HK1212552B - Gene knock-in non-human animal - Google Patents
Gene knock-in non-human animal Download PDFInfo
- Publication number
- HK1212552B HK1212552B HK16100557.7A HK16100557A HK1212552B HK 1212552 B HK1212552 B HK 1212552B HK 16100557 A HK16100557 A HK 16100557A HK 1212552 B HK1212552 B HK 1212552B
- Authority
- HK
- Hong Kong
- Prior art keywords
- human
- receptor
- gene
- human animal
- antibody
- Prior art date
Links
Description
Technical Field
The present invention relates to a gene-knock-in non-human animal and a method for evaluating a compound using the gene-knock-in non-human animal.
Background
Therapeutic agents having high specificity for molecular targets, such as antibody drugs, have been developed in large quantities, and there has been an increasing demand for humanized non-human animals, such as humanized mice, for more accurate clinical evaluation. As a method for producing a humanized mouse, a so-called transgenic mouse in which a mouse expresses a human gene and a gene targeting method in which a mouse gene is replaced with a human gene are widely known, and many humanized mice produced by the above method have been reported. However, many mice into which a vector for expressing a human gene has been introduced, such as transgenic mice, do not exhibit the expected expression pattern. For example, a mouse in which a human interleukin-6 (IL-6) receptor gene is overexpressed using a pCAGGS vector has been reported (non-patent document 1), but this transgenic mouse has a high expression level of the human IL-6(hIL-6) receptor because of its strong promoter, and is expressed ectopically in tissues and/or cells other than the original expression site. In addition, mouse endogenous IL-6 receptor expression. On the other hand, in a so-called knock-in mouse prepared by a gene targeting method in which a mouse gene is replaced with a human gene, when a coding sequence of the full-length human gene is inserted into a target mouse gene, a structure is formed in which a termination codon (PTC) of the human gene inserted far upstream of the termination codon of the mouse gene is present in the transcribed mRNA, and an exon-exon junction derived from the mouse gene is present downstream of the termination codon. Since this structure is recognized by a nonsense-mediated mRNA degradation mechanism (NMD mechanism) and mRNA is decomposed, the expression level of the target gene is not obtained in many cases. To cope with this, a poly-a addition signal was added immediately below the coding sequence and inserted into mice. Thus, in the transcribed mRNA, a structure in which no exon-exon junction derived from the target gene is generated downstream of the PTC is formed, and therefore NMD does not occur. However, it is generally known that the expression level of an mRNA that has not been excised is reduced (non-patent document 2). Thus, it is very difficult to produce a non-human animal which can inhibit the expression of a gene endogenous to the non-human animal and express a foreign gene at a physiologically appropriate level.
Furthermore, the hp7 sequence is known to be a GC-rich base sequence, and forms a strong stem loop when transcribed into RNA. The function of the hp7 sequence has been reported so far in 2 papers. In the case where the sequence is present on the 5 '-upstream side of the translation initiation site, the 40S ribosomal subunit is stopped on the 5' -side of the hairpin and translation is hindered, as reported in the paper 1 (non-patent document 3). In another recently reported article 1, it is described that NMD is inhibited if the hp7 sequence is present between the PTC and exon-exon junction that is the subject of NMD (non-patent document 4), but its effect is weak.
Documents of the prior art
Non-patent document
Non-patent document 1: exp.med.1995, nov.1; 182(5): 1461-1468
Non-patent document 2: Proc.Natl.Acad.Sci.U.S.A.85:836-840.
Non-patent document 3: mol, cell, biol, 1989: 9:5134-5142.
Non-patent document 4: nucleic Acid research.2012, doi: 10.1093/nar/gks344
Disclosure of Invention
Problems to be solved by the invention
The purpose of the present invention is to provide a non-human animal capable of deleting the expression of an endogenous gene (target gene) in the non-human animal and expressing a foreign gene at a physiologically appropriate level, and to provide a method for evaluating a compound using the animal. Further, the present invention aims to provide a method for producing an antibody having a desired activity by using the evaluation method.
Means for solving the problems
In order to solve the above problems, the present inventors have attempted to create a mouse capable of deleting the expression of an endogenous target gene and expressing an inserted foreign gene at a physiologically appropriate level. Further, as a result of intensive studies, it was found that a foreign gene can be expressed in a concentration equivalent to the concentration reported in human blood in a mouse by adding an hp7 sequence and a poly a addition signal downstream of the stop codon of the foreign gene and inserting the resultant into a target gene of the mouse.
Since the foreign gene inserted into this mouse adds a poly a addition signal, mRNA that is not spliced out is produced from the inserted foreign gene. Although it is known that the expression level of an mRNA that is not excised is reduced as described above (non-patent document 2), the use of the hp7 sequence in the present invention can avoid such a reduction in expression.
It is known that NMD is inhibited by inserting the hp7 sequence between the PTC and the exon-exon junction that is the subject of NMD (non-patent document 4), but in the present invention, the poly a addition signal is present downstream of the hp7 sequence, and no exon-exon junction is produced downstream of the PTC, and therefore, it is not recognized by the NMD mechanism.
Thus, in the present invention, it is unexpected and surprising that the use of the hp7 sequence enables the expression of foreign genes at physiologically appropriate levels by mechanisms other than the mechanism of inhibiting NMD.
The present inventors have also found that when a human interleukin-6 gene is overexpressed in a mouse having the interleukin-6 receptor gene inserted therein, the mouse shows symptoms of a disease caused by human interleukin-6 or the human interleukin-6 receptor, and the symptoms are improved by administering a humanized neutralizing antibody. The same symptoms as in humans are observed in mice administered with the humanized neutralizing antibody, in which the blood concentration of soluble human interleukin-6 receptor is increased. As a further advantage, in mice administered with humanized neutralizing antibodies, the production of endogenous mouse antibodies recognizing the neutralizing antibodies is inhibited. That is, the present inventors have succeeded in creating an excellent model animal showing the pathological condition of a disease caused by human interleukin-6 or a human interleukin-6 receptor. The use of the model animal enables easy measurement of the therapeutic effect of a disease of a test substance, pharmacokinetics, activity of removing soluble human interleukin-6 receptor from blood, and the like. Further, by using such an evaluation system, an antibody or the like having a desired activity can be efficiently developed.
The present invention has been completed based on the above findings, and specifically includes the following [1] to [20 ].
[1] A non-human animal characterized in that a DNA in which a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal are added to the 3' side of a DNA encoding an arbitrary foreign gene is inserted into the same reading frame of an arbitrary target gene present in the genome of the non-human animal.
[2] The non-human animal according to [1], wherein the foreign gene is a human interleukin-6 receptor gene.
[3] The non-human animal according to any one of [1] to [2], wherein the arbitrary target gene present on the genome of the non-human animal is an interleukin-6 receptor gene.
[4] The non-human animal according to any one of [2] to [3], wherein the soluble human interleukin-6 receptor is expressed at a blood concentration equivalent to that of a soluble interleukin-6 receptor in a healthy human.
[5] The non-human animal according to any one of [1] to [4], wherein the non-human animal is a rodent.
[6] The non-human animal according to any one of [1] to [5], wherein the non-human animal is a mouse.
[7] The non-human animal according to any one of [1] to [6], wherein human interleukin-6 is overexpressed.
[8] A method for evaluating the effect of a test substance on the treatment of a disorder caused by human interleukin-6 or a human interleukin-6 receptor, the method comprising:
a step (a) of administering a test substance to the non-human animal according to [7], and
and (b) determining whether or not symptoms of a disease caused by human interleukin-6 or a human interleukin-6 receptor are suppressed in the non-human animal to which the test substance has been administered.
[9] The method according to [8], wherein the disorder caused by human interleukin-6 or human interleukin-6 receptor is giant lymph node hyperplasia (Castleman's disease).
[10] A method for evaluating the pharmacokinetic properties of a test substance, the method comprising:
a step (a) of administering a test substance to the non-human animal according to any one of [1] to [7], and
and (b) measuring the blood concentration of the test substance in the non-human animal to which the test substance has been administered.
[11] A method for evaluating the activity of a test substance for removing soluble human interleukin-6 receptor from blood, which comprises:
a step (a) of administering a test substance to the non-human animal according to any one of [2] to [7],
and (b) measuring the blood concentration of the soluble human interleukin-6 receptor in the non-human animal to which the test substance has been administered.
[12] The method according to any one of [7] to [11], wherein the test substance is an antibody against human interleukin-6 receptor.
