HU196236B - Process for producing polypeptides showing hepatitis b virus antigenicity - Google Patents

Abstract

Field of the Invention. A method of producing at least one polypeptide having hepatitis B virus (HBV) antigenic antigenicity, comprising: a) a DNA sequence encoding a polypeptide having HBV antigenicity, wherein said DNA sequence is a DNA sequence encoding a surface antigen or antigenicity fragment of a hepatitis B virus; or '- a DNA sequence encoding fragments of an antigen or antigenicity of a hepatitis B virus, or a DNA sequence encoding a antigenicity antigen of a hepatitis B virus as part of the aforementioned NDS sequences is prepared by hepatitis B B Dane particles or other recombinant vectors containing the DNA sequence encoding a given HBV antigenicity polypeptide are cleaved with a restriction enzyme, and the resulting product is ligated into a cloned cloning support. and, if desired, inserting an expression control sequence operatively operating in the recombinant cloning support thus formed; or b) DNAs of the exact formula or fragments thereof encoding a polypeptide nucleotide having HBV antigenicity or any of these variants corresponding to natural triplet degeneration. ligated into a cloned cloning carrier, and, if desired, an expression control sequence operably operable in the recombinant cloning support thus formed, and then ligated. with the recombinant cloning support thus formed, a single-cell host cell is transformed and then III. culturing the transformed host cell and IV. isolating the corresponding polypeptide.

Description

The present invention relates to a method for producing polypeptides having HEPATITIS B VIRUS antigenicity. More particularly, the present invention relates to recombinant DNA molecules expressed in appropriate host cell organisms and to their preparation. These DNA molecules are characterized by DNA encoding polypeptides specific for hepatitis B virus antigens. Recombinant DNA molecules can be used to detect hepatitis B virus in humans and to enhance the synthesis of virus antibodies.

The virus that causes hepatitis or serum hepatitis seems to infect only humans. Hepatitis B virus (HBV) boiling is very common in humans. Approximately 0.1% of blood donors in the United States, Great Britain and Western Europe are carriers of chronic HBV. Although mortality rates due to viral hepatitis are not high (3 million people in the UK), 5% of the total population in the UK and 15% in the United States appear to be infected. In many African and Asian countries, up to 20% of those who are chronic carriers of HBV and over 50% of the adult population in these countries have been infected or infected with HBV.

Hepatitis infection is spread through three major mechanisms.

1) by parenteral inoculation of infected blood or body fluids, by large amounts of blood transfusions or by small amounts of accidental needle prick,

2) by close family or sexual contact, and

3) infected during pregnancy by some mothers who infect their newborn baby.

Under natural conditions, HBV is not very contagious. It rarely diffuses by inhalation, it spreads at all.

Most HBV infections are subclinical. Clinical disease usually lasts for 3 to 6 weeks and may be mild or manifest in acute acute inflammation of the liver, followed by hepatic shrinkage or salt. Clinical and subclinical HBV infections are usually completely cured. However, there may be serious and lasting consequences in some cases:

1) Approx. five percent of the infected individual will be a carrier of chronic hepatitis B virus, and can infect others continuously and have liver damage.

2} An ongoing HBV infection is likely to cause, in whole or in part, the majority of HBV seronegative cases of chronic active hepatitis, hepatic shrinkage, and primary liver cancer.

Recent advances in molecular biology have allowed the introduction of DNA containing specific non-bacterial eukaryotic proteins into bacterial cells. Generally, for non-chemically synthesized DNA, the recombinant DNA molecules are constructed by constructing a cDNA of the purified messenger (mRNA) template of the desired protein, then converting the cDNA to double-stranded DNA, a suitable clone-forming DNA in a carrier, and transforming the host cell with this recombinant molecule. By transformation, the host cell produces the desired protein. In addition, at least in the case of ovalbumin DNA, it is also dense. that fusion of a DNA with a strong bacterial promoter or expression control sequence produces a large amount of the desired ovalbumin protein, i.e., 0.5-1% of the total protein of an E. coli cell [Oh. Mercereau-Puilalon et al., "Synthesis of An Ovalbumin -Like Protein By Escherichia coli K12 Harboring A Recombinant Plasmid", Nature, 275, 505-510 (1978) and TH Fraser and B.J. Bruce, "Cineken Ovalbumin Is Synthesized and Secreted By Esclterichi coli. , Proc. Null. Acad. Sci. USA 75: 5936-5940. [1978J]

Many non-bacterial proteins and genes have already been synthesized using recombinant DNA technology. Includes a protein having rat proinsulin antigenic determinants [L. Villa - Komaroff et al., "A Bacterial Clone Synthesizing Proinsulin", Proc. Natl. Acad. Sci, USA, 75, 3727-3731 (1978)), rat growth hormone (Ρ, H. Seeburg et al., Synthesis of Growth Hormone By Bycteria, Nature, 276, 795-798 (1978)), murine dihydrofolate reductase. (ACY Chang et al., "Phenotypic Expression in E. coli" Of The DNA Sequence Coding For Mouse Dihydrofolate Reductase, "Nature215,617-624 [1978], Somatostatin (K. Itakura et al.," Expression In Escherichia coli Of A. Cliemically Synthesized Gene Fór The Hormones Somatostatin ', Science, 198, pp. 1056-1063 (1977), 2007 675A,

British Patent Nos. 2007676A and 2; 108,123 123A) and the polypeptide chains of human insulin A and B (DV Goeddel et al., "Exprction in Sulinotc / IncoChemically Synthesized Genes for Human Insulin", Proc. Natl. Acad. Sci. USA, pp. 106-110 [1979] and the corresponding English patents cited above).

However, none of the above literature refers to viral proteins, e.g. for recombinant DNA synthesis of hepatitis B virus antigens.

HBV infections are known to produce antibodies against viral antigens. These antibodies represent the body's defense mechanism against HBV cooking. The development of such antibodies before infection or the rapid development of a potential infection substantially reduces or prevents the virus from growing and spreading in the body.

Artificial antibody production against antigens of hepatitis B viruses is mediated by a limited number of virus hosts. For example, while hepatitis B virus is highly contagious to humans, few major mammalian animals have been able to induce infection. The virus did not reproduce in tissue culture. This limited number of virus hosts and the fact that cells of tissue cultures have not been infected seriously hinders the characterization of the virus and the pathology of the infection and the development of rapid detection methods and effective prevention and control of the infection.

Attempts have been made to use authentic HBV virus antigens isolated from the victims of HBV infections to develop antibodies and detect infections, and these treatments are generally not applicable

196 236 due to the number. Human antigens are not always advantageous because of the well-known contamination problem with human isolated antigens.

According to the present invention, the above problem is solved by the production of a recombinant DNA molecule encoding a structural gene encoding a HBV antigen-potentiated polypeptide. The present invention provides HBV antigens and genes in non-contaminant and quantitative amounts for use in viral vaccine formulations and viral infections. pathology and molecular biology. This has not been possible so far due to the small number of virus hosts and the failure to infect tissue cultures.

As will be apparent from the following, the recombinant DNA molecule is capable of producing at least one HBV viral polypeptide and genes encoding it with antigenic capability in a suitable host. The products can be identified and characterized and can be used either in the form produced in the host or in the form of further modified or modified preparations. The present invention relates to improving the production of products, detecting HBV infection, determining pathology and increasing the production of HBV antibodies in humans.

In accordance with the present invention, recombinant DNA molecules are prepared by linking a DNA sequence prepared from the endogenous DNA of a Dane particle to a DNA sequence obtained from a non-Dane particle source. Unlike the previous methods described above, the process of the present invention uses the natural DNA or gene of a particular protein to construct a recombinant DNA molecule and to produce that protein or gene. The known methods either isolate chemically synthesized genes from donor cells! Artificial genes obtained by enzymatic duplication of mRNA are used to obtain cDNA sequences.

One of the reasons that the known methods have not yet directly used natural DNA to synthesize recombinant DNA from proteins is that natural DNA isolated from the highest order organisms and at least some animal viruses contain "introns" or additional nucleotide sequences as part of the gene. . These inirons are not part of the final message from the gene. Instead, in higher organisms, specific enzymes acting on the primary transcription product remove introns in vivo and thus provide the final mRNA information for the gene. Bacteria are probably not capable of processing introns, so it would be expected that the natural DNA nein is expressed in the bacterial host cell and that these host cells do not produce the desired proteins.

Below is a brief explanation of the figures; It follows;

l. Fig. 6A is a simplified diagram showing the structure of endogenous DNA of a Danc particle. The figure shows two complementary DNA strands, strand a and b, the incision in strand a and the gap in strand b, and the filling of the gap by DNA polymerase reaction. THE

Fig. 2 schematically illustrates a preferred embodiment of the process of the invention.

Fragments of endogenous DNA isolated from Dane particles were fused to the E. coli penicillinase gene at Pst 1 at plasmid pBR322. After transformation with E. coli HB101, pBR322-Psl I dG; The recombinant DNA molecule HBV-KpnI dC directs the synthesis of polypeptides showing HBV antigenicity.

Figures 3-9 show the nucleotide sequence defining a portion of the hepatitis B virus genome of the invention. The sequence is shown together with the stop codons in the three reading frames placed above it. Optionally, the gene encoding the HBcAg can be numbered from the initiation codon. Nucleotides -80 - (- 1) represent the leading sequence preceding the gene. 1-549. nucleotides represent the nucleotide sequence encoding the hepatitis B virus internal antigen and the amino acid sequence (1 reading frame) of this antigen is shown above the sequence.

No. 1437-2114. nucleotides represent the nucleotide sequence determined for the gene encoding the hepatitis B virus surface antigen and the amino acid sequence of the antigen (3 reading frames) is shown above the sequence. The various restriction endonucleases present in these genes are recognizable _; 3 to 9 are also shown. FIG.

Figure 10 schematically illustrates a method according to the invention of dividing a recombinant DNA molecule capable of producing a polypeptide which expresses an internal antigenicity of hepatitis B virus into fragments and one fragment thereof? linked to an enhanced expression control sequence, the lac system.

All. Figure 3B illustrates a process according to the invention. wherein the recombinant DNA molecule of the invention is fragmented and linked to a phage DNA, which is used to lysogenize host cells, thereby increasing the number of gene copies therein.

Figure 12 shows another embodiment of the method of the invention: the recombinant DNA molecules of the invention which are unable to produce a polypeptide having an internal antigen of hepatitis B virus are fragmented to remove the structur gene from HBsAg and use this structur gene followed by the preparation of a recombinant DNA molecule which produces HBsAg in a suitable host.

The following terms are used in this description:

nucleotide: a monomeric unit of DNA or RNA which is a sugar moiety! (pentose) phosphate and a nitrogen containing heterocyclic base.

