HK40112911A - Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof - Google Patents

Description

Immunogenic compositions containing conjugated capsular sugar antigens and their uses

Technical Field

This invention relates to novel conjugated capsular sugar antigens (glycoconjugates), immunogenic compositions comprising said glycoconjugates, and their uses. The immunogenic compositions of this invention typically comprise glycoconjugates, wherein the sugars are derived from bacterial capsular polysaccharide antigens, particularly capsular polysaccharides derived from pathogenic bacteria. This invention also relates to the use of said glycoconjugates for vaccination of human individuals, especially infants and the elderly, to protect against infection.

Background Technology

Both Gram-positive and Gram-negative bacteria can produce extracellular compartments, or capsules, which cover the bacterial cell and typically prevent the reaction of potential cell surface antigens with their homologous antibodies. Capsules are present in several medically important bacteria, particularly extraintestinal and invasive strains. Bacterial capsules are primarily composed of polysaccharides. These polysaccharides form a gel-like substance around the cell. Capsular polysaccharides are important immunogens, making them a crucial component in vaccine design. Capsular polysaccharides have been shown to induce immune responses, especially when conjugated with carrier proteins.

For decades, methods have been successfully employed to enhance the immunogenicity of weak immunogenic molecules by conjugating them to “carrier” molecules (see, for example, Goebel et al. (1939) J. Exp. Med. 69:53). For instance, numerous immunogenic compositions have been described in which purified capsular polymers are conjugated to carrier proteins to produce more potent immunogenic compositions by employing this “carrier effect” (Schneerson et al. (1984) Infect. Immun. 45:582-591). Conjugation has also been shown to avoid undesirable antibody responses commonly observed in infants when immunized with free polysaccharides (Anderson et al. (1985) J. Pediatr. 107:346; Insel et al. (1986) J. Exp. Med. 158:294).

Various cross-linking or coupling agents, such as homobifunctional, heterobifunctional, or zero-length cross-linking agents, have been successfully used to generate conjugates. Many methods are currently available for coupling immunogenic molecules (such as sugars, proteins, and peptides) to peptide or protein carriers. Most methods generate amines, amides, urethanes, isothioureas, or disulfide bonds, or in some cases, thioethers. A drawback of using cross-linking or coupling agents that introduce reactive sites into the side chains of reactive amino acid molecules on the carrier and/or immunogenic molecule is that the reactive sites, if not neutralized, can react freely with any unwanted molecules in vitro (and thus potentially adversely affect the functionality or stability of the conjugate), or in vivo (and therefore pose a potential risk of adverse events in individuals or animals immunized with the formulation). Various known chemical reactions can be used to react with or “terminate” such excess reactive sites to inactivate them, but these reactions may otherwise compromise the functionality of the conjugate.

Therefore, there is still a need for new appropriately capped glycoconjugates and methods for preparing such conjugates, so that functionality is preserved and the conjugates can still induce the desired immune response.

The inventors have discovered a novel and efficient method for producing glycoconjugates. This method allows for the production of conjugates with extremely low free sugar content and good yield. Furthermore, the inventors have found that some Streptococcus pneumoniae serotypes (e.g., polysaccharides 35B and 29) present specific challenges in conjugate production due to their unique structures. There is a need for immunogenic Streptococcus pneumoniae serotype polysaccharide-carrier protein conjugates and their improved preparation methods.

Invention Overview

In one aspect, the present invention relates to a method for preparing capsular glycoconjugates, comprising the following steps:

(a) Reacting the isolated capsular sugar with a carbonate derivative and an azide linker in an aprotic solvent to produce an activated azide sugar.

(b) The carrier protein is reacted with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group, wherein the NHS moiety reacts with an amino group to form an amide bond, thereby obtaining an alkyne-functionalized carrier protein.

(c) The activated azide sugar from step (a) reacts with the activated alkyne-carrier protein from step (b) via a Cu ⁺¹ -mediated azide-alkyne cycloaddition reaction to form a glycoconjugate.

In one aspect, the separated sugar is sized prior to the activation step (a).

In one aspect, the carbonate derivatives are selected from the group consisting of: 1,1'-carbonyldiimidazole (CDI), 1,1'-carbonyl-di-(1,2,4-triazole) (CDT), disuccinimidyl carbonate (DSC) and N-hydroxysuccinimidyl chloroformate.

In one aspect, the azide-based linker is a compound of formula (I).

H ₂ NXN ₃ (I)

The X series is selected from the following groups: _CH2 ( _CH2 ) _n , ( _{CH2CH2O ) mCH2CH2 ,} NHCO( _CH2 ) _n , NHCO( _{CH2CH2O ) mCH2CH2 , OCH2} ( _CH2 ) _n and O( _CH2CH2O ) _mCH2CH2 ; wherein the n series is selected from 1 _to 10 and _the m series _is selected from ₁ to ₄ .

In one aspect, the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a terminal alkyne.

In one aspect, step a) involves reacting the capsular sugar with a carbonate derivative in an aprotic solvent, followed by reacting the carbonate-activated capsular sugar with an azide linker to produce an activated azide capsular sugar.

In one aspect, the conjugation reaction c) is carried out in an aqueous buffer solution in the presence of copper (I) as a catalyst.

In one aspect, after step c), the method further comprises the step of capping the unreacted azide groups retained in the conjugate with an azide-capping agent.

In one aspect, after step c), the method further comprises the step of capping the unreacted alkyne group retained in the conjugate with an alkyne-based capping agent.

In one aspect, the present invention relates to a capsular glycoconjugate produced according to the method.

In another aspect, the present invention relates to a capsular glycosyl conjugate comprising a capsular glycoside covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII):

The X series is selected from the following groups: _CH₂ ( _CH₂ ) _n' , ( _CH₂CH₂O ) _mCH₂CH₂ , NHCO( _CH₂ ) _{n' ,} NHCO( _CH₂CH₂O ) _mCH₂CH₂ , _OCH₂ ( _CH₂ ) _{n '} , and O( _CH₂CH₂O ) _mCH₂CH₂ ; where n' is selected _{from 1} to ₁₀ and m _is selected from _{1 to 4} .

Furthermore, X' is selected from the following groups: _CH2O ( _CH2 ) _{n” CH2C} ＝ _O , _CH2O ( _CH2CH2O ) _m' ( _CH2 ) _{n” CH2C} ＝O, where n” is selected from 0 to 10 and m' is selected from 0 to 4.

In a particular aspect, the present invention relates to a capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH2 ( _CH2 ) _n' , where n' is 2, and wherein X' is _CH2O ( _CH2 ) _{n” CH2C} ＝O, where n” is 1.

In one particular aspect, the present invention relates to a capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VIII).

Attached Figure Description

Figure 1 shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 35B.

Figure 2 shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 29.

Figure 3 illustrates the general preparation process of the glycoconjugate of the present invention using click chemistry and 3-azido-1-propylamine as an azido linker. CP = carrier protein, CDI = 1,1'-carbonyldiimidazole.

Invention Details

The inventors have developed novel polysaccharide-carrier protein conjugates and methods for preparing such conjugates. It has been found that the methods for producing glycoconjugates allow for the production of glycoconjugates with extremely low free sugar content and good yields.

Furthermore, the inventors have discovered specific challenges in the formation of conjugates from Streptococcus pneumoniae serotypes 35B and 29 polysaccharides. It has been found that Streptococcus pneumoniae serotypes 35B and 29 polysaccharides cleave during activation with periodate, a typical oxidizing agent used in commonly used reductive amination methods. It appears that periodate oxidation occurs on the backbone of serotypes 35B and 29 polysaccharides and cleaves mannitol or ribitol, resulting in a size reduction. This leads to several problems, including difficulty in obtaining activated serotypes 35B and 29 polysaccharides of a specific size. Activation with periodate results in a reduction in the polysaccharide size (Mw), thus significantly limiting the effective activation range.

WO 2020/247299 proposes that, in order to improve the properties of serotype 35B conjugates, the amount of periodate can be reduced and a certain temperature range can be used for the conjugation reaction. However, it has been found that such solutions lead to low yields and/or high contents of free sugars. The inventors have developed novel pneumococcal serotype 35B and 29 polysaccharide-carrier protein conjugates and an improved method for preparing these conjugates, which do not have these drawbacks.

1. The sugar conjugate of the present invention

This invention relates in part to conjugated bacterial capsular sugar antigens (also known as glycoconjugates). For the purposes of this invention, the term 'glycoconjugate' refers to a capsular sugar (especially a bacterial capsular sugar) covalently linked to a carrier protein.

1.1 The capsular sugar of the present invention

Throughout this specification, the term "sugar" may refer to a polysaccharide or an oligosaccharide and includes both. In one embodiment, the sugar of the present invention may be an oligosaccharide. Oligosaccharides have a low number of repeating units (typically 5 to 15 repeating units) and are generally obtained synthetically or by hydrolysis of polysaccharides. However, preferably, all sugars of the present invention and all sugars in the immunogenic compositions of the present invention are polysaccharides. High molecular weight polysaccharides are capable of inducing certain antibody immune responses due to the presence of epitopes on the surface of antigens. Preferably, the isolation and purification of high molecular weight capsular polysaccharides are considered for use in the conjugates, compositions, and methods of the present invention. Therefore, in a preferred embodiment of the present invention, the sugar is a polysaccharide.

Preferably, the sugar used in this invention is bacterial capsular sugar (also referred to herein as 'capsular sugar'). Capsules exist in certain bacteria of medical importance. Bacterial capsules are primarily composed of polysaccharides. Capsular sugars are prepared using standard techniques known to those skilled in the art.

In one of the most preferred embodiments of the present invention, the sugar is a Streptococcus pneumoniae capsular polysaccharide.

In one embodiment, the capsular sugar used in this invention is a synthetic carbohydrate.

However, in a preferred embodiment, the source of bacterial capsular sugar according to the invention may be bacterial cells. Bacterial strains that can be used as a source of capsular sugar may be obtained from existing culture collections (such as the American Type Culture Collection (ATCC, Manassas, VA USA) or streptococcal reference laboratories (Centers for Disease Control and Prevention, Atlanta, GA USA)) or clinical specimens.

Bacterial capsular sugars can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in US2006/0228380, US2006/0228381, US2007/0184071, US2007/0184072, US2007/0231340, US2008/0102498, and WO2008/118752). They can also be produced using synthetic methods known to those skilled in the art.

In cases where bacterial capsular sugars are obtained directly from bacteria, bacterial cells can be grown in a culture medium. Following fermentation of the capsular-producing bacterial cells, the bacterial cells can be lysed to produce cell lysate. The capsular sugars can then be separated from the cell lysate using purification techniques known in the art, including centrifugation, deep filtration, precipitation, ultrafiltration, treatment with activated carbon, percolation, and/or column chromatography (see, for example, US2006/0228380, US2006/0228381, and WO2008/118752). The purified capsular sugars can then be used to prepare immunogenic conjugates.

The purified capsular sugars obtained can be characterized by various parameters, including, for example, weight-average molecular weight (Mw). The molecular weight of polysaccharides can be measured by a combination of size exclusion chromatography (SEC) and multi-angle laser scattering detectors (MALLS).

In one embodiment, the capsular sugar used in the method for preparing the glycoconjugate of the present invention or a portion thereof is a capsular sugar derived from pathogenic bacteria. Preferably, the capsular sugar used in the present invention is a capsular sugar derived from pathogenic Streptococcus, pathogenic Staphylococcus, pathogenic Enterococcus, pathogenic Bacillus, pathogenic Corynebacterium, pathogenic Listeria, pathogenic Erysipelothrix, pathogenic Clostridium, pathogenic Haemophilus, pathogenic Neisseria, or pathogenic Escherichia. More preferably, the capsular sugar used in the present invention is a capsular sugar derived from pathogenic Streptococcus, pathogenic Neisseria, or pathogenic Escherichia.

In one embodiment, the capsular sugar used in this invention is derived from the following capsular sugars: Aeromonas hydrophila and other species; Bacillus anthracis; Bacillus cereus; Clostridium species that produce botulinum neurotoxin; Brucella abortus; Brucella melitensis; Brucella suis; Burkholderia mallei (official...). The following bacteria are listed: *Pseudomonas mallei*; *Burkholderia pseudomallei* (formerly known as *Pseudomonas pseudomallei*); *Campylobacter jejuni*; *Chlamydia psittaci*; *Chlamydia trachomatis*; *Clostridium botulinum*; *Clostridium dificile*; and *Enteromorpha gaseousa*. Clostridium perfringens; Coccidioides immitis; Coccidioides posadasii; Cowdria ruminantium (for heartwater); Coxiella burnetii; Enterococcus faecalis; Enterovirulent Escherichia coli (EEC group), such as enterotoxic Escherichia coli (E... Enteropathogenic Escherichia coli (TEC), enteropathogenic Escherichia coli (EPEC), O157:H7 enterohemorrhagic Escherichia coli (EHEC), and enteroinvasive Escherichia coli (EIEC); Ehrlichia species, such as Ehrlichiachajfeensis; Francisella tularensis; Legionella pneumophila; Liberobacter africanus; Liberobacter asiaticus; Listeria monocytogenes. (Listeria monocytogenes); other miscellaneous enteric bacteria, such as Klebsiella, Enterobacter, Proteus, Citrobacter, Aerobacter, Providencia, and Serratia; Mycobacterium bovis; Mycobacterium tuberculosis; goat... Mycoplasma capricolum; Mycoplasma mycoides ssp mycoides; Peronosclerospora philippinensis; Phakopsora pachyrhizi; Plesiomonas shigelloides; Ralstonia solanacearum race 3, biovar 2; Rickettsia prowleri azekii); Rickettsia rickettsii; Salmonella spp.; Schlerophthora rayssiae var zeae; Shigella spp.; Staphylococcus aureus; Streptococcus; Synchrotiformis endobioticum; Vibrio cholerae non-O1; Vibrio cholerae O1; Vibrio parahaemolyticus *Parahaemo Iyticus* and other Vibrio species; *Vibrio vulnificus*; *Xanthomonas oryzae*; *Xylella fastidiosa* (a strain of *citrus variegated chlorosis*); *Yersinia enterocolitis* and *Yersinia pseudotuberculosis*; or *Yersinia pestis*. Preferably, the capsular sugar used in this invention is derived from *Enterococcus faecalis*, *Escherichia coli*, *Staphylococcus aureus*, or *Streptococcus*.

In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Haemophilus influenzae, Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, group C and group G streptococci, or Escherichia coli. More preferably, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus agalactiae, or Escherichia coli. Even more preferably, the capsular sugar used in this invention is a capsular sugar derived from Streptococcus pneumoniae or Streptococcus agalactiae. Even more preferably, the capsular sugar used in this invention is a capsular sugar derived from Streptococcus pneumoniae.

In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Staphylococcus aureus. In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from Staphylococcus aureus type 5 or Staphylococcus aureus type 8.

In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Enterococcus faecalis. In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from Haemophilus influenzae type b.

In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis. In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup A (MenA), Neisseria meningitidis serogroup W135 (MenW135), Neisseria meningitidis serogroup Y (MenY), Neisseria meningitidis serogroup X (MenX), or Neisseria meningitidis serogroup C (MenC). In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup A (MenA). In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup W135 (MenW135). In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup Y (MenY). In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup C (MenC). In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from Neisseria meningitidis serogroup X (MenX).

In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from *Escherichia coli*. In yet another embodiment, the capsular sugar used in this invention is a capsular sugar derived from *Enterococcus faecalis*.

In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from group B streptococci (GBS). In some embodiments, the capsular sugar used in this invention is a capsular sugar derived from GBS types Ia, Ib, II, III, IV, V, VI, VII, or VIII. In some embodiments, the capsular sugar used in this invention is a capsular sugar derived from GBS types Ia, Ib, II, III, or V.

In another embodiment, the capsular sugar used in this invention is a capsular sugar derived from *Escherichia coli*. In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from a portion of *Escherichia coli* of diarrheal *E. coli* (EEC group), such as enterotoxic *E. coli* (ETEC), enteropathogenic *E. coli* (EPEC), O157:H7 enterohemorrhagic *E. coli* (EHEC), or enteroinvasive *E. coli* (EIEC). In one embodiment, the capsular sugar used in this invention is a capsular sugar derived from urinary tract pathogenic *Escherichia coli* (UPEC).

In one embodiment, the capsular sugar used in this invention is a capsular sugar from an *E. coli* serotype selected from the group consisting of serotypes O157:H7, O26:H11, O111:H-, and O103:H2. In one embodiment, the capsular sugar used in this invention is a capsular sugar from an *E. coli* serotype selected from the group consisting of serotypes O6:K2:H1 and O18:K1:H7. In one embodiment, the capsular sugar used in this invention is a capsular sugar from an *E. coli* serotype selected from the group consisting of serotypes O45:K1, O17:K52:H18, O19:H34, and O7:K1. In one embodiment, the capsular sugar used in this invention is a capsular sugar from the *E. coli* serotype O104:H4. In one embodiment, the capsular sugar used in this invention is a capsular sugar from the *E. coli* serotype O1:K12:H7. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Escherichia coli serotype O127:H6. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Escherichia coli serotype O139:H28. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Escherichia coli serotype O128:H2.

In a preferred embodiment, the capsular sugar used in this invention is a capsular sugar derived from Streptococcus pneumoniae. Preferably, the capsular sugar used in this invention is a capsular sugar derived from serotypes of Streptococcus pneumoniae selected from the group consisting of: serotypes 1, 2, 4, 5, 6A, 6B, 6C, 7C, 7F, 8, 9V, 9N, 10A, 10B, 11A, 12F, 14, 15A, 15B, 15C, 16F, 17F, 18C, 19A, 19F, 20, 21, 22A, 22F, 23A, 23B, 23F, 24B, 24F, 27, 29, 31, 33B, 33F, 34, 35B, 35F, 38, 72, and 73.

In a preferred embodiment, the capsular sugar used in this invention is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 1. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 2. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 4. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 5. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 6A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 6B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 7C. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 7F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 8. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 9V. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 9N. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 10A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 10B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 11A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 12F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 14. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 15A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 15B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 15C. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 16F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 17F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 18C. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 19A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 19F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 20. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 21. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 22A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 22F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 23A. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 23B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 23F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 24B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 24F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 27. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 29. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 31. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 33B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 33F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 34. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 35B. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 35F. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 38. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 72. In one embodiment, the capsular sugar used in this invention is a capsular sugar from Streptococcus pneumoniae serotype 73.

In one preferred embodiment, the capsular sugar used in this invention is a capsular sugar derived from Streptococcus pneumoniae serotype 35B. In another preferred embodiment, the capsular sugar used in this invention is a capsular sugar derived from Streptococcus pneumoniae serotype 29.

In one preferred embodiment, the capsular sugar used in this invention (purified prior to further processing) has a weight average molecular weight between 50 kDa and 5000 kDa. In another preferred embodiment, the capsular sugar used in this invention has a weight average molecular weight between 500 kDa and 5000 kDa. In yet another preferred embodiment, the capsular sugar used in this invention has a weight average molecular weight between 1000 kDa and 5000 kDa.

Consider any all integers within any of the above ranges as one embodiment of the present invention.

Preferably, in order to produce a glycoconjugate with favorable filterability, immunogenicity and/or yield, the size of the sugar is set to a target molecular weight range before conjugation with the carrier protein.

Advantageously, the size of purified capsular sugars is reduced while retaining key features of the polysaccharide structure. Size setting can be achieved using mechanical or chemical methods.

In one embodiment, the size of the purified capsular sugar is reduced by chemical hydrolysis. The chemical hydrolysis can be carried out using a weak acid (e.g., acetic acid, formic acid, propionic acid). In one embodiment, the chemical hydrolysis is carried out using formic acid. In another embodiment, the chemical hydrolysis is carried out using propionic acid. In a preferred embodiment, the chemical hydrolysis is carried out using acetic acid. The chemical hydrolysis can also be carried out using a diluted strong acid (such as dilute hydrochloric acid, dilute sulfuric acid, dilute phosphoric acid, dilute nitric acid, or dilute perchloric acid). In one embodiment, the chemical hydrolysis is carried out using dilute hydrochloric acid. In another embodiment, the chemical hydrolysis is carried out using dilute sulfuric acid. In another embodiment, the chemical hydrolysis is carried out using dilute phosphoric acid. In another embodiment, the chemical hydrolysis is carried out using dilute nitric acid. In another embodiment, the chemical hydrolysis is carried out using dilute perchloric acid.

The size of the purified capsular sugar can also be reduced by mechanical homogenization. In one embodiment, the size of the purified capsular sugar is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the process flow via a channel with a sufficiently small size. The shear rate is increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed flow through the homogenizer.

High-pressure homogenization can be used to reduce the size of purified capsular sugars while preserving their structural characteristics.

In one preferred embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight between 10 kDa and 1000 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight between 50 kDa and 500 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight between 50 kDa and 400 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight between 50 kDa and 250 kDa.

In one embodiment, the size of the isolated capsular sugar is set to a weight average molecular weight between 250 kDa and 1000 kDa. In another embodiment, the size of the isolated capsular sugar is set to a weight average molecular weight between 250 kDa and 500 kDa. In yet another embodiment, the size of the isolated capsular sugar is set to a weight average molecular weight between 250 kDa and 400 kDa. In a preferred embodiment, the size of the isolated capsular sugar is set to a weight average molecular weight between 200 kDa and 800 kDa.

In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 250 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 300 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 350 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 400 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 450 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 500 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 550 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 600 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 700 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 800 kDa. In one embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 900 kDa. In another embodiment, the size of the isolated capsular sugar is set to a weight-average molecular weight of about 1000 kDa.

In one implementation, the isolated capsular sugars were not sized.

The isolated capsular sugars described above can be activated (e.g., chemically activated) so that they can react (e.g. with a linker) and subsequently incorporate into the glycoconjugate, as further described herein.

For the purposes of this invention, the term 'glycoconjugate' refers to a sugar covalently linked to a carrier protein.

Generally, covalent conjugation of sugars to carriers enhances the immunogenicity of the sugar because the covalent conjugation transforms the sugar from a T-independent antigen to a T-dependent antigen, thereby triggering immune memory. Conjugation is particularly useful for childhood vaccines.

1.2 Capsular Glycoconjugate of the Invention

In some embodiments, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the polysaccharide before conjugation is between 10 kDa and 2,000 kDa.

The weight-average molecular weight (Mw) of the sugar prior to conjugation refers to the Mw before sugar activation (i.e., after the final size setting step but before the sugar reacts with the activator). In the context of this invention, the Mw of the sugar is not substantially altered by the activation step, and the Mw of the sugar incorporated into the conjugate is similar to the Mw of the sugar measured prior to activation. In one embodiment, the sugar system is activated using a combination of a carbonate derivative (e.g., CDI or CDT) and an azide linker (see section 1.3 below). In one embodiment, the sugar system is activated using a combination of CDI and an azide linker (see section 1.3 below). In one embodiment, the sugar system is activated using a combination of CDT and an azide linker (see section 1.3 below).

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 50 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 250 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 200 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 150 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 50 kDa and 100 kDa.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 75 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 250 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 200 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 150 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 75 kDa and 100 kDa.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 100 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 100 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 100 kDa and 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 100 kDa and 250 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 100 kDa and 200 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 100 kDa and 150 kDa.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 150 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 150 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 150 kDa and 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 150 kDa and 250 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 150 kDa and 200 kDa.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 200 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 200 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 200 kDa and 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 200 kDa and 300 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 200 kDa and 250 kDa.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is between 500 kDa and 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 500 kDa and 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 500 kDa and 700 kDa. In one embodiment, the weight-average molecular weight (Mw) is between 500 kDa and 600 kDa.

Consider any all integers within any of the above ranges as one embodiment of the present invention.

In one embodiment, the glycoconjugate of the present invention comprises a capsular sugar, wherein the weight-average molecular weight (Mw) of the sugar before conjugation is about 1,000 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 750 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 700 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 600 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 500 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 400 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 300 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 200 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 150 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 125 kDa. In one embodiment, the weight-average molecular weight (Mw) is about 100 kDa.

In some embodiments, the glycoconjugates of the present invention have a weight-average molecular weight (Mw) between 250 kDa and 20,000 kDa. In other embodiments, the glycoconjugates of the present invention have a weight-average molecular weight (Mw) between 500 kDa and 15,000 kDa. In still other embodiments, the glycoconjugates of the present invention have a weight-average molecular weight (Mw) between 500 kDa and 10,000 kDa.

In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 10,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 7,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 5,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 2,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 2,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 1,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 500 kDa and 1,000 kDa. In other embodiments, the glycoconjugates of the present invention have a weight-average molecular weight (Mw) between 500 kDa and 750 kDa.

In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 10,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 7,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 5,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 2,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 2,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 1,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 750 kDa and 1,000 kDa.

In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 10,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 7,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 5,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 2,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 2,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 1,500 kDa.

In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 10,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 7,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 5,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 4,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 3,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 2,000 kDa and 3,500 kDa.

In other embodiments, the glycoconjugates of the present invention have a weight-average molecular weight (Mw) between 2,250 kDa and 3,500 kDa.

In a preferred embodiment, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) between 1,000 kDa and 2,500 kDa.

Consider any all integers within any of the above ranges as one embodiment of the present invention.

In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 10,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 9,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 8,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 7,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 6,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 5,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 4,000 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 3,500 kDa. In still other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 3,250 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 3,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 2,500 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 2,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 1,500 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 1,000 kDa. In other embodiments, the glycoconjugate of the present invention has a weight-average molecular weight (Mw) of about 750 kDa.

Another way to characterize the glycoconjugates of the present invention is by the number of lysine residues in a carrier protein (e.g., CRM ₁₉₇ or SCP) that become sugar-conjugated, which can be characterized as the range of conjugated lysines (degree of conjugation). Evidence of lysine modification of the carrier protein due to covalent linkage with the sugar can be obtained by amino acid analysis using conventional methods known to those skilled in the art. Conjugation results in a reduction in the number of lysine residues recovered compared to the carrier protein starting material used to generate the conjugate. In a preferred embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 15. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 13. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 10. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 8. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 6. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 5. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is between 2 and 4. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 15. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 13. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 10. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 8. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 6. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 5. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 3 and 4. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 5 and 15. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 5 and 10. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 8 and 15. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 8 and 12. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 10 and 15. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 10 and 12.

In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 2. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 3. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 4. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 5. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 6. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 7. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 8. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 9. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 10 or about 11. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 12. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 13. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 14. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugate of the present invention is between 4 and 7. In some such embodiments, the carrier protein is CRM _197. In other such embodiments, the carrier protein is SCP.

The glycoconjugates of this invention can also be characterized by the sugar-to-carrier protein ratio (w/w). In some embodiments, the sugar-to-carrier protein ratio (w/w) in the glycoconjugate is between 0.5 and 3.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 0.5 and 2.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 0.5 and 1.5. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 0.8 and 1.2. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 0.5 and 1.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 1.0 and 1.5. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 1.0 and 2.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is between 0.8 and 1.2. In a preferred embodiment, the ratio of sugar to carrier protein in the conjugate is between 0.9 and 1.1.