[13] A method for producing an antibody against a human interleukin-6 receptor having a therapeutic effect on a disorder caused by human interleukin-6 or a human interleukin-6 receptor, the method comprising:
a step (a) of producing an antibody against a human interleukin-6 receptor,
a step (b) of administering the antibody to the non-human animal according to [7],
step (c) of determining whether or not symptoms of a disease caused by human interleukin-6 or human interleukin-6 receptor are suppressed in a non-human animal to which the antibody has been administered, and
step (d) of screening for an antibody that inhibits the symptoms of a disease caused by human interleukin-6 or a human interleukin-6 receptor.
[14] The method according to [13], wherein the disorder caused by human interleukin-6 or human interleukin-6 receptor is giant lymph node hyperplasia.
[15] A method for producing an antibody directed against the human interleukin-6 receptor with desirable pharmacokinetic properties, the method comprising:
a step (a) of producing an antibody against a human interleukin-6 receptor,
a step (b) of administering the antibody to the non-human animal according to any one of [2] to [7],
a step (c) of measuring the blood concentration of the antibody in the non-human animal to which the antibody has been administered, and
and (d) screening for an antibody having a desired blood concentration.
[16] A method for producing an antibody against a human interleukin-6 receptor having an activity of removing a soluble human interleukin-6 receptor from blood, the method comprising:
a step (a) of producing an antibody against a human interleukin-6 receptor,
a step (b) of administering the antibody to the non-human animal according to any one of [2] to [7],
a step (c) of measuring the blood concentration of soluble human interleukin-6 receptor in the non-human animal to which the antibody has been administered, and
and (d) screening for an antibody that reduces the blood concentration of the soluble human interleukin-6 receptor.
[17] The method for producing an antibody according to any one of [13] to [16], further comprising: and (e) chimerizing or humanizing the selected antibody.
[18] A DNA for producing the non-human animal according to any one of [1] to [7], wherein a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal are added to the 3' side of a DNA encoding an arbitrary foreign gene.
[19] A vector for producing the non-human animal according to any one of [1] to [7], which is a knock-in vector for holding the DNA according to [18 ].
[20] A transformed cell used for producing the non-human animal according to any one of [1] to [7], which is a transformed cell into which the knock-in vector according to [19] is introduced.
ADVANTAGEOUS EFFECTS OF INVENTION
The knock-in non-human animal of the present invention is capable of inhibiting the expression of a gene endogenous to the non-human animal and expressing a foreign gene at a physiologically appropriate level. Therefore, the knock-in non-human animal of the present invention can appropriately evaluate a therapeutic agent having high specificity for a molecular target, such as an antibody drug.
Drawings
FIG. 1A is a schematic diagram showing the relationship between the structure (1) of genomic DNA of the mouse interleukin-6 receptor (Il6ra) gene and the inserted knock-in vector (2). The knock-in vector has full-length human interleukin-6 receptor (hIL6R) cDNA, hp7 sequence, poly a addition signal, and neomycin resistance gene.
FIG. 1B is a schematic diagram showing the state in which genomic DNA (a) of the mouse interleukin-6 receptor gene and knock-in vector (B) undergo homologous recombination to produce knock-in genomic DNA (c). Further, it was revealed that the process of knocking-in the human interleukin-6 receptor gene into the array (d) was completed by allowing (c) to act on recombinase Cre to remove the neomycin resistance gene cassette. The arrows in the figure show the set positions of primers used for detecting knock-in of the human interleukin-6 receptor gene.
FIG. 2 shows a representative example of PCR for analyzing each genotype obtained in the course of establishment of a human interleukin-6 receptor knock-in mouse.
FIG. 3 is a graph showing the gene expression characteristics of interleukin-6 receptor in human interleukin-6 receptor gene knock-in mice and wild-type mice.
FIG. 4 is a graph showing the results of measurement of the concentration of soluble human interleukin-6 receptor (hsIL-6R) in the plasma of homozygous and heterozygous human interleukin-6 receptor gene knock-in mice and wild-type mice. KI/KI, KI/+ and +/+ indicate homozygous knock-in mice, heterozygous knock-in mice and wild type, respectively.
FIG. 5 is a graph showing the reactivity to species-specific interleukin-6 (ligand) in wild-type mice and homozygous human interleukin-6 receptor gene knock-in mice.
FIG. 6 shows a representative detection example of genotype analysis by PCR in a double transgenic mouse establishment by hybridization of a human interleukin-6 receptor knock-in mouse and a human interleukin-6 transgenic mouse.
FIG. 7 is a graph showing the spleen weight at the time of a dissection in a test of administration of various antibodies (TCZ or MR16-1) to a humanized giant lymph node hyperplasia model mouse.
Fig. 8 is a tissue image showing an increased inhibitory effect of plasma cells in the spleen in an experiment of administering TCZ to a humanized giant lymph node hyperplasia model mouse. A: hIL6R knock-in mice, B: humanized giant lymph node hyperplasia model mouse to which TCZ was not administered, C: a humanized giant lymph node hyperplasia model mouse administered TCZ.
FIG. 9 is a graph showing the concentrations of soluble human interleukin-6 receptor and human interleukin-6 in plasma when subjected to a dissection in a delivery experiment in which various antibodies (TCZ or MR16-1) were administered to a humanized giant lymph node hyperplasia model mouse.
FIG. 10 is a graph showing anti-TCZ antibody titers in plasma when subjected to a caesarean section in a test of administration of various antibodies (TCZ or R16-1) to humanized giant lymph node hyperplasia model mice.
FIG. 11A is a schematic diagram showing the relationship between the structure (1) of genomic DNA of mouse Pou5f1 gene and the inserted knock-in vector (2). In the knock-in vector, the control vector had the neomycin resistance (neo) gene cDNA, the hp7pA vector had the neomycin resistance (neo) gene cDNA, the hp7 sequence, and the poly A addition signal. In the knock-in vector, a neomycin-resistant (neo) gene cDNA was inserted into exon 1 of the mouse Pou5f1 gene in such a manner that its translation initiation site coincides with the translation initiation site of exon 1.
FIG. 11B is a schematic diagram showing the state in which genomic DNA (a) of mouse Pou5f1 gene and knock-in vector (B) undergo homologous recombination to generate knock-in genomic DNA (c). The arrows in the figure show the set positions of primers used for detecting the knock-in of the neo gene.
Detailed Description
The present invention provides a non-human animal, wherein a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal are added to the 3' side of a DNA encoding an arbitrary foreign gene, and the DNA is inserted into the same reading frame of an arbitrary target gene present in the genome of the non-human animal.
The "foreign gene" in the present invention refers to a gene introduced into the non-human animal of the present invention. The foreign gene in the present invention can be used without limitation to the source of the organism. For example, when the non-human animal of the present invention is used for the purpose of evaluating a human disease therapeutic agent or the like, a human gene serving as a target molecule of the disease therapeutic agent is preferable as the foreign gene. When the non-human animal of the present invention is used as a model of a disease caused by human interleukin-6 or a human interleukin-6 receptor, the human interleukin-6 receptor gene is particularly preferable as the foreign gene. The "human interleukin-6 receptor gene" of the present invention is a gene encoding a molecule having a function of transducing a signal into a cell by binding to human interleukin-6 and then binding to a signal transduction molecule gp130 on a cell membrane. Typically, the nucleotide sequence registered in GeneBank under the number # NM-000565 can be used in the present invention.
In addition, as the foreign gene, a selectable marker gene such as a Green Fluorescent Protein (GFP), a reporter gene such as β -galactosidase, or a drug (neomycin or the like) resistance gene can be used. As the foreign gene, a combination of 2 or more genes can be used. In this case, if loxP sites are added to both sides of a specific gene in advance, the specific gene can be removed later by the action with Cre. In addition, an enhancer or the like for regulating the expression of the gene may be added to the foreign gene. The form of the foreign gene is not particularly limited, and may be cDNA or genomic DNA, for example.
In the present invention, a DNA encoding the hp7 sequence and a DNA encoding a poly A addition signal are added to the 3' side of a DNA encoding a foreign gene. Here, the "hp 7 sequence" is the base sequence GGGGCGCGTGGTGGCGGCTGCAGCCGCCACCACGCGCCCC (SEQ ID NO: 1). The "poly A addition signal" is a base sequence of AATAAA having 6 base pairs, which is present in an untranslated region located 3 'downstream of the stop codon in the final exon of a eukaryotic gene and is required to add about 50 to 200 adenylic acids to the 3' end of mRNA.
The "non-human animal" in the present invention is not particularly limited, and may be rodents such as mice, rats and hamsters, non-human primates such as monkeys and chimpanzees, mammals such as rabbits, sheep, cows and pigs, birds, amphibians, reptiles, fishes, and the like, preferably rodents, and more preferably mice.