The base is attached to the sugar backbone through the glycoside carbon atom (via the pentose carbon atom) and this combination of base and sugar yields a nucleoside. The base characterizes the nucleotide. The four DNA bases are adenine ("A"), guanine ("G"), cytosine ("C") and tyrnine ("T"). The four RNA bases are A, G, C and uracil ("U").

DNA Sequence: A linear sequence of phosphodiester linked nucleotides bonded between the 3 'and 5' carbon atoms of adjacent pentoses.

codon: A sequence of three nucleotides (triplets) of DNA encoding an amino acid, a translational start signal, or a translational termination signal via mRNA. For example, the nucleotide triplets of TTA, TTG, CTT, CTC, CTA, and CTG encode the leucine (Leu) and the TAG, TAA and TGA translational stop signals and the ATG translational start signal.

reading frame: Grouping of codons during translation of an mRNA into an amino acid sequence. An appropriate reading frame should be maintained during translation. For example, GCTGGTT GTAAG can be translated by three reading frames or phases, each of which gives a different amino acid sequence:

GCT GGT TCTAAC-Ala-Gly-Cvs-Lys

G CTG GTTGTA AG-Leu-Val-Val

GC TGG TTG TAA A -Trp Lcu- (STOP) polypeptides

Linear sequence of peptides linked by peptide bonds between carboxy groups and α-amino groups of adjacent amino acids, genome: Total DNA of a compound. Among other things, the structural genes encoding the polypeptides of the compound, the operator, the promoter, and the ribosome binding, interaction sequences, e.g. It comprises structural genes encoding the Shine-Dalgaro sequence.

Structural gene: A DNA sequence encoding an amino acid sequence specific to a specific polypeptide, either through its own template or via mc RNA ("mRNA").

Transcription: A mRNA production process derived from a structural gene.

Translation: The process of producing a polypeptide from mRNA.

Expression: The process by which a polypeptide is generated from a structural gene. The combination of transcription and translation,

Plasmid: A non-chromosomal double-stranded DNA sequence containing an intact "replicon", thus replicating in the host cell. When the plasmid is introduced into a single-celled organism, the characteristics of the organism are plasmid DNA _; because of this they are changed or transformed. For example, a plasmid carrying the tetracycline resistance (Tet ^R ) gene transforms a cell previously sensitive to telracycline to a tetracycline resistant cell. A cell transformed with a plasmid is called a "transformant".

Phage or Bacteriophage: A bacterial virus, many of which have proteins or sheaths (capsids) that contain a DNA sequence. In a single-celled organism, the phage is replicated by a process called transfection.

Cloning Vehicle: Plasmid, phage DNA, or other DNA sequence that is cloned in a host cell. and which have one or more endonuclease recognition sites where the DNA sequences can be cleaved in a detectable manner without loss of essential biological functions, e.g. replication, production of capsids, or loss of promoter or binding sites, which contains a feature that is suitable for transforming cells, e.g. to detect tetracycline resistance or amipillillin 4 resistance. The chlorinating carrier is often referred to as a vector.

A'iAiozö.y.'Asexual reproduction process. ¹

Recombinant DNA Molecule: A hybrid DNA sequence consisting of at least two nucleotide sequences, the first of which is usually not found in nature together with the other.

Expression Regulating Sequence: The nucleotide DNA sequence that controls the expression of structural genes when operatively linked to these genes.

Returning to Figure 1, the figure shows a simplified diagram of the endogenous DNA of a Dane particle. Dane particles can be detected in the plasma of some patients with hepatitis 3 virus infection. (DSDaneesC. H. Cameron, "Virus-like Particles In Serum Of Patients From Australia-Antigen Associated Hepatitis," The Armor, 1, 695-698 (1970)). This particle is presumed to be identical or related to the hepatitis B infectious virion. Although its size is known (42 nanometers in diameter), its structure is not fully elucidated. Usually, the Dane particle probably consists of an outer layer and an inner core. The outer layer of the particle generally contains a hepatitis B virus ₍ known as surface antigen ("HBsAg")) polypeptide. The inner core (27 nanometers in diameter) contains a second polypeptide, hepatitis B internal antigen ("HBeAg"), and an endogenous double-stranded, It contains a circular, Ζ, ΙχΙΟ ⁶ Dalton molecular weight molecule that contains a single-stranded gap of varying lengths. A third polypeptide, antigen e (“HBeAg”), can also be attached to the Daner particles. endogenous DNA-dependent DNA polymerase, which partially fills the single-strand gap in endogenous DNA through the use of DNAase as a primer / template polymer. WS Robinson, "The Gcno.me of Hepatitis B Virus", Ann Rev. Mierobiol., 1977, 31.357-377]. however, the true structure of various antigens or their genes has not yet been determined.

End The endogenous DNA of the Dane particle was isolated by extraction of the Dane particle. It contains a constant length, small cut or orifice neucleotide strand (Figure 1, strand - 3000 nucleotides) and a slightly variable length < RTI ID = 0.0 > second nucleotide < / RTI > strand (Figure 1, strand, ~ 2000nucleotides). The second strand is complementary to. first and overlaps its incision to form a circular structure with hydrogen bonding between complementary bases in the Watscn-Crick stand. This overlap is evident from Figure 1. The DNA polymerase of the Danc-particle DNA appears to use the second strand of endogenous DNA as a primer and the first strand as a template to fill the gap of different lengths with nucleotides complementary to the nucleons of the first strand, and thus approx. Get 3000 double-stranded double-stranded DNA.

Preparation of Hepatitis B Virus DNA

One HBsAG positive, HBeAg positive donor serum is adym serotype equilibrated in volume of buffer [0.1 M Tris-HCl, 0.1 M saline, NaCl, 0.1 wt. 2% mercaptoethanol in volume, 0.1% bovine serum albumin in 0.001 M EDTAj and adjusted to p H7.4. The mixture was centrifuged at 35,000 rpm for 2 hours at 4 ° C. The pellet thus obtained is resuspended in 200 μl. layered in the same buffer and topped with a centrifuge tube containing 20% sucrose. The suspension! Centrifuge at 40000 rpm for 2 hours at 4 ° C. The pellet thus obtained was resuspended in 100 μΐ buffer (0.1 M tris-HCl, 0.1 M physiological saline) at pH 7.5.

The resulting DNA-containing pellet was then labeled with ³ H or ^M P [Ρ. M. Káplán et al., "DNA Polymerase Associated With Human Hepatitis B Antigen," J. Virol. 12, 995-1 (K) 5 p. (1973) 5 and thus easier to follow the successive steps of the process. This signal is obtained from a reaction of concentrated Dane particles and ³ H or '-P-labeled deoxy nucleoside triphosphates (dNTP) for 4 hours at 37 ° C. Following the DNA polymerase reaction, which partially fills the DNA single-strand gap (see Figure 1), the labeled DNA material is layered on top of a 30% sucrose centrifuge tube and centrifuged at 42,000 rpm for 3 and a half hours at 4 ° C. revolutions per minute.

The DNA is then extracted from the pellet with phenol. [LI Lutwick and WS Robinson, "DNASynthesized In The Hepatitis B Dane Partide DNA Polymerase Reaction", J. Virol., 21, 96-104. (1977) first The extracted DNA is then 0.0! mole Tris-HCl, 0.001 mole EDTA, pH 8.0, dialyzed to remove the phenol solvent. The isolated DNA is then ready for restriction enzymatic degradation. Specific radioactivity - 10 ⁸ cprn / gg. The process described above is schematically illustrated in Figure 2.

Cloning of hepatitis B virus DNA

A wide variety of combinations of host-clone-forming carriers can be used to clone double-stranded DNA isolated as described above. so e.g. useful clone-forming carriers such as chromosomal or non-chromosomal and synthetic DNA sequences, e.g. various known plasmids, e.g. pBR322 or other E. coli plasminides and their derivatives; broader host plasmids e.g. RP4; phage DNA ck, various derivatives of phage λ e.g. vectors derived from the combination of NM899 and plasmids and DNA, e.g. plasmids modified for use in phage DNA expression control sequences. Useful hosts may include bacterial host cells, e.g. E. coli. X1777, E. coli, X 2282, E. coli, HB101 and E. coli, MRCI and Pseudomonas, Bacillus subtilis strains, and other bacteria, yeast and other fungal, animal or plant host cells, e.g. animal or plant cell cultures and other host cells. Not all hosts are equally effective, of course. Λ It is the responsibility of the skilled person to make the appropriate selection of the host combination media carrier.

Selected from ^one of two different Properly done within each vector from the isolated double-stranded DNA to be inserted. These sites are usually designated by the name of the restriction enzyme or endonuclease that carries out the cleavage, e.g. in plasmid pBR322, the Pst I site is located in the pcnicillinase gene between nucleotide triplets encoding amino acids 181 and 182 of the penicillinase protein. This site was used by Villa-Komarcif et al. In the synthesis of protein with rat proinsulin antigenic determinants. The Elind Ti endonuclease recognition site is located between the triplets encoding amino acids 101 and 102 of the pBR322 protein and the Tag site is located at the triplet encoding amino acid 45. Similarly, the recognition site for the plasmid Eco Rl endonuclease is located between genes encoding resistance to tetracycline and ampicillin. This site was used by Itakura cs et al. And Goeddel et al. In their recombinant DNA synthesis schemes (see above). Figures 2 and 11 show some restriction sites in plasmid pBR322 and phage λ NM989.

A number of factors influence the selection of the site where the selected DNA fragment is inserted into the clone-forming carrier to form the recombinant DNA molecule. These factors are e.g. size and structure of the polypeptide to be expressed, susceptibility of the polypeptide to endoenzymatic degradation by components of the host cell, expression characteristics, e.g. the location of the start and stop codeins and other factors obvious to the person skilled in the art. As the expression process is not yet fully understood, none of these factors alone determine the site of insertion of the polypeptide. Rather, the site chosen affects the balance of factors and not all sites are equally effective for a particular protein.

Although many methods are known in the art for inserting foreign DNA into a clone-forming carrier to form a recombinant DNA molecule, the preferred method of the present invention is illustrated in Figure 2. The process is characterized by cleaving Dane particle DNA with restriction eridonuclease, attaching polydeoxy C sequences to the 3 'end of the cleaved DNA (named after the DNA of the DNA sugar backbone), and linking the elongated DNA to a clone-forming carrier. cleaved with a restriction endonuclease at a particular site and ligated with polydoxy G at the 3 'end of this cleavage. This polydoxy C sequence is complementary to the cleavage DNA extension polydoxy C sequence, and the complementary nature of the 3 'ends of the DNA and the clone-forming carrier allows for the cohesion of the terminal regions.