In one embodiment, the sugar-to-carrier protein ratio (w/w) is about 0.5. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 0.6. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 0.7. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 0.8. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 0.9. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.1. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.2. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.3. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.4. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.5. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.6. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.7. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.8. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 1.9. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 2.0. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 2.1. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 2.2. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 2.5. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 2.8. In other embodiments, the sugar-to-carrier protein ratio (w/w) is about 3.0. In some such embodiments, the carrier protein is CRM _197. In other such embodiments, the carrier protein is SCP.

The glycoconjugates of this invention can also be characterized by the number of covalent links between the carrier protein and the sugar, which varies with the number of sugar repeating units. In one embodiment, the glycoconjugates of this invention contain at least one covalent link between the carrier protein and the sugar for every four sugar repeating units. In another embodiment, the covalent link between the carrier protein and the sugar occurs at least once for every ten sugar repeating units. In another embodiment, the covalent link between the carrier protein and the sugar occurs at least once for every 15 sugar repeating units. In another embodiment, the covalent link between the carrier protein and the sugar occurs at least once for every 25 sugar repeating units. In another embodiment, the covalent link between the carrier protein and the sugar occurs at least once for every 50 sugar repeating units. In yet another embodiment, the covalent link between the carrier protein and the sugar occurs at least once for every 100 sugar repeating units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 5 to 10 sugar repeat units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 2 to 7 sugar repeat units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 6 to 11 sugar repeat units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 9 to 14 sugar repeat units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 10 to 20 sugar repeat units.

In other embodiments, the glycoconjugate of the present invention comprises at least one covalent link between the carrier protein and the sugar for every 4 to 25 sugar repeat units.

In a common implementation, the carrier protein is CRM _197. In other implementations, the carrier protein is SCP.

In some embodiments, the carrier protein is CRM ₁₉₇ , and the covalent link between CRM ₁₉₇ and the sugar occurs at least once in every 4, 10, 15, or 25 sugar repeat units. In other embodiments, the carrier protein is SCP, and the covalent link between SCP and the sugar occurs at least once in every 4, 10, 15, or 25 sugar repeat units.

The glycoconjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated with the carrier protein but are still present in the glycoconjugate composition. The free sugars may non-covalently associate with the glycoconjugates (i.e., non-covalently bonded to the glycoconjugates, adsorbed to the glycoconjugates, or coated in or by the glycoconjugates).

In one preferred embodiment, the glycoconjugate contains less than about 50% free sugar compared to the total amount of sugar. In another preferred embodiment, the glycoconjugate contains less than about 40% free sugar compared to the total amount of sugar. In yet another preferred embodiment, the glycoconjugate contains less than about 25% free sugar compared to the total amount of sugar. In an even more preferred embodiment, the glycoconjugate contains less than about 20% free sugar compared to the total amount of sugar. In yet another preferred embodiment, the glycoconjugate contains less than about 15% free sugar compared to the total amount of sugar.

Sugar conjugates can also be characterized by their molecular size distribution (K_{_d} ). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to obtain an overview of the molecular size distribution of the conjugates. Large molecules excluded from the pores of the medium elute faster than small molecules. A fraction collector is used to collect the column eluent. Colorimetric analysis is performed using sugar fractions. To determine K_{_d}, the column is calibrated to establish the fraction where molecules are completely excluded (V _₀), (K_{_d} = 0) and the fraction representing maximum retention (V_{_i} ), (K_{_d} = 1). The fraction achieving the specified sample properties (V_{_e} ) is correlated with K_{_d} by the expression K _{_d} = (V _{_e} - V_₀) / (V_{_i} - V_₀).

In one preferred embodiment, at least 30% of the glycoconjugates of the present invention in the CL-4B column have a K_{_d} value less than or equal to 0.3. In one preferred embodiment, at least 40% of the glycoconjugates of the present invention in the CL-4B column have a _K _d value less than or equal to 0.3. In one preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the glycoconjugates of the present invention in the CL-4B column have a K_{_d} value less than or equal to 0.3. In one preferred embodiment, at least 60% of the glycoconjugates of the present invention in the CL-4B column have a K_{_d} value less than or equal to 0.3. In one preferred embodiment, between 50% and 80% of the glycoconjugates of the present invention in the CL-4B column have a K_{_d} value less than or equal to 0.3. In a preferred embodiment, in the CL-4B column, 65% to 80% of the glycoconjugate of the present invention has a _Kd of less than or equal to 0.3.

1.3 Capsular glycoconjugates of the present invention prepared using click chemistry

The glycoconjugates of this invention are prepared using click chemistry. This invention also relates to methods for preparing the glycoconjugates as disclosed herein.

According to the present invention, click chemistry comprises three steps: (a) reacting the isolated capsular sugar with a carbonate derivative and an azide linker in an aprotic solvent to produce an activated azide sugar (sugar activation); (b) reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group, wherein the NHS moiety reacts with an amino group to form an amide bond, thereby obtaining an alkyne-functionalized carrier protein (carrier protein activation); and (c) reacting the activated azide sugar of step (a) with the activated alkyne-carrier protein of step (b) through a Cu ⁺¹ -mediated azide-alkyne cycloaddition reaction to form a glycoconjugate.

After step (a), the sugar is referred to as activated, and is referred to herein as “activated sugar” or “activated azidosaccharide”.

After step (b), the carrier is referred to as activated and is called "activated carrier".

As mentioned above, the sugar is sized to a target molecular weight (MW) range prior to activation (a). Therefore, in one embodiment, the isolated sugar is sized prior to activation with the carbonate derivative and the azide linker. In one embodiment, the isolated sugar is sized to any of the target molecular weight (MW) ranges defined above.

In one embodiment, the carbonate derivative is selected from the group consisting of 1,1'-carbonyldiimidazole (CDI), 1,1'-carbonyl-di-(1,2,4-triazole) (CDT), disuccinimidyl carbonate (DSC), and N-hydroxysuccinimidyl chloroformate.

In one embodiment, the carbonate derivative is 1,1'-carbonyldiimidazole (CDI). In another embodiment, the carbonate derivative is 1,1'-carbonyl-di-(1,2,4-triazole) (CDT). In yet another embodiment, the carbonate derivative is disuccinimide carbonate (DSC). In still another embodiment, the carbonate derivative is N-hydroxysuccinimide chloroformate.

In one embodiment, the carbonate derivative is 1,1'-carbonyldiimidazole (CDI) or 1,1'-carbonyl-bis-(1,2,4-triazole) (CDT). Preferably, the carbonate derivative is 1,1'-carbonyldiimidazole (CDI).

In one embodiment, the azide-based linker is a compound of formula (I).

H ₂ NXN ₃ (I)

The X series is selected from the following groups: _CH2 ( _CH2 ) _n , ( _{CH2CH2O ) mCH2CH2 ,} NHCO( _CH2 ) _n , NHCO( _{CH2CH2O ) mCH2CH2 , OCH2} ( _CH2 ) _n and O( _CH2CH2O ) _mCH2CH2 ; wherein the n series is selected from 1 _to 10 and _the m series _is selected from ₁ to ₄ .

In one embodiment, the azide-based linker is a compound of formula (I), wherein X is _CH₂ ( _CH₂ ) _ₙ , and n is selected from 1 to 10. In one embodiment, n is selected from 1 to 5. In one embodiment, n is selected from 1 to 4. In one embodiment, n is selected from 1 to 3. In one embodiment, n is selected from 1 to 2. In a particular embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In yet another embodiment, n is 4. In yet another embodiment, n is 5. In yet another embodiment, n is 6. In yet another embodiment, n is 7. In yet another embodiment, n is 8. In yet another embodiment, n is 9. In yet another embodiment, n is 10.

In one embodiment, the azide linker is a compound of formula (I), wherein X is ( _{CH₂CH₂O ) mCH₂CH₂} , and m is selected _from 1 to _4. In one embodiment, m is selected from 1 to 3. In one embodiment, m is selected from 1 to 2. In a particular embodiment, m is 1. In another embodiment, m is 2. In yet another embodiment, m is 3. In yet another embodiment, m is 4.

In one embodiment, the azide-based linker is a compound of formula (I), wherein X is NHCO( _CH₂ ) _ₙ , and n is selected from 1 to 10. In one embodiment, n is selected from 1 to 5. In one embodiment, n is selected from 1 to 4. In one embodiment, n is selected from 1 to 3. In one embodiment, n is selected from 1 to 2. In a particular embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In yet another embodiment, n is 4. In yet another embodiment, n is 5. In yet another embodiment, n is 6. In yet another embodiment, n is 7. In yet another embodiment, n is 8. In yet another embodiment, n is 9. In yet another embodiment, n is 10.

In one embodiment, the azide-based linker is a compound of formula (I), wherein X is _NHCO ( _CH₂CH₂O ) _mCH₂CH₂ , and m is selected _from 1 to _4. In one embodiment, m is selected from 1 to 3. In one embodiment, m is selected from 1 to 2. In a particular embodiment, m is 1. In another embodiment, m is 2. In yet another embodiment, m is 3. In yet another embodiment, m is 4.

In one embodiment, the azide-based linker is a compound of formula (I), wherein X is _OCH₂ ( _CH₂ ) _ₙ , and n is selected from 1 to 10. In one embodiment, n is selected from 1 to 5. In one embodiment, n is selected from 1 to 4. In one embodiment, n is selected from 1 to 3. In one embodiment, n is selected from 1 to 2. In a particular embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In yet another embodiment, n is 4. In yet another embodiment, n is 5. In yet another embodiment, n is 6. In yet another embodiment, n is 7. In yet another embodiment, n is 8. In yet another embodiment, n is 9. In yet another embodiment, n is 10.

In one embodiment, the azide-based linker is a compound of formula (I), wherein X is O _{( CH₂CH₂O} ) _mCH₂CH₂ , and wherein m is selected _from 1 to _4. In one embodiment, m is selected from 1 to 3. In one embodiment, m is selected from 1 to 2. In a particular embodiment, m is 1. In another embodiment, m is 2. In yet another embodiment, m is 3. In yet another embodiment, m is 4.

In one embodiment, the azide-based linker is a compound of formula (II).

In a preferred embodiment, the azide-based linker is 3-azidopropylamine.

In one embodiment, the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a terminal alkyne.

In one embodiment, the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a cycloalkyne.

In one embodiment, the reagent containing the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (III).

The X series is selected from the following groups: _CH₂O ( _CH₂ ) _nCH₂C ＝O and _CH₂O ( _CH₂CH₂O ) _m ( _CH₂ ) _nCH₂C ＝O, where _the n series is selected from 0 to ₁₀ and the m series is selected _from 0 to 4.

In _one embodiment, the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a compound of formula (III), wherein X is _CH₂O ( _CH₂ ) _nCH₂C =O, and n is selected from 0 to 10. In one embodiment, n is selected from 0 to 5. In one embodiment, n is selected from 0 to 4. In one embodiment, n is selected from 0 to 3. In one embodiment, n is selected from 0 to 2. In a particular embodiment, n is 0. In a particular embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In yet another embodiment, n is 4. In yet another embodiment, n is 5. In yet another embodiment, n is 6. In yet another embodiment, n is 7. In yet another embodiment, n is 8. In yet another embodiment, n is 9. In yet another embodiment, n is 10.

In one embodiment, the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a compound of formula (III), wherein X is _CH₂O ( _CH₂CH₂O ) _m ( _CH₂ ) _{nCH₂C =} O, wherein n is selected from 0 _to 10 and m is selected from 0 to 4. In one embodiment, n is selected from 0 to 5. In one embodiment, n is selected from 0 to 4. In one embodiment, n is selected from 0 to 3. In one embodiment, n is selected from 0 to 2. In a particular embodiment, n is 0. In a particular embodiment, n is 1. In another embodiment, n is 2. In yet another embodiment, n is 3. In yet another embodiment, n is 4. In yet another embodiment, n is 5. In yet another embodiment, n is 6. In yet another embodiment, n is 7. In yet another embodiment, n is 8. In yet another embodiment, n is 9. In yet another embodiment, n is 10. In one embodiment, m is selected from 0 to 3. In one embodiment, m is selected from 0 to 2. In a particular embodiment, m is 1. In one particular implementation, m is 1. In another implementation, m is 2. In yet another implementation, m is 3. In yet another implementation, m is 4.

In one embodiment, n is selected from 0 to 5 and m is selected from 0 to 3. In another embodiment, n is selected from 0 to 5 and m is selected from 0 to 2.

In one embodiment, n is selected from 0 to 4 and m is selected from 0 to 3. In another embodiment, n is selected from 0 to 4 and m is selected from 0 to 2.

In one embodiment, n is selected from 0 to 3 and m is selected from 0 to 3. In another embodiment, n is selected from 0 to 3 and m is selected from 0 to 2.

In one embodiment, n is selected from 0 to 2 and m is selected from 0 to 3.

In one embodiment, n is selected from 0 to 1 and m is selected from 0 to 3. In another embodiment, n is selected from 0 to 1 and m is selected from 0 to 2.

In one embodiment, n is 0 and m is 0. In one embodiment, n is 1 and m is 0. In one embodiment, n is 2 and m is 0. In one embodiment, n is 3 and m is 0. In one embodiment, n is 4 and m is 0. In one embodiment, n is 5 and m is 0. In one embodiment, n is 6 and m is 0. In one embodiment, n is 7 and m is 0. In one embodiment, n is 8 and m is 0. In one embodiment, n is 9 and m is 0. In one embodiment, n is 10 and m is 0.

In one implementation, n is 0 and m is 1. In one implementation, n is 1 and m is 1. In one implementation, n is 2 and m is 1. In one implementation, n is 3 and m is 1. In one implementation, n is 4 and m is 1. In one implementation, n is 5 and m is 1. In one implementation, n is 6 and m is 1. In one implementation, n is 7 and m is 1. In one implementation, n is 8 and m is 1. In one implementation, n is 9 and m is 1. In one implementation, n is 10 and m is 1.

In one implementation, n is 0 and m is 2. In one implementation, n is 1 and m is 2. In one implementation, n is 2 and m is 2. In one implementation, n is 3 and m is 2. In one implementation, n is 4 and m is 2. In one implementation, n is 5 and m is 2. In one implementation, n is 6 and m is 2. In one implementation, n is 7 and m is 2. In one implementation, n is 8 and m is 2. In one implementation, n is 9 and m is 2. In one implementation, n is 10 and m is 2.

In one embodiment, n is 0 and m is 3. In one embodiment, n is 1 and m is 3. In one embodiment, n is 2 and m is 3. In one embodiment, n is 3 and m is 3. In one embodiment, n is 4 and m is 3. In one embodiment, n is 5 and m is 3. In one embodiment, n is 6 and m is 3. In one embodiment, n is 7 and m is 3. In one embodiment, n is 8 and m is 3. In one embodiment, n is 9 and m is 3. In one embodiment, n is 10 and m is 3.

In one embodiment, n is 0 and m is 4. In one embodiment, n is 1 and m is 4. In one embodiment, n is 2 and m is 4. In one embodiment, n is 3 and m is 4. In one embodiment, n is 4 and m is 4. In one embodiment, n is 5 and m is 4. In one embodiment, n is 6 and m is 4. In one embodiment, n is 7 and m is 4. In one embodiment, n is 8 and m is 4. In one embodiment, n is 9 and m is 4. In one embodiment, n is 10 and m is 4.

In one embodiment, the reagent containing the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (IV):

In one embodiment, step a) comprises reacting the sugar with a carbonate derivative, and then reacting the sugar activated by the carbonate derivative with an azide linker in an aprotic solvent to produce an activated azide sugar.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.5 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.8 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 1 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 2 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 3 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 5 and 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.5 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.8 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 1 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 2 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 3 and 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.5 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.8 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 1 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 2 and 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.5 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.8 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 1 and 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.5 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.8 and 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.4 and 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a certain amount of a carbonic acid derivative.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.3 and 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.01 and 0.3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.05 and 0.3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.1 and 0.3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount between 0.2 and 0.3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.01 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.05 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.08 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 0.5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 1 molar equivalent relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 2 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 3 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 4 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 5 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 8 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, step a) comprises reacting the sugar with a carbonic acid derivative in an amount of about 10 molar equivalents relative to the amount of sugar present in the reaction mixture.

In one embodiment, at step a), the separated sugar is reacted with a carbonate derivative in an aprotic solvent.

In one embodiment, the isolated sugar and the carbonate derivative are reacted in a solution consisting essentially of dimethyl sulfoxide (DMSO) or dimethylformamide (DMF). In another embodiment, the isolated sugar and the carbonate derivative are reacted in a solution consisting essentially of dimethylformamide (DMF). In yet another embodiment, the isolated sugar and the carbonate derivative are reacted in a solution consisting essentially of dimethyl sulfoxide (DMSO).

In one embodiment, the separated sugar and the carbonate derivative are reacted in a solution consisting essentially of dimethylacetamide. In one embodiment, the separated sugar and the carbonate derivative are reacted in a solution consisting essentially of N-methyl-2-pyrrolidone. In one embodiment, the separated sugar and the carbonate derivative are reacted in a solution consisting essentially of hexamethylphosphoramide (HMPA).

In a preferred embodiment, the separated sugar is reacted with a carbonate derivative in a solution consisting essentially of dimethyl sulfoxide (DMSO).

In one embodiment, the isolated sugar is reacted with a carbonate derivative in dimethyl sulfoxide (DMSO) or dimethylformamide (DMF). In another embodiment, the isolated sugar is reacted with a carbonate derivative in dimethylformamide (DMF). In yet another embodiment, the isolated sugar is reacted with a carbonate derivative in dimethyl sulfoxide (DMSO).

In one embodiment, the separated sugar is reacted with a carbonate derivative in dimethylacetamide. In one embodiment, the separated sugar is reacted with a carbonate derivative in N-methyl-2-pyrrolidone. In one embodiment, the separated sugar is reacted with a carbonate derivative in hexamethylphosphoramide (HMPA).

In a preferred embodiment, the isolated sugar is reacted with CDI in dimethyl sulfoxide (DMSO). In another embodiment, the isolated sugar is reacted with CDI in anhydrous DMSO.

Surprisingly, it has been found that reacting isolated sugars with CDI in an environment with a moisture content of about 0.1% to 1% (v/v) avoids side reactions. Therefore, in one embodiment, isolated sugars and CDI are reacted in an aprotic solvent containing 0.1% to 1% (v/v) water. In another embodiment, isolated sugars and CDI are reacted in an aprotic solvent containing 0.1% to 0.8% (v/v) water. In yet another embodiment, isolated sugars and CDI are reacted in an aprotic solvent containing 0.1% to 0.5% (v/v) water. In yet another embodiment, isolated sugars and CDI are reacted in an aprotic solvent containing 0.1% to 0.4% (v/v) water. In yet another embodiment, isolated sugars and CDI are reacted in an aprotic solvent containing 0.1% to 0.3% (v/v) water. In one embodiment, the isolated sugar is reacted with CDI in an aprotic solvent containing 0.1% to 0.2% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.2% to 1% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.2% to 0.8% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.2% to 0.5% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.2% to 0.4% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.2% to 0.3% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.3% to 0.8% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.3% to 0.5% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing 0.3% to 0.4% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.1% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.2% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.3% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.4% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.5% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.6% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.7% (v/v) water. In one embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.8% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in an aprotic solvent containing about 0.9% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 1% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 0.8% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 0.5% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 0.4% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 0.3% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.1% to 0.2% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.2% to 1% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.2% to 0.8% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.2% to 0.5% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.2% to 0.4% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.2% to 0.3% (v/v) water.

In one embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.3% to 0.8% (v/v) water. In another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.3% to 0.5% (v/v) water. In yet another embodiment, the isolated sugar and CDI are reacted in DMSO containing 0.3% to 0.4% (v/v) water.

In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.1% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.2% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.3% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.4% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.5% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.6% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.7% (v/v) water. In one embodiment, the isolated sugar and CDI react in DMSO containing about 0.8% (v/v) water. In one embodiment, the isolated sugar is reacted with CDI in DMSO containing about 0.9% (v/v) water.

In one embodiment, the free carbonic acid derivative is quenched by adding water before the addition of the azide-based linker. Water deactivates the free CDI. Therefore, in one embodiment, water is added after the carbonic acid derivative has been activated. In one embodiment, water is added to bring the total water content in the mixture to between about 1% and about 10% (v/v). In one embodiment, water is added to bring the total water content in the mixture to between about 1.2% and about 8% (v/v). In one embodiment, water is added to bring the total water content in the mixture to between about 1.5% and about 5% (v/v). In one embodiment, water is added to bring the total water content in the mixture to between about 1.5% and about 3% (v/v). In one embodiment, water is added to bring the total water content in the mixture to between about 1.5% and about 2.5% (v/v). In one embodiment, water is added to bring the total water content in the mixture to about 1% (v/v). In one embodiment, water is added to bring the total water content in the mixture to about 1.2% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 1.4% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 1.5% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 2% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 2.5% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 3% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 5% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 7% (v/v). In one embodiment, water is added to bring the total water content of the mixture to about 10% (v/v).

Once the sugar has reacted with the carbonate derivative and the carbonate derivative has been quenched with water, the sugar activated by the carbonate derivative reacts with the azide linker.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in the amount (molar equivalent of RU) of the polysaccharide repeating unit relative to the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 8 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 4 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 3 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 1 molar equivalent relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.01 and 0.5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azide linker in the range of 0.01 to 0.1 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in the range of 0.05 to 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 1 molar equivalent relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 0.5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.05 and 0.1 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 0.1 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 8 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 4 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 1 molar equivalent relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.1 and 0.5 molar equivalents relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 0.5 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 0.5 and 1 molar equivalent relative to the amount of polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 1 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 1 and 8 molar equivalents of the polysaccharide repeating unit relative to the amount of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 1 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 1 and 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 1 and 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker between 1 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 2 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 2 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 2 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 2 and 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 2 and 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 3 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 3 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 3 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 3 and 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 4 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 4 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 4 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 5 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in a quantity between 5 and 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azido-linker in an amount between 8 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 0.01 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 0.05 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 0.1 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 0.5 molar equivalent relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 1 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 3 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 4 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 8 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, step a) further comprises reacting the sugar activated by the carbonate derivative with an azide linker in an amount of about 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In the above embodiments, the carbonate derivative is preferably CDI. In another embodiment, the carbonate derivative is CDT.

In one embodiment, the degree of activation of the activated sugar after step a) is between 0.5% and 50%. The degree of activation of the azidosaccharide is defined as the percentage of repeating units linked to the azido linker.

In one embodiment, the activation level of the activated sugar after step a) is between 1% and 30%. In another embodiment, the activation level of the activated sugar after step a) is between 2% and 25%. In yet another embodiment, the activation level of the activated sugar after step a) is between 3% and 20%.

In another embodiment, the activation level of the activated sugar after step a) is between 3% and 15%. In another embodiment, the activation level of the activated sugar after step a) is between 4% and 15%. In one embodiment, the activation level of the activated sugar after step a) is between 1% and 6%.

In one embodiment, the degree of activation of the activated sugar after step a) is between 3% and 6%. In another embodiment, the degree of activation of the activated sugar after step a) is between 10% and 15%.

In one embodiment, the activation level of the activated sugar after step a) is about 1%. In one embodiment, the activation level of the activated sugar after step a) is about 2%. In one embodiment, the activation level of the activated sugar after step a) is about 3%. In one embodiment, the activation level of the activated sugar after step a) is about 4%. In one embodiment, the activation level of the activated sugar after step a) is about 5%. In one embodiment, the activation level of the activated sugar after step a) is about 6%. In one embodiment, the activation level of the activated sugar after step a) is about 7%. In one embodiment, the activation level of the activated sugar after step a) is about 8%. In one embodiment, the activation level of the activated sugar after step a) is about 9%. In one embodiment, the activation level of the activated sugar after step a) is about 10%. In one embodiment, the activation level of the activated sugar after step a) is about 11%. In one embodiment, the activation level of the activated sugar after step a) is about 12%. In one embodiment, the activation level of the activated sugar after step a) is about 13%. In one embodiment, the activation level of the activated sugar after step a) is about 14%. In one embodiment, the activation level of the activated sugar after step a) is about 15%. In one embodiment, the activation level of the activated sugar after step a) is about 16%. In one embodiment, the activation level of the activated sugar after step a) is about 17%. In one embodiment, the activation level of the activated sugar after step a) is about 18%. In one embodiment, the activation level of the activated sugar after step a) is about 19%. In one embodiment, the activation level of the activated sugar after step a) is about 20%.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2 to 10 molar equivalents relative to the lysine residues on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2.5 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 3 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 5 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 7.5 to 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2.5 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 3 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 5 to 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2.5 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 3 to 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2.5 to 3 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 2.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 2.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 2.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 2.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 2 to 2.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 2 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 2 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 2 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1.5 to 2 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 1.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 1.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 1 to 1.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 1 molar equivalent relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.5 to 1 molar equivalent relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 0.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 10 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 7.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 3 molar equivalents relative to the lysine on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 2.5 molar equivalents relative to the lysine on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 2 molar equivalents relative to the lysine on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 1.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 1 molar equivalent relative to the lysine on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 0.5 molar equivalents relative to the lysine residue on the carrier.

In one embodiment, step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of about 0.1 molar equivalent relative to the lysine on the carrier.

In one embodiment, the activation level of the activated carrier after step b) is between 1 and 50. The activation level of the activated carrier is defined as the number of lysine residues in the carrier protein that become linked to a reagent with an N-hydroxysuccinimide (NHS) moiety and an alkyne group.

In one embodiment, the carrier protein is CRM ₁₉₇ , which contains 39 lysine residues. In this embodiment, the activation level of the activated carrier after step b) is between 1 and 30. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is between 5 and 20. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is between 9 and 18. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is between 8 and 11. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is between 15 and 20. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 5. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 6. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 7. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 8. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 9. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 10. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 11. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 12. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 13. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 14. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 15. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 16. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 17. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 18. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 19. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 20. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 21. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 22. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is about 23. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is approximately 24. In another embodiment, the activation level of the activated carrier (CRM ₁₉₇ ) after step b) is approximately 25.

In one embodiment, the carrier protein is SCP or a fragment thereof. In this embodiment, the activation level of the activated carrier after step b) is between 1 and 50. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 5 and 50. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 7 and 45. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 5 and 15. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 20 and 30. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 30 and 50. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 30 and 40. In another embodiment, the activation level of the activated carrier (SCP) after step b) is between 10 and 40. In another embodiment, the activation level of the activated carrier (SCP) after step b) is about 5. In another embodiment, the activation level of the activated carrier (SCP) after step b) is about 7. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 10. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 13. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 15. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 20. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 26. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 30. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 35. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 37. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 40. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 45. In another embodiment, the activation level of the activated carrier (SCP) after step b) is approximately 50.

In one embodiment, the carrier protein is TT or a fragment thereof. In this embodiment, the activation level of the activated carrier after step b) is between 1 and 30. In another embodiment, the activation level of the activated carrier (TT) after step b) is between 5 and 25. In another embodiment, the activation level of the activated carrier (TT) after step b) is between 7 and 25. In another embodiment, the activation level of the activated carrier (TT) after step b) is between 10 and 20. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 5. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 7. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 10. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 12. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 15. In another embodiment, the activation level of the activated carrier (TT) after step b) is about 20. In another embodiment, the degree of activation of the activated carrier (TT) after step b) is about 25. In another embodiment, the degree of activation of the activated carrier (TT) after step b) is about 30.