The "target gene" in the present invention refers to a gene of a non-human animal to which a foreign gene is to be inserted. The "same reading frame" refers to a unit of a base sequence of 3 bases which is read when an mRNA is translated into a protein. "inserted in the same reading frame" means that the foreign gene is inserted in such a manner that the initiation codon ATG of the target gene coincides with the initiation codon ATG of the foreign gene. Thus, the promoter of the target gene in the non-human animal and the inserted foreign gene are operably bound, and the foreign gene is expressed in response to activation of the promoter. When a foreign gene is inserted, it is preferable to delete a sequence of the target gene having a number of bases not a multiple of 3 in sequence after ATG from the viewpoint of making the target gene disrupted lose the possibility of being translated again in the original reading frame. In the present invention, the foreign gene is preferably inserted only into an exon where the translation start site of the target gene is originally present (i.e., homologous recombination occurs only with the target exon of the target gene). Further, on the 3' -downstream side of the poly A addition signal, a recognition sequence for a recombinase such as a loxP sequence, a Frt sequence and/or a Rox sequence is present.
In the case where the inserted foreign gene is human interleukin-6 receptor, the blood concentration of soluble human interleukin-6 receptor is preferably the same as that of soluble interleukin-6 receptor in healthy human. Here, the concentration of soluble interleukin receptor in a healthy person is 15 to 70 ng/ml. The measurement methods described in examples can be used as the measurement method of the concentration of soluble human interleukin receptor in a non-human animal.
When the non-human animal of the present invention is used as a model animal for a disease caused by human interleukin-6 or a human interleukin-6 receptor, for example, it is preferable to further overexpress human interleukin-6. "overexpression" of human interleukin-6 means expression in excess of the endogenous expression level of interleukin-6 in a non-human animal. The method for overexpressing human interleukin-6 is not particularly limited, and, for example, an expression vector using a major histocompatibility antigen H-2Ld gene promoter can be used to overexpress human interleukin-6 by introducing the gene into the genome of a non-human animal. As the major histocompatibility antigen H-2Ld gene promoter, a promoter described in the literature (Miyazaki, J. -I.et al. (1986) Proc.Natl.Acad.Sci.USA.83, 9537-9541) can be used. The expression vector is not particularly limited as long as it is a vector that can be used in genetic engineering, and examples thereof include a plasmid vector, a virus vector, a cosmid vector, a Bacterial Artificial Chromosome (BAC), a Yeast Artificial Chromosome (YAC), and other non-plasmid vectors. Examples of the "diseases caused by human interleukin-6 or human interleukin-6 receptor" include giant lymph node hyperplasia (Castleman's disease), chronic joint rheumatism, multiple myeloma, sepsis, mesangial proliferative glomerulonephritis, and cancer cachexia.
The present invention also provides a DNA for producing the non-human animal, a knock-in vector for holding the DNA, and a transformed cell into which the knock-in vector is introduced.
The "DNA used for preparing a non-human animal" in the present invention is a DNA obtained by adding a DNA encoding a sequence of hp7 and a DNA encoding a poly A addition signal to the 3' side of a DNA encoding an arbitrary foreign gene.
The "knock-in vector for holding a DNA" of the present invention is a vector having the ability to insert a DNA for producing the non-human animal into a target gene region in a host by homologous recombination, and has a 5 'arm (a base sequence homologous to a base sequence 5' upstream of a target site) and a 3 'arm (a base sequence homologous to a base sequence 3' downstream of a target site) arranged on the 5 'side and the 3' side of the DNA for producing the non-human animal. In the present invention, the knock-in vector is constructed in such a manner that the DNA used for producing the non-human animal is inserted into the same reading frame of the target gene in the host. In the knock-in vector, any foreign gene is preferably inserted into exon 1 of the target gene in such a manner that the translation initiation site thereof coincides with the translation initiation site of exon 1. That is, in the knock-in vector, it is preferable that a nucleotide sequence upstream of the translation start site of exon 1 of the target gene is arranged 5' to the translation start site of any foreign gene.
In addition, the knock-in vector of the present invention preferably has the ability to replicate in a host cell. Such a vector can be constructed by inserting the DNA used for producing the non-human animal into a known vector, for example. Examples of known vectors include plasmid vectors, Bacterial Artificial Chromosome (BAC) vectors, Yeast Artificial Chromosome (YAC) vectors, retroviral vectors, and lentiviral vectors.
The "transformed cell into which a knock-in vector has been introduced" of the present invention is a cell into which a knock-in vector for producing a DNA of the above-mentioned non-human animal has been introduced. The host cell into which the knock-in vector is introduced is a cell of the non-human animal or a cell (including a cell mass) capable of differentiating into a cell of the non-human animal. As such host cells, various cells can be used according to the purpose, and examples thereof include pluripotent stem cells such as ES cells and iPS cells, germ-line stem cells having the ability to differentiate into germ cells such as sperm stem cells, and fertilized eggs. The introduction of the knock-in vector into the host cell can be carried out by a known method such as electroporation. The pluripotent stem cells can be injected into an early embryo by a known method such as microinjection, and transplanted into a surrogate mother to generate a chimeric animal. In addition, by breeding the chimeric animal, an individual whose knock-in array is homozygously integrated can be obtained from its offspring. In the case of using the germ-line stem cells, cells obtained by introducing a knock-in vector by a known method such as electroporation and performing target recombination can be transplanted into the germ cell of an animal to differentiate into germ cells, and the animal can be mated with the cells or germ cells collected from the animal can be used to produce a knock-in animal. For a method for producing a genetically modified animal using a stem cell of the reproductive series, reference is made to the literature (Kanatsu-Shinohara, M.et al (2008) biol. reprod.79, 1121- "1128). In the case of using fertilized eggs, human nucleases such as a knock-in vector and Zinc Finger Nuclease (ZFN), Transcription Activator-like effector Nuclease (TALEN), which binds to a specific target sequence of a target region on a genome and is cleaved, and/or Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas 9, are injected together into the fertilized eggs, and the fertilized eggs are transplanted into surrogate mothers to generate knockin animals. Methods for using ZFNs and TALENs are described in the literature (Cui, X.et al. (2011) nat. Biotechnol.29, 64-67) and in the literature (Li, T.et al. (2011) Nucleic Acids Res.39, 6315-. Methods for using CRISPR/Cas9 are described in the literature (Yang, h.et al (2013) cell.in press). Furthermore, an individual having a knock-in array can be obtained by injecting a knock-in vector into the testis or ovary of an animal, directly subjecting the germ cells to gene recombination by electroporation or the like, and then mating or the like (Niu, Y.et al (2008) J.Genet. genomics.35, 701-714).
The non-human animal of the present invention can be used for various evaluations of the therapeutic effect of a disease of a test substance, pharmacokinetics, activity of removing soluble human interleukin-6 receptor from blood, and the like. Accordingly, the present invention also provides a method for evaluating a test substance using such a non-human animal of the present invention.
The "test substance" used in the evaluation method of the present invention is not particularly limited, and examples thereof include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, and the like. Preferred examples of the antibody against the human interleukin-6 receptor include PM-1 antibody (J.Immunol.143: 2900-2906, 1989), hPM-1 antibody (International publication No. 92/19759), and the like. Administration of the test substance to the non-human animal can be performed, for example, by tail vein administration, subcutaneous administration, intraperitoneal administration, oral administration, nasal administration, transdermal administration, pulmonary administration, or the like.
The following methods can be used for evaluating the test substance. For example, the effect of a test substance on treatment of a disorder associated with human interleukin-6 or human interleukin-6 receptor can be evaluated by determining whether or not symptoms of the disorder associated with human interleukin-6 or human interleukin-6 receptor are inhibited in a non-human animal of the present invention to which the test substance has been administered. In the evaluation of whether or not the symptoms of the disease are suppressed, not only the non-human animal of the present invention (including offspring obtained by mating with another non-human animal) but also a biological material such as an organ, tissue, cell, blood, or the like collected from the non-human animal may be used. Whether or not the symptoms of the disease caused by human interleukin-6 or human interleukin-6 receptor are suppressed can be judged by, for example, improving the enlargement of the spleen and normalizing the weight increase of the spleen in the case where the disease is giant lymph node hyperplasia.