In the process of the present invention, it is convenient to select a restriction enzyme for DNA cleavage which does not cleave HBV DNA in a substantial portion of the gene encoding the polypeptides exhibiting HBV antigenicity, and most preferably cleaves the DNA at a limited number of sites. The following restriction enzymes are used according to the invention: Kpn 1, Bgl 11, ylphyl H 1, 4ra 1 and Eco R 11. Other restriction enzymes may also be useful in the present invention. The enzyme should be selected by one of ordinary skill in the art having regard to the factors listed above. 3-9. Figures 3 to 5 show some restriction endonuclease recognition sites in the HBV genome.

Of course, other known methods can be used to construct DNA molecules. Such as direct ligation, where the same restriction endonuclease is used to cleave HBV DNA and the clone-forming carrier. This method also provides complementary ends for cohesion.

It is, of course, understood that the nucleotide sequence or gene fragment inserted at the selected restriction site of the clone batching medium may include nucleotides that are not part of the true structural gene for the desired protein or include only a fragment of the structural gene. All that is required is that, whatever DNA is incorporated, the transformed host cell will produce a polypeptide with HBV antigenicity.

A recombinant DNA molecule containing a hybrid gene can be used to transform a host cell so that the host cell (transformant) expresses a structural gene or fragment thereof and produces a polypeptide or portion thereof encoded by the hydride DNA. The recombinant NDS molecule can also transform the host cell by replication of the host cell! produce additional recombinant DNA molecules as a source of HBV structural genes and fragments thereof. The choice of a host suitable for the above purposes will depend on a number of factors known in the art. such factors are e.g. compatibility, by-product toxicity, ease of recovering the polypeptide product, expression characteristics, biosafety and cost. As the mechanism of expression is not yet fully elucidated, the host cell for the specific recombinant DNA molecule or polypeptide cannot be perfectly selected solely on the basis of the above factors. A balance of factors must be found while recognizing that not all host cells affect the expression of a particular recombinant DNA molecule in the same way. The preferred clone-forming vehicle for the synthesis of the invention is the bacterial plasmid pBR322 and the preferred restriction endonuclease site is the Pst1 site (Figure 2). This plasmid has an approx. 2.6 small molecular weight plasmids carrying resistance genes for antibiotics; ampicillin (Amp.) And tetracycline (Teta). The plasmid was fully characterized (F. Bolivar et al., "Construction and Characterization of New Cloning Vehicles II. The Multipurpose Cloning System", Gene 95-113 (1977)). The most preferred host cell of the invention is E. coli HB101.

by standard reaction with transferase *, polydeoxy-C sequences were coupled after the remaining protein was extracted with 20 µl of phenol and 20 µl of chloroform and removed. The phenol was removed from the aqueous phase by ether extraction and the DNA was precipitated by addition of 5 µl of 3 M sodium acetate pH 6.5 and 0.1 mL of cold ethanol. ^D stored at -70 C for one hour, the precipitated DNA by centrifugation at 10,000 rpm for 20 minutes and the pellet isolated minutes 10 ul of 10 mM pH 7.5 Tris-HCl dissolved. To this was added 3 µl of a 400 mM potassium cacodylate, pH 7.0, 4 mM cobalt chloride and 4 mM deoxylethosine triphosphate (dCTP), 200 µl / ml bovine serum albumin at 27 ° C for 10 min. 5 µl polynucleotide terminal transferase (6000 µg / ml) was induced by stopping the reaction by adding 50 µl EDTA 1 µl.

2. Preparation of pf1R322 Prolonged by Pst I Cooling with dC

Plasmid pBR322 is digested with Pst I restriction endonuclease (for which the plasmid contains a single target) and purified by phenol extraction and ethanol precipitation as described for HBV DNA. The poly-dG sequences (see GGG in Figure 2 for illustration) are linked to the 3 'end of the linear pBR322 molecule by terminal transferase, just as the poly-dC sequences are linked to HBV except that reaction was carried out at 37 ° C.

3. Poly-G extended pBR322 and potiC-extended HBV DNA cohesion

Equimolar amounts of pBR322 poly-dG and HBV-DNA poly-dC were mixed and the complementary sequences in 50 ml of TNE mixture TNE: 100 mM sodium chloride, 50 mM trisHCl, pH 7.5, 5 mM (EDTA) After incubation at 65 ° C for 1 hour, then incubated at 47 ° C for 1 hour, then incubated at 37 ° C for 1 hour and 20 ° C for 1 hour, an equal volume of TNE and 20 µl of 100 mM inagnesium chloride, 100 mM calcium chloride was added. 100 mM Tris-HCl pH 7.5 was added.

1. Preparation of dC-vcl Extended Dane Particle DNA

In a preferred embodiment of the method of the invention, DNA isolated from Danube particles as described above was digested with Kpn I (approximately 20 ng DNA in 10 µl of 10 mM Tris-HCl, pH 7.5, 10 mM magnesium chloride, 10 mM). 2-mercapto ethanol, 40 mM sodium chloride, in 0.5 μl of enzyme preparation) was digested at 37 ° C for 90 minutes and the inactivated restriction enzyme was heated at 70 ° C for 5 minutes. The polynucleotide terminal at the 3 'end of the product after digestion (designated CCC in Figure 2)

4. E. coli HfílO! transformation

E. coli HB101 cultures suitable for transformation were prepared Ε. M. Ledérberg and S. H. Cohen, "Transformation of Salntonella typhymurium by plasmid Deoxyribonucleic Acid", J. Bacteriok, 119, 1072-1074. [1974]. 0.1 ml aliquots of cells were mixed with 25 µl of tempered DNA preparation and incubated at () ° C for 20 min and then at 20 ° C for 10 min before 50 µg / ml (etracycline L-agar plates:

* (Nuclic Acids Research, 3.101-15 a, (1976)) and incubated overnight at 37 ° C. Because plasmid pBR322 also contains the tetracycline resistance gene, E. coli colonies transformed with the plasmid will grow in antibiotic-containing cultures, unlike untransformed E. coli colonies. Therefore, culturing in a culture containing tetracycline allows selection of properly transformed hosts.

5. Screening of E. coli colonies by hybridization

Bacterial colonies grown on incubated L-agar plates containing tetracycline were tested for sensitivity to ampicillin. Plasmid pBR322 contains the ampicillin resistance gene. This gene is the recommended site for inserting the hybrid gene. Therefore, colonies transformed with plasmids containing DNA inserted at the selected recognition site are sensitive to ampicillin but remain resistant to tetracycline. The ampicillin-sensitive but tetracycline-resistant E. coli colonies were transferred to a Millipore cellulose nitrate filter maintained on L-agar plates containing tetracycline. The colonies were grown overnight at 37 ° C and the Millipore filter was transferred to fresh L-agar plate containing tetracycline and 150 pg / ml chloramphenicol and incubated for several hours at 37 ° C to increase the number of copies within the cells. (Figure 2) Millipore filters are then used for colony hybridization: M. Grunstein and D. S. Hogness, "Colony Hybridization: Method Fór The Isolation of Cloned DNAs That Contain Specifications", Proc. Null. Acad. Sci. USA 72: 3961-3965. [1975], '-P-labeled HBV DNA, previously prepared as a sample. Colonies show that colonies containing DNA sequences complementary to authentic HBV DNA are present.

Detection of colonies synthesizing HBV antigenicity polypeptides

Colonies resistant to telracycline and hybridized to ampicillin-sensitive and authentic HBV DNA were tested for the production of at least one polypeptide having HBV antigen capability or HBV antigen specificity. The colonies were transferred again to Millipore filters on L-agar containing tetracycline and incubated at 37 ° C overnight. A second L-agar plate was covered with E. coli C600 culture (0.1 ml in 2 ml soft agar) which was spiked with λ vir. The bacteriophage was infected with a virulent strain (infection multiplication index of about 1) and also incubated at 37 ° C overnight, during which time the bacterial surface lysed seamlessly (i.e., viral wall (λ virulence) ruptured). Millipore filters containing cells transformed according to the method described above were raised (PC Wensink et al., "System Foor Mapping DNA Sequmences In The Chromosomes Of Drosophila Melanogaster", Ceu, 1974, 3,315-250).

α-plates and colonies were contacted with the surface of the E. coli C600 L-agar plate lysed with λ. This contact is approx. It was maintained for 10 minutes to allow cells on the Millipore filter to become infected with λ. The Millipore filter was then placed on fresh L-agar plate and incubated for an additional 5 hours. Meanwhile, the flexible polyvinyl sheets * were coated with HGV antibodies. | S. Broome cs W. Gilberl, Immunological Methods for Detection of Specific Translation Products, Proc. Natl. Acad. Sci. USA 75: 2746-2749 (1978). The lysed transformed bacterial colonies on the Millipore filter were contacted with the coated polyvinyl plates and left at 0 ° C for 3 hours. As a result of this contact, I-IBV antigens on the Millipore filter lysed from the cells bind to the HBV antibodies on the plate. The coated plates were separated from the Millborc filter, washed and incubated with 125 L of HBV antibody. As a result of the incubation, radioactive markings were observed in the areas of the plate where the HBV antigens from the Millipore filter were previously linked to the HBV antibody of the plate. After washing and radio autographing (Broome and Gilbert ... see above), colonies producing HBV antigen specific polypeptides were localized by radiautography.

Use of polypeptides and genes derived from recombinant P> NS molecules for the detection of HBV antibodies in humans

The HBV antigen-capable polypeptides, and the structural genes and fragments encoding them, can be used to detect HBV antibodies in humans and to detect CSVs in humans infected with this virus.

For example, HBcAg produced by host cells transformed with the recombinant DNA molecules of the present invention can be used in an immunoassay for the detection of hepatitis B virus used today, i.e., a radioimmunoassay or an ELISA (enzyme-linked immunosorbent assay). z \ radioimmunoassay in a laboratory animal elicited an in-arm antigen antibody to a solid phase, e.g. bound to the inner wall of the test tube. HBcAg, which binds to the antibody, is then added to the test tube. The patient's serum sample is added to the antigen-antibody complexed test tube with a radioactive isotope, e.g. with a known amount of HBV anti-intrinsic antibody labeled with radioactive iodine. Any HBV antibody in the patient's serum competes with the labeled antibody for free binding sites on the antigen-antibody complex. Serum is allowed to interact, excess liquid is removed, the test tube is washed, and the amount of radioactivity is measured. A low radioactive count indicates that the patient's serum contains HBV antibody.

* ("Immunological Sereening Method To Detect Specified Translation Products," Proc. Natl. Acad. Sci. USA. 75, 2746-49 (1979))

In one EL1SA assay, a microtiter plate is coated with HBcAG and the patient's serum sample is added. After an incubation period during which any antibody may interact with the antigen, the plate is washed and a composition of laboratory-made antihuman antibodies coupled with a labeled enzyme is added, and the plate is washed again. The enzyme substrate is then added to the microtiter plate and incubated until the enzyme acts on the substrate and the absorbance of the final formulation is measured. The large change in adsorption shows positive results.

