HK1069189B - A method for determining the activity and/or side-effects of a medicament by detecting the ratio of a mitochondrial nucleic acid in relation to a nuclear nucleic acid - Google Patents

A method for determining the activity and/or side-effects of a medicament by detecting the ratio of a mitochondrial nucleic acid in relation to a nuclear nucleic acid Download PDF

Info

Publication number
HK1069189B
HK1069189B HK05101744.2A HK05101744A HK1069189B HK 1069189 B HK1069189 B HK 1069189B HK 05101744 A HK05101744 A HK 05101744A HK 1069189 B HK1069189 B HK 1069189B
Authority
HK
Hong Kong
Prior art keywords
nucleic acid
mitochondrial
dna
rna
ratio
Prior art date
Application number
HK05101744.2A
Other languages
Chinese (zh)
Other versions
HK1069189A1 (en
Inventor
鲍勃.范格曼
伊夫琳.凯瑟琳娜.安娜.克拉西娜.蒂默曼斯
安东尼.德龙德
伊雷妮.约翰娜.莫尼卡.多伯拉尔
Original Assignee
普里马根公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP00204322A external-priority patent/EP1211323A1/en
Application filed by 普里马根公司 filed Critical 普里马根公司
Priority claimed from PCT/NL2001/000883 external-priority patent/WO2002046470A2/en
Publication of HK1069189A1 publication Critical patent/HK1069189A1/en
Publication of HK1069189B publication Critical patent/HK1069189B/en