In addition, the pharmacokinetic properties of the test substance can be evaluated by measuring the blood concentration of the test substance in the non-human animal of the present invention to which the test substance has been administered. The term "pharmacokinetic property" as used herein refers to a property such as an effective blood concentration, a blood half-life and/or a disappearance rate of a test substance in an animal body. The method for measuring the blood concentration of the test substance is not particularly limited. When the test substance is a protein (including an antibody), for example, an ELISA method is exemplified, and when the test substance is a low-molecular-weight compound, for example, a liquid chromatogram-mass spectrometry (LC-MS) method is exemplified. For a methodology for evaluating pharmacokinetic properties from blood concentrations, reference is made to the literature (Igawa et al (2010) nat. Biotechnol.28: 1203-1207).
In addition, the activity of the test substance for removing the soluble human interleukin-6 receptor from blood can also be evaluated by measuring the blood concentration of the soluble human interleukin-6 receptor in the non-human animal of the present invention to which the test substance has been administered. The method for measuring the concentration of soluble human interleukin-6 receptor is not particularly limited, and examples thereof include an ELISA method.
In this method, the amount of the test substance required for removing the soluble human interleukin-6 receptor from the blood can also be evaluated by further measuring the blood concentration of the test substance. The method described above can be used for measuring the blood concentration of the test substance.
By using the method for evaluating a test substance of the present invention, an antibody against human interleukin-6 receptor having a desired activity can be efficiently produced. Accordingly, the invention also provides methods for producing such antibodies.
In the method for producing an antibody of the present invention, first, an antibody against the human interleukin-6 receptor is produced.
As a method for producing a monoclonal antibody, the methods of Kohler and Milstein (Kohler & Milstein, Nature, 256: 495(1975)) are representatively exemplified. The antibody-producing cells used in the cell fusion step in this method are spleen cells, lymphocytes, peripheral blood leukocytes, and the like of animals (for example, mice, rats, hamsters, rabbits, monkeys, and goats) immunized with a human interleukin-6 receptor as an antigen. Antibody-producing cells obtained by allowing an antigen to act on the above-mentioned cells or lymphocytes isolated in advance from an animal not immunized in a culture medium can also be used. Various known cell lines can be used as myeloma cells. Hybridomas are produced, for example, by cell fusion between spleen cells obtained from mice immunized with an antigen and mouse myeloma cells, and then are screened to obtain hybridomas producing monoclonal antibodies against the human interleukin-6 receptor. Monoclonal antibodies against the human interleukin-6 receptor can be obtained by culturing hybridomas, or obtained from ascites of mammals to which hybridomas are administered.
Antibodies can also be produced as recombinant Antibodies by cloning DNA encoding the above-described Antibodies from hybridomas and/or B cells, etc., and incorporating the DNA into an appropriate vector, which is introduced into host cells (e.g., mammalian cell lines, E.coli, yeast cells, insect cells, plant cells, etc.) (e.g., Antibody Production: expression technologies, 1997 WILEY, Monoclonal Antibodies,2000 OXORD UNIVERSITY PRESS, Eur. J. biochem. 192: 767-775 (1990)). If a transgenic animal (e.g., a cow, a goat, a sheep, or a pig) having an antibody gene incorporated therein is produced by using a transgenic animal production technique, a monoclonal antibody derived from the antibody gene can be obtained in a large amount from the milk of the transgenic animal.
Chimeric antibodies can be obtained, for example, as follows: an antigen-immunized mouse is produced by cleaving an antibody variable region (variable region) bound to the antigen from the gene of a mouse monoclonal antibody, binding the resulting antibody variable region to a human bone marrow-derived antibody constant region (constant region) gene, integrating the resulting gene into an expression vector, and introducing the vector into a host (for example, Japanese patent laid-open No. 7-194384, Japanese patent No. 3238049, U.S. Pat. No. 4816397, U.S. Pat. No. 4816567, and U.S. Pat. No. 5807715).
Humanized antibodies can be produced by grafting (CDR-grafting) the gene sequence of the antigen binding site (CDR) of an antibody derived from a non-human source to the human antibody gene (see, for example, Japanese patent No. 2912618, Japanese patent No. 2828340, Japanese patent No. 3068507, European patent No. 239400, European patent No. 125023, International publication No. 90/07861, and International publication No. 96/02576).
For the preparation of human antibodies, transgenic animals (for example, mice) capable of producing a human antibody spectrum by immunization (for example, Nature, 362: 255-258(1992), Intern.Rev.Immunol, 13: 65-93(1995), J.mol.biol, 222: 581-597(1991), Nature Genetics, 15: 146-156(1997), Proc.Natl.Acad.Sci.USA, 97: 722-727(2000), Japanese patent application laid-open No. H10-146194, Japanese patent application laid-open No. H10-155492, Japanese patent No. 2938569, Japanese patent application laid-open No. H11-206387, Japanese patent application laid-open No. H8-509612, and Japanese patent application laid-open No. H11-505107) can be used.
An antibody against the human interleukin-6 receptor having a therapeutic effect on a disease caused by human interleukin-6 or human interleukin-6 receptor can be obtained by administering the antibody thus produced to a non-human animal of the present invention, determining whether or not the symptom of the disease caused by human interleukin-6 or human interleukin-6 receptor is suppressed in the non-human animal to which the antibody has been administered, and screening for an antibody that suppresses the symptom.
Further, an antibody against the human interleukin-6 receptor having desired in vivo kinetics can be obtained by measuring the blood concentration of the antibody in a non-human animal to which the produced antibody has been administered, and screening for an antibody having a desired blood concentration.
Furthermore, an antibody against the human interleukin-6 receptor having an activity of removing the soluble human interleukin-6 receptor from blood can be obtained by measuring the blood concentration of the soluble human interleukin-6 receptor in a non-human animal to which the produced antibody has been administered, and screening for an antibody that reduces the blood concentration of the soluble human interleukin-6 receptor.
When the antibody thus evaluated and screened for activity is a mouse monoclonal antibody or the like, an antibody having low antigenicity and less side effects when administered to a human can be obtained by conjugating or humanizing the antibody.
Examples
Next, the present invention will be described more specifically by way of examples, but the present invention is not limited to the following examples.
EXAMPLE 1 preparation of human IL6R Gene knock-in mice
(1) Construction of knock-in vectors
An E.coli artificial chromosome (BAC) clone was used which cloned a genomic region of mouse interleukin-6 gene (Il6 ra). A DNA fragment in which the coding sequence of the human interleukin-6 receptor gene (GeneBank # NM000565), the hp7 sequence, the poly A addition signal, the loxP sequence, the neomycin resistance (neo) gene cassette and loxP were sequentially linked to each other was inserted into the target region of the mouse Il6ra gene on BAC by homologous recombination using the Red/ET system (GeneBridges). At this time, the insertion was performed so that the translation initiation site of exon 1 of mouse Il6ra gene present on BAC and the translation initiation site of human Il6R gene were aligned, and the nucleotide sequence deletion after the translation initiation site in exon 1 of mouse Il6ra gene corresponded to 40 base pairs. Furthermore, neo, which is a drug resistance gene, is added with a promoter for the pgk gene, and the neo gene is expressed in ES cells. However, the neo gene was predicted to possibly suppress the expression of the hIL6R gene introduced upstream. Thus, loxP sites (ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 2)) were placed on both sides of the neo gene in order to enable the removal of the neo gene later. A structure in which the neo gene sandwiched between the loxP sites by recombination is removed by the action with Cre is formed. Next, in order to be able to linearize the knock-in vector, a restriction enzyme NotI recognition sequence (GCGGCCGC) was inserted together with the ampicillin resistance gene in the region upstream of the 5' side of the mouse Il6ra gene on BAC.
(2) Introduction into ES cells
The hIL6R knock-in vector was electroporated into ES cells (from 129SvEv mice), and homologous recombinants were selected by PCR using drug-resistant clones obtained after selection culture using G418. For knock-in vectors, 60. mu.g of NotI was linearized, phenol/chloroform extracted, and then ethanol precipitated and dissolved in PBS for use.
ES cells used in the screening were cultured in a 96-well plate, and 1 well was washed 2 times with 200. mu.l of PBS solution, and then 5. mu.l of a lysis buffer (10 XTLA buffer II (for TAKARA LA Taq), 5% NP-405. mu.l, 4. mu.l of proteinase K (TAKARA, 20mg/ml), and 36. mu.l of distilled water) having the following composition were added thereto, treated at 55 ℃ for 2 hours, and then treated at 95 ℃ for 15 minutes to inactivate proteinase K, thereby preparing a PCR sample.