- In vivo effect of polypeptide obtained from recombinant DNA molecules

The biological activity of the antigenic polypeptides translated from the E. coli recombinant DNA molecule of the invention was measured by injecting into sterile rabbits after mixing sterile bacterial cell extracts expressing HBcAg with an equal volume of Freund's adjuvant. Two animals received crude bacterial extracts and two obtained a sample obtained after fractionation of the extract on a Sephadex 650 column. Two samples were frozen and stored for two weeks after the first injection, and then kept frozen to maintain complete antigen activity. The animals were periodically bleed several weeks after the first injection. O. Ouchterlony: "Immunodifusion and Immunoelectrophoresis". Hanabook of Experimenlal Immunology (DW Wcir cd.) (Black-well Scientific Publications, Oxford and Edinburgh) Chapter 19 (1976) performed immunodiffusion experiments to compare rabbit serum (antibodies) with human hepatitis B virus intrinsic antibody (HBcAb). ) using HBcAg from human liver [B. J. Cohen and Y. E. Cossart, "Application Of A Screening Test For Factor Antibody To Hepatitis B Corc Antigen", · '. din. Path., 30. 709-713. 197 / j). All four rabbit sera gave precipitation bands with HBcAg, which are identical to those between human-derived HBcAg and BcAb. Therefore, in E. coli, the internal antigen synthesized by the recombinant DNA of the invention is serologically active in vivo. This activity enables the use of methods and compositions utilizing viral antigens synthesized in microbial cells to enhance human antibody production. These compositions and methods are characterized by polypeptides produced in host cells transformed with recombinant DNA molecules of the present invention. The polypeptides, alone or with known pharmaceutically acceptable carriers, e.g. saline or other known adjuvants for the treatment or prevention of viral infection in man.

As mentioned above, restriction enzymes other than the Kpn UPst I combination may be used to produce the recombinant DNA molecules of the invention. Other recognition sites in plasmid pBR322 and part of the HBV 8 genome are depicted in Figure 2, Figure 3. The latter, less preferred embodiment of the process of the invention is illustrated by the following examples.

HAM HI, ECO R1, BGL II-PST 1 combinations

HBV DNA fragments produced using Bam Hi Eco Ri and Bgl U could not be easily linked directly for cohesion due to the presence of short 5 'filament protrusions. Therefore, the fragments were treated with λ exonuclease to remove the above protrusions before adding the poly-dC sequences at the 3 'end. This was done by digesting the restriction enzyme-treated DNA (10 μ le of the previously described solution) with 15 μl of 100 mM sodium glycinate, pH 9.5.10 mM magnesium chloride, and 100 μΐ of bovine serum albumin. μΐ λ exonuclease was incubated at 0 ° C for 1.5 h. The mixture was then extracted with phenol and chloroform and the process continued. In the formulation in which Bam HI was used, the radioimmunoassay confirmed that a HBV antigen specific polypeptide was produced. !

Direct ligation ECO R1-ECO R1 and BAM, HI-BAM HI

Instead of amplifying DNA fragments for cohesion, direct ligation of the gene fragments can be used in the methods of the invention. so e.g. in two further formulations, HBV DNA (20 ng) is treated with restriction endonuclease (Eco RI or Bam HI) in 10 µl of 10 mM molostris-HCl. pH 7.5 in a mixture of 10 mM magnesium chloride, 10 mM 2-mercaptoethanol, 50 mM 10 μΐ sodium chloride at 37 ° C for 1.5 hours and mixed under the same conditions with an excess of pBR322 previously incubated with the same enzymes. 2 μΙ of a concentrated buffer solution (660 mM Tris-HCl, pH 7.5, 100 mM magnesium chloride, 10 mM EDTA, 100 mM 2-mercaptoethanol, 400 mM sodium chloride, 1 mM ATP) was added and the mixture was incubated with T4 DNA ligase (0.5 μΐ) at 10 ° C for 3 hours and then at 0 ° C for at least 24 hours. The solution was diluted to 10 ml with 10 mM Tris-HCl pH 7.5 and used to transform appropriate E. coli HB101 cultures as described above. In the case of recombinant DNA molecules produced by Bam HI, colonies were screened for susceptibility to tetracycline rather than ampicillin prior to screening for hybridization, because Bam HI targets pBR322 within the gene encoding for thiazide resistance, site results in the loss of resistance, instead of the loss of ampicillin resistance, as occurs at the Pst I site.

In the case of recombinant DNA molecules produced at the Eco RI site, colonies were tested for resistance to both tetracycline and ampicillin prior to screening for hybridization, since the target of Eco RI in pBR322 is tetracycline resistance and thus encodes genes for ampicillin resistance. ampicillin and tetracycline resistance genes are not inactivated by the insertion of hybrid DNA at this site.

The microorganisms of the present invention were deposited on December 15, 1978 at pBR322 HBV-A to F at the Culture of Collection of tbc Microbiological Research Establischment Porton Down. These cultures are characterized as follows:

A: E. coli HB 101 / pBR322-P. «I dG: HBV-AFW I De: Tet ^R Amp ^s HBV * VA ⁺

Β: E. coli HB 101 / pBR322-Pu I dG: HBV-Snm Hl dC: Tet ^R Amp ⁵ HBV ⁺ VA *

C: E. coli HB 101 / pBR322-PsI I dG: HVB-Sg / II dC: Tct ^R Amp ^s HBV *

D: E. coli HB 101 / pBR322-ft d l: HBV-£ co Rl dC: Tet ^R Amp ^s HBV '

Ε E. coli HB 101 / pBR322-OM 'Hl: HBV guard / MHI, Tet ^{R and} Amp HBV ¹

F: E, coli HB 101 / pBR322- £ «? Rl: HBV- £ ra Rl: Tet ^R Amp ^R HBV ·

Part of the cultures were dec. We also deposited it in Abcrdeen, Scotland, on 19 June with the National Collection of Industrial Bacteria.

The aforementioned culture nomenclature contains the following culture description: host / clone generator; the restriction site in the clone-forming carrier, with the optional extended nucleotide; hepatitis B virus restriction site in hepatitis B virus, indicating the presence of an extension: resistance (R) or sensitivity (S) to tetracycline (Tet) and ampicillin (Amp), positive hybridization with HBV DNA in the colony hybridization assay (I. (HBV ¹ ) and HBV Antigenicity Polypeptide (above) (VA *).

Based on the above nomenclature, pBR322-BV-A refers to a culture of E. coli MB101 containing recombinant DNA as a plasmid containing pBR 322 cleaved at the Pst I site and extended at the 3 'end with a polydG terminus and the associated Kpn. It consists of HBV DNA cleaved with I and extended at the 3 'end with poly dC and produces a tetracycline-resistant, ampicillin-sensitive, HBV DNA hybridization test positive and showing HBV antigenicity.

Of course, hybrid microorganisms, recombinant DNA molecules, and polypeptides are not limited to the preferred embodiment listed above. The hybrid organisms, the recombinant DNA molecules and the polypeptides may be modified during production or in a manner known per se. so e.g. more efficient expression control sequences may be used for transcription of HBV genes or hybrid genes, mutations may be introduced to reduce the synthesis of unwanted gene products, to reduce protease levels in host cells, and snow-inducible lysogens containing HBV genes may be incorporated into host cells. and methods can be used to increase the number of gene copies in cells or to increase the productivity of cells producing the desired polypeptides.

In addition to being useful in the production of polypeptides having HBV antigenicity, the hybrid microorganisms of the invention are also capable of generating large amounts of DNA containing all or a portion of the hepatitis B virus genome. so e.g. Addition of chloramphenicol to the medium, reaching appropriate cell density, or using mutations to prevent the lysis of bacteriophage hybrids containing HBV sequences will allow production of previously unavailable HBV DNA.

The HBV DNA produced in this manner can be used to determine the nucleotide sequence of the genome and hence the amino acid sequence and gene of the HBV antigens as well as the structural genes themselves. Knowledge of these sequences will help to understand the biology of the hepatitis B virus and to make the best use of the above modifications.

- DNA fragment mapping and nucleotide sequencing

1. Hepatitis B Internal Antigen

The recombinant DNA molecules obtained by the method of the invention, which confer the host cells their ability to synthesize HBcAg, as demonstrated by solid phase radioimmunoassay, were selected for sequence analysis. The fragments were prepared from the recombinant DNA molecules by digestion with the appropriate restriction enzymes and the fragments were labeled at their 5 'end with [α ^-12 P] ATP and T4 polynucleotide kinase. The nucleotide sequences of each fragment were determined by known chemical degradation methods. [AM Maxam and W. Gilbert. "New Method Foor Sequencing DNA", Proc. Nat. Acad. Sci. USA. 74, 560-564. She.

11977] j.

The resulting nucleotide sequences are shown in Figures 3-9. 4a. The sequence is numbered starting with A from the ATG translation initiation codon of the internal gene. The nucleotide sequence of the 1-lBCΔ gene and the amino acid sequence (first reading frame) of the polypeptide derived from this gene are shown in Figures 1-549. 3 to 9 are shown between nucleotides. FIG. The size of the polypeptide encoded by this gene is close to 19 (I (X) molecular weight (as observed for internal antigens from the Dane particle). However, the present structural definition does not exclude the possibility that some of the authentic antigen may be In addition, this structure does not take into account other or additional modifications caused by the interaction of the polypeptide with other human enzymes, such as glycosylating enzymes, and therefore the polypeptide structure defined herein may not be the same as in vivo. ! HBcAg, but very similar if it does not give the same immune response.

In all recombinant DNA molecules tested, HBV DNA was incorporated such that the internal antigen gene was found to be in the same translation phase as the penicillin resistance gene of pBR322. In addition, the HBV DNA insertion in the various recombinants began within one or two nucleotides of the same position in the HBV sequence. Since these recombinant DNA molecules have different restriction enzymes, e.g. Bam Hewe and derived from Kpn I-digested HBV DNA, this unique linkage is surprising and may be due to the random break of an HBV DNA-attached polynucleotide at the insertion of the endogenous DNA of the Dane particle. (Figure 1). Recombinant DNA molecules containing HBV DNA incorporated in different translational phases did not express the HBeAg gene and no HBV antigenic polypeptide was detected in host cells transformed with such recombinant DNA molecules. Of course, it will be appreciated that host cells and recombinant molecules that do not express such a gene are still useful in the process of producing the HBV DNA of the present invention.