In one embodiment, the conjugation reaction c) is carried out in an aqueous buffer. In one embodiment, the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst. In one embodiment, the conjugation reaction c) is carried out in an aqueous buffer in the presence of an oxidant and copper (I) as a catalyst. In a preferred embodiment, the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst and ascorbate as an oxidant. In one embodiment, THPTA (tris(3-hydroxypropyltriazolylmethyl)amine) and aminoguanidine may be further added to prevent side reactions of the protein. Therefore, in a preferred embodiment, the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst and ascorbate as an oxidant, wherein the reaction mixture further comprises THPTA (tris(3-hydroxypropyltriazolylmethyl)amine) and aminoguanidine.

In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is between 0.1 and 3. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is between 0.5 and 2. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is between 0.6 and 1.5. In a preferred embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is between 0.8 and 1. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 0.5. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 0.6. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 0.7. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 0.8. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 0.9. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.1. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.2. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.3. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.4. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.5. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.6. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.7. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is about 1.8. In one embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-support at step c) is about 1.9. In another embodiment, the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-support at step c) is about 2.

After the click conjugation reaction, unreacted azide groups may remain in the conjugate. These unreacted azide groups can be capped using a suitable azide-capping agent. Therefore, in one embodiment, after step c), the unreacted azide groups in the conjugate are capped using a suitable azide-capping agent. In one embodiment, this azide-capping agent is a reagent with an alkyne group. In one embodiment, this azide-capping agent is a reagent with a terminal alkyne. In one embodiment, this azide-capping agent is a reagent with a cycloalkyne.

In one embodiment, the azide-based end-capping agent is a compound of formula (V).

≡-X-OH (V)

Where X is (CH ₂ ) _n , and n is selected from 1 to 15.

In one embodiment, the azide-based end-capping agent is propargyl alcohol.

Therefore, in one embodiment, after step c), the method further includes the step of capping the unreacted azide groups retained in the conjugate with an azide-capping agent.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.05 and 20 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.1 and 15 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.5 and 10 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.5 and 5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.5 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.5 and 1 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 1 and 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount between 0.75 and 1.5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount of about 1 molar equivalent relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount of about 1.5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount of about 0.5 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

In one embodiment, the capping of unreacted azide groups is performed using a capping agent in an amount of about 2 molar equivalents relative to the amount of polysaccharide repeating units of the activated sugar.

After the click conjugation reaction, unreacted alkyne groups may remain in the conjugate. These unreacted alkyne groups can be capped using a suitable alkyne capping agent. In one embodiment, this alkyne capping agent is a reagent with an azide group.

In one embodiment, the alkyne-based end-capping agent is a compound of formula (VI).

N ₃ -X-OH (VI)

Where X is (CH ₂ ) _n , and n is selected from 1 to 15.

In one embodiment, the alkyne-based end-capping agent is 3-azido-1-propanol.

Therefore, in one embodiment, after step c), the method further includes the step of capping the unreacted alkyne group retained in the conjugate with an alkyne-based capping agent.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.05 and 20 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.1 and 15 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.5 and 10 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.5 and 5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.5 and 2 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 0.5 and 1 molar equivalent relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 1 and 5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 1 and 2 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount between 1.5 and 2.5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 0.5 molar equivalent relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 1 molar equivalent relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 1.5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 2 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 2.5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

In one embodiment, the capping of the unreacted alkyne group is performed using a capping agent in an amount of about 5 molar equivalents relative to the amount of the polysaccharide repeating unit of the activated sugar.

Following conjugation with a carrier protein, the glycoconjugate can be purified (enriched in terms of the amount of glycoprotein conjugate) using a variety of techniques known to those skilled in the art. These techniques include dialysis, concentration/percolation, tangential flow filtration precipitation/elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration. Therefore, in one embodiment, the method for producing the glycoconjugate of the present invention includes a step of purifying the glycoconjugate after its production.

In one aspect, the present invention provides a glycoconjugate produced according to any of the methods disclosed herein.

In one aspect, the present invention provides a capsular glycosyl conjugate comprising a capsular glycoside covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII):

The X series is selected from the following groups: _CH₂ ( _CH₂ ) _n' , ( _CH₂CH₂O ) _mCH₂CH₂ , NHCO( _CH₂ ) _{n' ,} NHCO( _CH₂CH₂O ) _mCH₂CH₂ , _OCH₂ ( _CH₂ ) _{n '} , and O( _CH₂CH₂O ) _mCH₂CH₂ ; where n' is selected _{from 1} to ₁₀ and m _is selected from _{1 to 4} .

Furthermore, X' is selected from the following groups: _CH2O ( _CH2 ) _{n” CH2C} ＝ _O , _CH2O ( _CH2CH2O ) _m' ( _CH2 ) _{n” CH2C} ＝O, where n” is selected from 0 to 10 and m' is selected from 0 to 4. The structure in square brackets represents the repeating unit of the capsular sugar.

In one implementation, the capsular sugar is not derived from Streptococcus pneumoniae serotype 3.

Formula (VII) is a schematic representation of the glycoconjugate of the present invention. It should not be construed as implying that every repeating unit of the sugar (the structure in square brackets) has a connection. In reality, most sugar repeating units remain unmodified, and a few sugar repeating units have covalently linked carrier proteins to the sugar. Furthermore, individual carrier protein (CP) molecules can be linked to more than one sugar molecule, and individual sugar molecules can be linked to more than one individual carrier protein (CP) molecule. The structure in square brackets represents a repeating unit of a capsular sugar.

In a preferred embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH₂ ( _CH₂ ) _n' , where n' is 2, and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} ＝O, where n” is 1. In one embodiment, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

Therefore, in a preferred embodiment, the present invention provides a capsular glycosyl conjugate comprising a capsular glycoside covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VIII).

The structure within square brackets represents a repeating unit of the capsular sugar.

Formula (VIII) is a schematic representation of the preferred glycoconjugate of the present invention. It should not be construed as implying that every repeating unit of the sugar (the structure in square brackets) has a connection. In reality, most sugar repeating units remain unmodified, and a few sugar repeating units have a covalent connection between a carrier protein and the sugar. Furthermore, individual carrier protein (CP) molecules can connect to more than one sugar molecule, and individual sugar molecules can connect to more than one individual carrier protein (CP) molecule. The structure in square brackets is a schematic representation of a sugar repeating unit.

In one implementation, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH₂ ( _CH₂ ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} ＝O, wherein n” is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5 and n” is selected from 0 to 10. In another embodiment, n' is selected from 1 to 5 and n” is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3 and n” is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2 and n” is selected from 0 to 2. In a particular embodiment, n' is 1 and n” is 0. In another embodiment, n' is 2 and n” is 0. In yet another embodiment, n' is 3 and n” is 0. In yet another embodiment, n' is 4 and n” is 0. In yet another embodiment, n' is 5 and n” is 0. In yet another embodiment, n' is 6 and n” is 0. In one particular embodiment, n' is 1 and n” is 1. In another embodiment, n' is 2 and n” is 1. In yet another embodiment, n' is 3 and n” is 1. In yet another embodiment, n' is 4 and n” is 1. In yet another embodiment, n' is 5 and n” is 1. In yet another embodiment, n' is 6 and n” is 1. In one particular embodiment, n' is 1 and n” is 2. In another embodiment, n' is 2 and n” is 2. In yet another embodiment, n' is 3 and n” is 2. In yet another embodiment, n' is 4 and n” is 2. In yet another embodiment, n' is 5 and n” is 2. In yet another embodiment, n' is 6 and n” is 2. In one particular embodiment, n' is 1 and n” is 3. In another embodiment, n' is 2 and n” is 3. In yet another embodiment, n' is 3 and n” is 3. In yet another embodiment, n' is 4 and n” is 3. In yet another embodiment, n' is 5 and n” is 3. In yet another embodiment, n' is 6 and n” is 3. In one particular embodiment, n' is 1 and n” is 4. In another embodiment, n' is 2 and n” is 4. In yet another embodiment, n' is 3 and n” is 4. In yet another embodiment, n' is 4 and n” is 4. In yet another embodiment, n' is 5 and n” is 4. In yet another embodiment, n' is 6 and n” is 4. In one particular embodiment, n' is 1 and n” is 5. In another embodiment, n' is 2 and n” is 5. In yet another embodiment, n' is 3 and n” is 5. In yet another embodiment, n' is 4 and n” is 5. In yet another embodiment, n' is 5 and n” is 5. In yet another embodiment, n' is 6 and n” is 5. In one particular embodiment, n' is 1 and n” is 6. In another embodiment, n' is 2 and n” is 6. In yet another embodiment, n' is 3 and n” is 6. In yet another embodiment, n' is 4 and n” is 6. In yet another embodiment, n' is 5 and n” is 6. In yet another embodiment, n' is 6 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH2 ( _CH2 ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH2O ( _CH2CH2O ) _m' ( _{CH2 ) n” CH2C} =O, wherein n” is selected from 0 to 10 and m' is selected from 0 to 4.

In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, n' is 1, m' is 0, and n” is 0. In another implementation, n' is 1, m' is 1, and n” is 0. In yet another implementation, n' is 1, m' is 2, and n” is 0. In yet another implementation, n' is 1, m' is 3, and n” is 0.

In another embodiment, n' is 2, m' is 0, and n” is 0. In another embodiment, n' is 2, m' is 1, and n” is 0. In another embodiment, n' is 2, m' is 2, and n” is 0. In another embodiment, n' is 2, m' is 3, and n” is 0.

In yet another embodiment, n' is 3, m' is 0, and n” is 0. In yet another embodiment, n' is 3, m' is 1, and n” is 0. In yet another embodiment, n' is 3, m' is 2, and n” is 0. In yet another embodiment, n' is 3, m' is 3, and n” is 0.

In yet another embodiment, n' is 4, m' is 0, and n” is 0. In yet another embodiment, n' is 4, m' is 1, and n” is 0. In yet another embodiment, n' is 4, m' is 2, and n” is 0. In yet another embodiment, n' is 4, m' is 3, and n” is 0.

In yet another embodiment, n' is 5, m' is 0, and n” is 0. In yet another embodiment, n' is 5, m' is 1, and n” is 0. In yet another embodiment, n' is 5, m' is 2, and n” is 0. In yet another embodiment, n' is 5, m' is 3, and n” is 0.

In one particular implementation, n' is 1, m' is 0, and n” is 1. In one particular implementation, n' is 1, m' is 1, and n” is 1. In one particular implementation, n' is 1, m' is 2, and n” is 1. In one particular implementation, n' is 1, m' is 3, and n” is 1.

In another implementation, n' is 2, m' is 0, and n” is 1. In another implementation, n' is 2, m' is 1, and n” is 1. In another implementation, n' is 2, m' is 2, and n” is 1. In another implementation, n' is 2, m' is 3, and n” is 1.

In yet another embodiment, n' is 3, m' is 0, and n” is 1. In yet another embodiment, n' is 3, m' is 1, and n” is 1. In yet another embodiment, n' is 3, m' is 2, and n” is 1. In yet another embodiment, n' is 3, m' is 3, and n” is 1.

In yet another embodiment, n' is 4, m' is 0, and n” is 1. In yet another embodiment, n' is 4, m' is 1, and n” is 1. In yet another embodiment, n' is 4, m' is 2, and n” is 1. In yet another embodiment, n' is 4, m' is 3, and n” is 1.

In yet another embodiment, n' is 5, m' is 0, and n” is 1. In yet another embodiment, n' is 5, m' is 1, and n” is 1. In yet another embodiment, n' is 5, m' is 2, and n” is 1. In yet another embodiment, n' is 5, m' is 3, and n” is 1.

In one particular implementation, n' is 1, m' is 0, and n” is 2. In one particular implementation, n' is 1, m' is 1, and n” is 2. In one particular implementation, n' is 1, m' is 2, and n” is 2. In one particular implementation, n' is 1, m' is 3, and n” is 2.

In another embodiment, n' is 2, m' is 0, and n” is 2. In another embodiment, n' is 2, m' is 1, and n” is 2. In another embodiment, n' is 2, m' is 2, and n” is 2. In another embodiment, n' is 2, m' is 3, and n” is 2.

In yet another embodiment, n' is 3, m' is 0, and n” is 2. In yet another embodiment, n' is 3, m' is 1, and n” is 2. In yet another embodiment, n' is 3, m' is 2, and n” is 2. In yet another embodiment, n' is 3, m' is 3, and n” is 2.

In yet another embodiment, n' is 4, m' is 0, and n” is 2. In yet another embodiment, n' is 4, m' is 1, and n” is 2. In yet another embodiment, n' is 4, m' is 2, and n” is 2. In yet another embodiment, n' is 4, m' is 3, and n” is 2.

In yet another embodiment, n' is 5, m' is 0, and n” is 2. In yet another embodiment, n' is 5, m' is 1, and n” is 2. In yet another embodiment, n' is 5, m' is 2, and n” is 2. In yet another embodiment, n' is 5, m' is 3, and n” is 2.

In one particular implementation, n' is 1, m' is 0, and n” is 3. In one particular implementation, n' is 1, m' is 1, and n” is 3. In one particular implementation, n' is 1, m' is 2, and n” is 3. In one particular implementation, n' is 1, m' is 3, and n” is 3.

In another embodiment, n' is 2, m' is 0, and n” is 3. In another embodiment, n' is 2, m' is 1, and n” is 3. In another embodiment, n' is 2, m' is 2, and n” is 3. In another embodiment, n' is 2, m' is 3, and n” is 3.

In yet another embodiment, n' is 3, m' is 0, and n” is 3. In yet another embodiment, n' is 3, m' is 1, and n” is 3. In yet another embodiment, n' is 3, m' is 2, and n” is 3. In yet another embodiment, n' is 3, m' is 3, and n” is 3.

In yet another embodiment, n' is 4, m' is 0, and n” is 3. In yet another embodiment, n' is 4, m' is 1, and n” is 3. In yet another embodiment, n' is 4, m' is 2, and n” is 3. In yet another embodiment, n' is 4, m' is 3, and n” is 3.

In yet another embodiment, n' is 5, m' is 0, and n” is 3. In yet another embodiment, n' is 5, m' is 1, and n” is 3. In yet another embodiment, n' is 5, m' is 2, and n” is 3. In yet another embodiment, n' is 5, m' is 3, and n” is 3.

In one particular implementation, n' is 1, m' is 0, and n” is 4. In one particular implementation, n' is 1, m' is 1, and n” is 4. In one particular implementation, n' is 1, m' is 2, and n” is 4. In one particular implementation, n' is 1, m' is 3, and n” is 4.

In another embodiment, n' is 2, m' is 0, and n” is 4. In another embodiment, n' is 2, m' is 1, and n” is 4. In another embodiment, n' is 2, m' is 2, and n” is 4. In another embodiment, n' is 2, m' is 3, and n” is 4.

In yet another embodiment, n' is 3, m' is 0, and n” is 4. In yet another embodiment, n' is 3, m' is 1, and n” is 4. In yet another embodiment, n' is 3, m' is 2, and n” is 4. In yet another embodiment, n' is 3, m' is 3, and n” is 4.

In yet another embodiment, n' is 4, m' is 0, and n” is 4. In yet another embodiment, n' is 4, m' is 1, and n” is 4. In yet another embodiment, n' is 4, m' is 2, and n” is 4. In yet another embodiment, n' is 4, m' is 3, and n” is 4.

In yet another embodiment, n' is 5, m' is 0, and n” is 4. In yet another embodiment, n' is 5, m' is 1, and n” is 4. In yet another embodiment, n' is 5, m' is 2, and n” is 4. In yet another embodiment, n' is 5, m' is 3, and n” is 4.

In one particular implementation, n' is 1, m' is 0, and n” is 5. In one particular implementation, n' is 1, m' is 1, and n” is 5. In one particular implementation, n' is 1, m' is 2, and n” is 5. In one particular implementation, n' is 1, m' is 3, and n” is 5.

In another embodiment, n' is 2, m' is 0, and n” is 5. In another embodiment, n' is 2, m' is 1, and n” is 5. In another embodiment, n' is 2, m' is 2, and n” is 5. In another embodiment, n' is 2, m' is 3, and n” is 5.

In yet another embodiment, n' is 3, m' is 0, and n” is 5. In yet another embodiment, n' is 3, m' is 1, and n” is 5. In yet another embodiment, n' is 3, m' is 2, and n” is 5. In yet another embodiment, n' is 3, m' is 3, and n” is 5.

In yet another embodiment, n' is 4, m' is 0, and n” is 5. In yet another embodiment, n' is 4, m' is 1, and n” is 5. In yet another embodiment, n' is 4, m' is 2, and n” is 5. In yet another embodiment, n' is 4, m' is 3, and n” is 5.

In yet another embodiment, n' is 5, m' is 0, and n” is 5. In yet another embodiment, n' is 5, m' is 1, and n” is 5. In yet another embodiment, n' is 5, m' is 2, and n” is 5. In yet another embodiment, n' is 5, m' is 3, and n” is 5.

Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is ( _CH₂CH₂O ) _mCH₂CH₂ , wherein _m is selected from 1 to ₄ , and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} =O, wherein n” is selected from 0 to 10. In _one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 2. In a particular embodiment, m is 1, and n” is 0. In another embodiment, m is 2, and n” is 0. In yet another embodiment, m is 3, and n” is 0. In yet another embodiment, m is 4, and n” is 0. In one particular embodiment, m is 1 and n” is 1. In another embodiment, m is 2 and n” is 1. In yet another embodiment, m is 3 and n” is 1. In yet another embodiment, m is 4 and n” is 1. In one particular embodiment, m is 1 and n” is 2. In another embodiment, m is 2 and n” is 2. In yet another embodiment, m is 3 and n” is 2. In yet another embodiment, m is 4 and n” is 2. In one particular embodiment, m is 1 and n” is 3. In another embodiment, m is 2 and n” is 3. In yet another embodiment, m is 3 and n” is 3. In yet another embodiment, m is 4 and n” is 3. In one particular embodiment, m is 1 and n” is 4. In another embodiment, m is 2 and n” is 4. In yet another embodiment, m is 3 and n” is 4. In yet another embodiment, m is 4 and n” is 4. In one particular embodiment, m is 1 and n” is 5. In another embodiment, m is 2 and n” is 5. In yet another embodiment, m is 3 and n” is 5. In yet another embodiment, m is 4 and n” is 5. In one particular embodiment, m is 1 and n” is 6. In another embodiment, m is 2 and n” is 6. In yet another embodiment, m is 3 and n” is 6. In yet another embodiment, m is 4 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having _the general formula ₍ VII), wherein X is ( _CH₂CH₂O ) _mCH₂CH₂ , wherein _m is selected from 1 to 4, and wherein X' is _CH₂O ( _CH₂CH₂O ) _m' ( _CH₂ ) _{n” CH₂C} =O, wherein n” is selected _from 0 to 10 and m' is selected from 0 to 4.

In one embodiment, m is selected from 1 to 3, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, m is 1, m' is 0, and n” is 0. In another implementation, m is 1, m' is 1, and n” is 0. In yet another implementation, m is 1, m' is 2, and n” is 0. In yet another implementation, m is 1, m' is 3, and n” is 0.

In another embodiment, m is 2, m' is 0, and n” is 0. In another embodiment, m is 2, m' is 1, and n” is 0. In another embodiment, m is 2, m' is 2, and n” is 0. In another embodiment, m is 2, m' is 3, and n” is 0.

In yet another embodiment, m is 3, m' is 0, and n” is 0. In yet another embodiment, m is 3, m' is 1, and n” is 0. In yet another embodiment, m is 3, m' is 2, and n” is 0. In yet another embodiment, m is 3, m' is 3, and n” is 0.

In yet another embodiment, m is 4, m' is 0, and n” is 0. In yet another embodiment, m is 4, m' is 1, and n” is 0. In yet another embodiment, m is 4, m' is 2, and n” is 0. In yet another embodiment, m is 4, m' is 3, and n” is 0.

In one specific implementation, m is 1, m' is 0, and n” is 1. In one specific implementation, m is 1, m' is 1, and n” is 1. In one specific implementation, m is 1, m' is 2, and n” is 1. In one specific implementation, m is 1, m' is 3, and n” is 1.

In another embodiment, m is 2, m' is 0, and n” is 1. In another embodiment, m is 2, m' is 1, and n” is 1. In another embodiment, m is 2, m' is 2, and n” is 1. In another embodiment, m is 2, m' is 3, and n” is 1.

In yet another embodiment, m is 3, m' is 0, and n” is 1. In yet another embodiment, m is 3, m' is 1, and n” is 1. In yet another embodiment, m is 3, m' is 2, and n” is 1. In yet another embodiment, m is 3, m' is 3, and n” is 1.

In yet another embodiment, m is 4, m' is 0, and n” is 1. In yet another embodiment, m is 4, m' is 1, and n” is 1. In yet another embodiment, m is 4, m' is 2, and n” is 1. In yet another embodiment, m is 4, m' is 3, and n” is 1.

In one specific implementation, m is 1, m' is 0, and n” is 2. In one specific implementation, m is 1, m' is 1, and n” is 2. In one specific implementation, m is 1, m' is 2, and n” is 2. In one specific implementation, m is 1, m' is 3, and n” is 2.

In another embodiment, m is 2, m' is 0, and n” is 2. In another embodiment, m is 2, m' is 1, and n” is 2. In another embodiment, m is 2, m' is 2, and n” is 2. In another embodiment, m is 2, m' is 3, and n” is 2.

In yet another embodiment, m is 3, m' is 0, and n” is 2. In yet another embodiment, m is 3, m' is 1, and n” is 2. In yet another embodiment, m is 3, m' is 2, and n” is 2. In yet another embodiment, m is 3, m' is 3, and n” is 2.

In yet another embodiment, m is 4, m' is 0, and n” is 2. In yet another embodiment, m is 4, m' is 1, and n” is 2. In yet another embodiment, m is 4, m' is 2, and n” is 2. In yet another embodiment, m is 4, m' is 3, and n” is 2.

In one particular embodiment, m is 1, m' is 0, and n” is 3. In one particular embodiment, m is 1, m' is 1, and n” is 3. In one particular embodiment, m is 1, m' is 2, and n” is 3. In one particular embodiment, m is 1, m' is 3, and n” is 3.

In another embodiment, m is 2, m' is 0, and n” is 3. In another embodiment, m is 2, m' is 1, and n” is 3. In another embodiment, m is 2, m' is 2, and n” is 3. In another embodiment, m is 2, m' is 3, and n” is 3.

In yet another embodiment, m is 3, m' is 0, and n” is 3. In yet another embodiment, m is 3, m' is 1, and n” is 3. In yet another embodiment, m is 3, m' is 2, and n” is 3. In yet another embodiment, m is 3, m' is 3, and n” is 3.

In yet another embodiment, m is 4, m' is 0, and n” is 3. In yet another embodiment, m is 4, m' is 1, and n” is 3. In yet another embodiment, m is 4, m' is 2, and n” is 3. In yet another embodiment, m is 4, m' is 3, and n” is 3.

In one particular embodiment, m is 1, m' is 0, and n” is 4. In one particular embodiment, m is 1, m' is 1, and n” is 4. In one particular embodiment, m is 1, m' is 2, and n” is 4. In one particular embodiment, m is 1, m' is 3, and n” is 4.

In another embodiment, m is 2, m' is 0, and n” is 4. In another embodiment, m is 2, m' is 1, and n” is 4. In another embodiment, m is 2, m' is 2, and n” is 4. In another embodiment, m is 2, m' is 3, and n” is 4.

In yet another embodiment, m is 3, m' is 0, and n” is 4. In yet another embodiment, m is 3, m' is 1, and n” is 4. In yet another embodiment, m is 3, m' is 2, and n” is 4. In yet another embodiment, m is 3, m' is 3, and n” is 4.

In yet another embodiment, m is 4, m' is 0, and n” is 4. In yet another embodiment, m is 4, m' is 1, and n” is 4. In yet another embodiment, m is 4, m' is 2, and n” is 4. In yet another embodiment, m is 4, m' is 3, and n” is 4.

In one particular embodiment, m is 1, m' is 0, and n” is 5. In one particular embodiment, m is 1, m' is 1, and n” is 5. In one particular embodiment, m is 1, m' is 2, and n” is 5. In one particular embodiment, m is 1, m' is 3, and n” is 5.

In another embodiment, m is 2, m' is 0, and n” is 5. In another embodiment, m is 2, m' is 1, and n” is 5. In another embodiment, m is 2, m' is 2, and n” is 5. In another embodiment, m is 2, m' is 3, and n” is 5.

In yet another embodiment, m is 3, m' is 0, and n” is 5. In yet another embodiment, m is 3, m' is 1, and n” is 5. In yet another embodiment, m is 3, m' is 2, and n” is 5. In yet another embodiment, m is 3, m' is 3, and n” is 5.

In yet another embodiment, m is 4, m' is 0, and n” is 5. In yet another embodiment, m is 4, m' is 1, and n” is 5. In yet another embodiment, m is 4, m' is 2, and n” is 5. In yet another embodiment, m is 4, m' is 3, and n” is 5.

Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is NHCO( _CH₂ ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} ＝O, wherein n” is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5, and n” is selected from 0 to 10. In another embodiment, n' is selected from 1 to 5, and n” is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3, and n” is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2, and n” is selected from 0 to 2. In a particular embodiment, n' is 1, and n” is 0. In another embodiment, n' is 2, and n” is 0. In yet another embodiment, n' is 3, and n” is 0. In yet another embodiment, n' is 4, and n” is 0. In yet another embodiment, n' is 5 and n” is 0. In yet another embodiment, n' is 6 and n” is 0. In one particular embodiment, n' is 1 and n” is 1. In another embodiment, n' is 2 and n” is 1. In yet another embodiment, n' is 3 and n” is 1. In yet another embodiment, n' is 4 and n” is 1. In yet another embodiment, n' is 5 and n” is 1. In yet another embodiment, n' is 6 and n” is 1. In one particular embodiment, n' is 1 and n” is 2. In another embodiment, n' is 2 and n” is 2. In yet another embodiment, n' is 3 and n” is 2. In yet another embodiment, n' is 4 and n” is 2. In yet another embodiment, n' is 5 and n” is 2. In yet another embodiment, n' is 6 and n” is 2. In one particular embodiment, n' is 1 and n” is 3. In another embodiment, n' is 2 and n” is 3. In yet another embodiment, n' is 3 and n” is 3. In yet another embodiment, n' is 4 and n” is 3. In yet another embodiment, n' is 5 and n” is 3. In yet another embodiment, n' is 6 and n” is 3. In one particular embodiment, n' is 1 and n” is 4. In another embodiment, n' is 2 and n” is 4. In yet another embodiment, n' is 3 and n” is 4. In yet another embodiment, n' is 4 and n” is 4. In yet another embodiment, n' is 5 and n” is 4. In yet another embodiment, n' is 6 and n” is 4. In one particular embodiment, n' is 1 and n” is 5. In another embodiment, n' is 2 and n” is 5. In yet another embodiment, n' is 3 and n” is 5. In yet another embodiment, n' is 4 and n” is 5. In yet another embodiment, n' is 5 and n” is 5. In yet another embodiment, n' is 6 and n” is 5. In one particular embodiment, n' is 1 and n” is 6. In another embodiment, n' is 2 and n” is 6. In yet another embodiment, n' is 3 and n” is 6. In yet another embodiment, n' is 4 and n” is 6. In yet another embodiment, n' is 5 and n” is 6. In yet another embodiment, n' is 6 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is NHCO( _CH₂ ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH₂O ( _CH₂CH₂O ) _m' ( _{CH₂ ) n” CH₂C} ＝O, wherein n” is selected from 0 to 10 and m' is selected from 0 to 4.