The PCR reaction mixture was 1. mu.l of sample, 2.5. mu.l of 10 × LA buffer II, and 25mM MgCl22.5. mu.l, 4. mu.l of dNTP (2.5mM), 0.2. mu.l of each primer (50. mu.M), 0.25. mu.l of LA Taq (TAKARA), and 14.35. mu.l of distilled water (25. mu.l in total). In addition, PCR conditions were 94 ℃ for 5 minutes of pre-heating, 98 ℃ for 10 seconds, 68 ℃ for 3 minutes and 30 seconds of amplification cycle 35 cycles, and 68 ℃ for 7 minutes of re-heating.
The primers used are as follows. In a sample of ES cells in which homologous recombination had occurred, a band of about 2.2kb was amplified. The primers were placed in the P6Ra1 and the hRLI6 — 11638R in the hIL6R cDNA in the genomic region of mouse Il6Ra upstream of the 5' homology arm in the knock-in vector (see fig. 1). P6Ra1 (front) 5'-ACAGGGCCTTAGACTCACAGC-3' (SEQ ID NO: 3); hRLI6_11638R (rear) 5'-AACTTGCTCCCGACACTACTGG-3' (serial number: 4).
(3) Preparation of knock-in mice
Homologous recombinant ES clones were suspended by trypsin treatment and washed with ES cell culture medium. A female mouse of C57BL/6J (B6) that had been subjected to an superovulation treatment by intraperitoneal administration of 5IU of equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) at 48-hour intervals was mated with a syngeneic male mouse. On day 2.5 of pregnancy, uterus and oviduct were perfused with the date of confirmation of vaginal embolus in female mice as 0.5 day, and embryos from 8-cell stage to morula stage were recovered. The recovered embryos were cultured overnight at 37 ℃ and the embryos that had developed in the blastoderm were injected into 10-15 ES cells as host embryos. The injected embryos were transplanted into the uterus of recipient female mice of ICR line 2.5 days old in pseudopregnancy, and calving was obtained 17 days later. Chimeric mice in which recombinant ES cells (wild color) and cells derived from host blastoderm (black color) were present in a mixed manner were obtained by distinguishing the hair color of the litter obtained by injecting ES cells into blastoderm cells. The male chimeric mice were mated with B6 female mice after sexual maturation, and whether or not the knock-in array was transduced into the next generation mice was confirmed by the PCR method using genomic DNA extracted from the tail of the next generation mice as a template. PCR is carried out by the method used for screening of the above-mentioned homologous recombination ES cells. As a result, individuals in which a signal of 2.2kb was detected were obtained, and it was confirmed that knock-in arrays were transduced in these individuals.
(4) Removal of neo Gene
The neo gene cassette was removed by microinjecting the recombinase Cre expression vector into the pronuclei of fertilized eggs obtained by confirming the propagation of the transduced individuals of the knock-in array. That is, the neo gene cassette was removed by expressing Cr once to induce recombination between loxP sites arranged at 2 positions of the knock-in array. Fertilized eggs of the Cre expression vector after microinjection were transplanted into the oviduct of an ICR line-grafted female mouse on the day 0.5 of pseudopregnancy, and farrowing was carried out 19 days later. Confirmation of the removal of the neo gene cassette was performed by PCR using genomic DNA extracted from the tail collected after weaning of the litter.
The PCR reaction solution consisted of 1. mu.l of sample, 12.5. mu.l of 2 XGC buffer I, 4. mu.l of dNTP (2.5mM), 0.25. mu.l of each primer (50. mu.M), 0.25. mu.l of LA Taq (TAKARA), and 6.75. mu.l of distilled water (25. mu.l total). The PCR conditions were 94 ℃ for 4 minutes of pre-heating, 94 ℃ for 30 seconds, 62 ℃ for 30 seconds, 72 ℃ for 3 minutes of amplification cycle for 35 cycles, and 72 ℃ for 7 minutes of re-heating.
The set positions of the primers are shown in FIG. 1B. As primers, mRLI6_10355 (5'-TCTGCAGTAGCCTTCAAAGAGC-3' (SEQ ID NO: 5)) and mRLI6_11166R (5'-AACCAGACAGTGTCACATTCC-3' (SEQ ID NO: 6)) were used. By the PCR reaction, signals of 4.2kb and 0.8kb derived from the wild-type array were detected as the amplification products derived from the knock-in array in the sample of the individual before the neo cassette was removed, whereas signals of about 2.7kb and 0.8kb derived from the wild-type array were detected in the sample of the individual after the neo cassette was removed (fig. 2).
(5) Establishment of knock-in mice
Individuals homozygous for the knock-in array were obtained by breeding mice for which removal of the neo gene cassette was confirmed. The homozygote was confirmed by PCR. The PCR reaction was carried out in the same manner as the reaction system for confirming the removal of the neo gene cassette. The homozygote was confirmed by using as an index a signal of 2.7kb derived from the knock-in array detected in the homozygote, but a signal of 0.8kb derived from the wild-type array was not detected (FIG. 2).
(6) Confirmation of expression of human IL6R and mouse Il6ra
Confirmation by RT-PCR method Using tissue RNA-
Expression of human IL6R and mouse IL6ra was analyzed by RT-PCR using tissue RNA of homozygote knock-in mice and wild-type mice. Tissue RNA was prepared from liver, spleen, thymus, kidney, heart and lung. Using 1. mu.g of each tissue RNA as a template, a reverse transcription reaction was performed using the SuperScript II First Strand cDNA Synthesis Kit (Invitrogen) using OligodT (20) primer to synthesize cDNA. PCR was performed using the synthesized cDNA as a template to detect human IL6R and mouse Il6 ra. Detection of human IL6R was carried out using a combination of forward primer 6RIK-s1 (5'-CCCGGCTGCGGAGCCGCTCTGC-3' (SEQ ID NO: 7)) set in the 5 ' untranslated region upstream of the translation initiation site as the insertion position of hIL6R gene in the knock-in array and human IL 6R-specific reverse primer RLI6-a1 (5'-ACAGTGATGCTGGAGGTCCTT-3' (SEQ ID NO: 8)). On the other hand, the detection of mouse Il6ra was carried out using a combination of the above forward primer 6RIK-s1 and a reverse primer 6RLICA2 (5'-AGCAACACCGTGAACTCCTTTG-3' (SEQ ID NO: 9)) specific to mouse Il6 ra. The PCR reaction solution consisted of 1. mu.l of sample, 12.5. mu.l of 2 XGC buffer I, 4. mu.l of dNTP (2.5mM), 0.25. mu.l of each primer (50. mu.M), 0.25. mu.l of LA Taq (TAKARA), and 6.75. mu.l of distilled water (25. mu.l total). The PCR conditions were 94 ℃ for 2 minutes, 94 ℃ for 30 seconds, 62 ℃ for 30 seconds, 72 ℃ for 1 minute for 30 cycles of amplification cycles, and 72 ℃ for 5 minutes for repeated heating. The amplification product of human IL6R was detected at 880bp, the amplification product of mouse IL6ra at 846bp, and only human IL6R and no mouse IL6ra were detected in each tissue of homozygote hIL6R knock-in mice. In addition, no human IL6R was detected from each tissue of the wild type mouse, and only mouse IL6ra was detected (fig. 3). From this result, it was confirmed that, as designed, the knock-in vector was homologously recombined to obtain a mouse in which human Il6R was expressed instead of mouse Il6 ra.
Determination of the concentration of human IL6R in plasma
The soluble form of Human IL6R concentration in plasma isolated from blood taken from the vena cava of the abdomen was determined using the Quantikin Human IL-6sR Immunoassay Kit (R & DSystems) with an abdominal inhalation anesthesia performed under isoflurane inhalation anesthesia. As a result, the concentration of soluble hIL6R in plasma was quantified to 22.1. + -. 5.0 ng/ml in homozygous knock-in mice and to 11.5. + -. 4.1 ng/ml in heterozygous knock-in mice. In addition, in wild type mice, soluble form of hIL6R could not be detected in plasma (FIG. 4). In homozygous knock-in mice, the concentrations were equivalent to those reported in humans (Nishimoton. et. al. (2008) blood.112: 3959-.
Confirmation of the reactivity of species-specific ligands-
For the homozygous knock-in mice and wild-type mice, mouse IL6 or human IL6 was administered intraperitoneally at 4 μ g/kg body weight, and blood was collected 6 hours later, and Serum Amyloid A (SAA) in blood was quantified using SAA ELISA Kit (Invitrogen). As a solvent to which IL6 was applied, a solution prepared by adding Phosphate Buffered Saline (PBS) to 0.5% of mouse plasma was used, and a control group to which only the solvent was applied was provided. As a result, the homozygous knock-in mice reacted only with human IL6 and the plasma SAA level was increased, but no reactivity to mouse IL6 was observed (fig. 5). On the other hand, the wild-type mice responded to both human IL6 and mouse IL6, and the plasma SAA level was confirmed to increase (fig. 5). It is known that mouse Il6ra binds to both mouse Il6 and human Il6, and human Il6R binds to human Il6 but not to mouse Il6, and the results of this experiment are consistent with this finding. Thus, it was clear that in homozygous knock-in mice, as designed, mouse Il6ra was not expressed, but human Il6R was expressed and functioned instead.