Although it would have been expected that HBcAg or its fragments obtained by expression of HBV DNA integrations would be fused to the β-lactanase product of the penicillinase resistance gene through a small number of glycine residues, this was not the case. Instead, the β-lactamase was in each case linked to the same peptide sequence via 5-8 glycines, but this sequence was completed after 25 amino acids. In this reading frame (box 1, figure 3), the stop codon (TAG) is followed by three nucleotides, followed by an initiation codon, from which translation is continued without interruption, resulting in a polypeptide of 183 amino acids in length. (Figure 3-8). Thus, the portion of the intrinsic antigen activity is approx. It consists of a polypeptide having a molecular weight of 21,000 daltons translated de novo from the HBV sequence within mRNA transcribed from a recombinant DNA molecule. This polypeptide molecule stays within the host cell because it is not bound to the selected penicillinase carrier protein due to rearrangement of the stop and start codons of the inserted HBV DNA.

2. Hepatitis B: surface antigen

The nucleotide sequence of the HBsAg gene and the amino acid sequence of the polypeptide derived from this gene (reading frame 3) are also shown in Figures 6-8. 1437-2114. nucleotides. The amino acid sequence of this polypeptide begins at the N-terminus with the Met-Glu-Asn-IleThr-Ser sequence. This initial amino acid sequence was determined by D. L. Petcrson et al. From authentic human HBsAg: "Partial Amino Acid Sequence of Two Major Component Polypeptides of Hepatitis B Surface Antigen", Proc. Natl. Acad. Sci. USA 74, 1530-1534. [1977]. The amino acid sequence of the protein is shown in Figures 6-8. Figure 1B continues to a stop codon 226 amino acids distant. This 226 polypeptide sequence corresponds to a protein having a molecular weight of 25400 deltons.

The amino acid sequence and length of HBsAg were independently verified by sequence analysis of appropriate recombinant DNA molecules: P. Valenzucla et al., Nucleotide Sequence of The Gene Coding 10

Fór The Major Protein of Hepatitis B Virus Surface Antigen, 'Natúré, pp. 280,815-819. [1979]

This recombinant DNA molecule nucleotide sequence determined Iákra ¹ shows that the expression of HBeAg gene DNA molecules, none of favored HBsAg gene from which would be expected to be expressed in a suitable host cell. In essence, no HBsAg was detected in cell extracts transformed with plasmids expressing the HBeAg gene. However, as noted above, knowing the nucleotide sequence of these genes allows modification of the expression process, enhances the yield and facilitates the expression of genes and production of polypeptides that have not yet been expressed or detected.

Generation of improved recombinant DNA molecules for the production of HBV antigens

The genes and amino acid sequences of the above antigens are useful in designing methods to increase the level of antigen or gene / bacterial cell production.

The production level of a protein is influenced by two important factors: the number of copies of genes within the cell and the efficiency of transcription and translation of the gene copies. However, the efficiency of transcription and translation (the two giving expression) usually depends on the nucleotide sequences preceding the desired coding sequence. These nucleotide sequences or expression control sequences determine, among other things, the place where RNA polymerase interacts to initiate transcription (promoter sequence) and where ribosomes bind and interact with mRNA (transcription product) to initiate translation. , re. Not all such expression control sequences work equally well. Therefore, it is preferable to separate the specific sequences encoding the desired protein from the adjacent nucleotide sequences and instead link them to known expression control sequences to achieve a higher level of expression. Once this is achieved, the newly arranged DNA fragment is inserted into a multiplication promoter (multicopy) plasmid or bacteriophage derivative to increase the number of gene copies within the cell and further improve the production of the protein to be expressed.

For illustration purposes, the sequence determined for the HBcAb gene was used to improve the production of HBeAg in E. coli. Figure 10 illustrates such a process.

Analysis of the HBeAg DNA sequence in Figure 3 shows that this gene is preceded by an Alu I target at nucleotide 26 (AGCT) and Eco RI * targets at nucleotides 22 and 1950 and 209 Eco RII targets (CCTGG). , 280 contains Hae III targets and 246 and 461 nucleotides (GGACC GGTCC) contain Ava II targets. Because of this complex situation, it is easy to transfer the internal antigen coding sequence into sequences that regulate more efficient expression in two steps. so e.g. if a recombinant DNA molecule (pHBV 114) of approximately 2350 base pairs (nucleotides) from the nucleotide region -80 to 2270 of Figure 3, obtained by the method of the invention, is provided with both an Alin I- all digested with Eco RI *, the nucleotide fragment -26 to 22 (fragment A) is obtained, but only Eco RI * alone digests the same recombinant DNA molecule, a fragment of nucleotides 23-1589 (B). fragntent) and, in low yield, another fragment of nucleotides 23-576 (fragment B '). These fragments are readily identifiable in Figures 3-4. 10 and schematically the roles of FIG.

Fragments A and B are fractionated by electrophoresis for purification and then joined by their Eco RI * cohesive end to give a combined fragment (fragment C). Fragment C is now linked to a novel expression control sequence by direct ligation to maintain the correct translation phase by the aforementioned 3 'feeding method or by synthetic oligonucleotide linkers. Not only does this linkage utilize a better expression control sequence to increase protein production, it also allows the HBcAg coding gene fragment to be more closely linked to the expression control sequence itself and thus enhances the regulation of the gene fragment expression. Similarly, fragments A and B 'or other fragments may be linked together and the resulting fragment used in the same manner. This procedure shows that only a portion of the structural gene encoding a given polypeptide should be used in recombinant DNA molecules.

To further shorten the distance between the expression control sequence and the initiation codon of the selected gene fragment, the corresponding fragment may be slightly treated with a nuclease specifically acting at or near the terminus, or an exonuclease polymerase coupled repair reaction may be used to remove nucleotides from the fragment. Another method is to use -26. and the AII fragment obtained as a result of cleavage at nucleotides 30 and 30 can be similarly truncated by exonuclease treatment or polymerase coupled repair reactions followed by digestion with Eco RI to produce a fragment from nucleotide -26 to 22 which is capable of fusing to the expression control sequence. Alternatively, fragment B or its equivalent may be hybridized to the appropriate single-stranded template of the parent recombinant DNA molecule to extend it in a series of reactions with DNA polymerase and a limited number of nucleotide triphosphates such that the fragment strand can be reconstructed to the start of the coding sequence. The template strand is then cleaved with S1 endonuclease at the site of attachment to the elongated fragment strand and the resulting fragment is linked to the expression control sequence.

Multiple expression control sequences may be used. These include: E. coli lactose is the binding, interacting sequences of the ramp operator, promoter, and ribosome (including sequences such as the Shine-Dulgano sequence ("lac"system); sequences corresponding to the E. coli tryptophan synthase system). "Tr-system") are the major operator and promoter regions of phage λ (O _L P _L and RO _r P, < ¹ ) and the regulatory region of the phage fd capsid protein. DNA fragments containing these sequences are then cleaved with restriction enzymes from the transduction phages lac or trpoperons. These fragments are then labeled with the HB V antigen sequence so as to obtain a restricted population of molecules such that the essential regulatory sequences are very close to the initiation codon of the sequence encoding the desired antigen. next to it as in fragment C (see above)

The tr-fusion of the fusion is transformed into the appropriate host cells by transformation into a serving clone-forming medium and the degree of antigen production after lysis of the cells is determined by radioimmunoassay. In this way, the cells with the most efficient expression can be selected. Cloning agents linked to an initiation codon and carrying a lac.trp or l.P regulatory system and a fragment encoding a sequence encoding a HBV antigen-capable polypeptide may also be used such that the structural gene fragment is correctly translated from the initiation codon of the cloning carrier.

Although the above experiments were specifically directed to the production of HBV internal antigen, other genes, e.g. They can also improve the expression of their HBsAbs and HBsAbs.

Further enhancement of the intracellular production of the above antigens depends on the increase in the number of genes utilized in the cell. For illustrative purposes, the recombinant DNA molecules constructed as described above were incorporated into the "moderate" bacteriophage λ, simply by digesting the plasmid with a restriction enzyme (eg Eco RI or Hind H1) and treating the resulting linear molecule with restriction enzymes. phage λ with clone-forming medium fpl. Ν. With the cloning medium described by E. Murray et al., "Lambdoid Phages That Simplify The Rexovery Of VitroRceembinants", Molec. gene. Genet. 150, 53-61. o, (1977). and Ν. E. Murray et al., "Molecular Cloning Of The DNA Ligase Gene From Bacteriophagc T4,". Mole. Bioi., 132, 493-505. (1979) 1 and mixed with the resulting recombinant DNA molecule incubated with DNA ligase. The procedure is all. illustrated. The desired recombinant phage for the antigen was then selected by hybridization with HBV DNA sequences for which the corresponding antigen was radioimmunoassay or radiolabeled and the E. coli host strain was lysed with the phage.

A particularly useful λ clone-forming carrier contains a temperature-sensitive mutation in the r expression gene and suppressor mutations in the S gene, the product of which is required for host cell lysis, and also contains the E gene, the major capsid protein of the virus. In this system, lysogenic cells are cultured at 32 ° C and then warmed to 45 ° C to initiate profusion. Long term cultivation at 37 ° C leads to efficient antigen production, which is sustained within the cells, as these phage gene products are not lysed in the usual manner and, since the inserted phage gene is not encapsulated, remains accessible for transcription. Artificial cell lysis releases antigen with good production (Figure 11)

In addition to the E. coli systems discussed above, the same operations can be used to increase the activity of other microbial cells, e.g. B, subtilis, thermophilic bacteria, yeast or fungi or other plant or animal cell cultures for antigen production. For B. subtilis, a plasmid carrying penicillinase determinants isolated from B. licheniformis provides a useful expression control sequence for this purpose.

Enhancer for the expression of a gene encoding HBsAg! preparation of a recombinant DNA molecule

The gene and amino acid sequences determined for HBsAg can be used to develop methods for expressing the HBsAg gene according to the present invention. Such expression has not been previously observed in host cells transformed with recombinant DNA molecules producing HBV antigenicity.

6-8. The nucleotide sequence of Figures 1 to 4 shows the HBsAg coding gene between nucleotides 1437 and 2114. This gene is in a different translation phase (reading frame 3) than the gene encoding HBcAg in the HBV genome (reading frame 1), Figures 1-3-9. Therefore, we selected a recombinant DNA molecule for HBsAg production that did not produce IIBcAg during host cell transformation but, at the same time, produced about 2% of HBsAg. It contained an HBV DNA of 2350 nucleotides (the sequences corresponding to nucleotides from -80 to 2270 (see Figures 3-8).

