sequence encoding said amino acid sequence from said open reading frame is encoded by said protein. HU 219 505 Β is removed by inserting a translation stop codon at the 3'-terminus of the amplified DNA sequence. 21. The method of claim 20, wherein the product of step c) is pMOG405. 22. A 17-21. A process according to any one of claims 1 to 3, characterized in that said osmotin is naturally occurring in tobacco. 23. A process according to any one of claims 1 to 3, characterized in that said plant is a tobacco or potato plant. 24. Use of a recombinant polynucleotide a 8-23. A process according to any one of claims 1 to 3, comprising: (i) a plant-operable promoter; (ii) an open reading frame encoding an intracellular pathogenesis-linked protein under the control of said promoter, wherein the open reading frame is modified to direct the intracellular pathogenesis-linked protein into an apoplast, creating a translational stop codon 3 for the open reading frame. which results in the deletion of the C-terminal amino acids of the protein involved in intracellular pathogenesis; and (iii) a terminator operably connected to said open reading frame. Use according to claim 24, characterized in that the protein linked to pathogenesis is a hydrolytic enzyme selected from chitinase, glucanase, PR-1 or osmotin. Use according to claim 24 or 25, characterized in that, prior to modification, the protein, which is an osmotin, is naturally directed to the vacuole. Use according to claim 25 or 26, characterized in that osmotin naturally occurs in tobacco. Use according to claim 24, characterized in that the recombinant polynucleotide comprises: (i) a plant-operable promoter operably linked to (ii) an open reading frame encoding an intracellular protein of chitinase, glucanase, osmotin or PR-1, modified by the production of a translation stop codon at the 3 'end of the open reading frame. deleting the C-terminal amino acids required for intracellular targeting of its intracellular protein and directing the intracellular protein to the extracellular space; and (iii) a transcriptional termination region operably linked to the open reading frame. Use according to claim 28, characterized in that osmotin is naturally directed to the vacuole of a plant cell. 30. The use of claim 28, wherein the osmotin is naturally occurring in tobacco. 31. A 24-30. Use of a plasmid containing the recombinant polynucleotide according to any one of claims 8 to 23. A process according to any one of claims 1 to 6. 32. The use of claim 31, wherein the plasmid is pMOG405.