Since mRNA of hIL6R gene transcribed from the knock-in array of the present invention is not cleaved, it is not degraded by NMD mechanism, but it is known that the expression level of the gene not cleaved is reduced. However, it was confirmed that the soluble hIL6R concentration in blood was equal to that in blood of a healthy human in the knock-in mouse of hIL6R of the present invention, and that SAA was produced by sufficiently reacting with administered human IL 6. This indicates that hp7 inserted together with the poly A addition signal contributes to stabilization of the expression level of hIL6R that should be reduced due to the non-cleaved structure.
EXAMPLE 2 establishment and evaluation of humanized giant lymph node hyperplasia model mouse
(1) Establishment of humanized giant lymph node hyperplasia model mouse
Double transgenic mice were made by mating hIL6R knock-in mice with the H-2Ld human IL6 transgenic mice (cytokine.2002, Dec. 21; 20 (6): 304-311). Genotype was analyzed by PCR using genomic DNA extracted from each individual tissue, and individuals having homozygous hIL6R knock-in arrays and hIL6 transgenes were selected. Detection of the hIL6R knock-in array was performed using the PCR reaction system described above. That is, the PCR reaction solution consisted of 1. mu.l of sample, 12.5. mu.l of 2 XGC buffer I, 4. mu.l of dNTP (2.5mM), 0.25. mu.l of each primer (50. mu.M), 0.25. mu.l of LA Taq (TAKARA), and 6.75. mu.l of distilled water (25. mu.l in total). In addition, PCR conditions were 94 ℃ for 4 minutes of pre-heating, 94 ℃ for 30 seconds, 62 ℃ for 30 seconds, 72 ℃ for 3 minutes of amplification cycle 35 cycles, and 72 ℃ for 7 minutes of re-heating. As primers, mRLI6_10355 (5'-TCTGCAGTAGCCTTCAAAGAGC-3' (SEQ ID NO: 10)) and mRLI6_11166R (5'-AACCAGACAGTGTCACATTCC-3' (SEQ ID NO: 11)) were used. By the PCR reaction, the knock-in array was detected as a signal of about 2.7kb and the wild type array was detected as a signal of 0.8kb (FIG. 6). Further, detection of the hIL6 transgene was performed by PCR. That is, the PCR reaction solution consisted of 1. mu.l of sample, 2.5. mu.l of 10 XEx buffer, 2. mu.l of dNTP (2.5mM), 0.1. mu.l of each primer (50. mu.M), 0.25. mu.l of Ex Taq (TAKARA), and 19.05. mu.l of distilled water (25. mu.l total). PCR conditions were 94 ℃ for 4 minutes pre-heating, 94 ℃ for 30 seconds, 65 ℃ for 30 seconds, 72 ℃ for 30 seconds amplification cycle 35 cycles, and 72 ℃ for 7 minutes re-heating. The primer used was "5'-ACCTCTTCAGAACGAATTGACAAA-3' (SEQ ID NO: 12)" as the forward primer and "5'-AGCTGCGCAGAATGAGATGAGTTGT-3' (SEQ ID NO: 13)" as the reverse primer. The hIL6 transgene was detected at a chain length of 0.45kb (FIG. 6). In mice with homozygous hIL6R knock-in arrays and hIL6 transgenes, macrolymph node hyperplasia-like symptoms, i.e., generalized lymph node swelling and spleen enlargement were confirmed. From the above, it can be established: the pathological causes were the overproduction of human IL6, and a humanized giant lymph node hyperplasia model mouse in which IL6R as its receptor was also humanized.
(2) Study on therapeutic Effect of humanized giant lymph node hyperplasia model mouse on hIL 6R-specific neutralizing antibody
The humanized giant lymph node hyperplasia model mouse was used to investigate whether the efficacy of the hIL6R neutralizing antibody could be evaluated. Humanized anti-human IL6R monoclonal antibody (toclizumab, hereinafter referred to as TCZ) was administered to the humanized giant lymph node hyperplasia model mouse at 2 mg/subject in tail vein at 4 weeks of age, and 0.1, 0.25, or 0.5 mg/subject of TCZ was subcutaneously administered at a frequency of 2 times/week from the next week over a period of 4 weeks. As a comparative control, 2 mg/individual of rat anti-mouse Il6ra monoclonal antibody (MR16-1) was administered in the tail vein at 4 weeks of age, and 0.1 mg/individual of MR16-1 was administered subcutaneously at a frequency of 2 times/week over a period of 4 weeks from the next week. The group to which the solvent physiological saline is administered is also set. In addition, Il6ra was administered to a wild-type mouse with a gene encoding hIL 6. In addition, only the administration of physiological saline was performed in the same manner using a hIL6R knock-in mouse or a mouse not having hIL6 transgene among wild-type mice of Il6ra as a control group which did not develop a pathological condition. In addition, 5 individuals were used in any experimental group. After the final administration for 4 days, the abdomen was opened under isoflurane inhalation anesthesia, and after total blood collection, euthanasia was performed by exsanguination, and the spleen was collected. The collected blood was separated into heparin plasma and stored in a refrigerator at-80 ℃. Spleen was measured for weight, and a part of the spleen was frozen at-80 ℃ as a preparation of RNA, and the remainder was immersed in 10% neutral buffered formalin.
The spleen weight of hIL6R knock-in mice or wild-type mice without hIL6 transgene were 0.08. + -. 0.01g in the case of solvent-only administration, and no effect on spleen weight was observed due to humanization of the IL6 receptor. Subsequently, in the case of hIL6 transgenic mice having wild-type IL6 receptor, the spleen weight was 0.34. + -. 0.09g in the group administered with the solvent alone, and splenomegaly was confirmed. On the other hand, when only the solvent was administered to the hIL6R knock-in mouse with hIL6 transgene (i.e., humanized giant lymph node hyperplasia model mouse), the spleen weight was 0.26. + -. 0.03g, and even when the IL6 receptor was humanized, the enlargement of the spleen was confirmed in the same manner as in the mouse-type receptor-expressing mouse.
Splenomegaly was significantly inhibited in the humanized megalymph node hyperplasia model mouse by administration of TCZ (fig. 7). That is, spleen weights (mean. + -. standard deviation) in the TCZ-administered groups of 0.1, 0.25 and 0.5 mg/subject were 0.14. + -. 0.03g, 0.14. + -. 0.02g and 0.13. + -. 0.03g, respectively, and a statistically significant weight reduction was confirmed compared with the spleen weight of 0.26. + -. 0.03g in the solvent-administered group. On the other hand, the spleen weight of the MR16-1 administered group was 0.34 mg. + -. 0.11g, and no significant difference was found compared with the solvent administered group. In addition, in the hIL6 transgenic mice with wild-type Il6ra, spleen enlargement was observed at 0.34. + -. 0.09g in the solvent-administered group, but inhibition of spleen enlargement (0.45. + -. 0.26g) was not observed in any of the administered amounts of TCZ, while a significant weight reduction to 0.12. + -. 0.01g was observed in the MR16-1 administered group.
In the pathological histological analysis of the spleen, an increase in plasma cells and an increase in the number of white spleen marrow were confirmed in the humanized megalymph node hyperplasia model mouse, but no improvement was observed in any of the results observed by administration of TCZ (fig. 8, table 1).
TABLE 1
Histopathological analysis of spleen in humanized giant lymph node hyperplasia model mice administered and not administered Tuzumab
Grade: +/-and weak; +, weak; + + +, medium level.
The values in the table represent the number of animals for which observation results were confirmed/the number of animals evaluated.