In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, n' is 1, m' is 0, and n” is 0. In another implementation, n' is 1, m' is 1, and n” is 0. In yet another implementation, n' is 1, m' is 2, and n” is 0. In yet another implementation, n' is 1, m' is 3, and n” is 0.

In another embodiment, n' is 2, m' is 0, and n” is 0. In another embodiment, n' is 2, m' is 1, and n” is 0. In another embodiment, n' is 2, m' is 2, and n” is 0. In another embodiment, n' is 2, m' is 3, and n” is 0.

In yet another embodiment, n' is 3, m' is 0, and n” is 0. In yet another embodiment, n' is 3, m' is 1, and n” is 0. In yet another embodiment, n' is 3, m' is 2, and n” is 0. In yet another embodiment, n' is 3, m' is 3, and n” is 0.

In yet another embodiment, n' is 4, m' is 0, and n” is 0. In yet another embodiment, n' is 4, m' is 1, and n” is 0. In yet another embodiment, n' is 4, m' is 2, and n” is 0. In yet another embodiment, n' is 4, m' is 3, and n” is 0.

In yet another embodiment, n' is 5, m' is 0, and n” is 0. In yet another embodiment, n' is 5, m' is 1, and n” is 0. In yet another embodiment, n' is 5, m' is 2, and n” is 0. In yet another embodiment, n' is 5, m' is 3, and n” is 0.

In one particular implementation, n' is 1, m' is 0, and n” is 1. In one particular implementation, n' is 1, m' is 1, and n” is 1. In one particular implementation, n' is 1, m' is 2, and n” is 1. In one particular implementation, n' is 1, m' is 3, and n” is 1.

In another implementation, n' is 2, m' is 0, and n” is 1. In another implementation, n' is 2, m' is 1, and n” is 1. In another implementation, n' is 2, m' is 2, and n” is 1. In another implementation, n' is 2, m' is 3, and n” is 1.

In yet another embodiment, n' is 3, m' is 0, and n” is 1. In yet another embodiment, n' is 3, m' is 1, and n” is 1. In yet another embodiment, n' is 3, m' is 2, and n” is 1. In yet another embodiment, n' is 3, m' is 3, and n” is 1.

In yet another embodiment, n' is 4, m' is 0, and n” is 1. In yet another embodiment, n' is 4, m' is 1, and n” is 1. In yet another embodiment, n' is 4, m' is 2, and n” is 1. In yet another embodiment, n' is 4, m' is 3, and n” is 1.

In yet another embodiment, n' is 5, m' is 0, and n” is 1. In yet another embodiment, n' is 5, m' is 1, and n” is 1. In yet another embodiment, n' is 5, m' is 2, and n” is 1. In yet another embodiment, n' is 5, m' is 3, and n” is 1.

In one particular implementation, n' is 1, m' is 0, and n” is 2. In one particular implementation, n' is 1, m' is 1, and n” is 2. In one particular implementation, n' is 1, m' is 2, and n” is 2. In one particular implementation, n' is 1, m' is 3, and n” is 2.

In another embodiment, n' is 2, m' is 0, and n” is 2. In another embodiment, n' is 2, m' is 1, and n” is 2. In another embodiment, n' is 2, m' is 2, and n” is 2. In another embodiment, n' is 2, m' is 3, and n” is 2.

In yet another embodiment, n' is 3, m' is 0, and n” is 2. In yet another embodiment, n' is 3, m' is 1, and n” is 2. In yet another embodiment, n' is 3, m' is 2, and n” is 2. In yet another embodiment, n' is 3, m' is 3, and n” is 2.

In yet another embodiment, n' is 4, m' is 0, and n” is 2. In yet another embodiment, n' is 4, m' is 1, and n” is 2. In yet another embodiment, n' is 4, m' is 2, and n” is 2. In yet another embodiment, n' is 4, m' is 3, and n” is 2.

In yet another embodiment, n' is 5, m' is 0, and n” is 2. In yet another embodiment, n' is 5, m' is 1, and n” is 2. In yet another embodiment, n' is 5, m' is 2, and n” is 2. In yet another embodiment, n' is 5, m' is 3, and n” is 2.

In one particular implementation, n' is 1, m' is 0, and n” is 3. In one particular implementation, n' is 1, m' is 1, and n” is 3. In one particular implementation, n' is 1, m' is 2, and n” is 3. In one particular implementation, n' is 1, m' is 3, and n” is 3.

In another embodiment, n' is 2, m' is 0, and n” is 3. In another embodiment, n' is 2, m' is 1, and n” is 3. In another embodiment, n' is 2, m' is 2, and n” is 3. In another embodiment, n' is 2, m' is 3, and n” is 3.

In yet another embodiment, n' is 3, m' is 0, and n” is 3. In yet another embodiment, n' is 3, m' is 1, and n” is 3. In yet another embodiment, n' is 3, m' is 2, and n” is 3. In yet another embodiment, n' is 3, m' is 3, and n” is 3.

In yet another embodiment, n' is 4, m' is 0, and n” is 3. In yet another embodiment, n' is 4, m' is 1, and n” is 3. In yet another embodiment, n' is 4, m' is 2, and n” is 3. In yet another embodiment, n' is 4, m' is 3, and n” is 3.

In yet another embodiment, n' is 5, m' is 0, and n” is 3. In yet another embodiment, n' is 5, m' is 1, and n” is 3. In yet another embodiment, n' is 5, m' is 2, and n” is 3. In yet another embodiment, n' is 5, m' is 3, and n” is 3.

In one particular implementation, n' is 1, m' is 0, and n” is 4. In one particular implementation, n' is 1, m' is 1, and n” is 4. In one particular implementation, n' is 1, m' is 2, and n” is 4. In one particular implementation, n' is 1, m' is 3, and n” is 4.

In another embodiment, n' is 2, m' is 0, and n” is 4. In another embodiment, n' is 2, m' is 1, and n” is 4. In another embodiment, n' is 2, m' is 2, and n” is 4. In another embodiment, n' is 2, m' is 3, and n” is 4.

In yet another embodiment, n' is 3, m' is 0, and n” is 4. In yet another embodiment, n' is 3, m' is 1, and n” is 4. In yet another embodiment, n' is 3, m' is 2, and n” is 4. In yet another embodiment, n' is 3, m' is 3, and n” is 4.

In yet another embodiment, n' is 4, m' is 0, and n” is 4. In yet another embodiment, n' is 4, m' is 1, and n” is 4. In yet another embodiment, n' is 4, m' is 2, and n” is 4. In yet another embodiment, n' is 4, m' is 3, and n” is 4.

In yet another embodiment, n' is 5, m' is 0, and n” is 4. In yet another embodiment, n' is 5, m' is 1, and n” is 4. In yet another embodiment, n' is 5, m' is 2, and n” is 4. In yet another embodiment, n' is 5, m' is 3, and n” is 4.

In one particular implementation, n' is 1, m' is 0, and n” is 5. In one particular implementation, n' is 1, m' is 1, and n” is 5. In one particular implementation, n' is 1, m' is 2, and n” is 5. In one particular implementation, n' is 1, m' is 3, and n” is 5.

In another embodiment, n' is 2, m' is 0, and n” is 5. In another embodiment, n' is 2, m' is 1, and n” is 5. In another embodiment, n' is 2, m' is 2, and n” is 5. In another embodiment, n' is 2, m' is 3, and n” is 5.

In yet another embodiment, n' is 3, m' is 0, and n” is 5. In yet another embodiment, n' is 3, m' is 1, and n” is 5. In yet another embodiment, n' is 3, m' is 2, and n” is 5. In yet another embodiment, n' is 3, m' is 3, and n” is 5.

In yet another embodiment, n' is 4, m' is 0, and n” is 5. In yet another embodiment, n' is 4, m' is 1, and n” is 5. In yet another embodiment, n' is 4, m' is 2, and n” is 5. In yet another embodiment, n' is 4, m' is 3, and n” is 5.

In yet another embodiment, n' is 5, m' is 0, and n” is 5. In yet another embodiment, n' is 5, m' is 1, and n” is 5. In yet another embodiment, n' is 5, m' is 2, and n” is 5. In yet another embodiment, n' is 5, m' is 3, and n” is 5.

Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is NHCO( _CH₂CH₂O ) _mCH₂CH₂ , wherein _m is selected _from 1 to 4, and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} ＝O, wherein _n ” is selected from 0 to 10. In one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 2. In a particular embodiment, m is 1, and n” is 0. In another embodiment, m is 2, and n” is 0. In yet another embodiment, m is 3, and n” is 0. In yet another embodiment, m is 4, and n” is 0. In one particular embodiment, m is 1 and n” is 1. In another embodiment, m is 2 and n” is 1. In yet another embodiment, m is 3 and n” is 1. In yet another embodiment, m is 4 and n” is 1. In one particular embodiment, m is 1 and n” is 2. In another embodiment, m is 2 and n” is 2. In yet another embodiment, m is 3 and n” is 2. In yet another embodiment, m is 4 and n” is 2. In one particular embodiment, m is 1 and n” is 3. In another embodiment, m is 2 and n” is 3. In yet another embodiment, m is 3 and n” is 3. In yet another embodiment, m is 4 and n” is 3. In one particular embodiment, m is 1 and n” is 4. In another embodiment, m is 2 and n” is 4. In yet another embodiment, m is 3 and n” is 4. In yet another embodiment, m is 4 and n” is 4. In one particular embodiment, m is 1 and n” is 5. In another embodiment, m is 2 and n” is 5. In yet another embodiment, m is 3 and n” is 5. In yet another embodiment, m is 4 and n” is 5. In one particular embodiment, m is 1 and n” is 6. In another embodiment, m is 2 and n” is 6. In yet another embodiment, m is 3 and n” is 6. In yet another embodiment, m is 4 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII ₎ , wherein X is NHCO( _{CH₂CH₂O ) mCH₂CH₂} , wherein _m is selected from 1 to 4, and wherein X' is _CH₂O ( _CH₂CH₂O ) _m' ( _{CH₂ ) n” CH₂C} =O, wherein n” is selected from 0 to 10 and m' is selected from 0 to 4.

In one embodiment, m is selected from 1 to 3, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, m is 1, m' is 0, and n” is 0. In another implementation, m is 1, m' is 1, and n” is 0. In yet another implementation, m is 1, m' is 2, and n” is 0. In yet another implementation, m is 1, m' is 3, and n” is 0.

In another embodiment, m is 2, m' is 0, and n” is 0. In another embodiment, m is 2, m' is 1, and n” is 0. In another embodiment, m is 2, m' is 2, and n” is 0. In another embodiment, m is 2, m' is 3, and n” is 0.

In yet another embodiment, m is 3, m' is 0, and n” is 0. In yet another embodiment, m is 3, m' is 1, and n” is 0. In yet another embodiment, m is 3, m' is 2, and n” is 0. In yet another embodiment, m is 3, m' is 3, and n” is 0.

In yet another embodiment, m is 4, m' is 0, and n” is 0. In yet another embodiment, m is 4, m' is 1, and n” is 0. In yet another embodiment, m is 4, m' is 2, and n” is 0. In yet another embodiment, m is 4, m' is 3, and n” is 0.

In one specific implementation, m is 1, m' is 0, and n” is 1. In one specific implementation, m is 1, m' is 1, and n” is 1. In one specific implementation, m is 1, m' is 2, and n” is 1. In one specific implementation, m is 1, m' is 3, and n” is 1.

In another embodiment, m is 2, m' is 0, and n” is 1. In another embodiment, m is 2, m' is 1, and n” is 1. In another embodiment, m is 2, m' is 2, and n” is 1. In another embodiment, m is 2, m' is 3, and n” is 1.

In yet another embodiment, m is 3, m' is 0, and n” is 1. In yet another embodiment, m is 3, m' is 1, and n” is 1. In yet another embodiment, m is 3, m' is 2, and n” is 1. In yet another embodiment, m is 3, m' is 3, and n” is 1.

In yet another embodiment, m is 4, m' is 0, and n” is 1. In yet another embodiment, m is 4, m' is 1, and n” is 1. In yet another embodiment, m is 4, m' is 2, and n” is 1. In yet another embodiment, m is 4, m' is 3, and n” is 1.

In one specific implementation, m is 1, m' is 0, and n” is 2. In one specific implementation, m is 1, m' is 1, and n” is 2. In one specific implementation, m is 1, m' is 2, and n” is 2. In one specific implementation, m is 1, m' is 3, and n” is 2.

In another embodiment, m is 2, m' is 0, and n” is 2. In another embodiment, m is 2, m' is 1, and n” is 2. In another embodiment, m is 2, m' is 2, and n” is 2. In another embodiment, m is 2, m' is 3, and n” is 2.

In yet another embodiment, m is 3, m' is 0, and n” is 2. In yet another embodiment, m is 3, m' is 1, and n” is 2. In yet another embodiment, m is 3, m' is 2, and n” is 2. In yet another embodiment, m is 3, m' is 3, and n” is 2.

In yet another embodiment, m is 4, m' is 0, and n” is 2. In yet another embodiment, m is 4, m' is 1, and n” is 2. In yet another embodiment, m is 4, m' is 2, and n” is 2. In yet another embodiment, m is 4, m' is 3, and n” is 2.

In one particular embodiment, m is 1, m' is 0, and n” is 3. In one particular embodiment, m is 1, m' is 1, and n” is 3. In one particular embodiment, m is 1, m' is 2, and n” is 3. In one particular embodiment, m is 1, m' is 3, and n” is 3.

In another embodiment, m is 2, m' is 0, and n” is 3. In another embodiment, m is 2, m' is 1, and n” is 3. In another embodiment, m is 2, m' is 2, and n” is 3. In another embodiment, m is 2, m' is 3, and n” is 3.

In yet another embodiment, m is 3, m' is 0, and n” is 3. In yet another embodiment, m is 3, m' is 1, and n” is 3. In yet another embodiment, m is 3, m' is 2, and n” is 3. In yet another embodiment, m is 3, m' is 3, and n” is 3.

In yet another embodiment, m is 4, m' is 0, and n” is 3. In yet another embodiment, m is 4, m' is 1, and n” is 3. In yet another embodiment, m is 4, m' is 2, and n” is 3. In yet another embodiment, m is 4, m' is 3, and n” is 3.

In one particular embodiment, m is 1, m' is 0, and n” is 4. In one particular embodiment, m is 1, m' is 1, and n” is 4. In one particular embodiment, m is 1, m' is 2, and n” is 4. In one particular embodiment, m is 1, m' is 3, and n” is 4.

In another embodiment, m is 2, m' is 0, and n” is 4. In another embodiment, m is 2, m' is 1, and n” is 4. In another embodiment, m is 2, m' is 2, and n” is 4. In another embodiment, m is 2, m' is 3, and n” is 4.

In yet another embodiment, m is 3, m' is 0, and n” is 4. In yet another embodiment, m is 3, m' is 1, and n” is 4. In yet another embodiment, m is 3, m' is 2, and n” is 4. In yet another embodiment, m is 3, m' is 3, and n” is 4.

In yet another embodiment, m is 4, m' is 0, and n” is 4. In yet another embodiment, m is 4, m' is 1, and n” is 4. In yet another embodiment, m is 4, m' is 2, and n” is 4. In yet another embodiment, m is 4, m' is 3, and n” is 4.

In one particular embodiment, m is 1, m' is 0, and n” is 5. In one particular embodiment, m is 1, m' is 1, and n” is 5. In one particular embodiment, m is 1, m' is 2, and n” is 5. In one particular embodiment, m is 1, m' is 3, and n” is 5.

In another embodiment, m is 2, m' is 0, and n” is 5. In another embodiment, m is 2, m' is 1, and n” is 5. In another embodiment, m is 2, m' is 2, and n” is 5. In another embodiment, m is 2, m' is 3, and n” is 5.

In yet another embodiment, m is 3, m' is 0, and n” is 5. In yet another embodiment, m is 3, m' is 1, and n” is 5. In yet another embodiment, m is 3, m' is 2, and n” is 5. In yet another embodiment, m is 3, m' is 3, and n” is 5.

In yet another embodiment, m is 4, m' is 0, and n” is 5. In yet another embodiment, m is 4, m' is 1, and n” is 5. In yet another embodiment, m is 4, m' is 2, and n” is 5. In yet another embodiment, m is 4, m' is 3, and n” is 5. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _OCH2 ( _CH2 ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH2O ( _CH2 ) _{n” CH2C} ＝O, wherein n” is selected from 0 to 10.

In one embodiment, n' is selected from 1 to 5, and n" is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5, and n" is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3, and n" is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2, and n" is selected from 0 to 2. In a particular embodiment, n' is 1, and n" is 0. In another embodiment, n' is 2, and n" is 0. In yet another embodiment, n' is 3, and n" is 0. In yet another embodiment, n' is 4, and n" is 0. In yet another embodiment, n' is 5, and n" is 0. In yet another embodiment, n' is 6, and n" is 0. In one particular embodiment, n' is 1, and n" is 1. In another embodiment, n' is 2, and n" is 1. In yet another embodiment, n' is 3, and n" is 1. In yet another embodiment, n' is 4, and n" is 1. In yet another embodiment, n' is 5 and n” is 1. In yet another embodiment, n' is 6 and n” is 1. In one particular embodiment, n' is 1 and n” is 2. In another embodiment, n' is 2 and n” is 2. In yet another embodiment, n' is 3 and n” is 2. In yet another embodiment, n' is 4 and n” is 2. In yet another embodiment, n' is 5 and n” is 2. In yet another embodiment, n' is 6 and n” is 2. In one particular embodiment, n' is 1 and n” is 3. In another embodiment, n' is 2 and n” is 3. In yet another embodiment, n' is 3 and n” is 3. In yet another embodiment, n' is 4 and n” is 3. In yet another embodiment, n' is 5 and n” is 3. In yet another embodiment, n' is 6 and n” is 3. In one particular embodiment, n' is 1 and n” is 4. In another embodiment, n' is 2 and n” is 4. In yet another embodiment, n' is 3 and n” is 4. In yet another embodiment, n' is 4 and n” is 4. In yet another embodiment, n' is 5 and n” is 4. In yet another embodiment, n' is 6 and n” is 4. In one particular embodiment, n' is 1 and n” is 5. In another embodiment, n' is 2 and n” is 5. In yet another embodiment, n' is 3 and n” is 5. In yet another embodiment, n' is 4 and n” is 5. In yet another embodiment, n' is 5 and n” is 5. In yet another embodiment, n' is 6 and n” is 5. In one particular embodiment, n' is 1 and n” is 6. In another embodiment, n' is 2 and n” is 6. In yet another embodiment, n' is 3 and n” is 6. In yet another embodiment, n' is 4 and n” is 6. In yet another embodiment, n' is 5 and n” is 6. In yet another embodiment, n' is 6 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _OCH2 ( _CH2 ) _n' , wherein n' is selected from 1 to 10, and wherein X' is _CH2O ( _CH2CH2O ) _m' ( _{CH2 ) n” CH2C} =O, wherein n” is selected from 0 to 10 and m' is selected from 0 to 4.

In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, n' is selected from 1 to 5, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, n' is selected from 1 to 3, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, n' is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, n' is 1, m' is 0, and n” is 0. In another implementation, n' is 1, m' is 1, and n” is 0. In yet another implementation, n' is 1, m' is 2, and n” is 0. In yet another implementation, n' is 1, m' is 3, and n” is 0.

In another embodiment, n' is 2, m' is 0, and n” is 0. In another embodiment, n' is 2, m' is 1, and n” is 0. In another embodiment, n' is 2, m' is 2, and n” is 0. In another embodiment, n' is 2, m' is 3, and n” is 0.

In yet another embodiment, n' is 3, m' is 0, and n” is 0. In yet another embodiment, n' is 3, m' is 1, and n” is 0. In yet another embodiment, n' is 3, m' is 2, and n” is 0. In yet another embodiment, n' is 3, m' is 3, and n” is 0.

In yet another embodiment, n' is 4, m' is 0, and n” is 0. In yet another embodiment, n' is 4, m' is 1, and n” is 0. In yet another embodiment, n' is 4, m' is 2, and n” is 0. In yet another embodiment, n' is 4, m' is 3, and n” is 0.

In yet another embodiment, n' is 5, m' is 0, and n” is 0. In yet another embodiment, n' is 5, m' is 1, and n” is 0. In yet another embodiment, n' is 5, m' is 2, and n” is 0. In yet another embodiment, n' is 5, m' is 3, and n” is 0.

In one particular implementation, n' is 1, m' is 0, and n” is 1. In one particular implementation, n' is 1, m' is 1, and n” is 1. In one particular implementation, n' is 1, m' is 2, and n” is 1. In one particular implementation, n' is 1, m' is 3, and n” is 1.

In another implementation, n' is 2, m' is 0, and n” is 1. In another implementation, n' is 2, m' is 1, and n” is 1. In another implementation, n' is 2, m' is 2, and n” is 1. In another implementation, n' is 2, m' is 3, and n” is 1.

In yet another embodiment, n' is 3, m' is 0, and n” is 1. In yet another embodiment, n' is 3, m' is 1, and n” is 1. In yet another embodiment, n' is 3, m' is 2, and n” is 1. In yet another embodiment, n' is 3, m' is 3, and n” is 1.

In yet another embodiment, n' is 4, m' is 0, and n” is 1. In yet another embodiment, n' is 4, m' is 1, and n” is 1. In yet another embodiment, n' is 4, m' is 2, and n” is 1. In yet another embodiment, n' is 4, m' is 3, and n” is 1.

In yet another embodiment, n' is 5, m' is 0, and n” is 1. In yet another embodiment, n' is 5, m' is 1, and n” is 1. In yet another embodiment, n' is 5, m' is 2, and n” is 1. In yet another embodiment, n' is 5, m' is 3, and n” is 1.

In one particular implementation, n' is 1, m' is 0, and n” is 2. In one particular implementation, n' is 1, m' is 1, and n” is 2. In one particular implementation, n' is 1, m' is 2, and n” is 2. In one particular implementation, n' is 1, m' is 3, and n” is 2.

In another embodiment, n' is 2, m' is 0, and n” is 2. In another embodiment, n' is 2, m' is 1, and n” is 2. In another embodiment, n' is 2, m' is 2, and n” is 2. In another embodiment, n' is 2, m' is 3, and n” is 2.

In yet another embodiment, n' is 3, m' is 0, and n” is 2. In yet another embodiment, n' is 3, m' is 1, and n” is 2. In yet another embodiment, n' is 3, m' is 2, and n” is 2. In yet another embodiment, n' is 3, m' is 3, and n” is 2.

In yet another embodiment, n' is 4, m' is 0, and n” is 2. In yet another embodiment, n' is 4, m' is 1, and n” is 2. In yet another embodiment, n' is 4, m' is 2, and n” is 2. In yet another embodiment, n' is 4, m' is 3, and n” is 2.

In yet another embodiment, n' is 5, m' is 0, and n” is 2. In yet another embodiment, n' is 5, m' is 1, and n” is 2. In yet another embodiment, n' is 5, m' is 2, and n” is 2. In yet another embodiment, n' is 5, m' is 3, and n” is 2.

In one particular implementation, n' is 1, m' is 0, and n” is 3. In one particular implementation, n' is 1, m' is 1, and n” is 3. In one particular implementation, n' is 1, m' is 2, and n” is 3. In one particular implementation, n' is 1, m' is 3, and n” is 3.

In another embodiment, n' is 2, m' is 0, and n” is 3. In another embodiment, n' is 2, m' is 1, and n” is 3. In another embodiment, n' is 2, m' is 2, and n” is 3. In another embodiment, n' is 2, m' is 3, and n” is 3.

In yet another embodiment, n' is 3, m' is 0, and n” is 3. In yet another embodiment, n' is 3, m' is 1, and n” is 3. In yet another embodiment, n' is 3, m' is 2, and n” is 3. In yet another embodiment, n' is 3, m' is 3, and n” is 3.

In yet another embodiment, n' is 4, m' is 0, and n” is 3. In yet another embodiment, n' is 4, m' is 1, and n” is 3. In yet another embodiment, n' is 4, m' is 2, and n” is 3. In yet another embodiment, n' is 4, m' is 3, and n” is 3.

In yet another embodiment, n' is 5, m' is 0, and n” is 3. In yet another embodiment, n' is 5, m' is 1, and n” is 3. In yet another embodiment, n' is 5, m' is 2, and n” is 3. In yet another embodiment, n' is 5, m' is 3, and n” is 3.

In one particular implementation, n' is 1, m' is 0, and n” is 4. In one particular implementation, n' is 1, m' is 1, and n” is 4. In one particular implementation, n' is 1, m' is 2, and n” is 4. In one particular implementation, n' is 1, m' is 3, and n” is 4.

In another embodiment, n' is 2, m' is 0, and n” is 4. In another embodiment, n' is 2, m' is 1, and n” is 4. In another embodiment, n' is 2, m' is 2, and n” is 4. In another embodiment, n' is 2, m' is 3, and n” is 4.

In yet another embodiment, n' is 3, m' is 0, and n” is 4. In yet another embodiment, n' is 3, m' is 1, and n” is 4. In yet another embodiment, n' is 3, m' is 2, and n” is 4. In yet another embodiment, n' is 3, m' is 3, and n” is 4.

In yet another embodiment, n' is 4, m' is 0, and n” is 4. In yet another embodiment, n' is 4, m' is 1, and n” is 4. In yet another embodiment, n' is 4, m' is 2, and n” is 4. In yet another embodiment, n' is 4, m' is 3, and n” is 4.

In yet another embodiment, n' is 5, m' is 0, and n” is 4. In yet another embodiment, n' is 5, m' is 1, and n” is 4. In yet another embodiment, n' is 5, m' is 2, and n” is 4. In yet another embodiment, n' is 5, m' is 3, and n” is 4.

In one particular implementation, n' is 1, m' is 0, and n” is 5. In one particular implementation, n' is 1, m' is 1, and n” is 5. In one particular implementation, n' is 1, m' is 2, and n” is 5. In one particular implementation, n' is 1, m' is 3, and n” is 5.

In another embodiment, n' is 2, m' is 0, and n” is 5. In another embodiment, n' is 2, m' is 1, and n” is 5. In another embodiment, n' is 2, m' is 2, and n” is 5. In another embodiment, n' is 2, m' is 3, and n” is 5.