The selected recombinant DNA molecule contained, inter alia, the gene encoding the entire HBsAg. Nucleotide sequencing of the inserted HBV DNA reveals a number of restriction endonuclease targets that allow for the cleavage of fragments containing the gene encoding HBsAg. For example, nucleotide 1409 (Xho), nucleotide 1410 (Tkk /), nucleotide 1409 (Avn-I), and nucleotide 1428 (goose I) (Figure 6). Of these, Hha1 is particularly useful because the cleavage of the inserted HBV DNA occurs between nucleotides 1430 and 1431, which is only six nucleotides before the translational initiation codon (ATG) of the HBsAg gene! means fission. In all four cases, the excised fragment extends beyond the chosen inserted HBV DNA to the target of the appropriate restriction endonuclease located within the nucleotide sequence of the pBR322 portion of the recombinant DNA molecule. The use of these or other restriction endonucleases, alone or in combination, is very useful in allowing the gene encoding HBsAg to be excised before, but close to, and after the translation termination codon of the initiation codon. Of course, similarly to the HBcAg gene, only fragments of the entire gene need to be used in recombinant DNA molecules to produce HBsAg antigenicity polypeptides in appropriate host cells. ¹

HBV DNA fragments obtained by such digestion can be treated with a series of reactions described for genes and gene fragments encoding an internal antigen, e.g. the fragment may be inserted into the pBR322 penicillin resistance codon gene (eg, Pst I recognition site, Figure 2) to obtain the HBsAg antigenicity polypeptide by fusion to the β-lactamase (product of the penicillinase gene); in another case, the gene fragment is inserted between the pBR322 genes encoding penicillin resistance and tetracycline resistance (Eco RI or Hind III recognition sites) - Figure 2. Also, prior to incorporation into the expression control sequence of the lac system, HBV DNA fragments can be linked to the lar system, thereby obtaining a HBsAg antigenicity polypeptide fused to the lac system's β-galactosidase protein. The gene fragment may be inserted into the cloning carrier as close as possible to the expression control sequence as described above for the gene encoding HBsAg, or the gene fragment may be cloned differently in accordance with the present invention.

As an illustration, one such scheme is shown in Figure 12. As shown, the selected recombinant DNA molecule containing the inserted HBV DNA between nucleotides -80 and 2280 (Figure 3-8) was fragmented by digestion with HhalveV. The resulting fragment was introduced by the 3 'linkage method at the Pst I site of pBR322 as described previously. Host cells transformed with recombinant DNA molecules produced polypeptides with HBsAg antigenicity.

Other fragments (e.g., Ava I, Taq, Xho, or Pst 1 (detailed digestion)) have been incorporated into the Pis 1 recognition site of pBR322 or other sites for the production of recombinant DNA molecules which allow expression of HBsAg antigenic polypeptides or HBsAg-encoding gene fragments. live.

In addition, gene fragments were inserted into pBR322 which were cleaved with Pst I and the resulting gene expression of the penicillinase encoding gene was further digested from the codon 182 of the penicillinase or β-lactamase to one of the 32 codons. in another case up to the codon encoding the 13th amino acid of the polypeptide. These plasmid derivatives of pBR322-Pst I'were also used in the HBsAg gene fragment, from nucleotides 1147 to 1796, to produce polypeptides with HBsAg antigenicity.

The nucleotide sequence between nucleotides 948 and 1437, which directly precedes the structural gene encoding HBsAg, may be included in the fragments required for the production of useful recombinant DNA molecules, for the production of polypeptides exhibiting HBsAg antigenicity and fragments of the HBsAg structural gene. This nucleotide sequence is the precursor sequence of the gene. Gene fragments comprising the precursor sequence and the HBsAg structural gene can be excised with Alit I (nucleotide 939), Hittt I (nucleotide 900) or Hae II (nucleotide 899). For Alu 1 and Hha I, partial digestion and the resulting fragments are e.g. separation by electrophoresis is necessary because the recognition sites of these enzymes also occur within the precursor sequence (nucleotide 1091 for Alu I and nucleotide 1428 for Hha [I).

The microorganisms of the present invention are supported by examples of cultures deposited at the Culture Collectionoft National Collection of Industrial Bacteria, Aberdeen, Scotland on December 19, 1979 and identified in pBR322-HBV-G to L numbers. The microorganisms are characterized as follows:

G: £ ?. coli HB 101 / pBR322-Pst I dG: HBV-K / m I dC: (hereinafter "pHBV 114"): Tet ^H Amp ^s HBV *

Η: E. coli HB 101 / pBR322-Pst I 'dG: pHBV 114-Eri I dC: I: Tet ^R Amp ^s HBV · VA ·

I: E. coli HB 101 / pBR322- £ co Rí. Bam HI lac promoter sequence) -Húid III switches 114 HBV-Bam HI WIII Tet ^{R and} Amp HBV * VA *

J: E. coli HB 10l / pUR2 * EcoRl: HBV-1I4 W / Iu I Eco R switches, Tet ^{R and} Amp HBV VA ¹ Κ ^1: E. coli HB 101 / pBR322-dG PSZ 1: 144 pHBV-Ara I dC: Tet ^R Amp ^s HBV * VA *

L: E. coli HB 101 / pBR322-Pv I dG: pHBV 144-rof / dC: Beta Amp ^s HBV · VA '

The example

This example describes a method for producing polypeptides having specificity for hepatitis B internal antigens ("HBcAg"), which comprises inserting a DNA fragment encoding this polypeptide into a Bacillus cloning vector and transforming a Bacillus host with such a vector. express the inserted DNA fragment and produce the HBcAg polypeptide.

An appropriate cloning vector was constructed with plasmid pBR322 E. coli [F. Bolivár et al., “Construction and Characterization of New Cloning Vehicles II. The Multi-Purpose Cloning System (G7, 95-113, 1977); J. G. Sutcliffe. "PBR322 Restriction Map Derived From the DNA Sequence: A Restriction Map From the DNA Sequence of pBR322: Exact DNA Size Features to 4361 Nucleotide Pairs", Nucleic Aeids Research 5, 2721-28 ( 1978); JG Sutcliffe, "Complete Nucleotide Sequence of the Escherichia coli Plasmid pBR322" (Cold Spring Harbor Symposium 43 I. 77-90 (1978)), in combination with plasmid pBD9, that is replicated in the Bacillus host (pBR322 with a smaller DNA sequence containing the E. coli lac system instead of the DNA sequence containing the gene encoding tetracycline resistance).

Iis "(Construction and properties of chimeric plasmids in Bacillus subtilis, Proe. Natl. Acad. Sci. USA, 75, 1423-28 (1978);" Characterization of ι Chimeric Plasmid Cloning Vehicles in Bacillus Subtilis "(Characterization of a Chimeric Plasmid Cloning Agent in Bacillus subtilis) (J. Bacteriol. 141: 246-53 (1980)).

The ligation of the two plasmids is accomplished by cleaving both plasmids with Eco RI restriction endonuclease and combining the two linearized plasmids in the presence of T4 DNA ligase. Because pBR322 carries the genes encoding penicillin resistance (Amp ^R ) and tetracycline resistance (Tet ^R ), and pBD9 carries the genes encoding kanamycin resistance (Km ^R ) and erythromycin resistance (Em), and none of these genes are inactivated. during fusion of two plasmids, the combined plasmid, designated pKH80, carries all four resistance markers. (* Erythromycin resistance is conferred by a polypeptide having a molecular weight of about 29,000. The production of the polypeptide is induced by concentrations of erythromycin below the inhibitor level). Because plasmid pKHSO is a combination of E. coli plasmid cs Bacillus, each of these strains can be used as a host for the plasmid. Because E. coli host transformation is somewhat easier than Bacillus host transformation, and especially since the frequency of transformation is generally higher in E. coli host than Bacillus host, it is preferable to initially transform E. coli host with the plasmid constructed above and select in this host. These plasmids can then be used to transform the desired Bacillus host.

Correctly constructed plasmids are selected by transforming E. coli HB101 with the above plasmids and selecting for ampicillin (40 µg / ml). resistance to tetracycline (25 pg / ml) and kanamycin (5 pg / ml) on L-agar plates. The relative orientation of pBR322 and pBD9 was determined by digestion with Ρ.ϊίΙ in pKH80, since the two PstI sites of pKH80 are asymmetric with respect to parts of pKH80 pBD9 and pBR322.

PKH80 also imparts erythromycin resistance to E. coli HB101, which is transformed. In addition, 29,000 molar proteins encoded by the erythromycin resistance gene can be detected in pKH80-transformed and 2 pg / ml cnithromycin-induced E. coli minicells.

The DNA fragment encoding the polypeptide showing the antigenicity of HBcAg is selected and inserted into the cloning vector and transformed with the recombinant DNA molecule of the Bacillus host to produce polypeptides showing the antigenicity of HBcAg.

An appropriate recombinant DNA molecule of the present invention is digested with P1 / I to cleave a DNA sequence containing an HBcAg-related DNA fragment. The excised fragment is treated with BAL-31 exonuclease under standard conditions by removing an average of 100 bp from each end of the DNA sequence. A mixture of Ba / r / HI and HindIII linkers (ligands) is then ligated to the ends of the digested fragment and, after BtmiHI digestion, the fragment is inserted in place of pBR322 / JnmHI. E. coli HB10'i is transformed with these hybrid plasmids and hosts that are resistant to ampicillin (40 pg / ml) are selected for tetracycline (15 pg / ml) *. (* The HeAzuHI site in pBR322 is located in the tetracycline resistance coding gene. Therefore, the insertion of a DNA fragment at that site inactivates the tetracycline resistance coding gene and renders the host transformed with the resulting recombinant DNA molecule susceptible). Plasmid DNA was isolated from selected transformed hosts and the nucleotide sequence was determined at the junction between pBR322 and the inserted HBcAg coding fragment according to the method of AM Maxam and W. Cilbert. method for DNA sequencing). Proc. Natl. Acad. Sci. USA, 74, 60-64 (1977)].

The nucleotide sequence of one of the isolated plasmids (pH 98), together with the known sequence of the gene encoding for azerythromycin resistance, and the location of the Bell site in this gene allow the prediction that the HBcAg - BamHI fragment can be inserted into the Bell80 , in a suitable reading frame such that the termination codon, which is three nucleotides upstream of the AUG start codon of the HBcAg-related DNA fragment in the λamHI fragment from pH98, is in phase with the erythromycin resistance coding gene in pKH80. Therefore, it is expected that expression of the erythromycin gene in these costumes would be the usual start codon! start and end at the stop codon provided by the HBcAg insert. De novo expression may then resume at the AUG ray codon of the HBcAg-related DNA fragment, producing an unfused product showing the antigenicity of HBcAg.

Consequently, the Bamyl fragment of pH98 is inserted into the Bcll site of pKH80 * (* DNA fragments produced by digestion with BamHI and flc / I have a GATC sequence at their 5 'end such that a fragment prepared by digestion with <RTIgt; (place it in a Bell place). As previously, correctly constructed recombinant DNA molecules are selected after transformation into E. coli HB101 (here based on resistance to ampicillin (40 pg / ml) and tetracycline (25 pg / ml) and sensitivity to arithromycin (60 pmi)). This combination of antibiotic susceptibility and resistance indicates that the E. coli host is transformed with a plasmid that is resistant to tetracycline and ampicillin and not resistant to erythromycin (i.e., the hybrid molecule is derived from pKHSY-b inserted foreign DNA fragments).