Administration Tuzhuzumab (TCZ)
Soluble hIL6R concentration in plasma was determined using the Quantikin Human IL-6sR Immunoassay Kit (R & DSsystems, DR 600). Plasma hIL6 concentrations were determined using a Human IL-6 ELISA Kit (Invitrogen, KHC 0062). As a result, it was confirmed that both the plasma-soluble hIL6R concentration and the hIL6 concentration were significantly increased by administration of TCZ to human megalymph node hyperplasia model mice (FIG. 9). That is, the concentration of hIL6R in the plasma-soluble form was 21. + -.7 ng/ml in the solvent-administered group, whereas significant increases to 713. + -.387, 1066. + -.126 and 1120. + -.171 ng/ml were observed with TCZ at 0.1, 0.25 and 0.5 mg/subject and administration at 2 times/week. On the other hand, in the administration of MR16-1, the concentration of plasma-soluble hIL6R was 21. + -.2 ng/ml, which was the same as that in the solvent-administered group. The hIL6 concentration in plasma was 163. + -.112 pg/ml in the solvent-administered group, whereas significant increases to 936. + -.350, 1194. + -.394 and 1204. + -.325 pg/ml were confirmed by TCZ at 0.1, 0.25 and 0.5 mg/subject, 2 administrations per week. On the other hand, in the administration of MR16-1, the plasma hIL6 concentration was 163. + -.36 pg/ml, which was the same as that in the solvent administration group.
It has been reported that the concentration of soluble IL6R and IL6 in blood is increased by administration of TCZ to patients with giant lymph node hyperplasia and patients with chronic rheumatoid arthritis (blood.2008112: 3959-. It was found that prolonged clearance of TCZ by complex formation with soluble IL6R in blood is responsible for the increase in blood concentration of soluble IL 6R. Further, it is also considered that the concentration of IL6 in blood is increased because the presence ratio of IL6R not bound to TCZ is decreased. In this experiment, it was found that soluble hIL6R and hIL6 were increased in the humanized macrolymph node hyperplasia model mouse to which TCZ was administered by the same mechanism. In addition, since the plasma hIL6R concentration of hIL6R knock-in mice and humanized giant lymph node hyperplasia model mice was the same as the blood concentration before administration of TCZ reported in giant lymph node hyperplasia patients and chronic joint rheumatism patients, it is expected to be an effective model mouse for predicting the blood level change of antigen in human patients. In particular, it is contemplated that the ability of an antibody to remove hIL6R from blood can be assessed by monitoring the change in soluble hIL6R in blood after administration of the antibody. In addition, since the test animal is a small experimental animal such as a mouse, the necessary amount of the test antibody for comparative study can be suppressed to a small amount.
Evaluation of anti-TCZ antibody titres in plasma
anti-TCZ antibody titers were determined using plasma samples obtained at necropsy. That is, the plasma sample was mixed with biotin-labeled TCZ antibody and SULFO-TAG-labeled TCZ antibody, incubated overnight, and then added to MSD-streptavidin plate. Subsequently, an ECL (enhanced chemiluminescence) substrate was added to measure the intensity of chemiluminescence. As a result, interleukin-6 receptor was administered via TCZ in wild-type hIL6 transgenic mice, and showed extremely high anti-TCZ antibody titers at any dose, whereas anti-TCZ antibody production was extremely inhibited at any dose of TCZ in humanized macrolymph node hyperplasia model mice (fig. 10). It was thus clarified that the production of anti-TCZ antibody was suppressed by blocking the signal from interleukin-6 by the action of TCZ.
EXAMPLE 3 knock-in of the neomycin resistance Gene into the mouse Pou5f1 Gene locus
(1) Construction of knock-in vectors
The neomycin-resistant (neo) gene was inserted so that the translation initiation site of exon 1 present in the mouse Pou5f1 gene and the translation initiation site of the neomycin-resistant (neo) gene were aligned, and the base sequence deletion after the translation initiation site in exon 1 of the mouse Pou5f1 gene corresponded to 107 base pairs, thereby constructing a knock-in vector. In this case, an hp7pA vector in which the hp7 sequence and the poly A addition signal are ligated immediately below the stop codon of the neo gene, and a control vector in which the hp7 sequence and the poly A addition signal are not ligated and the endogenous poly A addition signal is used were constructed. As a homology arm of the knock-in vector, a genomic DNA 1.7kb upstream of the above-mentioned translation initiation site of the Pou5f1 gene and a genomic DNA of about 5kb after the exon 1 defective region were ligated, and inserted into the vector pMC1DTA (A + T/pau) (Yagi T.et. al. (1993) Anal biochem.214: 77-86). Since a restriction enzyme NotI recognition sequence (GCGGCCGC) was created at the 5' end of the homology arm in the knock-in vector, it was linearized with NotI. The structure of the carrier is shown in FIG. 11A.
(2) Introduction into ES cells
The knock-in vector was introduced into ES cells (from a C57BL/6N mouse) by electroporation, and selection culture was performed using G418. the knock-in vector was linearized with NotI, extracted with phenol/chloroform, then ethanol-precipitated and dissolved in PBS, and used as a reagent for ES cells 2 × 107Electroporation was performed by adjusting the concentration of the introduced knock-in vector to 20. mu.g. In addition, electroporation of ES cells was performed 2 times for each vector in order to confirm reproducibility. ES cells were seeded after electroporation, and from 24 hours later, they were added to the medium so that G418 became 300. mu.g/mL, and selection culture was performed.
(3) PCR screening for detection of homologous recombinant clones
ES cell colonies derived from the hp7pA vector were picked and the efficiency of homologous recombination was investigated. That is, ES cells were cultured in a 96-well plate, and 1 well was washed 2 times with 200. mu.l of PBS solution, and then 5. mu.l of a lysis buffer (10 XTLA buffer II (for TAKARA LA Taq), 5% NP-405. mu.l, 4. mu.l of proteinase K (TAKARA, 20mg/ml), and 36. mu.l of distilled water) having the following composition were added thereto, and the mixture was treated at 55 ℃ for 2 hours and then at 95 ℃ for 15 minutes to inactivate proteinase K, thereby preparing a PCR sample.
The PCR reaction mixture was 1. mu.l of sample, 2.5. mu.l of 10 × LA buffer II, and 25mM MgCl22.5. mu.l, 4. mu.l of dNTP (2.5mM), 0.1. mu.l of each primer (50. mu.M), 0.25. mu.l of LA Taq (TAKARA), and 14.55. mu.l of distilled water (3: (M))Total 25 μ l). The PCR conditions were 94 ℃ for 2 minutes for pre-heating, 98 ℃ for 10 seconds, 60 ℃ for 15 seconds, 35 cycles of amplification at 68 ℃ for 3 minutes, and 68 ℃ for 5 minutes for re-heating.
The primers used are as follows. In a sample of ES cells in which homologous recombination has occurred, a band of about 2.2kb is amplified. For the primers, Pou4175F2 was placed in the genomic region of mouse Pou5F1 located 5' upstream of the homology arm placed on the knock-in vector, and neo8916R was placed in the neo gene cDNA (see fig. 11B). Pou4175F2 (front) 5'-AAGTCGCTGCCTTTATTTAGGTCTTCCAACTAA CC-3' (SEQ ID NO: 14); neo0891R (rear) 5'-TTCAGTGACAACGTCGAGCA CAGCTGC-3' (SEQ ID NO: 15).
The number of clones of ES cells which became G418-resistant, the number of clones of homologous recombination, and the efficiency of cloning after introducing the neo gene knock-in vector into the Pou5f1 gene region are summarized in Table 2.
TABLE 2
Introduction Performance of neo Gene knock-in vector into Pou5f1 Gene region
First, when the control vector was introduced, the growth status of the ES cell colonies was observed 10 days after the inoculation, and as a result, no ES cell colonies with normal growth were obtained. On the other hand, when the hp7pA vector was introduced, ES cell colonies of normal growth were observed.
Since the lengths of the homologous arms of both knock-in vectors are completely the same, it is considered that the efficiency of inserting the neo gene into the target region by homologous recombination is the same, but in the case of the control vector, it is considered that even if the neo gene is inserted into the desired region, only the neo gene is expressed in an amount insufficient to exhibit G418 resistance.
When hp7pA vector was introduced, 167G 418 resistant clones were obtained from 2 electroporation. As a result of analyzing these G418-resistant clones by the above-mentioned PCR system, the clone in which the neo gene was knocked in by homologous recombination was 64 clones (38%) out of 167 clones. When the hp7pA vector was introduced, it is considered that if the neo gene was inserted in a translation initiation site-corresponding manner in the target region of the endogenous Pou5f1 gene by homologous recombination, neo expression was caused under the control of the promoter of the Pou5f1 gene activated in ES cells, and G418 resistance was developed. In addition, considering that in the clone whose PCR result is negative, the neo gene is present not in the target region but at a random position on the chromosome, and is introduced downstream of any gene promoter that is activated in ES cells. That is, it was determined that neo was expressed by the activity of a promoter present in the vicinity of the insertion site, and a clone resistant to G418 was obtained. From these results, it was presumed that sufficient expression level of neo gene was obtained by the presence of hp7 sequence and poly A addition signal, regardless of whether the target region was inserted or random position was inserted.