In yet another embodiment, n' is 3, m' is 0, and n” is 5. In yet another embodiment, n' is 3, m' is 1, and n” is 5. In yet another embodiment, n' is 3, m' is 2, and n” is 5. In yet another embodiment, n' is 3, m' is 3, and n” is 5.

In yet another embodiment, n' is 4, m' is 0, and n” is 5. In yet another embodiment, n' is 4, m' is 1, and n” is 5. In yet another embodiment, n' is 4, m' is 2, and n” is 5. In yet another embodiment, n' is 4, m' is 3, and n” is 5.

In yet another embodiment, n' is 5, m' is 0, and n” is 5. In yet another embodiment, n' is 5, m' is 1, and n” is 5. In yet another embodiment, n' is 5, m' is 2, and n” is 5. In yet another embodiment, n' is 5, m' is 3, and n” is 5.

Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula ₍ VII), wherein X is O( _{CH₂CH₂O ) mCH₂CH₂} , wherein _m is selected from 1 to 4, and wherein X' is _CH₂O ( _CH₂ ) _{n” CH₂C} ＝O, wherein n” is selected from 0 to 10.

In one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 3, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, and n” is selected from 0 to 2. In a particular embodiment, m is 1, and n” is 0. In another embodiment, m is 2, and n” is 0. In yet another embodiment, m is 3, and n” is 0. In yet another embodiment, m is 4, and n” is 0. In one particular embodiment, m is 1, and n” is 1. In another embodiment, m is 2, and n” is 1. In yet another embodiment, m is 3, and n” is 1. In yet another embodiment, m is 4, and n” is 1. In one particular embodiment, m is 1, and n” is 2. In another embodiment, m is 2, and n” is 2. In yet another embodiment, m is 3 and n” is 2. In yet another embodiment, m is 4 and n” is 2. In one particular embodiment, m is 1 and n” is 3. In another embodiment, m is 2 and n” is 3. In yet another embodiment, m is 3 and n” is 3. In yet another embodiment, m is 4 and n” is 3. In one particular embodiment, m is 1 and n” is 4. In another embodiment, m is 2 and n” is 4. In yet another embodiment, m is 3 and n” is 4. In yet another embodiment, m is 4 and n” is 4. In one particular embodiment, m is 1 and n” is 5. In another embodiment, m is 2 and n” is 5. In yet another embodiment, m is 3 and n” is 5. In yet another embodiment, m is 4 and n” is 5. In one particular embodiment, m is 1 and n” is 6. In another embodiment, m is 2 and n” is 6. In yet another embodiment, m is 3 and n” is 6. In yet another embodiment, m is 4 and n” is 6. Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

In one embodiment, the present invention provides a glycoconjugate comprising a sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is O( _{CH₂CH₂O ) mCH₂CH₂} , wherein _m is selected from 1 to 4, and wherein X' is _CH₂O ( _CH₂CH₂O ) _m' ( _{CH₂ ) n” CH₂C} =O, wherein n” is selected from 0 to ₁₀ and m' is selected from 0 to 4.

In one embodiment, m is selected from 1 to 3, m' is selected from 0 to 4, and n” is selected from 0 to 10. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 4, and n” is selected from 0 to 5. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 3. In one embodiment, m is selected from 1 to 2, m' is selected from 0 to 2, and n” is selected from 0 to 1.

In one particular implementation, m is 1, m' is 0, and n” is 0. In another implementation, m is 1, m' is 1, and n” is 0. In yet another implementation, m is 1, m' is 2, and n” is 0. In yet another implementation, m is 1, m' is 3, and n” is 0.

In another embodiment, m is 2, m' is 0, and n” is 0. In another embodiment, m is 2, m' is 1, and n” is 0. In another embodiment, m is 2, m' is 2, and n” is 0. In another embodiment, m is 2, m' is 3, and n” is 0.

In yet another embodiment, m is 3, m' is 0, and n” is 0. In yet another embodiment, m is 3, m' is 1, and n” is 0. In yet another embodiment, m is 3, m' is 2, and n” is 0. In yet another embodiment, m is 3, m' is 3, and n” is 0.

In yet another embodiment, m is 4, m' is 0, and n” is 0. In yet another embodiment, m is 4, m' is 1, and n” is 0. In yet another embodiment, m is 4, m' is 2, and n” is 0. In yet another embodiment, m is 4, m' is 3, and n” is 0.

In one specific implementation, m is 1, m' is 0, and n” is 1. In one specific implementation, m is 1, m' is 1, and n” is 1. In one specific implementation, m is 1, m' is 2, and n” is 1. In one specific implementation, m is 1, m' is 3, and n” is 1.

In another embodiment, m is 2, m' is 0, and n” is 1. In another embodiment, m is 2, m' is 1, and n” is 1. In another embodiment, m is 2, m' is 2, and n” is 1. In another embodiment, m is 2, m' is 3, and n” is 1.

In yet another embodiment, m is 3, m' is 0, and n” is 1. In yet another embodiment, m is 3, m' is 1, and n” is 1. In yet another embodiment, m is 3, m' is 2, and n” is 1. In yet another embodiment, m is 3, m' is 3, and n” is 1.

In yet another embodiment, m is 4, m' is 0, and n” is 1. In yet another embodiment, m is 4, m' is 1, and n” is 1. In yet another embodiment, m is 4, m' is 2, and n” is 1. In yet another embodiment, m is 4, m' is 3, and n” is 1.

In one specific implementation, m is 1, m' is 0, and n” is 2. In one specific implementation, m is 1, m' is 1, and n” is 2. In one specific implementation, m is 1, m' is 2, and n” is 2. In one specific implementation, m is 1, m' is 3, and n” is 2.

In another embodiment, m is 2, m' is 0, and n” is 2. In another embodiment, m is 2, m' is 1, and n” is 2. In another embodiment, m is 2, m' is 2, and n” is 2. In another embodiment, m is 2, m' is 3, and n” is 2.

In yet another embodiment, m is 3, m' is 0, and n” is 2. In yet another embodiment, m is 3, m' is 1, and n” is 2. In yet another embodiment, m is 3, m' is 2, and n” is 2. In yet another embodiment, m is 3, m' is 3, and n” is 2.

In yet another embodiment, m is 4, m' is 0, and n” is 2. In yet another embodiment, m is 4, m' is 1, and n” is 2. In yet another embodiment, m is 4, m' is 2, and n” is 2. In yet another embodiment, m is 4, m' is 3, and n” is 2.

In one particular embodiment, m is 1, m' is 0, and n” is 3. In one particular embodiment, m is 1, m' is 1, and n” is 3. In one particular embodiment, m is 1, m' is 2, and n” is 3. In one particular embodiment, m is 1, m' is 3, and n” is 3.

In another embodiment, m is 2, m' is 0, and n” is 3. In another embodiment, m is 2, m' is 1, and n” is 3. In another embodiment, m is 2, m' is 2, and n” is 3. In another embodiment, m is 2, m' is 3, and n” is 3.

In yet another embodiment, m is 3, m' is 0, and n” is 3. In yet another embodiment, m is 3, m' is 1, and n” is 3. In yet another embodiment, m is 3, m' is 2, and n” is 3. In yet another embodiment, m is 3, m' is 3, and n” is 3.

In yet another embodiment, m is 4, m' is 0, and n” is 3. In yet another embodiment, m is 4, m' is 1, and n” is 3. In yet another embodiment, m is 4, m' is 2, and n” is 3. In yet another embodiment, m is 4, m' is 3, and n” is 3.

In one particular embodiment, m is 1, m' is 0, and n” is 4. In one particular embodiment, m is 1, m' is 1, and n” is 4. In one particular embodiment, m is 1, m' is 2, and n” is 4. In one particular embodiment, m is 1, m' is 3, and n” is 4.

In another embodiment, m is 2, m' is 0, and n” is 4. In another embodiment, m is 2, m' is 1, and n” is 4. In another embodiment, m is 2, m' is 2, and n” is 4. In another embodiment, m is 2, m' is 3, and n” is 4.

In yet another embodiment, m is 3, m' is 0, and n” is 4. In yet another embodiment, m is 3, m' is 1, and n” is 4. In yet another embodiment, m is 3, m' is 2, and n” is 4. In yet another embodiment, m is 3, m' is 3, and n” is 4.

In yet another embodiment, m is 4, m' is 0, and n” is 4. In yet another embodiment, m is 4, m' is 1, and n” is 4. In yet another embodiment, m is 4, m' is 2, and n” is 4. In yet another embodiment, m is 4, m' is 3, and n” is 4.

In one particular embodiment, m is 1, m' is 0, and n” is 5. In one particular embodiment, m is 1, m' is 1, and n” is 5. In one particular embodiment, m is 1, m' is 2, and n” is 5. In one particular embodiment, m is 1, m' is 3, and n” is 5.

In another embodiment, m is 2, m' is 0, and n” is 5. In another embodiment, m is 2, m' is 1, and n” is 5. In another embodiment, m is 2, m' is 2, and n” is 5. In another embodiment, m is 2, m' is 3, and n” is 5.

In yet another embodiment, m is 3, m' is 0, and n” is 5. In yet another embodiment, m is 3, m' is 1, and n” is 5. In yet another embodiment, m is 3, m' is 2, and n” is 5. In yet another embodiment, m is 3, m' is 3, and n” is 5.

In yet another embodiment, m is 4, m' is 0, and n” is 5. In yet another embodiment, m is 4, m' is 1, and n” is 5. In yet another embodiment, m is 4, m' is 2, and n” is 5. In yet another embodiment, m is 4, m' is 3, and n” is 5.

Preferably, the sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

Preferably, the sugar in the sugar conjugate of the present invention is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

1.5 Carrier protein of the glycoconjugate of the present invention

The component of the glycoconjugate is the carrier protein conjugated with the glycoside. The terms "protein carrier," "carrier protein," or "carrier" are used interchangeably herein. The carrier protein should be suitable for a standard conjugation procedure.

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is selected from the group consisting of: DT (diphtheria toxoid), TT (tetanus toxoid) or fragment C of TT, CRM ₁₉₇ (a non-toxic but antigenically identical variant of diphtheria toxoid), other DT mutants (such as CRM ₁₇₆ , CRM ₂₂₈ , CRM ₄₅ (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM ₉ , CRM ₁₀₂ , CRM ₁₀₃ or CRM ₁₀₇ ; and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, ed.: Frankel, Maecel Dekker Inc. (1992); Glu-148 deletion or mutation to Asp, Gln or Ser, and/or Ala 158 deletion or mutation to Gly, and other mutations disclosed in U.S. Patent Nos. 4,709,017 and 4,950,740; mutations of at least one or more residues Lys 516, Lys 526, Phe 530 and/or Lys 534, and other mutations disclosed in U.S. Patent Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Patent No. 5,843,711, pneumococcal pneumococcal hemolysin (ply) (Kuo et al. (1995) Infectlmmun 63:2706-2713) includes a ply that is detoxified in some way, such as dPLY-GMBS (WO 2004/081515, WO2006/032499) or dPLY-formol, PhtX (including PhtA, PhtB, PhtD, PhtE (sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO 00/37105 and WO 00/39299) and Pht protein fusions, such as PhtDE fusion, PhtBE fusion, Pht AE (WO 01/98334, WO 03/054007, WO 2009/000826), OMPC (meningococcal outer membrane protein) (which is usually extracted from Neisseria meningitidis serogroup B (EP0372501)), PorB (from Neisseria meningitidis), PD (Haemophilus influenzae protein D; see, for example, EP0594610) B) or its immune equivalents, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO 91/01146), artificial proteins containing multiple human CD4+ T cell epitopes derived from various pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), such as N19 protein (Baraldoi et al. (2004) Infect Immun 72:4884-4887), pneumococcal surface protein PspA (WO 02/091998), iron uptake protein (WO 01/72337), Clostridium difficile toxin A or B (WO00/61761), transferrin-binding protein, Streptococcus pneumoniae adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (especially its non-toxic mutants (such as exotoxin A with glutamate 553 substitution (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivatives of tuberculin (PPD), can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins, such as cholera toxins (e.g., WO00/61761). (As described in 2004/083251); Escherichia coli LT; Escherichia coli ST; and exotoxin A from Pseudomonas aeruginosa. Another suitable carrier protein is C5a peptidase from Streptococcus (SCP).

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is TT, DT, DT mutant (such as CRM ₁₉₇ ) or C5a peptidase (SCP) from Streptococcus.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the present invention is TT (tetanus toxoid).

In another embodiment, the carrier protein of the glycoconjugate of the present invention is PD (Haemophilus influenzae protein D; see, for example, EP0594610 B).

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is CRM ₁₉₇ or C5a peptidase (SCP) from Streptococcus.

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is CRM _197. CRM ₁₉₇ protein is a non-toxic form of diphtheria toxin, but immunologically indistinguishable from diphtheria toxin. CRM ₁₉₇ is produced by Corynebacterium diphtheriae infected with the non-toxic bacteriophage β197 ^tox- , which is produced by mutagenesis of toxin-producing Corynebacterium phage β with nitrosoguanidine (Uchida et al. (1971) Nature New Biology 233:8-11). CRM ₁₉₇ protein has the same molecular weight as diphtheria toxin, but differs from diphtheria toxin due to a single base change in its structural gene (guanine to adenine). This single base change results in an amino acid substitution in the mature protein (glutamate replacing glycine), eliminating the toxic properties of diphtheria toxin. CRM ₁₉₇ protein is a safe and effective T-cell-dependent carrier of glycoconjugates. Further details regarding CRM ₁₉₇ and its origins can be found, for example, in U.S. Patent No. 5,614,382.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is the A chain of CRM ₁₉₇ (see CN103495161). In another embodiment, the carrier protein of the glycoconjugate of the present invention is the A chain of CRM ₁₉₇ obtained by expression in recombinant Escherichia coli (see CN103495161).

In other preferred embodiments, the carrier protein of the glycoconjugate of the present invention is SCP (streptococcal C5a peptidase). Two important species of β-hemolytic streptococci, *Streptococcus pyogenes* (Group A, GAS) and *Streptococcus agalactiae* (Group B, GBS), cause a variety of serious human infections, ranging from mild pharyngitis and impetigo to severe invasive diseases such as necrotizing fasciitis (GAS) and neonatal sepsis (GBS), and methods have been developed to counteract this immune response. All human isolates of β-hemolytic streptococci (including GAS and GBS) produce a highly conserved cell wall protein, SCP (streptococcal C5a peptidase), which specifically inactivates C5a. The scp gene from GAS and GBS encodes a polypeptide containing 1,134 to 1,181 amino acids (Brown et al., PNAS, 2005, Vol. 102, No. 51, pp. 18391-18396). The first 31 residues form the pre-output signal sequence and are removed upon crossing the cell membrane. The subsequent 68 residues serve as the original sequence and must be removed to generate the active SCP. The next 10 residues can be removed without loss of protease activity. At the other end, four consecutive 17-residue motifs begin with Lys-1034, followed by cell sorting and cell wall attachment signals. This combined signal consists of a 20-residue hydrophilic sequence containing the LPTTND sequence, a 17-residue hydrophobic sequence, and a short basic carboxyl terminus.

SCPs can be divided into domains (see Brown et al., PNAS, 2005, Vol. 102, No. 51, pp. 18391-18396, Figure 1B). These domains include anterior/posterior domains (containing the pre-output signal sequence (typically the first 31 residues) and the original sequence (typically the following 68 residues)), a protease domain (which is divided into two parts (protease part 1, typically residues 89 to 333/334; and protease domain part 2, typically residues 467/468 to 583/584), a protease-associated domain (PA domain) (typically residues 333/334 to 467/468), three fibronectin type III (Fn) domains (Fn1, typically residues 583/584 to 712/713; Fn2, typically residues 712/713 to 928/929/930; typically Fn3, residues 929/930 to 1029/1030/1031), and a cell wall anchoring domain (typically residues 1029/1030/1031 to the C-terminus).

In one embodiment, the carrier protein of the glycoconjugate of the present invention is SCP (SCPB) from GBS. An example of SCPB is provided at SEQ ID NO:3 of WO97/26008. See also SEQ ID NO:3 of WO00/34487.

In another preferred embodiment, the carrier protein of the glycoconjugate of the present invention is SCP (SCPA) derived from GAS. Examples of SCPA can be found in SEQ ID No. 1 and SEQ ID No. 2 of WO97/26008. See also SEQ ID NO: 1, 2 and 23 of WO00/34487.

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP.

In other preferred embodiments, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP (SCPB) derived from GBS.

In another preferred embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP (SCPA) derived from GAS.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP. In another embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA. Preferably, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP, which includes a protease domain, a protease-associated domain (PA domain) and three fibronectin type III (Fn) domains, but does not include the output signal pre-sequence, the original sequence and the cell wall anchoring domain.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP, which includes a protease domain, a protease-associated domain (PA domain) and three fibronectin type III (Fn) domains, but does not include the output signal pre-sequence, the original sequence and the cell wall anchoring domain.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, which includes a protease domain, a protease-associated domain (PA domain), and two of the three fibronectin type III (Fn) domains, but does not include the output signal pre-sequence, the original sequence, and the cell wall anchoring domain.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity. In one embodiment, the fragment of SCP without enzymatic activity comprises a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but does not include the pre-output signal sequence, the original sequence, or the cell wall anchoring domain.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA without enzymatic activity. In one embodiment, the fragment of SCPA without enzymatic activity comprises a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but does not include the pre-output signal sequence, the original sequence, or the cell wall anchoring domain.

In a preferred embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB without enzymatic activity. Preferably, the fragment of SCPB without enzymatic activity comprises a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but does not include the pre-output signal sequence, the original sequence, or the cell wall anchoring domain.

In one embodiment, the enzymatic activity of the SCP is inactivated by substituting at least one amino acid of the wild-type sequence. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. The number indicates the position of the amino acid residue in the peptidase numbered SEQ ID NO:1 according to WO00/34487.

Therefore, in one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPA, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPB, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB with no enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by substituting at least one amino acid of the wild-type sequence. Preferably, the at least one amino acid substitution is in the protease domain. In one embodiment, the at least one amino acid substitution is in portion 1 of the protease domain. In one embodiment, the at least one amino acid substitution is in portion 2 of the protease domain. In one embodiment, the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the substitution is D130A. In another embodiment, the substitution is H193A. In another embodiment, the substitution is N295A. In yet another embodiment, the substitution is S512A.

In one embodiment, the enzymatic activity of SCP is inactivated by replacing at least two amino acids of the wild-type sequence. In one embodiment, the at least two amino acid replacements are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid replacements are D130A and H193A. In one embodiment, the at least two amino acid replacements are D130A and N295A. In one embodiment, the at least two amino acid replacements are D130A and S512A. In one embodiment, the at least two amino acid replacements are H193A and N295A. In one embodiment, the at least two amino acid replacements are H193A and S512A. In one embodiment, the at least two amino acid replacements are N295A and S512A.

Therefore, in one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP, wherein the inactivation is achieved by replacing at least two amino acids of the wild-type sequence. Preferably, the replacement of at least two amino acids is in the protease domain. In one embodiment, the replacement of at least two amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least two amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least two amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least two amino acids is D130A and H193A. In one embodiment, the replacement of at least two amino acids is D130A and N295A. Preferably, the replacement of at least two amino acids is D130A and S512A. In one embodiment, the replacement of at least two amino acids is H193A and N295A. In one embodiment, the replacement of at least two amino acids is H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPA, wherein the inactivation is achieved by substituting at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid substitutions are in the protease domain. In one embodiment, the at least two amino acid substitutions are in part 1 of the protease domain. In one embodiment, the at least two amino acid substitutions are in part 2 of the protease domain. In one embodiment, the at least two amino acid substitutions are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid substitutions are D130A and H193A. In one embodiment, the at least two amino acid substitutions are D130A and N295A. Preferably, the at least two amino acid substitutions are D130A and S512A. In one embodiment, the at least two amino acid substitutions are H193A and N295A. In one embodiment, the at least two amino acid substitutions are H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPB, wherein the inactivation is achieved by substituting at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid substitutions are in the protease domain. In one embodiment, the at least two amino acid substitutions are in part 1 of the protease domain. In one embodiment, the at least two amino acid substitutions are in part 2 of the protease domain. In one embodiment, the at least two amino acid substitutions are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid substitutions are D130A and H193A. In one embodiment, the at least two amino acid substitutions are D130A and N295A. Preferably, the at least two amino acid substitutions are D130A and S512A. In one embodiment, the at least two amino acid substitutions are H193A and N295A. In one embodiment, the at least two amino acid substitutions are H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, wherein the inactivation is achieved by substituting at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid substitutions are in the protease domain. In one embodiment, the at least two amino acid substitutions are in part 1 of the protease domain. In one embodiment, the at least two amino acid substitutions are in part 2 of the protease domain. In one embodiment, the at least two amino acid substitutions are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid substitutions are D130A and H193A. In one embodiment, the at least two amino acid substitutions are D130A and N295A. Preferably, the at least two amino acid substitutions are D130A and S512A. In one embodiment, the at least two amino acid substitutions are H193A and N295A. In one embodiment, the at least two amino acid substitutions are H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid replacements are in the protease domain. In one embodiment, the at least two amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least two amino acid replacements are in portion 2 of the protease domain. In one embodiment, the at least two amino acid replacements are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid replacements are D130A and H193A. In one embodiment, the at least two amino acid replacements are D130A and N295A. Preferably, the at least two amino acid replacements are D130A and S512A. In one embodiment, the at least two amino acids are replaced with H193A and N295A. In one embodiment, the at least two amino acids are replaced with H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid replacements are in the protease domain. In one embodiment, the at least two amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least one amino acid replacement is in portion 2 of the protease domain. In one embodiment, the at least two amino acid replacements are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid replacements are D130A and H193A. In one embodiment, the at least two amino acid replacements are D130A and N295A. Preferably, the at least two amino acid replacements are D130A and S512A. In one embodiment, the at least two amino acids are replaced with H193A and N295A. In one embodiment, the at least two amino acids are replaced with H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB with no enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least two amino acids of the wild-type sequence. Preferably, the at least two amino acid replacements are in the protease domain. In one embodiment, the at least two amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least two amino acid replacements are in portion 2 of the protease domain. In one embodiment, the at least two amino acid replacements are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least two amino acid replacements are D130A and H193A. In one embodiment, the at least two amino acid replacements are D130A and N295A. Preferably, the at least two amino acid replacements are D130A and S512A. In one embodiment, the at least two amino acids are replaced with H193A and N295A. In one embodiment, the at least two amino acids are replaced with H193A and S512A. In one embodiment, the at least two amino acids are replaced with N295A and S512A.

In one embodiment, the enzymatic activity of SCP is inactivated by replacing at least three amino acids of the wild-type sequence. In one embodiment, the at least three amino acid replacements are selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the at least three amino acid replacements are D130A, H193A, and N295A. In one embodiment, the at least three amino acid replacements are D130A, H193A, and S512A. In one embodiment, the at least three amino acid replacements are D130A, N295A, and S512A. In one embodiment, the at least three amino acid replacements are H193A, N295A, and S512A.

Therefore, in one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPA, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPB, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the at least three amino acids are replaced with D130A, N295A, and S512A. In another embodiment, the at least three amino acids are replaced with H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the at least three amino acids are replaced with D130A, N295A, and S512A. In another embodiment, the at least three amino acids are replaced with H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB with no enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least three amino acids of the wild-type sequence. Preferably, the replacement of at least three amino acids is in the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 1 of the protease domain. In one embodiment, the replacement of at least three amino acids is in portion 2 of the protease domain. In one embodiment, the replacement of at least three amino acids is selected from the group consisting of D130A, H193A, N295A, and S512A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and N295A. In one embodiment, the replacement of at least three amino acids is D130A, H193A, and S512A. In one embodiment, the at least three amino acids are replaced with D130A, N295A, and S512A. In another embodiment, the at least three amino acids are replaced with H193A, N295A, and S512A.

In one embodiment, the enzymatic activity of SCP is inactivated by replacing at least four amino acids in the wild-type sequence. In one embodiment, the at least four amino acids are replaced with D130A, H193A, N295A, and S512A.

Therefore, in one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCP, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the replacement of at least four amino acids is in the protease domain. In one embodiment, the replacement of at least four amino acids is in part 1 of the protease domain. In one embodiment, the replacement of at least four amino acids is in part 2 of the protease domain. In one embodiment, the replacement of at least four amino acids is D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPA, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the replacement of at least four amino acids is in the protease domain. In one embodiment, the replacement of at least four amino acids is in portion 1 of the protease domain. In one embodiment, the replacement of at least four amino acids is in portion 2 of the protease domain. In one embodiment, the replacement of at least four amino acids is D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is an enzymatically inactive SCPB, wherein the inactivation is achieved by substituting at least four amino acids of the wild-type sequence. Preferably, the substitution of at least four amino acids is in the protease domain. In one embodiment, the substitution of at least four amino acids is in portion 1 of the protease domain. In one embodiment, the substitution of at least four amino acids is in portion 2 of the protease domain. In one embodiment, the substitution of at least four amino acids is D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the replacement of at least four amino acids is in the protease domain. In one embodiment, the replacement of at least four amino acids is in portion 1 of the protease domain. In one embodiment, the replacement of at least four amino acids is in portion 2 of the protease domain. In one embodiment, the replacement of at least four amino acids is D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the at least four amino acid replacements are in the protease domain. In one embodiment, the at least four amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least four amino acid replacements are in portion 2 of the protease domain. In one embodiment, the at least four amino acid replacements are D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPA without enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the at least four amino acid replacements are in the protease domain. In one embodiment, the at least four amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least one amino acid replacement is in portion 2 of the protease domain. In one embodiment, the at least four amino acid replacements are D130A, H193A, N295A, and S512A.

In one embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCPB with no enzymatic activity, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains, but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by replacing at least four amino acids of the wild-type sequence. Preferably, the at least four amino acid replacements are in the protease domain. In one embodiment, the at least four amino acid replacements are in portion 1 of the protease domain. In one embodiment, the at least four amino acid replacements are in portion 2 of the protease domain. In one embodiment, the at least four amino acid replacements are D130A, H193A, N295A, and S512A.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of the non-enzymatically active SCP consisting of SEQ ID NO:41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of SCP with no enzymatic activity, consisting of SEQ ID NO:42.

SEQ ID NO: 41:

SEQ ID NO: 41 has a length of 950 amino acids.

SEQ ID NO: 42:

SEQ ID NO: 42 has a length of 949 amino acids.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 90% identity with SEQ ID NO: 41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 95% identity with SEQ ID NO: 41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99% identity with SEQ ID NO: 41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99.5% identity with SEQ ID NO: 41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99.8% identity with SEQ ID NO:41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99.85% identity with SEQ ID NO:41.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 90% identity with SEQ ID NO:42.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 95% identity with SEQ ID NO:42.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99% identity with SEQ ID NO:42.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99.5% identity with SEQ ID NO:42.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP composed of a polypeptide having at least 99.8% identity with SEQ ID NO:42.

In one particular embodiment, the carrier protein of the glycoconjugate of the present invention is a fragment of an enzymatically inactive SCP consisting of a polypeptide having at least 99.85% identity with SEQ ID NO:42.