Selected recombinant DNA molecules (pKHS1, pKH82 and pKH83) were isolated from E. coli hosts following conventional methods for plasmid DNA isolation and digested with A '/ ml to determine the orientation of the inserted fragments.

Bacillus subtilis MII 19 (leu B6, trpC2, r ~, m) "Restriction of Plasmid Mediated Transformations in Bacillus Subtilis 168", (Restriction of Plasmid Mediated Transformation in Bacillus subtilis i68-bau), Mol. Gene. Genet. 175, 235-37 (1979)] and SE 650 (spoll A 69, trpC2, rif-2) (gift from R. Piggot) were transformed with pKH81, pKH82 and pKH83 using conventional methods [Contente and Dubnau: Characterization Of Plasmid Transformations In Bacillus Subtilis: Kinetic Properties And The Effect Of DNA Conformation "(Kinetic properties cs effect of DNA conformation). Mol. Gene. Genet. (1979, 67, 251-58). Properly transformed Bacillus hosts are then selected based on kanamycin resistance and erythromycin sensitivity. The structure of the plasmids in these selected transformed Bacillus hosts can also be confirmed by isolating the plasmid DNA from the hosts (Lovett and Keggius, "Molecular Cloning of Bacillus Subtilis As Hero") (Bacillus subtilis, as a host). Methods in Enzimology 68, 342-47 (1979)], and plasmid DNA is digested with A 'ul. .

Induction of bacillus host transformed with pH 81, pKH82 and pKH83 at concentrations below the erythromycin inhibitory concentration (0.05 pg / ml) (by inducing synthesis of polypeptides into the gene encoding erythromycin resistance) is then measured for the production of products showing the antigenicity of HBcAg in solid phase radioimmunoassay (e.g., CJ Burret et al., supra). These measurements demonstrate that transformed Bacillus hosts produce polypeptides that show the antigenicity of HBcAg.

Example B

This example describes a method for producing polypeptides having specificity for hepatitis B internal antigens (HBsAg ¹ '), which comprises inserting a DNA fragment encoding this polypeptide into a yeast cloning vector and transforming a yeast host with such a vector to replicate it. and express the inserted DNA fragment and produce the HBsAg polypeptide.

5 pg of the DNA of the corresponding plasmid of the present invention is digested with A vol restriction endonuclease as described by the supplier (New England Biolabs). A 1336 bp fragment encoding HBsAg is obtained, including 27 bp of a possible pre-HBsAg sequence. Figure 2 and Gough et al., Supra): encodes the Arai fragment from the AT10I relay to an Avul site, where the Arai site has 62 bp of the HBsAg coding region and the "inner" coding region. SrwiHJ place too). The 1336 bp fragment was purified on soft agarose clftroforscsi (0.8% agarose gel).

Mg-pBR322 / FH0J Bal-Sattt was digested with restriction endonucleases SalI and Aval (position 1424 of pBR322). The resulting 3.9 kb vector fragment, which contains pBR322 sequences together with the BHŰS Bam-Sal segment, was electrophoresed on soft agarose. purified.

pg of 1336 bp fragment was eluted with 3 pg of 3.9 kb vctor-fragment, 50 µl of a solution containing 1 mM Iris-HCl (Ph 7.5), 10 mM MgCl containing 1 mM DTT, 1 mM ATP and 600 units T4 DNA ligase (Biolabs). At 15 'C for 4 hours. Transformation of E. coli HBIÖI is described in “1. plasmid 'according to nmpicillin resistance. The correct construction of the plasmid is then confirmed by restriction analysis.

For the purpose, mountain of? "First plasmid ', the coding regions for the PH05 protein were deleted, until 5) plasmid was digested with Kpu restriction endonuclease (conditions of use are described in detail by the supplier, New England Biolabs) to obtain a linearized plasmid.

pg linearized plasmid was digested with 1 unit of BAL 31 exonuclease (Bethesda Research I-Aboratory) at 30 ° C for 45 seconds in a solution of 12 mM CaCl ₂ , 12 mM MgCl ₂ . Contains 300 mM NaCl, 20 IN / H iris, and 1 mM EDTA (pH 8.1) with a total volume of reaction medium of 100 µl. The reaction was quenched by phenolic etration. After ethanol precipitation, the DNA was resuspended in 50 µl TE.

g of DNA was re-circulated by ligation with T4 DNA ligase in 20 µl volume to prepare the "2. p! Azmi "respectively.

Following transformation of E. coli HB101, "2. DNA was isolated with piazrrid 'for ampicillin resistance and each plasmid preparation was analyzed by restriction analysis with the following enzymes: Hnell I, Psi I, Bs / ΕΠ and I'. This is it. analysis allows to determine the presence of the ΗΙ; α (site (6 bp before the start of the HBsAg protein coding region) and gives the size of the dclease. DNA sequences in the junction region were determined using the method of Mattam and Gilbert [A. M. Maxam and W. Gilbert, Methods in Enzymology, 65, 499 (1980).

THE 2. Plasmid "was digested with 5 g of BamllII restriction endonuclease (New England Biolabs. conditions are set as directed by the supplier). A 1.8 kb Barn HI fragment was prepared by soft agarose gel electrophoresis (0.8% agarose).

pgpjD207 'worker' ^- vector digested with the same enzyme. 1 pg of digested pJDB207 and 1 pg of the above-generated 1.8 kb restriction fragment were ligated to a total volume of 20 pg. E. coli HB101 is then transformed into ampicillin resistance. and then plasmid DNA is isolated. The plasmids were analyzed individually by restriction digestion with ftwiH1 and the orientation of the inserted BamHI restriction fragment was // ί> η / 1Π / 0, ΕΙί double digest! determined. This will allow you to select "Plasmid 3".

THE 3. plasmid 'is transformed into the yeast strain AH220. The transformed yeast cells are selected, incubated in liquid medium and grown under derepressing conditions, and the transformed yeast colonies are selected.

Cell extratuns are prepared and the amount of HBsAg protein produced is determined using Abbot readioimmunassay (Grough et al., Supra). This proves the production of polypeptides with HÖV antigenicity in yeast.

Example C

This example describes a method for producing polypeptides having specificity for hepatitis B antigens ("HBsAg") in animal cells. Chinese hamster ovary (CHO) cells are transformed with a cloning carrier that contains DNA encoding HBsAg polypeptides. This allows the inserted DNA fragment to be cleaved and expressed in the mammalian host cell and to produce HBsAg polypeptides.

This example uses CHO cells lacking the co-transformation of dihydrofolate reductase (DHFR) [G. Urlaubés L. A. Chasin: Pios. Natl. Acad. Science '. HSA, 77, 4216-20 (1980)] with two plasmids. p.AdD26SV (A) -3 [R, J. Kaufman and P. Λ. Sharp. J. Moh Bioi. 159, 601-621 (1982) and the "2. piuzmid song. which encodes HbsAg polypeptides.

CHO (DHFR) cells used for this co-transformation were maintained at 37 ° C in tissue culture flasks (Gibco) containing alpha minimal essential medium (MEM) (Gibco, Catalog No. 072-1900) with 10% fetal bovine serum ( FCS) and 50 pg / m! supplemented with gentamichine. The transformants were cultured in alpha MEM (which lacks ribonucleotides and deoxyribonucleosides (Gibco, Cat. 072-2000)) and 10% dialyzed FCS. The latter medium is referred to as "serum> fluid". .

An HBsAg coding plasmid was constructed, e.g. in principle, by inserting the HB.tAg coding sequence (as described in this application) into a modified pSV2-dhfr [S. Subramani et al., 1981, Moh Ceih Bioh 1, 854-64. The resulting plasmid contains the HBsAg coding sequence "downstream" directly from the SV 40 early promoter and upstream of the SV40 splice sites and polyadenylation signal. Another plasmid used for co-transformation, pAdD26SV (A) -3, contains the murine DHFR coding sequence. This transforms the cell into a DHFR phenotype, as demonstrated by the ability of the transformant. that it grows in "selective medium" (a medium that lacks ribonucleoside and deoxyribonucleosides).

A method similar to that described by Graham and van der Eb is used to co-transform CHO cells (FL Graham, CS AJ van Der Eb, Virology 54: 536-39 (1973)). Initially, soybean flasks (125 cm ² ) were inoculated with 5 x IIP cells for about 24 hours before the DNA was added to these cells. For addition to Λ cells, prepare DNA by cleavage of the two plasmids described above with appropriate restriction endonucleases, combining appropriate amounts of the cleaved DNA (generally about 10 µg in total) at various relative ratios, precipitating the DNA with ethanol, resuspending in 200 µl of solution, 1 M Tris-HCl (pH 7.2); Containing 0.1 mM HEPES, pH 7.2, and the resulting solution is slowly pipetted into 250 µl of a solution [2xHBS: 28 (1 mM NaCl; 3.0 mM Na ₂ HPO _4). 100 mM HEPES (pH 7.2)] while continuously aspirating the HESS solution.

After allowing for the precipitation of potassium phosphate DNA, 500 μΙ of suspension was added to a monolayer from which the growth medium was removed. Tilt the flask to ensure complete coverage of the mono-layer. Thereafter, 5 ml of medium was added and the flask was incubated for 4 hours at 37 ° C.

The suspension is then added to the flask containing the cells, the medium is added and the cells are cultured. These transformants are trypsinized in a cloning cylinder and transferred to small flasks. Finally, samples of the culture media from the monolayers of these transformants were screened to detect transformants that constitutively secrete HBsAg. The HBsAg was harvested, isolated from the extracts at regular intervals. Consequently, this example demonstrates the production of HBV pqlipeptides in animal sets.