In this experiment, the neo gene was inserted in line with the translation initiation site of the Pou5f1 gene, and the region of the target gene that was defective was minimized, but the mRNA transcribed from the gene array after the modification with the control vector had a structure in which the inserted stop codon (PTC) of the neo gene existed far upstream of the stop codon of the Pou5f1 gene, and the exon-exon junction derived from the Pou5f1 gene existed downstream of the PTC. It is considered that this structure is recognized by nonsense-mediated mRNA degradation mechanism (NMD mechanism) and mRNA is decomposed, and thus the expression amount of neo gene sufficient to obtain G418 resistance is not obtained. If only the poly-a addition signal is added immediately below the neo gene, the transcribed mRNA forms a structure in which no exon-exon junction derived from the target gene is generated downstream of the PTC, and thus NMD does not occur. However, it is considered that the expression level of mRNA is likely to decrease because of the non-spliced structure (non-patent document 2). On the other hand, in the case where the hp7 sequence forming a strong stem loop is inserted immediately below the neo gene, it can be expected that NMD is likely to be inhibited (non-patent document 4), but the hp7 sequence alone, which is predicted from the description of non-patent document 4, has a weak NMD inhibitory effect and cannot be expected to stabilize gene expression.
In view of the above, the present experimental results strongly suggest that when a foreign gene is introduced into a target gene region using a knock-in vector, the expression of the knocked-in foreign gene can be stabilized by inserting both the hp7 sequence and the poly a addition signal immediately below the foreign gene. In the case where the neo gene is inserted into the target region by homologous recombination regardless of the use of either the control vector or the hp7pA vector, since the 5' -upstream region is completely the same, it is considered that there is no difference between the two vectors in the transcriptional control using the promoter. That is, it is strongly suggested that the difference in the expression level of the neo gene is mainly caused by the simultaneous insertion of both hp7 and the poly A addition signal downstream of the stop codon into the structure of mRNA, thereby stabilizing the mRNA. Furthermore, since the structure of the vector does not cause NMD due to the insertion of a poly a addition signal, it is considered that the action of the hp7 sequence is caused by a newly discovered function different from the known NMD inhibitory effect.
Industrial applicability
The present invention provides a non-human animal capable of deleting the expression of a gene (target gene) endogenous to the non-human animal and expressing a foreign gene at a physiologically appropriate level, and a method for evaluating a compound using the non-human animal. Therefore, the present invention can be utilized particularly for the development of a therapeutic agent having high specificity for a molecular target.
Sequence Listing free text
Sequence No. 1
Sequence < 223 > hp7
Sequence numbers 3-15
< 223 > sequences of artificially synthesized primers
Claims (16)
1. A method for producing a non-human animal, characterized by inserting a DNA, in which a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal are added to the 3' side of a DNA encoding an arbitrary foreign gene, into the same reading frame of an arbitrary target gene present in the genome of a non-human animal, wherein the hp7 sequence is the sequence shown in sequence table 1.
2. The method of claim 1, wherein the foreign gene is a human interleukin-6 receptor gene.
3. The method for producing a non-human animal according to claim 1 or 2, wherein the arbitrary target gene present in the genome of the non-human animal is an interleukin-6 receptor gene.
4. The method for producing a non-human animal according to claim 2, wherein the non-human animal expresses soluble human interleukin-6 receptor at a blood concentration equivalent to that of soluble interleukin-6 receptor in a healthy human.
5. The method of claim 1 or 2, wherein the non-human animal is a rodent.
6. The method of claim 1 or 2, wherein the non-human animal is a mouse.
7. The method for producing a non-human animal according to claim 1 or 2, wherein the non-human animal overexpresses human interleukin-6.
8. A method for evaluating the pharmacokinetic properties of a test substance, the method comprising:
a step (a) of applying a test substance to a non-human animal produced by the method according to any one of claims 1 to 7, and
and (b) measuring the blood concentration of the test substance in the non-human animal to which the test substance has been administered.
9. A method for evaluating the activity of a test substance for removing soluble human interleukin-6 receptor from blood, which comprises:
a step (a) of applying a test substance to a non-human animal produced by the method according to any one of claims 2 to 7,
and (b) measuring the blood concentration of the soluble human interleukin-6 receptor in the non-human animal to which the test substance has been administered.
10. The method according to claim 8 or 9, wherein the test substance is an antibody against human interleukin-6 receptor.
11. A method for producing an antibody directed against the human interleukin-6 receptor with desirable pharmacokinetic properties, the method comprising:
a step (a) of producing an antibody against a human interleukin-6 receptor,
a step (b) of administering the antibody to a non-human animal produced by the method according to any one of claims 2 to 7,
a step (c) of measuring the blood concentration of the antibody in the non-human animal to which the antibody has been administered, and
and (d) screening for an antibody having a desired blood concentration.
12. A method for producing an antibody against a human interleukin-6 receptor having an activity of removing a soluble human interleukin-6 receptor from blood, the method comprising:
a step (a) of producing an antibody against a human interleukin-6 receptor,
a step (b) of administering the antibody to a non-human animal produced by the method according to any one of claims 2 to 7,
a step (c) of measuring the blood concentration of soluble human interleukin-6 receptor in the non-human animal to which the antibody has been administered, and
and (d) screening for an antibody that reduces the blood concentration of the soluble human interleukin-6 receptor.
13. The method for producing an antibody according to claim 11 or 12, further comprising: and (e) chimerizing or humanizing the selected antibody.
14. The DNA used for the method of producing a non-human animal according to any one of claims 1 to 7, wherein the DNA is obtained by adding a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal to the 3' side of a DNA encoding an arbitrary foreign gene, and the hp7 sequence is the sequence shown in sequence Listing 1.
15. The vector for use in the method of producing a non-human animal according to any one of claims 1 to 7, which is a knock-in vector comprising a DNA obtained by adding a DNA encoding a hp7 sequence and a DNA encoding a poly A addition signal to the 3' side of a DNA encoding any foreign gene, wherein the hp7 sequence is the sequence shown in sequence Listing 1.
16. A transformed cell used in the method for producing a non-human animal according to any one of claims 1 to 7, which is introduced with the knock-in vector according to claim 15.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2012201299 | 2012-09-13 | ||
| JP2012-201299 | 2012-09-13 | ||
| PCT/JP2013/074882 WO2014042251A1 (en) | 2012-09-13 | 2013-09-13 | Gene knock-in non-human animal |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| HK1212552A1 HK1212552A1 (en) | 2016-06-17 |
| HK1212552B true HK1212552B (en) | 2018-03-29 |
Family
ID=
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10945418B2 (en) | Genetically modified non-human animal with human or chimeric PD-L1 | |
| US11279948B2 (en) | Genetically modified non-human animal with human or chimeric OX40 | |
| US11317611B2 (en) | Genetically modified non-human animal with human or chimeric PD-L1 | |
| US11505806B2 (en) | Genetically modified non-human animal with human or chimeric OX40 | |
| EP1573314B1 (en) | Transgenic mice expressing human cd20 | |
| US11071290B2 (en) | Genetically modified non-human animal with human or chimeric CTLA-4 | |
| JP6282591B2 (en) | Gene knock-in non-human animal | |
| EP1988768A2 (en) | Gene disruptions, compositions and methods relating thereto | |
| EP1871163A2 (en) | Transgenic models for different genes and their use for gene characterization | |
| JP5075641B2 (en) | Genetically modified animals and uses thereof | |
| JP2001211782A (en) | Tob gene deletion knock out non-human mammal | |
| HK1212552B (en) | Gene knock-in non-human animal | |
| WO2010047423A1 (en) | Method for introducing mutated gene, gene having mutation introduced therein, cassette for introducing mutation, vector for introducing mutation, and knock-in non-human mammal | |
| US20220217956A1 (en) | Rodent Model Of Increased Bone Mineral Density | |
| JP2004267002A (en) | Senescence marker protein 30-deficient animal, antibody and method for preparing the antibody | |
| JPWO2003037081A1 (en) | HCV gene transgenic animals | |
| CN120608103A (en) | A non-human animal modified with AGT and/or REN genes | |
| EP1989939B1 (en) | Method using an oasis gene-deficient mouse | |
| JP2004166596A (en) | Zaq gene-modified animal | |
| JP2004121241A (en) | Human slt gene-introduced animal | |
| WO2017026383A1 (en) | Non-human transgenic mammalian animal expressing human egfr specifically in lungs |