2 Immunogenic Compositions

2.1 Combination of the sugar conjugates of the present invention

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention (as disclosed in section 1 above).

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising 1 to 25 different glycoconjugates.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising 1 to 25 glycoconjugates derived from different Streptococcus pneumoniae serotypes (1 to 25 Streptococcus pneumoniae conjugates). In one embodiment, the present invention relates to an immunogenic composition comprising glycoconjugates derived from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different Streptococcus pneumoniae serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates derived from 16 or 20 different Streptococcus pneumoniae serotypes. In one embodiment, the immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 14, 15, 16, 17, 18, or 19-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 16-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 19-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 20-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the immunogenic composition is a 21-, 22-, 23-, 24-, or 25-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition. In one embodiment, the immunogenic composition is a 25-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F. In one embodiment, the immunogenic composition is an 11-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F. In one embodiment, the immunogenic composition is a 13-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and further comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 15-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 20-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and further comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 2, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 2, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23B, 23F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and further comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23B, 23F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, and 33F. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, and 33F. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 33F, and 35B. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the immunogenic composition is a 25-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising glycoconjugates of the present invention selected from the group consisting of glycoconjugates of Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F and 38.

In one embodiment, the present invention relates to an immunogenic composition comprising glycoconjugates of the present invention selected from the group consisting of glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 21-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising twenty-one glycoconjugates selected from the group consisting of glycoconjugates of Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 22-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising at least one glycoconjugate selected from the group consisting of: glycoconjugates of Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 19A, 19F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F and 38.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising twenty-two glycoconjugates selected from the group consisting of glycoconjugates of Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 19A, 19F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising twenty-three glycoconjugates selected from the group consisting of: glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 19A, 19F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 24-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 9N, 15A, 17F, 20, 23A, 23B, 24F, and 35B. In one embodiment, the immunogenic composition is a 10-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 9N, 15A, 17F, 19A, 19F, 20, 23A, 23B, 24F, and 35B. In one embodiment, the immunogenic composition is a 12-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 23-valent Streptococcus pneumoniae conjugate composition.

In one embodiment, the present invention relates to an immunogenic composition comprising the glycoconjugate of the present invention and comprising glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 7C, 9N, 10B, 15A, 16F, 17F, 19A, 19F, 20, 21, 22A, 23A, 23B, 24B, 24F, 27, 29, 31, 33B, 34, 35B, 35F, and 38. In one embodiment, the immunogenic composition is a 25-valent Streptococcus pneumoniae conjugate composition.

In a preferred embodiment, each sugar is individually conjugated to a different molecule of the protein carrier (each molecule of the protein carrier has only one type of sugar conjugated to it). In this embodiment, capsular sugars are referred to as individually conjugated to the carrier protein. Preferably, all sugar conjugates of the above-described immunogenic composition are individually conjugated to the carrier protein.

In any one embodiment of the above-described immunogenic compositions, the glycoconjugate of the present invention is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, the glycoconjugate of the present invention is conjugated with SCP.

In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 22F is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 33F is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 15B is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 12F is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 10A is conjugated with CRM _197. In any one embodiment of the above-described immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 11A is conjugated with CRM ₁₉₇ . In any one embodiment of the above immunogenic compositions, a glycoconjugate from Streptococcus pneumoniae serotype 8 is conjugated with CRM _197. In any one embodiment of the above immunogenic compositions, glycoconjugates from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated with CRM _197. In any one embodiment of the above immunogenic compositions, glycoconjugates from Streptococcus pneumoniae serotypes 1, 5, and 7F are conjugated with CRM _197. In any one embodiment of the above immunogenic compositions, glycoconjugates from Streptococcus pneumoniae serotypes 6A and 19A are conjugated with CRM ₁₉₇ .

In any embodiment of the above-described immunogenic compositions, the glycoconjugate of each of the above-described immunogenic compositions is individually conjugated with CRM ₁₉₇ .

In any of the above-described immunogenic compositions, the glycoconjugate of the present invention is conjugated with SCP and the other glycoconjugates are individually conjugated with CRM ₁₉₇ .

In one embodiment, any of the above-described immunogenic compositions containing glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and/or 23F are individually conjugated to PD.

In one embodiment, any of the immunogenic compositions described above, a glycoconjugate derived from Streptococcus pneumoniae serotype 18C, is conjugated with TT.

In one embodiment, any of the immunogenic compositions described above, a glycoconjugate derived from Streptococcus pneumoniae serotype 19F, is conjugated with DT.

In one embodiment, the glycoconjugates of any of the above immunogenic compositions derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F are individually conjugated with PD, the glycoconjugate derived from Streptococcus pneumoniae serotype 18C is conjugated with TT, and the glycoconjugate derived from Streptococcus pneumoniae serotype 19F is conjugated with DT.

In one embodiment, the immunogenic composition comprises 8 to 25 different Streptococcus pneumoniae serotypes.

The compositions of the present invention may include a small amount of free carrier. When a given carrier protein is present in the compositions of the present invention in both free and conjugated forms, the unconjugated form preferably does not exceed 5% of the total amount of carrier protein in the composition, and more preferably is less than 2% by weight.

2.2 Dosage of the immunogenic composition of the present invention

The amount of glycoconjugate in each dose was selected to induce a protective immune response without significant adverse side effects in typical vaccine recipients. This amount will vary depending on the specific immunogen used and its delivery method.

The amount of a specific glycoconjugate in an immunogenic composition can be calculated based on the total sugars (conjugated and unconjugated sugars) of the conjugate. For example, in a 100 μg sugar dose, a glycoconjugate with 20% free sugars will have approximately 80 μg of conjugated sugars and approximately 20 μg of unconjugated sugars. The amount of glycoconjugate can vary depending on the bacteria and bacterial serotype. Sugar concentration can be determined by uronic acid analysis.

The "immunogenic amount" of different sugar components in the immunogenic composition may vary, and each may contain about 0.5 μg, about 0.75 μg, about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, or about 100 μg of any specific sugar antigen.

Generally, each dose will contain 0.1 μg to 100 μg of sugar. In one embodiment, each dose will contain 0.1 μg to 100 μg of sugar. In a preferred embodiment, each dose will contain 0.5 μg to 20 μg. In a preferred embodiment, each dose will contain 1.0 μg to 10 μg. In an even more preferred embodiment, each dose will contain 2.0 μg to 5.0 μg of serum-type 3 polysaccharide. Any integer within any of the above ranges is considered as an embodiment of the invention.

In one embodiment, each dose will contain about 0.5 μg of sugar. In one embodiment, each dose will contain about 0.55 μg of sugar. In one embodiment, each dose will contain about 0.75 μg of sugar. In one embodiment, each dose will contain about 1.0 μg of sugar. In one embodiment, each dose will contain about 1.1 μg of sugar. In one embodiment, each dose will contain about 1.5 μg of sugar. In one embodiment, each dose will contain about 2.0 μg of sugar. In one embodiment, each dose will contain about 2.2 μg of sugar. In one embodiment, each dose will contain about 2.5 μg of sugar. In one embodiment, each dose will contain about 3.0 μg of sugar. In one embodiment, each dose will contain about 3.5 μg of sugar. In one embodiment, each dose will contain about 4.0 μg of sugar. In one embodiment, each dose will contain about 4.4 μg of sugar. In one embodiment, each dose will contain about 5.0 μg of sugar. In one embodiment, each dose will contain about 5.5 μg of sugar. In one implementation, each dose will contain approximately 6.0 μg of sugar.

Generally, each dose will contain 0.1 μg to 100 μg of sugar against a given bacterium or serotype. In one embodiment, each dose will contain 0.1 μg to 100 μg of sugar against a given bacterium or serotype. In a preferred embodiment, each dose will contain 0.5 μg to 20 μg. In a preferred embodiment, each dose will contain 1.0 μg to 10 μg. In an even more preferred embodiment, each dose will contain 2.0 μg to 5.0 μg of sugar against a given bacterium or serotype. Any integer within any of the above ranges is considered as an embodiment of the invention.

In one embodiment, each dose will contain about 0.5 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 0.55 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 0.75 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 1.0 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 1.1 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 1.5 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 2.0 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 2.2 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 2.5 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 3.0 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 3.5 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 4.0 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 4.4 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 5.0 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 5.5 μg of sugar for each specific glycoconjugate. In one embodiment, each dose will contain about 6.0 μg of sugar for each specific glycoconjugate.

2.3 Carrier quantity

Generally, each dose will contain 10 μg to 150 μg of carrier protein, particularly 15 μg to 100 μg of carrier protein, even more particularly 25 μg to 75 μg of carrier protein, and even more particularly 40 μg to 60 μg of carrier protein. In one embodiment, the carrier protein is CRM _197. In one embodiment, the carrier protein is SCP.

In one embodiment, each dose will comprise approximately 10 μg, approximately 15 μg, approximately 20 μg, approximately 25 μg, approximately 26 μg, approximately 27 μg, approximately 28 μg, approximately 29 μg, approximately 30 μg, approximately 31 μg, approximately 32 μg, approximately 33 μg, approximately 34 μg, approximately 35 μg, approximately 36 μg, approximately 37 μg, approximately 38 μg, approximately 39 μg, approximately 40 μg, approximately 41 μg, approximately 42 μg, approximately 43 μg, approximately 44 μg, approximately 45 μg, approximately 46 μg, approximately 47 μg, approximately... Carrier protein in 48 μg, approximately 49 μg, approximately 50 μg, approximately 51 μg, approximately 52 μg, approximately 53 μg, approximately 54 μg, approximately 55 μg, approximately 56 μg, approximately 57 μg, approximately 58 μg, approximately 59 μg, approximately 60 μg, approximately 61 μg, approximately 62 μg, approximately 63 μg, approximately 64 μg, approximately 65 μg, approximately 66 μg, approximately 67 μg, approximately 68 μg, approximately 69 μg, approximately 70 μg, approximately 71 μg, approximately 72 μg, approximately 73 μg, approximately 74 μg, or approximately 75 μg.

In one embodiment, each dose will comprise approximately 25 μg, approximately 26 μg, approximately 27 μg, approximately 28 μg, approximately 29 μg, approximately 30 μg, approximately 31 μg, approximately 32 μg, approximately 33 μg, approximately 34 μg, approximately 35 μg, approximately 36 μg, approximately 37 μg, approximately 38 μg, approximately 39 μg, approximately 40 μg, approximately 41 μg, approximately 42 μg, approximately 43 μg, approximately 44 μg, approximately 45 μg, approximately 46 μg, approximately 47 μg, approximately 48 μg, approximately 49 μg. Carrier protein in g, approximately 50 μg, approximately 51 μg, approximately 52 μg, approximately 53 μg, approximately 54 μg, approximately 55 μg, approximately 56 μg, approximately 57 μg, approximately 58 μg, approximately 59 μg, approximately 60 μg, approximately 61 μg, approximately 62 μg, approximately 63 μg, approximately 64 μg, approximately 65 μg, approximately 66 μg, approximately 67 μg, approximately 68 μg, approximately 69 μg, approximately 70 μg, approximately 71 μg, approximately 72 μg, approximately 73 μg, approximately 74 μg, or approximately 75 μg.

In one embodiment, each dose will contain approximately 30 μg of the carrier protein. In one embodiment, each dose will contain approximately 31 μg of the carrier protein. In one embodiment, each dose will contain approximately 32 μg of the carrier protein. In one embodiment, each dose will contain approximately 33 μg of the carrier protein. In one embodiment, each dose will contain approximately 34 μg of the carrier protein. In one embodiment, each dose will contain approximately 45 μg of the carrier protein.

In one embodiment, each dose will contain approximately 40 μg of the carrier protein. In one embodiment, each dose will contain approximately 41 μg of the carrier protein. In one embodiment, each dose will contain approximately 42 μg of the carrier protein. In one embodiment, each dose will contain approximately 43 μg of the carrier protein. In one embodiment, each dose will contain approximately 44 μg of the carrier protein. In one embodiment, each dose will contain approximately 45 μg of the carrier protein.

In one embodiment, each dose will contain approximately 48 μg of the carrier protein. In one embodiment, each dose will contain approximately 49 μg of the carrier protein. In one embodiment, each dose will contain approximately 50 μg of the carrier protein. In one embodiment, each dose will contain approximately 51 μg of the carrier protein. In one embodiment, each dose will contain approximately 52 μg of the carrier protein. In one embodiment, each dose will contain approximately 53 μg of the carrier protein.

In one embodiment, the carrier protein is CRM ₁₉₇ .

In one implementation, the carrier protein is SCP.

2.4 Other antigens

The immunogenic composition of the present invention comprises a conjugated glycoantigen (glycoconjugate). It may further comprise antigens from other pathogens, particularly bacteria and/or viruses. Preferred other antigens are selected from: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P) (which is typically acellular (Pa)), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular sugar (Hib), and inactivated poliovirus vaccine (IPV).

In one embodiment, the immunogenic composition of the present invention comprises D-T-Pa. In one embodiment, the immunogenic composition of the present invention comprises D-T-Pa-Hib, D-T-Pa-IPV, or D-T-Pa-HBsAg. In one embodiment, the immunogenic composition of the present invention comprises D-T-Pa-HBsAg-IPV or D-T-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition of the present invention comprises D-T-Pa-HBsAg-IPV-Hib.

Pertussis antigen: Bordetella pertussis causes pertussis. The pertussis antigen in the vaccine is either cellular (whole-celled, in the form of inactivated Bordetella pertussis cells) or acellular. The preparation of cellular pertussis antigen is well documented (e.g., it can be obtained by heat inactivation of a stage I culture of Bordetella pertussis). However, the present invention preferably uses acellular antigen. When using acellular antigen, it is preferred to use one, two, or (preferably) all of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid or PT); (2) filamentous hemagglutinin (FHA); (3) pertussis adhesin (also known as 69 kDalton outer membrane protein). FHA and pertussis adhesin can be treated with formaldehyde before use according to the present invention. PT is preferably detoxified by treatment with formaldehyde and/or glutaraldehyde. Acellular pertussis antigen is preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, it can be added in an unadsorbed state. When pertussis adhesin is added, it is preferably already adsorbed onto aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto aluminum hydroxide adjuvant or aluminum phosphate. Most preferably, PT, FHA, and pertussis adhesin are all adsorbed onto aluminum hydroxide.

Inactivated poliovirus vaccine: Poliovirus causes poliomyelitis. A preferred embodiment of the invention uses IPV instead of an oral poliovirus vaccine. The poliovirus must be inactivated before administration to a patient, which can be achieved by treatment with formaldehyde. Polio can be caused by one of three types of poliovirus. The three types are similar and cause the same symptoms, but they differ antigenically, and infection with one type does not prevent infection with the others. Therefore, it is preferred to use the three poliovirus antigens of the present invention: poliovirus type 1 (e.g., Mahoney virus strain), poliovirus type 2 (e.g., MEF-1 virus strain), and poliovirus type 3 (e.g., Saukett virus strain). The viruses are preferably grown, purified, and inactivated separately, and then combined to obtain the main trivalent mixture used in the present invention.

Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxoids can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoids can be obtained by growing Corynebacterium diphtheriae in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoid material can then be treated by methods involving sterile filtration and/or dialysis. Diphtheria toxoids are preferably adsorbed onto aluminum hydroxide adjuvant.

Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to obtain a protective toxoid. The toxoid is used in tetanus vaccines. Preferably, tetanus toxoids are those prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing Clostridium tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The substance can then be processed using methods involving sterile filtration and/or dialysis.

Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known factors that cause viral hepatitis. Preferably, the HAV component is based on inactivated virus, and inactivation can be achieved through formalin treatment.

Hepatitis B virus (HBV) is one of the known agents that causes viral hepatitis. The main component of its capsid is a protein known as HBV surface antigen, or more commonly as HBsAg, which is typically a 226-amino acid polypeptide with a molecular weight of approximately 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to regularly vaccinated individuals, it stimulates the production of anti-HBsAg antibodies to prevent HBV infection.

For vaccine manufacturing, HBsAg is prepared in two ways: by purifying the antigen in particulate form from the plasma of chronic hepatitis B carriers, or by expressing the protein via recombinant DNA methods (e.g., recombinant expression in yeast cells). Unlike natural HBsAg (i.e., as in plasma-purified products), yeast-expressed HBsAg is typically unglycosylated, and this is the most preferred form of HBsAg used in this invention.

Conjugated Haemophilus influenzae type b antigen: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular sugar antigens, and their preparation is well-documented. Hib sugars can conjugate with carrier proteins to enhance their immunogenicity, especially in children. Typical carrier proteins include tetanus toxoid, diphtheria toxoid, CRM ₁₉₇ , Haemophilus influenzae protein D, and outer membrane protein complexes from serogroup B meningococci. The sugar portion of the conjugate may contain full-length polyribosylribitol phosphate (PRP) and/or fragments of full-length PRP prepared from Hib bacteria. Hib conjugates may or may not adsorb to aluminum salt adjuvants.

2.5 Adjuvant

In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one, two, or three adjuvants. In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one adjuvant. In some embodiments, the immunogenic compositions disclosed herein may further comprise one adjuvant. In some embodiments, the immunogenic compositions disclosed herein may further comprise two adjuvants. The term "adjuvant" refers to a compound or mixture that enhances an immune response against an antigen. An antigen may primarily serve as a delivery system, primarily as an immunomodulator, or possess strong characteristics of both.

Suitable adjuvants include those suitable for mammals (including humans). Examples of adjuvants known to be suitable for human use include (but are not limited to) alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions (such as MF59) (4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)), water-in-oil emulsions (such as Montanide), and poly(D,L-lactide-co-glycolic acid) (PLG) microparticles or nanoparticles.

In one embodiment, the immunogenic composition disclosed herein comprises an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a preferred embodiment, the immunogenic composition disclosed herein comprises aluminum phosphate or aluminum hydroxide as an adjuvant. In a preferred embodiment, the immunogenic composition disclosed herein comprises aluminum phosphate as an adjuvant.

Other exemplary adjuvants that enhance the effectiveness of the immunogenic compositions disclosed herein include (but are not limited to): (1) oil-in-water emulsion formulations (with or without other specific immunostimulants, such as cell wall peptides (see below) or bacterial cell wall components), such as (a) SAF, which contains 10% squalene, 0.4% Tween 80, 5% Pronicotinic block polymer L121 and thr-MDP microfluidized into submicron-sized emulsions or vortexed to produce larger particle size emulsions, and (b) the RIBI ^™ adjuvant system (RAS) (Ribi Immunochem, Hamilton, MT), which contains 2% squalene, 0.2% Tween 80 and one or more bacterial cell wall components (such as monophosphoryl lipid A (MPL), trehalose dimethicone ester (TDM) and cell wall skeleton (CWS), preferably MPL+CWS (DETOX ^™) . (2) Saponin adjuvants, such as QS21, STIMULON ^™ (Cambridge Bioscience, Worcester, MA), (Isconova, Sweden) or (Commonwealth Serum Laboratories, Australia), or particles derived therefrom, such as ISCOMs (immunostimulatory complexes), which may be free of additional detergents (e.g., WO 00/07621); (3) Freund's complete adjuvant (CFA) and Freund's incomplete adjuvant (IFA); (4) Cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 00/07621)). (99/44636)), interferon (e.g., gamma interferon), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) (see, for example, GB-2220221, EP0689454), optionally substantially free of alum when used with Streptococcus pneumoniae sugar (see, for example, WO 00/56358); (6) 3dMPL in combination with, for example, QS21 and/or oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ether or polyoxyethylene ester (see, for example, WO 99/52549); (8) polyoxyethylene dehydrated sorbitol ester surfactant in combination with octylbenzyl alcohol (e.g., WO (9) Saponins and immunostimulating oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO 00/62800); (10) Immunostimulants and metal salt particles (see, for example, WO 00/23105); (11) Saponins and oil-in-water emulsions (e.g., WO 99/11241); (12) Saponins (e.g., QS21) + 3dMPL + IM2 (if applicable + sterol) (e.g., WO 01/21207) or polyoxyethylene alkyl ether or ester surfactants (e.g., WO 01/21152); (13) Saponins and oil-in-water emulsions (e.g., WO 99/11241); (14) Saponins (e.g., QS21) + 3dMPL + IM2 (if applicable + sterol) (e.g., WO 01/21207) or polyoxyethylene alkyl ether or ester surfactants (e.g., WO 01/21152); (15) Saponins and immunostimulating oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO 00/62800); (15) Immunostimulants and metal salt particles (see, for example, WO 00/23105); (16) Saponins and oil-in-water emulsions (e.g., WO 99/11241); (17) Saponins (e.g., QS21) + 3dMPL + IM2 (if applicable + sterol) (e.g., WO 00/21207) or polyoxyethylene alkyl ether or ester surfactants (e.g., WO 00/2120 98/57659); (13) Other substances that act as immunostimulants to enhance the efficacy of the composition. Cell wall peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetyl-muramyl-L-alanyl-D-isoglutamine-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycerol-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.

In one embodiment of the invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to immunostimulatory CpG oligodeoxynucleotide (CpGODN), and therefore these terms are used interchangeably unless otherwise indicated. An immunostimulatory CpG oligodeoxynucleotide contains one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, depending on certain preferred base backgrounds. The methylation state of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide containing a 5' unmethylated cytosine linked to 3' guanine via a phosphate ester bond and activating the immune system via binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system via TLR9 but not as strongly as unmethylated CpG motifs. CpG immunostimulatory oligonucleotides may comprise one or more palindromic sequences and may also comprise CpG dinucleotides. CpG oligonucleotides have been described in numerous published patents, patent applications, and other publications, including U.S. Patents 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068. In one embodiment of the invention, the immunogenic composition disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO 2010/125480.

Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C, and P, and are described in more detail on page 3, line 22 to page 12, line 36 of WO 2010/125480. The method of this invention covers the use of these different classes of CpG immunostimulatory oligonucleotides.

In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a class A CpG oligonucleotide. Preferably, the class A CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO:1). Some non-limiting examples of class A oligonucleotides include: 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO:2); wherein "*" refers to a phosphate thioester bond and "_" refers to a phosphodiester bond.

In one embodiment of the invention, the immunogenic composition disclosed herein comprises a class B CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the invention is a class B CpG oligonucleotide represented by at least the following formula: 5' × ₁ × ₂ CG _{× 3} × ₄ 3', wherein X1, X2, X3, and X4 are nucleotides. In one embodiment, _X2 is adenine, guanine, or thymine. In another embodiment, _X3 is cytosine, adenine, or thymine.

The class B CpG oligonucleotide sequences of this invention are those generally described above and disclosed in the following documents: WO 96/02555, WO 98/18810, and U.S. Patents 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068. Exemplary sequences include (but are not limited to) those disclosed in these subsequent applications and patents.

In one embodiment, the "Type B" CpG oligonucleotide of the present invention has the following nucleic acid sequence:

5'TCGTCGTTTTTCGGTGCTTT 3'(SEQ ID NO:3), or

5'TCGTCGTTTTTCGGTCGTTTT 3'(SEQ ID NO:4), or

5'TCGTCGTTTTGTCGTTTTGTCGTT 3'(SEQ ID NO:5), or

5'TCGTCGTTTCGTCGTTTTGTCGTT 3'(SEQ ID NO:6), or

5'TCGTCGTTTTGTCGTTTTTTTCGA 3'(SEQ ID NO:7).

In any of these sequences, all linkages may be thiophosphate bonds. In another embodiment, in any of these sequences, one or more linkages may be phosphodiesters, preferably forming a semi-soft CpG oligonucleotide between the "C" and "G" of the CpG motif. In any of these sequences, ethyl-uridine or halogen may substitute 5'T; examples of halogen substitution include (but are not limited to) bromo-uridine or iodo-uridine substitution.

Some non-limiting examples of class B oligonucleotides include:

5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3'(SEQ ID NO:8), or

5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3'(SEQ ID NO:9), or

5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:10), or

5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:11), or

5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3'(SEQ ID NO:12).

The asterisk (*) indicates a thiophosphate bond.

In one embodiment of the invention, the immunogenic composition disclosed herein comprises a class C CpG oligonucleotide. In one embodiment, the class C CpG oligonucleotide of the invention has the following nucleic acid sequence:

5'TCGCGTCGTTCGGCGCGCGCCG 3'(SEQ ID NO:13), or

5'TCGTCGACGTTCGGCGCGCGCCG 3'(SEQ ID NO:14), or

5'TCGGACGTTCGGCGCGCGCCG 3'(SEQ ID NO:15), or

5'TCGGACGTTCGGCGCGCCG 3'(SEQ ID NO:16), or

5'TCGCGTCGTTCGGCGCGCCG 3'(SEQ ID NO:17), or

5'TCGACGTTCGGCGCGCGCCG 3'(SEQ ID NO:18), or

5'TCGACGTTCGGCGCGCCG 3'(SEQ ID NO:19), or

5'TCGCGTCGTTCGGCGCCG 3'(SEQ ID NO:20), or

5'TCGCGACGTTCGGCGCGCGCCG 3'(SEQ ID NO:21), or

5'TCGTCGTTTTCGGCGCGCGCCG 3'(SEQ ID NO:22), or

5'TCGTCGTTTTCGGCGGCCGCCG 3'(SEQ ID NO:23), or

5'TCGTCGTTTTACGGCGCCGTGCCG 3'(SEQ ID NO:24), or

5'TCGTCGTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).

In any of these sequences, all linkages may be phosphate thioester bonds. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester bonds, preferably between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide.

Some non-limiting examples of class C oligonucleotides include:

5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(SEQ ID NO:26), or

5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:27), or

5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:28), or

5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:29), or

5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:30), or

5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:31), or

5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:32), or

5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3'(SEQ ID NO:33), or

5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3'(SEQ ID NO:34), or

5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G3'(SEQ ID NO:35), or

5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G3'(SEQ ID NO:36), or

5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3'(SEQ ID NO:37), or

5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3'(SEQ ID NO:38)

The asterisk (*) refers to a thiophosphate bond, and the underscore (_) refers to a phosphate diester bond.

In any of these sequences, ethyl-uridine or halogen may replace 5'T; examples of halogen substitution include (but are not limited to) bromo-uridine or iodo-uridine substitution.

In one embodiment of the invention, the immunogenic composition disclosed herein comprises a class P CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the invention is a class P CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, each palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected directly or via a spacer to a 3' palindromic region of at least 8 nucleotides in length, wherein the oligonucleotide comprises at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In one embodiment, the class P CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment, the TLR activation domain is located within the 5' palindrome. In yet another embodiment, the TLR activation domain is immediately adjacent to the 5' of the 5' palindrome. In one embodiment, the "P-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).

In the sequence, all linkages may be thiophosphate bonds. In another embodiment, one or more of the linkages may be phosphodiesters, preferably forming a semi-soft CpG oligonucleotide between the "C" and "G" of the CpG motif. In any of these sequences, ethyl-uridine or halogen may replace 5'T; examples of halogen substitution include (but are not limited to) bromo-uridine or iodo-uridine substitution.

Non-limiting examples of class P oligonucleotides include:

5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:40)

The asterisk (*) refers to a thiophosphate bond, and the underscore (_) refers to a phosphate diester bond.