Claims (13)

Claims CLAIMS 1. A method of producing at least one polypeptide having antigenicity to hepatitis B virus (BV) antigen, comprising: I. (a) HBV antigen ^; a DNA sequence encoding a polypeptide showing a citation, wherein said DNA sequence is a DNA sequence encoding a surface antigen or antigenicity fragments of a hepatitis B virus, or a DNA sequence encoding an internal antigen or antigenicity fragments of a hepatitis B virus, or any DNA sequence encoding a Hepatitis B virus antigen antigen: citation polypeptide, such that a recombinant vector containing a Hepatitis B Dane particle or a DNA sequence encoding a particular HÉV antigenicity is encoded. enzyme, the resulting product is ligated into a suitably cloned cloning carrier and, if desired, an operative expression control sequence is inserted into the recombinant cloning carrier so formed. . obsession ATGGACATTGACCCTTATAAAG AATTTGGAGCTACTGTGGAGTT, actctcgtttttgccttctgACT TCTTTCCTTCCGTACGAGATCTT CrAGATACCGCCGCAGCTCTGT ATCGGGATGCCTTAGAGTCTCC TGAGCATTGTTCACCTCACCATA CTGCACTCAGGCAAGCAATTCT TTGCTGGGGAGACTTAATGACT CTAGCTACCTGGGTGGGTACTA ATTTAGAAGATCCAGCATCTAC GCACCTACTAGTCAGTTATGTC AACACTAATGTGGGCCTAAAGT TCAGACAATTATTGTGGTTTCAC ATTTCTTGTCTCACTTTTGGAAG AGAAACGGTTCTAGAGTATTTG G TG TCTTTTG G A G T GTG G ATTCG CACTCCTCCAGCTTATAGACCAC CÁAATGCCCCTATCCTATCAAC GCJTCCGGAG ACT ACTG TTGTT A GACGACGAGGCAGGTCCCCTAG A AG A AG A ACTCCCTCGCCTCGC AGACGAAGATCTCAATCGCCGC GTCGCÁGAAGATCTCAATCTCG GGAATCTCAATGT or CATCACATCAGGATTCCTAGGA CCCCTGCTCGTGTTACAGGCGG G G TTTTTCTTG TTG AC A A G A ATC CTCACAATACCGCAGAGTCTAG The CTCGTGGTGGACTTCTCTCAAT TTTCTAGGGGGAACTACCGTGT GTCTTGGCCAAAATTCGCAGTC CCCAATCTCAATCACTCACCAA C CTCCTGTCCTCCAACTTGTCCT CGTTATCGCTGGATGTGTCTGC CGCGTTTTATCATCTTCCTCTTC ATCCTGCTGCTATGCCTCATCTT (TTGTTGOTTCTTCTGGACTATC Λ AGGTATGTTGCCCGTTTGTCCT CTAATTCCAGGATCATCAACCA CCAGCACGGGATCCTGCAGAAC CTGCACGACTCCTGCTCAAGGA ATCTCTATGTATCCCTCCTGTTG C T G T A C A A A A CCTTC G G ATG G A «ACTG CACCTGTATTCCCATCCC ATCATCCTGGGCTTTCGGAAAA TTCCTATGGGAGTGGGCCTCAG CCCGTTTCTCTTGGCTCAGTTT A CTAGTGCCATTTGTTCAGTGGTT CGTAGGGCTTTCCCCCATTGTTT GGCTTTCAGTTATATGGATGAT GTGGTATTGGGGGCCAAGTCTG '•' AGAGCATCTTGAGTCCCTTTTT ACCGCTGTTACCAATTTTCTTTT Formula GTCTTTGGGCATACATT DNA, or fragments thereof, encoding polypeptides showing HBV antigenicity, or nindes of any variant corresponding to the natural triplet degeneration, are ligated into a suitably cloned cloning carrier and, if desired, operatively regulated in the recombinant cloning carrier so formed. sequence, then ϊ II. with a recombinant clone-forming carrier thus formed, a single-cell host cell is transformed and III. culturing the transformed host cell; and ARC. isolating the appropriate polypeptide. The method of claim 1, wherein the DNA sequence encoding the at least one HBV antigenicity polypeptide is inserted between the first and second endonuclease recognition sites of a cloning carrier to form said recombinant molecule. The method of claim 1 or 2, wherein at least one. The DNA sequence encoding the HBV antigenicity polypeptide is used as endogenous DNA of a Dane particle, or fragments thereof, or synthetically produced equivalents thereof, which encode the HBV antigenicity polypeptide. 4. The method according to any one of claims 1 to 4, wherein the single-cell host is Escherichia coli, Bacillus subtilis or other Bacillus, yeast, fungi, or animal or plant cell cultures. 5. The method of any one of claims 1 to 4, wherein the expression control sequence is inserted between additional endonuclease recognition sites in the cloning carrier. 6. The method of any one of claims 1 to 3, wherein the expression control sequence is a lac system, a trp system, or the major operator and promoter regions of phage λ or regulatory regions of the phage fd envelope protein. * 7. The method of any one of claims 1 to 4, wherein said DNA sequence encoding said HBV antigenicity polypeptide is produced by: I. recovering a recombinant DNA molecule comprising a DNA molecule encoding a polypeptide having HBV antigenicity from another culture transformed with it, and II. extracting from said recovered recombinant DNA molecule a sequence encoding said HBV antigenicity polypeptide or fragments thereof encoding a HBV antigenicity polypeptide. The method of any one of claims 1 to 7, wherein the coding DNA sequence is ATGGACATTGACCCTTATAAAG AA'ÍTTGŰ AGCTACTGTGG AGTT ACTCTCGTTTTTGCCTTCTGACT TCTTTCCTTCCGTACG AG AT CTT CTAGATACCGCCŰCAGCTCTGT ATCGGGATGCCTTAGAGTCTCC TGAGCATTGTTCACCTCACCATA CTGCACTC AGGCA AGC The ATTC, TTGCTGGGGAGACTTAATGACT CTAGCTACCTGG6TGGGTACTA ATTTAGAAGATCCAGCATCTAG GGACCTAGTAGTCAGTTATGTC AACACTAATGTGGGCCTAAAŰT TCAGACAATTATTGTGGTTTCAC atttcttgtctcacttttggaag AGAAACGGTTCTAGAGTATTTG GTGTCTTTTGG AGTGTGG ATTCG cactcctccagcttatacaccac G0 CAAATGCCCCTATCCTATCAAC GCTTCCGG AGACTACTGTTGTTA C <ACG ACG AGGCAGGTCCCCTAG AAGAAGAACTCCCTCGCCTCGC AGACGAAGATCTCAATCGCCGC GTCGC AG AG ATCTCAATCTCG GNAATCTCAATGT contains a DNA encoding or encoding fragments thereof that encode HBV. The method of any one of claims 1 to 7, wherein the coding DNA sequence is ATGGAGAA CATCACATCAGGATTCCTAGGA CCCCTGCTCGTGTTACAGGCGG GGTTTTTCTTGTTG ACAAG A ATC CTCACAATACCGCAGAGTCTAG ACTCGTGGTGGACTTCTCTCAAT TTTCTA '^; GGGGAACTACCŰTGT GTCTTGGCCAAAATTCGCAGTC CCCAATCTCCAATCACTCACCAA CCTCCTGTCCTCCAACTTGTCCT GGTTATCGCTGGATGTGTCTGC GGCGTTTTATCATCTTCCTCTTC ATCCTGCTGCTATGCCTCATCTT CTTGTTGGTTCTTCTGGACTATC AAGGTATGTTGCCCGTTTGTCCT CTAATTCCAGGATCATCAACCA CCAGCACGGGATCCTGCAGAAC CTGCACGACTCCTGCTCAAGGA ATCTCTATGTATCCCTCCTGTTG CTC TACAAAACCTTCGGATGGA AACTGCACCTGTATTCCCATCCC ATCATCCTGGGCTTTCGGAAAA TTCCTATGGGAGTGGGCCTCAG CCCGTTTCTCTTGGCTC AGTTT A CTAGTGCCATTTGTTCAGTGGTT CGTAGGGCTTTCCCCCATTGTTT G G CTTTC A G TT AT ATG G A TG A T GTGGTATTGGGGGCCAAGTCTG TACAGCATCTTG AGTCCCTTTTT. ACCGCTGTTACCAATTTTCTTTT Formula GTCTTTGGGCATACATT DNA, or fragments thereof, which encode polypeptides having HBV antigenicity are ligated into the clone-forming carrier. Shoot. 1-9. The method of any one of claims 1 to 3, wherein the recombinant clone-forming carrier is transformed into E. coli strain HB (01) and NCIB 11548, 11549, 11550, 11551, 11552, 11553, 11554, 115555, 11556, 11557, 11558, 11559 or deposited under number 11560 E. coli HB101 strains are selected. 11. L-9. The method according to any one of claims 1 to 4, wherein the E. coli HB 101 strains deposited at NCIB under numbers 11548, 11549, 11550, 11551, 11552, 11553, 11554, 11555, 11556, 11557, 11558, 11559 or 11560 are cultivated. 12. A process according to any one of claims 1 to 6, a MetGluAsnlleThrSerGlyPheLeuGl yProl.euí.cuValLeuGlnAlaGlyPhe P h e L c u I. e u T h r A r g 11 c L e u T h r 11 e P r ÖGlnSerLeuAspSerTrpTrpThrSerL CuAsnPheLeuGlyGlyThrThrValCy sLeuGlyGInAsnSerGlnSerProlleSe r S S II II also ro er P T S er hr Cys P r P r ο ο T hrCysProGlyTyrArgTrpMetCysLeu ArgArgPhelleílePheLcuPhcIleLcii LeuLeuCysLeuIIcPheLeiiLeiiValLe uLeuAspTyrGlnGIyMetLeuProVal CysProLeuIleProGlySerSerThrThr .SerThrGlySerCysArgThrCysThrTh rProAlaGlnGlyíleSerMetTyrProSc rCysCysCysTbLysProSerAspGlyAs nCysThrCysIleProIleProSerSerTrp AlaPheGlyLysPheLeuTrpGluTrpA laSerAlaArgPhcSerTrpLeuSerLcu LeuValProPheValGlnTrpPheValGI yLeuSerProIleValTrpLcuSer valyl these T rp M et M et T rp T ry T rp GI y P ro cr S L CuTyrSerlleLcuSerProPheLeuProL euLeuProIlePhePheCysLeuTrpAla Tyrlle.MetAspIleAspPt'oTyrLysGl uPheGlyAlaThrValGluLeuLeuSerP heLeuProSerAspPhePhcProScrVal ArgAspLeuLeuÁspThrAIaAlaAlaL euTyrÁrgAspAlalleuGluSerPro Glu HisCysSerProHisHisThrAlaLcuAr g GI la 11 e L eu Cys Tr p y sp G1 L eu M etTlirLeuAlaThrTrpValólyThrAsn LeuGluAspProAlaSerArgAspLeuVi IV of 1S er T yr V a 1A sn T hr A s η V a 1G 1 yi L c ii L ys P hc A rg G 1 n L eu L eu T rp P he H isllcSerCysLcuThrPheGlyArgCluT ItiValLcuGluTyrLeuValSerPheGly ValTrpIIcArgThrProProAlaTyrAr. gProPioAsnAlaProIleLeuSerThrL · CuPioGluThrThrValValArgArgArg GlyArgSerProArgArgArgThrProSe ι P r ο The ι g gw The gw The gw S er G1 n S er P ro _t wherein rgArgArgArgSerGlnSerArgGluSep G 1N Cys ainínosavszekvenciájú polypeptide, or a pointer HBV antigenicity fragment of j's preparation to the corresponding coding DNA sequence is digested into the clone-forming carrier. 13. Method for Detecting HBV Infection in the Blood polypeptides having the antigenic expression of HBV antigens or DNA sequences encoding such polypeptides according to any one of claims 1 to 12; any of the polypeptides produced according to the present invention.