In one embodiment, the oligonucleotide includes at least one phosphate thioester linker. In another embodiment, all nucleotide links between the oligonucleotides are phosphate thioester links. In another embodiment, the oligonucleotide includes at least one phosphodiester-like linker. In another embodiment, the phosphodiester-like linker is a phosphodiester linker. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

In one embodiment, all nucleotides of the CpG oligonucleotides disclosed herein are linked by phosphodiester bonds (“soft” oligonucleotides, as described in WO 2007/026190). In another embodiment, the CpG oligonucleotides of the present invention are resistant to degradation (e.g., stable). “Stable oligonucleotide” refers to an oligonucleotide that is relatively resistant to intracellular degradation (e.g., in vivo degradation via exonucleases or endonucleases). Nucleic acid stability can be achieved through backbone modification. Oligonucleotides with phosphate thioester linkages provide maximum activity and prevent degradation by intracellular exonucleases and endonucleases.

Immunostimulatory oligonucleotides may have a chimeric backbone consisting of a combination of phosphodiester links and phosphate thioester links. For the purposes of this invention, a chimeric backbone refers to a partially stable backbone in which at least one nucleotide link is a phosphodiester link or a phosphodiester-like link, and at least one other nucleotide link is a stable nucleotide link, wherein at least one phosphodiester link or phosphodiester-like link differs from at least one stable link. When the phosphodiester link is preferentially located within a CpG motif, such molecules are referred to as “semi-soft,” as described in WO 2007/026190.

Other modified oligonucleotides include phosphodiester, thiophosphate, methylphosphonate, methylthiophosphate, dithiophosphate, and/or combinations linked to ethoxy groups.

ODNs with hybrid main chain modifications can be synthesized as described in WO 2007/026190.

The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along its length) also contributes to its stimulatory activity. To facilitate absorption into cells, the CpG oligonucleotides of this invention preferably have a minimum length of 6 nucleotide residues. In the presence of sufficient immunostimulatory motifs, oligonucleotides of any size (even many kb long) larger than 6 nucleotides can induce an immune response, as larger oligonucleotides degrade intracellularly. In some embodiments, the CpG oligonucleotide is 6 to 100 nucleotides long, preferably 8 to 30 nucleotides long. In an important embodiment, the nucleic acids and oligonucleotides of this invention are not plasmids or expression vectors.

In one embodiment, the CpG oligonucleotides disclosed herein contain substitutions or modifications, such as substitutions or modifications of bases and/or sugars as described in paragraphs 134 to 147 of WO2007/026190.

In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker et al. (1995) Mod. Synth. Methods 7:331-417. The oligonucleotide of the present invention may have one or more modifications, wherein each modification is located at a specific phosphodiester nucleoside bridge and/or a specific β-D-ribose unit and/or a specific native nucleoside base position, compared to an oligonucleotide having the same sequence as that composed of natural DNA or RNA.

In some embodiments of the present invention, the CpG-containing nucleic acid can be simply mixed with an immunogenic vector according to methods known to those skilled in the art (see, for example, WO 03/024480).

In one specific embodiment of the invention, any of the immunogenic compositions disclosed herein comprises 2 μg to 100 mg of CpG oligonucleotides. In one specific embodiment of the invention, the immunogenic composition of the present invention comprises 0.1 mg to 50 mg of CpG oligonucleotides, preferably 0.2 mg to 10 mg of CpG oligonucleotides, more preferably 0.3 mg to 5 mg of CpG oligonucleotides. In one specific embodiment of the invention, the immunogenic composition of the present invention comprises 0.3 mg to 5 mg of CpG oligonucleotides. Even more preferably, the immunogenic composition of the present invention may comprise 0.5 to 2 mg of CpG oligonucleotides. Most preferably, the immunogenic composition of the present invention may comprise 0.75 to 1.5 mg of CpG oligonucleotides. In a preferred embodiment, any of the immunogenic compositions disclosed herein may comprise about 1 mg of CpG oligonucleotides.

3 formulations

The immunogenic compositions of the present invention can be formulated into liquid form (i.e., solution or suspension) or lyophilized form. In one embodiment, the immunogenic compositions of the present invention are formulated into liquid form. In another embodiment, the immunogenic compositions of the present invention are formulated into lyophilized form. Liquid formulations can be advantageously administered directly from their packaging form and are therefore ideal for injection, as they do not require reconstitution in an aqueous medium as the lyophilized compositions of the present invention do.

The immunogenic compositions of the present invention can be formulated using methods recognized in the art. For example, individual polysaccharides and/or conjugates can be formulated together with physiologically acceptable solvents to prepare the compositions. Examples of such solvents include (but are not limited to) water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextran solutions.

The present invention provides an immunogenic composition comprising any combination of the glycoconjugates disclosed herein and a pharmaceutically acceptable excipient, carrier, or diluent.

In one embodiment, the immunogenic composition of the present invention is in liquid form, preferably in aqueous liquid form.

The immunogenic compositions of the present invention may comprise one or more of the following: buffer solutions, salts, divalent cations, nonionic detergents, cryoprotectants (such as sugars), and antioxidants (such as free radical scavengers or chelating agents) or any combination thereof.

In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is a phosphate, succinate, histidine, or citrate. In some embodiments, the buffer is a succinate. In some embodiments, the buffer is histidine. In some embodiments, the buffer is a succinate at a final concentration of 1 mM to 10 mM. In a particular embodiment, the final concentration of the succinate buffer is about 5 mM.

In one embodiment, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In a particular embodiment, the salt is sodium chloride. In a particular embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.

In one embodiment, the immunogenic composition of the present invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of: polysorbate 20 (TWEEN ^™ 20), polysorbate 40 (TWEEN ^™ 40), polysorbate 60 (TWEEN ^™ 60), polysorbate 65 (TWEEN ^™ 65), polysorbate 80 (TWEEN ^™ 80), polysorbate 85 (TWEEN ^™ 85), TRITON ^™ N-101, TRITON ^™ X-100, octylbenzenesilol 40, nonylbenzeneol ether-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H15), polyoxyethylene-35-ricinoleate (EL), soybean lecithin, and poloxamer.

In one particular embodiment, the surfactant is polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.02% (w/w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.01% (w/w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.03% (w/w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.04% (w/w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.05% (w/w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% (w/w) polysorbate 80.

In one particular embodiment, the surfactant is polysorbate 20. In some embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 20. In some embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 20. In some embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 20. In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.02% (w/w) polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.01% (w/w) polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.03% (w/w) polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.04% (w/w) polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.05% (w/w) polysorbate 20. In another embodiment, the final concentration of polysorbate 20 in the formulation is 1% (w/w) polysorbate 20.

In one particular embodiment, the surfactant is polysorbate 40. In some embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 40. In some embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 40. In some embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 40. In other embodiments, the final concentration of polysorbate 40 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 40. In another embodiment, the final concentration of polysorbate 40 in the formulation is 1% (w/w) polysorbate 40.

In one particular embodiment, the surfactant is polysorbate 60. In some embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 60. In some embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 60. In some embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 60. In other embodiments, the final concentration of polysorbate 60 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 60. In another embodiment, the final concentration of polysorbate 60 in the formulation is 1% (w/w) polysorbate 60.

In one particular embodiment, the surfactant is polysorbate 65. In some embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 65. In some embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 65. In some embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 65. In other embodiments, the final concentration of polysorbate 65 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 65. In another embodiment, the final concentration of polysorbate 65 in the formulation is 1% (w/w) polysorbate 65.

In one particular embodiment, the surfactant is polysorbate 85. In some embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.0001% to 10% by weight (w/w) of polysorbate 85. In some embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.001% to 1% by weight (w/w) of polysorbate 85. In some embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.01% to 1% by weight (w/w) of polysorbate 85. In other embodiments, the final concentration of polysorbate 85 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w/w) of polysorbate 85. In another embodiment, the final concentration of polysorbate 85 in the formulation is 1% (w/w) polysorbate 85.

In some embodiments, the immunogenic composition of the present invention has a pH of 5.5 to 7.5, more preferably 5.6 to 7.0, and even more preferably 5.8 to 6.0.

In one embodiment, the present invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of vials, syringes, flasks, fermenters, bioreactors, bags, wide-mouth bottles, ampoules, cartridges, and disposable pens. In some embodiments, the container is siliconized.

In one embodiment, the container of the present invention is made of glass, metal (e.g., steel, stainless steel, aluminum, etc.) and/or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer). In one embodiment, the container of the present invention is made of glass.

In one embodiment, the present invention provides a syringe filled with any of the immunogenic compositions disclosed herein. In some embodiments, the syringe is siliconized and/or made of glass.

A typical dose of the immunogenic composition of the present invention for injection has a volume of 0.1 mL to 2 mL. In one embodiment, the immunogenic composition of the present invention for injection has a volume of 0.2 mL to 1 mL, or even more preferably about 0.5 mL.

4. Uses of the glycoconjugates and immunogenic compositions of the present invention

The glycoconjugates disclosed herein can be used as antigens. For example, they can be part of a vaccine.

Therefore, in one embodiment, the immunogenic composition of the present invention is suitable as a medicine.

In one embodiment, the immunogenic composition of the present invention is suitable for use as a vaccine.

Therefore, in one embodiment, the immunogenic composition described herein is suitable for inducing an immune response in an individual. In one aspect, the individual is a mammal, such as a human, a non-human primate, a cat, a sheep, a pig, a horse, a bovine animal, or a dog. In another aspect, the individual is a human.

The immunogenic compositions described herein can be used in therapeutic or preventative methods for preventing, treating, or improving bacterial infections, diseases, or symptoms in an individual. Therefore, in one aspect, the present invention provides a method for preventing, treating, or improving an individual's infection, disease, or symptoms associated with a bacterial infection, comprising administering to the individual an immunogenically effective amount of the immunogenic composition of the present invention.

The immunogenic composition of the present invention can be used to protect or treat humans susceptible to bacterial infections by administration via systemic or mucosal routes. In one embodiment, the immunogenic composition of the present invention is administered via intramuscular, intraperitoneal, intradermal, or subcutaneous routes. In one embodiment, the immunogenic composition of the present invention is administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In one embodiment, the immunogenic composition of the present invention is administered by intramuscular or subcutaneous injection. In one embodiment, the immunogenic composition of the present invention is administered by intramuscular injection. In one embodiment, the immunogenic composition of the present invention is administered by subcutaneous injection.

5 Individuals to be treated with the immunogenic composition of the present invention

As disclosed herein, the immunogenic compositions described herein can be used in various therapeutic or preventive methods for the prevention, treatment, or improvement of bacterial infections, diseases, or symptoms in an individual.

In a preferred embodiment, the individual is a human. In a most preferred embodiment, the individual is a newborn (i.e., less than three months old), an infant (i.e., aged three months to one year), or a toddler (i.e., aged one to four years).

In one embodiment, the immunogenic compositions disclosed herein are suitable for use as vaccines.

In such embodiments, the individual to be vaccinated may be less than 1 year old. For example, the individual to be vaccinated may be about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 months old. In one embodiment, the individual to be vaccinated is about 2, about 4, or about 6 months old. In another embodiment, the individual to be vaccinated is less than 2 years old. For example, the individual to be vaccinated may be from about 12 months to about 15 months old. In some cases, as few as one dose of the immunogenic composition according to the invention is required, but in some cases, a second, third, or fourth dose may be given (see section 8 below).

In one embodiment of the invention, the individual to be vaccinated is a human adult aged 50 years or older, more preferably a human adult aged 55 years or older. In another embodiment, the individual to be vaccinated is a human adult aged 65 years or older, 70 years or older, 75 years or older, or 80 years or older.

In one implementation plan, the individuals to be vaccinated are immunocompromised individuals, particularly humans. Immunocompromised individuals are generally defined as those who exhibit a weakened or reduced capacity to establish normal humoral or cellular defenses against infectious agents.

In one embodiment of the present invention, the immunocompromised individual to be vaccinated suffers from a disease or condition that weakens the immune system and causes insufficient antibody response to prevent or treat pneumococcal disease.

In one embodiment, the disease is a primary immunodeficiency disorder. Preferably, the primary immunodeficiency disorder is selected from the group consisting of: combined T-cell and B-cell immunodeficiency, antibody deficiency, well-defined syndromes, immune dysregulation disorders, phagocytic disorders, congenital immunodeficiency, autoinflammatory diseases, and complement deficiency. In one embodiment, the primary immunodeficiency disorder is selected from the diseases disclosed on page 24, line 11 to page 25, line 19 of WO 2010/125480.

In one particular embodiment of the present invention, the immunocompromised individual to be vaccinated suffers from a disease selected from the group consisting of: HIV infection, acquired immunodeficiency syndrome (AIDS), cancer, chronic heart or lung disease, congestive heart failure, diabetes, chronic liver disease, alcoholism, cirrhosis, cerebrospinal fluid leakage, cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive pulmonary disease (COPD), splenic dysfunction (such as sickle cell disease), aplasia (asplenia), hematologic malignancies, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, renal failure, nephrotic syndrome, and asthma.

In one embodiment of the present invention, the immunocompromised individual to be vaccinated suffers from malnutrition.

In one specific embodiment of the invention, an immunocompromised individual to be vaccinated takes a drug that reduces the body's resistance to infection or undergoes treatment that reduces the body's resistance to infection. In one embodiment, the drug is selected from those disclosed on page 26, lines 33 to 4 of WO 2010/125480.

In one particular embodiment of the present invention, the immunocompromised individual to be vaccinated is a smoker.

In one specific embodiment of the present invention, the immunocompromised individual to be vaccinated has the following white blood cell count: less than 5 × ^10⁹ cells/L, or less than 4 × ^10⁹ cells/L, or less than 3 × ^10⁹ cells/L, or less than 2 × ^10⁹ cells/L, or less than 1 × ^10⁹ cells/L, or less than 0.5 × ^10⁹ cells/L, or less than 0.3 × ^10⁹ cells/L, or less than 0.1 × ^10⁹ cells/L.

White blood cell count (WBC): The number of white blood cells (WBCs) in the blood. WBC is usually measured as part of the CBC (complete blood count). White blood cells are infection-fighting cells in the blood and are different from the red (oxygenated) blood cells called red blood cells. There are different types of white blood cells, including neutrophils (polymorphonuclear leukocytes; PMNs), band cells (slightly immature neutrophils), T lymphocytes (T cells), B lymphocytes (B cells), monocytes, eosinophils, and basophils. All types of white blood cells are reflected in the white blood cell count. The normal range for white blood cell count is usually between 4,300 and 10,800 cells per cubic millimeter of blood. This is also called the white blood cell count and can be expressed in international units as 4.3–10.8 × ^10⁹ cells per liter.

In one specific embodiment of the present invention, the immunocompromised individual to be vaccinated suffers from neutropenia. In another specific embodiment of the present invention, the immunocompromised individual to be vaccinated has a neutrophil count of less than 2 × ^10⁹ cells/L, or less than 1 × ^10⁹ cells/L, or less than 0.5 × ^10⁹ cells/L, or less than 0.1 × ^10⁹ cells/L, or less than 0.05 × ^10⁹ cells/L.

A low white blood cell count, or neutropenia, is a condition characterized by an abnormally low number of neutrophils in the circulating blood. Neutrophils are a specific type of white blood cell that helps prevent and fight infection. The most common reason cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases the risk of infection and interferes with cancer treatment.

In one specific embodiment of the present invention, the immunocompromised individual to be vaccinated has a CD4+ cell count of less than 500/ ^mm³ , or less than 300/ ^mm³ , or less than 200/ ^mm³ , less than 100/ ^mm³ , less than 75/ ^mm³ , or less than 50/ ^mm³ .

CD4 cell counts are typically reported as the number of cells per ^mm³ . Normal CD4 counts are between 500 and 1,600, and CD8 counts are between 375 and 1,100. CD4 counts are significantly reduced in people with HIV.

In one embodiment of the invention, any of the immunocompromised individuals disclosed herein is a male human. In one embodiment of the invention, any of the immunocompromised individuals disclosed herein is a female human.

6 schemes

In some cases, as few as one dose of the immunogenic composition according to the invention is required, but in other cases, such as under conditions of high immunodeficiency, a second, third, or fourth dose may be administered. Following the initial vaccination, an individual may receive one or more booster immunizations at appropriate intervals.

In one embodiment, the vaccination schedule of the immunogenic composition according to the invention is a single dose. In a particular embodiment, the single-dose schedule is for healthy individuals at least 2 years of age.

In one embodiment, the vaccination schedule of the immunogenic composition according to the invention is a multi-dose schedule. In a particular embodiment, the multi-dose schedule consists of a series of two doses spaced approximately one month to two months apart. In another particular embodiment, the multi-dose schedule consists of a series of two doses spaced approximately one month apart, or a series of two doses spaced approximately two months apart.

In another embodiment, the multi-dose schedule consists of a series of three doses spaced approximately one month to two months apart. In yet another embodiment, the multi-dose schedule consists of a series of three doses spaced approximately one month apart, or a series of three doses spaced approximately two months apart.

In another embodiment, the multiple-dose schedule consists of a series of three doses spaced approximately one month to two months apart, followed by a fourth dose approximately 10 to 13 months after the first dose. In another embodiment, the multiple-dose schedule consists of a series of three doses spaced approximately one month apart, followed by a fourth dose approximately 10 to 13 months after the first dose, or a series of three doses spaced approximately two months apart, followed by a fourth dose approximately 10 to 13 months after the first dose.

In one implementation, the multi-dose schedule consists of at least one dose (e.g., 1, 2, or 3 doses) during the first year of life and at least one subsequent dose for the young child.

In one embodiment, the multi-dose schedule consists of a series of two or three doses spaced approximately one to two months apart, starting at 2 months of age (e.g., doses spaced 28 to 56 days apart), followed by a toddler dose at 12 to 18 months of age. In another embodiment, the multi-dose schedule consists of a series of three doses spaced approximately one to two months apart, starting at 2 months of age (e.g., doses spaced 28 to 56 days apart), followed by a toddler dose at 12 to 15 months of age. In yet another embodiment, the multi-dose schedule consists of a series of two doses spaced approximately two months apart, starting at 2 months of age, followed by a toddler dose at 12 to 18 months of age.

In one implementation, the multi-dose schedule consists of a four-dose series of vaccines administered at 2, 4, 6, and 12 to 15 months of age.

In one embodiment, the initial dose is given on day 0, and one or more booster doses are given at intervals ranging from about 2 to about 24 weeks, preferably at intervals of 4 to 8 weeks.

In one implementation, the initial dose is given on day 0, and a booster dose is given approximately 3 months later.

7. The present invention also provides the following embodiments as defined in paragraphs 1 to 96 below.

1. A method for preparing capsular glycoconjugates, comprising the following steps:

(a) Reacting the isolated capsular sugar with a carbonate derivative and an azide linker in an aprotic solvent to produce an activated azide sugar.

(b) The carrier protein is reacted with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group, wherein the NHS moiety reacts with an amino group to form an amide bond, thereby obtaining an alkyne-functionalized carrier protein.

(c) The activated azide sugar from step (a) reacts with the activated alkyne-carrier protein from step (b) via a Cu ⁺¹ -mediated azide-alkyne cycloaddition reaction to form a glycoconjugate.

2. As in paragraph 1, wherein the separated sugar is sized prior to the activation step (a).

3. As described in paragraph 2, wherein the separated capsular sugars are sized to a weight-average molecular weight between 200 kDa and 800 kDa.

4. The method of any of paragraphs 1 to 3, wherein the carbonate derivative is selected from the group consisting of 1,1'-carbonyldiimidazole (CDI), 1,1'-carbonyl-di-(1,2,4-triazole) (CDT), disuccinimidyl carbonate (DSC) and N-hydroxysuccinimidyl chloroformate.

5. The method of any of paragraphs 1 to 3, wherein the carbonate derivative is 1,1'-carbonyldiimidazole (CDI).

6. The method of any of paragraphs 1 to 3, wherein the carbonate derivative is 1,1'-carbonyl-bis-(1,2,4-triazole)(CDT).

7. The method of any of paragraphs 1 to 6, wherein the azide-linker is a compound of formula (I),

H ₂ NXN ₃ (I)

The X series is selected from the following groups: _CH2 ( _CH2 ) _n , ( _{CH2CH2O ) mCH2CH2 ,} NHCO( _CH2 ) _n , NHCO( _{CH2CH2O ) mCH2CH2 , OCH2} ( _CH2 ) _n and O( _CH2CH2O ) _mCH2CH2 ; wherein the n series is selected from 1 _to 10 and _the m series _is selected from ₁ to ₄ .

8. The method of any of paragraphs 1 to 6, wherein the azide-linker is a compound of formula (II),

9. The method of any of paragraphs 1 to 8, wherein the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a terminal alkyne.

10. The method of any of paragraphs 1 to 8, wherein the reagent having the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a reagent having the N-hydroxysuccinimide (NHS) moiety and the cycloalkyne group.

11. The method of any of paragraphs 1 to 8, wherein the reagent having the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (III),

The X series is selected from the following groups: _CH₂O ( _CH₂ ) _nCH₂C ＝O and _CH₂O ( _CH₂CH₂O ) _m ( _CH₂ ) _nCH₂C ＝O, where _the n series is selected from 0 to ₁₀ and the m series is selected _from 0 to 4.

12. The method of any of paragraphs 1 to 8, wherein the reagent having the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (IV):

13. The method of any of paragraphs 1 to 12, wherein step a) comprises reacting the capsular sugar with a carbonate derivative in an aprotic solvent, and subsequently reacting the carbonate-activated capsular sugar with an azide linker to produce an activated azide capsular sugar.

14. The method of any of paragraphs 1 to 13, wherein in step a), the separated capsular sugar is reacted with the carbonate derivative in an aprotic solvent.

15. The method of any of paragraphs 1 to 13, wherein in step a), the separated capsular sugar and the carbonate derivative are reacted in a solution consisting essentially of dimethyl sulfoxide (DMSO).

16. The method of any of paragraphs 1 to 14, wherein in step a), the separated capsular sugar and CDI are reacted in an aprotic solvent containing 0.1% to 1% (v/v) water.

17. The method of any of paragraphs 1 to 14, wherein in step a), the separated capsular sugar is reacted with CDI in DMSO containing 0.1% to 1% (v/v) water.

18. The method of any of paragraphs 1 to 17, wherein in step a), water is added after the carbonic acid derivative has been activated.

19. The method as described in paragraph 18, wherein water is added to bring the total water content in the mixture to between about 1% and about 10% (v/v).

20. The method of any of paragraphs 1 to 19, wherein step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azide linker in the amount between 0.01 and 10 molar equivalents relative to the amount of sugar repeating unit of the activated sugar.

21. The method of any of paragraphs 1 to 20, wherein the degree of activation of the activated sugar after step a) is between 0.5% and 50%.

22. The method of any of paragraphs 1 to 21, wherein step b) comprises reacting the carrier protein with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group in an amount of 0.1 to 10 molar equivalents relative to the lysine residue on the carrier.

23. The method of any of paragraphs 1 to 22, wherein the degree of activation of the activating carrier after step b) is between 1 and 50.

24. The method of any of paragraphs 1 to 23, wherein the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst.

25. The method of any of paragraphs 1 to 23, wherein the conjugation reaction c) is carried out in an aqueous buffer in the presence of an oxidant and copper (I) as a catalyst.

26. The method of any of paragraphs 1 to 23, wherein the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst and ascorbate as an oxidant, wherein the reaction mixture further comprises THPTA (tris(3-hydroxypropyltriazolylmethyl)amine) and aminoguanidine.

27. The method of any of paragraphs 1 to 26, wherein the initial input ratio (weight/weight) of the activated azidosaccharide to the activated alkyne-carrier at step c) is between 0.1 and 3.

28. The method of any of paragraphs 1 to 27, wherein after step c), the method further comprises the step of capping the unreacted azide groups retained in the conjugate with an azide capping agent.

29. The method as described in paragraph 28, wherein the azide-terminated agent is a compound of formula (V).

≡-X-OH (V)

Where X is (CH ₂ ) _n , and n is selected from 1 to 15.

30. The method as described in paragraph 28, wherein the azide-terminant is propargyl alcohol.

31. The method of any of paragraphs 28 to 30, wherein the capping of the unreacted azide group is carried out with a capping agent in an amount between 0.05 and 20 molar equivalents relative to the amount of the sugar repeating unit of the activated sugar.

32. The method of any of paragraphs 1 to 31, wherein after step c), the method further comprises the step of capping the unreacted alkyne group retained in the conjugate with an alkyne-based capping agent.

33. The method as described in paragraph 32, wherein the alkyne-terminant is a reagent with an azide group.

34. As described in paragraph 33, wherein the alkyne-based end-capping agent is a compound of formula (VI).

N ₃ -X-OH (VI)

Where X is (CH ₂ ) _n , and n is selected from 1 to 15.

35. The method as described in paragraph 32, wherein the alkyne-based end-capping agent is 3-azido-1-propanol.

36. The method of any of paragraphs 32 to 35, wherein the capping of the unreacted alkyne group is carried out with a capping agent in an amount between 0.05 and 20 molar equivalents relative to the amount of the sugar repeating unit of the activated sugar.

37. The method of any of paragraphs 1 to 36, wherein the method further includes a step of purifying the glycoconjugate after its formation.

38. A capsular glycoconjugate produced according to any one of the methods described in paragraphs 1 to 37.

39. A capsular glycosyl conjugate comprising a capsular glycoside covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII):

The X series is selected from the following groups: _CH₂ ( _CH₂ ) _n' , ( _CH₂CH₂O ) _mCH₂CH₂ , NHCO( _CH₂ ) _{n' ,} NHCO( _CH₂CH₂O ) _mCH₂CH₂ , _OCH₂ ( _CH₂ ) _{n '} , and O( _CH₂CH₂O ) _mCH₂CH₂ ; where n' is selected _{from 1} to ₁₀ and m _is selected from _{1 to 4} .

Furthermore, X' is selected from the following groups: _CH2O ( _CH2 ) _{n” CH2C} ＝ _O , _CH2O ( _CH2CH2O ) _m' ( _CH2 ) _{n” CH2C} ＝O, where n” is selected from 0 to 10 and m' is selected from 0 to 4.

40. A capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH2 ( _CH2 ) _n' , where n' is 2, and wherein X' is _CH2O ( _CH2 ) _{n” CH2C} ＝O, where n” is 1.

41. A capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VIII),

42. A capsular sugar conjugate as described in any of paragraphs 38 to 41, comprising a capsular sugar wherein the weight-average molecular weight (Mw) of the capsular sugar prior to conjugation is between 10 kDa and 2,000 kDa.

43. A capsular sugar conjugate as described in any of paragraphs 38 to 41, comprising a capsular sugar wherein the weight-average molecular weight (Mw) of the capsular sugar prior to conjugation is between 50 kDa and 1,000 kDa.

44. A capsular sugar conjugate as described in any of paragraphs 38 to 41, comprising a capsular sugar wherein the weight-average molecular weight (Mw) of the capsular sugar prior to conjugation is between 200 kDa and 750 kDa.

45. A capsular glycoconjugate as described in any of paragraphs 38 to 44, having a weight-average molecular weight (Mw) between 250 kDa and 20,000 kDa.

46. A capsular glycoconjugate such as any of paragraphs 38 to 44, having a weight-average molecular weight (Mw) between 500 kDa and 5,000 kDa.

47. A capsular glycosyl conjugate as described in any of paragraphs 38 to 44, having a weight-average molecular weight (Mw) between 750 kDa and 2,500 kDa.

48. A capsular glycosyl conjugate as described in any of paragraphs 38 to 47, wherein the degree of conjugation of the capsular glycosyl conjugate is between 2 and 15.

49. A capsular glycoconjugate as described in any of paragraphs 38 to 48, wherein the ratio (w/w) of the capsular sugar to the carrier protein in the glycoconjugate is between 0.5 and 3.0.

50. A capsular glycosyl conjugate as described in any of paragraphs 38 to 49, wherein the capsular glycosyl conjugate contains at least one covalent link between the carrier protein and the sugar for every four sugar repeat units of the sugar.

51. A capsular glycosyl conjugate as described in any of paragraphs 38 to 49, wherein the capsular glycosyl conjugate contains at least one covalent link between the carrier protein and the sugar for every 25 sugar repeat units of the sugar.

52. A capsular glycosyl conjugate as described in any of paragraphs 38 to 49, wherein the capsular glycosyl conjugate contains at least one covalent link between the carrier protein and the sugar for every 5 to 10 sugar repeat units.

53. A capsular glycoconjugate as described in any of paragraphs 38 to 56, wherein the carrier protein is CRM ₁₉₇ .

54. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is SCP.

55. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is an SCP without enzymatic activity.

56. A capsular glycoconjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is an enzymatically inactive SCP (SCPB) derived from GBS.

57. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of SCPB.

58. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of SCP, comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain.

59. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of an enzymatically inactive SCP, wherein the fragment of the enzymatically inactive SCP contains a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but does not contain the pre-output signal sequence, the original sequence, or the cell wall anchoring domain.

60. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of an inactive SCP comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by substitution of at least one amino acid of the wild-type sequence, and wherein the substitution is selected from the group consisting of D130A, H193A, N295A, and S512A, wherein the number indicates the position of the amino acid residue in the peptidase numbered SEQ ID NO:1 according to WO00/34487.

61. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of an inactive SCP comprising a protease domain, a protease-associated domain (PA domain), and three fibronectin type III (Fn) domains but excluding the pre-output signal sequence, the original sequence, and the cell wall anchoring domain, wherein the inactivation is achieved by substituting at least two amino acids of the wild-type sequence, wherein the at least two amino acids are substituting for D130A and S512A, wherein the number indicates the position of the amino acid residues in the peptidase numbered SEQ ID NO:1 according to WO00/34487.

62. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of an enzymatically inactive SCP consisting of a polypeptide having at least 95% identity with SEQ ID NO:41.

63. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of an enzymatically inactive SCP consisting of a polypeptide having at least 95% identity with SEQ ID NO:42.

64. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of the non-enzymatically active SCP consisting of SEQ ID NO:41.

65. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is a fragment of the non-enzymatically active SCP consisting of SEQ ID NO:42.

66. A capsular glycoconjugate of any of paragraphs 38 to 53, wherein the carrier protein is DT (diphtheria toxoid).

67. A capsular glycosyl conjugate of any of paragraphs 38 to 53, wherein the carrier protein is TT (tetanus toxoid).

68. A capsular glycosyl conjugate as described in any of paragraphs 38 to 53, wherein the carrier protein is PD (Haemophilus influenzae protein D).

69. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from pathogenic bacteria.

70. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from pathogenic Streptococcus, pathogenic Staphylococcus, pathogenic Enterococcus, pathogenic Bacillus, pathogenic Corynebacterium, pathogenic Listeria, pathogenic Erysipelothrix, pathogenic Clostridium, pathogenic Haemophilus, pathogenic Neisseria, or pathogenic Escherichia.

71. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, or Streptococcus.

72. The method for preparing capsular sugar conjugates as described in any of paragraphs 1 to 37, or the capsular sugar conjugates as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Haemophilus influenzae, Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, group C and group G streptococci, or Escherichia coli.

73. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus agalactiae, or Escherichia coli.

74. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae or Streptococcus agalactiae.

75. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae.

76. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Staphylococcus aureus.

77. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Enterococcus faecalis.

78. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Haemophilus influenzae type b.

79. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Neisseria meningitidis.

80. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Escherichia coli.

81. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Enterococcus faecalis.

82. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus agalactiae (Group B Streptococcus (GBS)).

83. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar of GBS type Ia, Ib, II, III, IV, V, VI, VII or VIII.

84. The method for preparing capsular sugar conjugates as described in any of paragraphs 1 to 37, or the capsular sugar conjugates as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from a Streptococcus pneumoniae serotype selected from the group consisting of: serotypes 1, 2, 4, 5, 6A, 6B, 6C, 7C, 7F, 8, 9V, 9N, 10A, 10B, 11A, 12F, 14, 15A, 15B, 15C, 16F, 17F, 18C, 19A, 19F, 20, 21, 22A, 22F, 23A, 23B, 23F, 24B, 24F, 27, 29, 31, 33B, 33F, 34, 35B, 35F, 38, 72, and 73.

85. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 35B.

86. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 29.

87. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 15A.

88. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 24F.

89. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 23A.

90. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 23B.

91. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 6B.

92. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 19A.

93. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 19F.

94. The method for preparing a capsular sugar conjugate as described in any of paragraphs 1 to 37, or the capsular sugar conjugate as described in any of paragraphs 38 to 68, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae serotype 23F.

95. The method or capsular sugar conjugate as described in any of paragraphs 1 to 94, wherein the capsular sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3.

96. An immunogenic composition comprising a capsular glycosyl conjugate as described in any of paragraphs 38 to 95.

As used herein, the term “about” means a range of values that are statistically significant, such as stated concentration ranges, time ranges, molecular weights, temperatures, or pH. Such ranges may be within one order of magnitude of a given value or range, typically within 20%, more typically within 10%, and even more typically within 5% or 1%. Sometimes, such ranges may be within the typical experimental errors of standard methods used to measure and/or determine a given value or range. The permissible deviation covered by the term “about” will depend on the specific system studied and will be readily understood by those skilled in the art. Whenever a range is described in this application, each number within that range is also considered as one embodiment of the invention.

The inventors intend that, in various cases, the terms “comprising,” “comprise,” and “comprises” used herein may be replaced with the terms “consisting essentially of,” “consist essentially of,” “consists essentially of,” “consisting of,” “consist of,” and “consists of,” respectively.

The terms “immunogenic amount,” “immunogenic effective amount,” “therapeutic effective amount,” “prophylactic effective amount,” or “dosage” are used interchangeably herein and generally refer to an amount of antigen or immunogenic composition that, when measured by standard analysis known to those skilled in the art, is sufficient to induce an immune response, namely a cellular (T cell) or humoral (B cell or antibody) response or both.

Consider any all integers within the scope of this document as one embodiment of the invention.

All references or patent applications cited in this patent specification are incorporated herein by reference.

The invention is illustrated in the accompanying embodiments. Unless otherwise described in detail, the following embodiments are carried out using standard techniques well-known and commonly used by those skilled in the art. The embodiments are illustrative and not limiting of the invention.

Example

Example 1: Using click chemical conjugation of Streptococcus pneumoniae serotype 35B capsular polysaccharide (see Figure 3)

1. Activation of serum-type 35B capsular polysaccharide using azide linkers

Serum type 35B capsular polysaccharide (200 mg) was mixed with imidazole (600 mg) and then frozen and lyophilized.

After lyophilization for 3 days, the lyophilized polysaccharide was reconstituted with anhydrous DMSO (100 mL). The reaction mixture was then heated to 45 °C, and 669 μL (2 MEq) of CDI (100 mg/mL in DMSO) was added. The reaction mixture was stirred at 45 °C for 2 hours. After cooling the reaction mixture to 23 °C, 2 mL (2% v/v) of WFI was added to quench the free CDI, and the mixture was stirred at 23 °C for 30 minutes. Subsequently, 41 μL (2 MEq) of 3-azido-1-propylamine was added, and the mixture was stirred at 23 °C for 20 hours. After 20 hours of reaction, the reaction mixture was diluted (5×, v/v) with 400 mL of saline containing 10 mM sodium phosphate buffer (SPB) (pH 7) and cooled to 5 °C. The diluted reaction mixture was then purified via UF/DF using a 10K MWCO PES membrane (Millipore Pellicon 2 Mini) relative to brine containing 10 mM SPB (pH 7) (30×, v/v).

2. Activate CRM ₁₉₇ and SCP to alkyne-CRM ₁₉₇ using alkyne NHS ester.

Activation of CRM ₁₉₇ :

Add 57 mL of WFI and 50 mL of 0.5 M sodium phosphate buffer (pH 8.3) to the CRM ₁₉₇ solution (1000 mg). After cooling to 8 °C, add 3.8 mL (0.5 MEq relative to lysine on CRM ₁₉₇ ) of 3-propyne-propionic acid NHS ester (POPS) (20 mg/mL in DMSO) dropwise to the reaction mixture, maintaining the reaction temperature at 8 ± 3 °C. After stirring the reaction mixture at 8 °C for 2 hours, purify it via UF/DF using a 10 K MWCO PES membrane (Millipore Pellicon 2 Mini) relative to saline containing 100 mM sodium phosphate buffer (pH 7.0) (30 × filtration volume). After UF/DF, add 23 g (15% v/v) of sucrose.

SCP Activation:

SCP activation is similar to CRM ₁₉₇ activation, except for the adjustment of the amount of connector. The final amount of connector is 0.5 MEq relative to SCP (0.092 w/w connector per SCP).

Click to combine:

The activated azide polymer and alkyne CRM ₁₉₇ or SCP are conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction, which is known as a "click reaction".

At 23°C, a mixture of 5 mM copper sulfate (CuSO₄) (1 mL) and 25 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) ( ₁ mL) was added to a mixture of serum-type 35B capsular polysaccharide activated with an azide linker (see step 1 above) and alkyne-CRM ₁₉₇ or alkyne-SCP (see step 2 above) (in saline (pH 7.0) containing 100 mM sodium phosphate buffer (SPB)). Then, 100 mM aminoguanidine (2 mL) and 100 mM sodium ascorbate (2 mL) were added. After stirring the reaction mixture at 23°C for 2 hours, unreacted azide groups were capped at 23°C with propargyl alcohol (1 MEq) for 2 hours. Following the first capping, unreacted alkyne groups were capped at 23°C with 3-azido-1-propanol (2 MEq) for 2 hours. The reaction mixture was then purified by UF/DF using a 100K MWCO PES membrane relative to a saline solution (pH 7.0) containing 10mM EDTA + 10mM SPB (30 × percolation volume) and then relative to a saline solution (pH 6.0) containing 5mM succinate (30 × percolation volume).

Table 1. Properties of Pn35B conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 35B conjugates with extremely low free sugar content and good yields. Furthermore, it allows for the production of 35B conjugates containing polysaccharides close to those found in natural polysaccharides (unlike activation with periodate, no size reduction was observed during the activation step; see WO 2020/247299).

Example 2: Using click chemical conjugation of Streptococcus pneumoniae serotype 29 capsular polysaccharide (see Figure 3)

1. Activation of serum-type 29 capsular polysaccharide using azide linkers

Serum type 29 capsular polysaccharide (200 mg) was mixed with imidazole (600 mg) and then frozen and lyophilized.

After lyophilization for 3 days, the lyophilized polysaccharide was reconstituted with anhydrous DMSO (100 mL). The reaction mixture was then heated to 45 °C, and 1050 μL (3 MEq) of CDI (100 mg/mL in DMSO) was added. The reaction mixture was stirred at 45 °C (300 rpm) for 3 hours. After cooling the reaction mixture to 23 °C, 2 mL (2% v/v) of WFI was added to quench the free CDI, and the mixture was stirred at 23 °C for 30 minutes. Subsequently, 42 μL (2 MEq) of 3-azido-1-propylamine was added, followed by 60 μL of triethylamine, and the mixture was stirred at 23 °C for 20 hours. After 20 hours of reaction, the reaction mixture was diluted to 5 °C with 400 mL of saline (pH 7) (5×, v/v) containing 10 mM sodium phosphate buffer (SPB) to cool. The diluted reaction mixture was then purified via UF/DF using a 10K MWCO PES membrane (Millipore Pellicon 2 Mini) relative to brine containing 10 mM SPB (pH 7) (30×, v/v).

2. Activate CRM ₁₉₇ to alkyne-CRM ₁₉₇ using alkyne NHS ester.

Add 57 mL of WFI and 50 mL of 0.5 M sodium phosphate buffer (pH 8.3) to the CRM ₁₉₇ solution (1000 mg). After cooling to 8 °C, add 3.8 mL (0.5 MEq relative to lysine on CRM ₁₉₇ ) of 3-propyne-propionic acid NHS ester (POPS) (20 mg/mL in DMSO) dropwise to the reaction mixture, maintaining the reaction temperature at 8 ± 3 °C. After stirring the reaction mixture at 8 °C for 2 hours, purify it via UF/DF using a 10 K MWCO PES membrane (Millipore Pellicon 2 Mini) relative to saline containing 100 mM sodium phosphate buffer (pH 7.0) (30 × filtration volume). After UF/DF, add 23 g (15% v/v) of sucrose.

3. Click Conjugation: The activated azide polymer and alkyne CRM ₁₉₇ are conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction, which is called a "click reaction".

At 23°C, a mixture of 5 mM copper sulfate (CuSO₄) (1 mL) and ₂₅ mM tris( ₃ -hydroxypropyltriazolylmethyl)amine (THPTA) (1 mL) was added to a mixture of serum-type 29 capsular polysaccharide activated with an azide linker (see step 1 above) and alkyne-CRM 197 (see step 2 above) (in saline containing 100 mM sodium phosphate buffer (SPB) (pH 7.0)). Then, 100 mM aminoguanidine (2 mL) and 100 mM sodium ascorbate (2 mL) were added. After stirring the reaction mixture at 23°C for 2 hours, unreacted azide groups were capped at 23°C with propargyl alcohol (1 MEq) for 2 hours. Following the first capping, unreacted alkyne groups were capped at 23°C with 3-azido-1-propanol (2 MEq) for 2 hours. The reaction mixture was then purified by UF/DF using a 100K MWCO PES membrane relative to a saline solution (pH 7.0) containing 10mM EDTA + 10mM SPB (30 × percolation volume) and then relative to a saline solution (pH 6.0) containing 5mM succinate (30 × percolation volume).

Table 2. Properties of Pn29 conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 29 conjugates with low free sugar content and good yields. Furthermore, it allows for the production of serum-type 29 conjugates containing polysaccharides close to those found in natural polysaccharides (unlike activation with periodate, no size reduction was observed during the activation step; see WO 2020/247299).

Example 3. Immunogenicity of serotype 35B conjugates obtained by click chemical conjugation

The opsonization phagocytic activity (OPA) titer of the serotype 35B conjugates of -CRM ₁₉₇ or SCP in mice was determined under standard conditions. Click chemistry (click) was used to generate the conjugates tested (see properties in Table 1).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.01 μg/animal, 0.05 μg/animal, or 0.1 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 3.

NA: 'Not obtained'

The data in Table 3 indicate that all serotype 35B conjugates induced dose-dependent OPA titers in a mouse immunogenicity model.

Example 4: Using click chemical conjugation of capsular polysaccharides of Streptococcus pneumoniae serotypes 23A and 23B (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotypes 23A and 23B capsular polysaccharides were activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharides 23A and 23B were click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Tables 4 and 5.

Table 4. Properties of Pn23A conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 23A conjugates with extremely low free sugar content and good yields.

Table 5. Properties of Pn23B conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 23B conjugates with low percentages of free sugars and good yields.

Example 5: Using click chemical conjugation of Streptococcus pneumoniae serotype 15A capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 15A capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 15A was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 6.

Table 6. Properties of Pn15A conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 15A conjugates with low free sugar content and good yields for SPC.

Example 6: Using click chemical conjugation of Streptococcus pneumoniae serotype 24F capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 24F capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 24F was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 7.

Table 7. Properties of Pn24F conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows for the production of 24F conjugates with low free sugar content and good yields.

Example 7: Using click chemical conjugation of Streptococcus pneumoniae serotype 6B capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 6B capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 6B was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 8.

Table 8. Properties of 6B conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows the production of 6B conjugates with extremely low levels of free sugars and free proteins.

Example 8: Using click chemical conjugation of Streptococcus pneumoniae serotype 19A capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 19A capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 19A was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 9.

Table 9. Properties of 19A conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows the production of 19A conjugates with low free sugar and extremely low free protein content.

Example 9: Using click chemical conjugation of Streptococcus pneumoniae serotype 19F capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 19F capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 19F was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 10.

Table 10. Properties of 19F conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows the production of 19F conjugates with low free sugar and extremely low free protein content.

Example 10: Using click chemical conjugation of Streptococcus pneumoniae serotype 23F capsular polysaccharide (see Figure 3)

Using a similar method to that used for serotypes 35B and 29 (see Examples 1 and 2), serotype 23F capsular polysaccharide was activated with an azide linker (3-azido-1-propylamine). Using a similar method to Examples 1 and 2, CRM ₁₉₇ and SCP were activated to alkyne-CRM ₁₉₇ or alkyne-SCP with alkyne NHS ester, and the activated azide polysaccharide 23F was click-conjugated with alkyne CRM ₁₉₇ or SCP (conjugated via a Cu+1-mediated azide-alkyne cycloaddition reaction).

The properties of the obtained conjugates are presented in Table 11.

Table 11. Properties of 23F conjugates obtained using click chemistry

MW: Molecular weight; SPR: Sugar-to-protein ratio

Click chemistry allows the production of 23F conjugates with low free sugar and extremely low free protein content.

Example 11. Immunogenicity of serotype 19F conjugates obtained by click chemistry

The opsonization phagocytic activity (OPA) titer of the serotype 19F conjugates of -CRM ₁₉₇ or SCP in mice was determined under standard conditions. The tested conjugates were generated using click chemistry (click) (see properties in Table 10 of Example 9).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.05 μg/animal or 0.1 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 12.

Example 12. Immunogenicity of serotype 29 conjugate using click chemical conjugation

The opsonization phagocytic activity (OPA) titer of the serotype 29 conjugate with -CRM ₁₉₇ in mice was determined under standard conditions. Click chemistry (click) was used to generate the tested conjugates (see Table 2 in Example 2 for properties).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.01 μg/animal, 0.05 μg/animal, or 0.1 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 13.

The data in Table 13 indicate that the serotype 29 conjugate induced a dose-dependent OPA titer in a mouse immunogenicity model.

Example 13. Immunogenicity of serotype 19A conjugates obtained by click chemistry

The opsonization phagocytic activity (OPA) titer of the serotype 19A conjugates of -CRM ₁₉₇ or SCP in mice was determined under standard conditions. The tested conjugates were generated using click chemistry (click) (see properties in Table 9 of Example 8).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.05 μg/animal or 0.1 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 14.

Example 14. Immunogenicity of serotype 6B conjugates obtained by click chemical conjugation

The opsonization phagocytic activity (OPA) titer of the serotype 6B conjugates of -CRM ₁₉₇ or SCP in mice was determined under standard conditions. Click chemistry (click) was used to generate the tested conjugates (see properties in Table 8 of Example 7).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.05 μg/animal, 0.1 μg/animal, or 0.2 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 15.

Example 15. Immunogenicity of serotype 15A conjugates obtained by click chemical conjugation

The opsonization phagocytic activity (OPA) titer of the serotype 15A conjugates of -CRM ₁₉₇ or SCP in mice was determined under standard conditions. The tested conjugates were generated using click chemistry (click) (see properties in Table 6 of Example 5).

At week 0, 6- to 8-week-old female Swiss Webster mice were immunized subcutaneously with 0.01 μg/animal, 0.1 μg/animal, or 1.0 μg/animal of the test conjugate (250 μL). Mice were boosted with the same dose of the conjugate at week 3, and blood was subsequently collected at week 5. Serum samples from week 5 were analyzed for serotype-specific OPA.

The results are presented in Table 16.

All publications and patent applications mentioned in this specification are indicative of the level of a person skilled in the art to which this invention pertains. All publications and patent applications are incorporated herein by reference as if individually and separately indicated to be incorporated by reference.

Although the invention has been described in considerable detail by way of illustration and examples for purposes of clarity, certain changes and modifications may be made within the scope of the appended claims.

Claims (29)

1. A method for preparing capsular glycoconjugates, the method comprising the following steps: (a) Reacting the separated capsular sugar with a carbonate derivative and an azide linker in an aprotic solvent to produce an activated azide sugar. (b) The carrier protein is reacted with a reagent containing an N-hydroxysuccinimide (NHS) moiety and an alkyne group, wherein the NHS moiety reacts with an amino group to form an amide bond, thereby obtaining an alkyne-functionalized carrier protein. (c) The activated azide sugar from step (a) reacts with the activated alkyne-carrier protein from step (b) via a Cu ⁺¹ -mediated azide-alkyne cycloaddition reaction to form a glycoconjugate. 2. The method of claim 2, wherein prior to activation step (a), the size of the separated capsular sugar is set to a weight-average molecular weight between 200 kDa and 800 kDa. 3. The method of any one of claims 1-2, wherein the carbonate derivative is selected from the group consisting of: 1,1'-carbonyldiimidazole (CDI), 1,1'-carbonyl-di-(1,2,4-triazole) (CDT), disuccinimidyl carbonate (DSC), and N-hydroxysuccinimidyl chloroformate. 4. The method according to any one of claims 1-3, wherein the azide-based linker is a compound of formula (I), H,N—X—N. _(I) X is selected from the following groups: _CH2 ( _CH2 )n, ( _CH2CH2O )mCH2CH2 _{, NHCO ( CH2} ) _n , NHCO( _CH2CH2O ) _mCH2CH2 , _OCH2 ( _CH2 )n and O( _CH2CH2O ) _mCH2CH2 ; where n is selected from 1 to ₁₀ and m is selected _from 1 to ₄ . 5. The method according to any one of claims 1-3, wherein the azide-based linker is a compound of formula (II), 6. The method according to any one of claims 1-5, wherein the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a terminal alkyne. 7. The method according to any one of claims 1-5, wherein the reagent having an N-hydroxysuccinimide (NHS) moiety and an alkyne group is a reagent having an N-hydroxysuccinimide (NHS) moiety and a cycloalkyne. 8. The method according to any one of claims 1-5, wherein the reagent having the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (III). X is selected from the following groups: _CH₂O ( _CH₂ ) _nCH₂C ＝O and _CH₂O ( _CH₂CH₂O ) _m ( _CH₂ ) _nCH₂C ＝O, where n is selected _from 0 to ₁₀ and _m is selected from 0 to 4. 9. The method according to any one of claims 1-5, wherein the reagent having the N-hydroxysuccinimide (NHS) moiety and the alkyne group is a compound of formula (IV): 10. The method of any one of claims 1-9, wherein step a) comprises reacting the capsular sugar with a carbonate derivative in an aprotic solvent, and subsequently reacting the carbonate-activated capsular sugar with an azide linker to produce an activated azide capsular sugar. 11. The method of any one of claims 1-10, wherein in step a), the separated capsular sugar is reacted with CDI in an aprotic solvent containing 0.1% to 1% (v/v) water. 12. The method according to any one of claims 1-11, wherein in step a), water is added after the carbonic acid derivative is activated. 13. The method of any one of claims 1-12, wherein step a) further comprises reacting the sugar activated by the carbonate derivative with an amount of azide linker in the amount between 0.01 and 10 molar equivalents relative to the amount of sugar repeating unit of the activated sugar. 14. The method according to any one of claims 1-13, wherein the conjugation reaction c) is carried out in an aqueous buffer in the presence of copper (I) as a catalyst. 15. The method of any one of claims 1-14, wherein the method further comprises, after generating the glycoconjugate, purifying the glycoconjugate. 16. A capsular glycoconjugate, produced by the method according to any one of claims 1-15. 17. A capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII): X is selected from the following groups: _CH₂ ( _CH₂ ) _n' , ( _CH₂CH₂O ) _mCH₂CH₂ , NHCO( _CH₂ ) _{n' ,} NHCO( _{CH₂CH₂O ) mCH₂CH₂} , _OCH₂ ( _CH₂ ) _n' , and O( _CH₂CH₂O ) _mCH₂CH₂ ; where n' _is selected from ₁ to ₁₀ and _m is selected from ₁ to _{4 .} And X' is selected from the following groups: CH ₂ O(CH ₂ ) _n” CH ₂ C＝O, CH ₂ O(CH ₂ CH ₂ O) _m' (CH ₂ ) _n” CH ₂ C＝O, where n” is selected from 0 to 10 and m' is selected from 0 to 4. 18. A capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VII), wherein X is _CH2 ( _CH2 ) _n' , where n' is 2, and wherein X' is _CH2O ( _CH2 ) _{n” CH2C} ＝O, where n" is 1. 19. A capsular glycosyl conjugate comprising a capsular sugar covalently conjugated to a carrier protein (CP) via a spacer and having the general formula (VIII), 20. The capsular sugar conjugate of any one of claims 16 to 19, comprising a capsular sugar, wherein the weight-average molecular weight (Mw) of the capsular sugar prior to conjugation is between 10 kDa and 2,000 kDa. 21. The capsular glycosyl conjugate according to any one of claims 16 to 20, having a weight average molecular weight (Mw) between 250 kDa and 20,000 kDa. 22. The capsular glycosyl conjugate according to any one of claims 16 to 21, wherein the degree of conjugation of the capsular glycosyl conjugate is between 2 and 15. 23. The capsular glycoconjugate according to any one of claims 16 to 22, wherein the ratio (w/w) of the capsular glycoside to the carrier protein in the glycoconjugate is between 0.5 and 3.0. 24. The capsular glycosyl conjugate of any one of claims 16 to 23, wherein the capsular glycosyl conjugate comprises at least one covalent link between the carrier protein and the sugar for every 5 to 10 sugar repeating units. 25. The capsular glycosyl conjugate according to any one of claims 16 to 24, wherein the carrier protein is CRM ₁₉₇ , SCP, DT (diphtheria toxoid), TT (tetanus toxoid), or PD (Haemophilus influenzae protein D). 26. The method for preparing a capsular sugar conjugate according to any one of claims 1 to 15 or the capsular sugar conjugate according to any one of claims 16 to 25, wherein the capsular sugar is a capsular sugar derived from pathogenic bacteria. 27. The method for preparing capsular sugar conjugates according to any one of claims 1 to 15 or the capsular sugar conjugates according to any one of claims 16 to 25, wherein the capsular sugar is a capsular sugar derived from Streptococcus pneumoniae. 28. The method for preparing capsular sugar conjugates or the capsular sugar conjugates according to any one of claims 1 to 27, wherein the capsular sugar is not a capsular sugar derived from Streptococcus pneumoniae serotype 3. 29. An immunogenic composition comprising the capsular glycosyl conjugate according to any one of claims 16 to 28.