Links

Description

Method for determining drug activity and/or side effects by detecting ratio of mitochondrial nucleic acid to nuclear gene nucleic acid
Technical Field
The invention relates to the diagnosis of diseases and/or the determination of the function of cellular organisms (cells), which may be multicellular or unicellular, may be macroscopic or microbial.
Background
Disease diagnosticians investigating the function (disorder) of a cellular organism can carry out extensive and intensive investigations of that organism to obtain relevant information about various aspects of the dysfunction. These have been extensively investigated, for example, to examine the relative ratios of kidney stones by studying urine samples from different patients, to investigate the presence or absence of intestinal ulcers by endoscopy, to find tumors by Nuclear Magnetic Resonance (NMR) scanning, to detect diabetes by measuring insulin levels and/or glucose concentrations in plasma, to determine the propensity to canceration by measuring the transcriptional level of oncogenes, and the like.
Current assays for higher organisms such as animal and plant diseases or dysfunctions (or in contrast, the detection of health and normal function) rely on samples obtained from these organisms and studied in the laboratory. Methods that are effective for identifying, identifying or determining a disease or dysfunction of an organism are also found to be useful in testing or screening for compounds or methods that treat or cause such disease or dysfunction. Methods for identifying, identifying or detecting various aspects of a disease can be determined, and such candidate compounds or methods can generally be evaluated for their effectiveness in treating or causing the disease or disorder in which we are discussing. Clearly, life science laboratories have long needed additional information about diseases or dysfunctions and about compounds and methods for inducing or treating diseases or dysfunctions through other intensive studies on organisms.
Disclosure of Invention
The present invention provides a method for determining the function (disorder) of a cellular organism, which method comprises determining the relative proportion of endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample from the organism in relation to another nucleic acid or gene product. In the present invention, the term "relative ratio" means that the amount of said first endosymbiont cellular organelle nucleic acid and/or gene product thereof is compared to the amount of said second nucleic acid and/or gene product thereof. For example, the relative ratio may be a value obtained by dividing the amount of the second nucleic acid or gene product thereof by the amount of the first endosymbiont cellular organelle nucleic acid or gene product thereof, or vice versa. The amount of one or both compounds may also be divided or subtracted by a reference value. The determination of the function of a cellular organism is here understood to mean a compound which detects whether the cellular organism is in a healthy state or whether the organism is affected by something, such as a disease and/or a (toxic). Clinical symptoms may be present after a disease and/or (toxic) compound has an effect on an organism to some extent. It is also possible that a disease and/or (toxic) compound has an effect on an organism but has not yet manifested clinical symptoms.
Endosymbiont organelles include those formed by prokaryotic bacteria present in eukaryotic cells, believed to originate from an early stage of eukaryotic cell evolution. These bacteria (as they are believed) are symbiotic with early eukaryotic cells, and today eukaryotic cells containing these endosymbiont organelles are generally unable to survive without organelles. There is no eukaryotic cell that functions normally without mitochondria in the present day, and most plant cells are at least dysfunctional if not for proplastids or their derived organelles such as chloroplasts, leucoplasts (etioplasts), amyloplasts (amyloplasts), elaioplasts (elaioplasts), or chromoplasts (chromoplasts). In general, these organelles appear to be at least partially self-replicating, yet are fairly autonomous, although also under the control of the nucleus.
In particular, the invention provides a method by which the relative ratio of the endosymbiont cellular organelle nucleic acids and/or its gene products is determined by the amount of essentially nuclear nucleic acid (which may be DNA or RNA) detected in the sample, or the gene product (obtained by transcription and/or translation, such as mRNA or (poly) peptide) of the nuclear nucleic acid (where the nuclear nucleic acid comprises chromosomal DNA and transcribed RNA) present in the nuclear or cytoplasmic components or parts of the sample. The DNA encoding the micronuclein protein (SNRNP) or the corresponding mRNA, or other substantially common nucleic acids from chromosomal DNA, are particularly useful for testing because they are widely available. In this respect, the invention provides a method for studying diseases associated with endosymbiont organelles such as mitochondria and proplastids (proplastids). An endosymbiont cellular organelle-associated disease is defined herein as a condition in which the endosymbiont cellular organelle has a nucleic acid and/or gene product thereof in an amount and/or at least one characteristic different from the natural condition, e.g., the expression of the nucleic acid may be reduced. Endosymbiont organelle-associated diseases are for example encoded by defective DNA of said organelles, manifested in many different syndromes, and its expression is variable (and therefore generally difficult to detect only by testing clinical parameters) due to heterogeneity, which is why mutant and wild-type nucleic acids co-exist in one cell and its distribution is altered. Endosymbiont organelle-associated diseases typically worsen with the age of the affected individual. Endosymbiont cellular organ related diseases are also often observed when other diseases are treated with various drugs, and then contribute to the various side effects of these drugs that are intended to be avoided when treating. These side effects can now be better studied using the methods provided herein.
Furthermore, the invention provides a method according to which the relative ratio of one endosymbiont cellular organelle nucleic acid and/or its gene product is determined by the amount of another (different) endosymbiont cellular organelle nucleic acid (which may be DNA or RNA) detectable in the sample, or by the gene product of the endosymbiont cellular organelle nucleic acid (resulting from transcription and/or translation, such as mRNA or (poly) peptide). One aspect of the invention also includes determining the ratio of organelle DNA (e.g., mtDNA) to its corresponding transcribed organelle RNA (e.g., related mtRNA) or translated gene product. This method allows the determination of the level of transcription and/or translation. When the level of transcription and/or translation is altered from the natural level, it is indicative that the function of the cell has also been altered. The functional alteration may be due to dysfunction of the organelles resulting from a disease or from a particular side effect of a treatment, and the dysfunction may include, for example, a decrease in transcription level. Alternatively, the altered function may also be an improvement in the function of the organelle, for example in the treatment and/or cure of a disease associated with endosymbiotic organelles.
The dysfunction may also comprise an increase in the level of transcription. A disease or treatment of a disease may involve a reduction in endosymbiont organelle DNA. However, said reduction can be at least partially compensated for by an increase in the level of transcription of said DNA in the first phase of said disease. Thus, the amount of RNA derived from the endosymbiont cellular organelle DNA may not be reduced at all, or to a lesser extent, relative to the endosymbiont cellular organelle DNA. In that case the symptoms of the disease or treatment may not be (completely) perceptible. However, if the amount of endosymbiont organelle DNA is further reduced, the amount of RNA derived from the DNA will eventually be significantly reduced. Side effects then occur. Conventionally, the decision whether to treat the disease or to reduce or stop treatment is often based on the clinical manifestations of the side effects. However, in this conventional manner, the patient has suffered from the aforementioned side effects. However, if the method of the present invention is used, side effects including clinical symptoms can be predicted. For example, a change in the level of transcription and/or translation of endosymbiont cellular organelle nucleic acid is an indication of a functional change in a cellular organism, such as an organism suffering from (future) side effects. A change in the relative ratio of endosymbiont cellular organelle DNA and/or its gene product to nuclear nucleic acid or its gene product is also an indication of a change in the functioning of the cellular organism.
In another aspect of the invention, the ratio between two different organelle DNAs or their associated gene products is determined. In one aspect, the method of the invention is provided wherein the first endosymbiont cellular organelle nucleic acid and the second endosymbiont cellular organelle nucleic acid are both from the same organelle. For example, the organelle comprises a mitochondrion.
The method of the invention is particularly suitable for staging of a disease. An organism may have been affected by a disease, although with essentially no or few clinical symptoms. However, while exhibiting essentially no clinical symptoms, the relative ratio of one endosymbiont cellular organelle nucleic acid and/or gene product to another endosymbiont cellular organelle nucleic acid and/or gene product thereof may have been altered. As shown in the examples, such changes in the relative ratios can be detected prior to clinical symptoms and/or conventional testing methods, such as determining the ratio of lactate pyruvate, indicating a change in the function of the organism. Thus, the relative ratios described are well suited to determining the stage of a particular disease. Thus in one aspect the invention provides a method of determining the stage of a disease comprising determining the relative ratio of endosymbiont cellular organelle nucleic acid and/or gene products thereof in a sample taken from an organism experiencing or about to experience said disease.
A method of the invention for staging disease can also be used to diagnose disease. For example, one may routinely test at regular intervals using the methods of the invention, or they may test after clinical symptoms have appeared. A change in the relative ratios indicates that the disease has progressed to some extent. The type of disease need not be diagnosed by the methods of the invention. The invention may also be used for testing of drug candidates to find out the beneficial activity and/or side effects of potential agents or pharmaceutical components such as antiparasitic compounds, antibiotics and cell proliferation inhibitors. For example, the invention provides a method for determining the therapeutic activity and/or possible side effects of a candidate compound, such as determining the effectiveness of a candidate compound in treating a dysfunction of a cellular organism, comprising determining the relative ratio of endosymbiont cellular organelle nucleic acids and/or gene products thereof in a sample derived from said organism, preferably said organism or a substantially related organism (e.g., belonging to the same species or genus) has been treated with said compound. Therapeutic and/or side effects of the candidate compound when administered to an organism are indicated if the relative ratio of endosymbiont cellular organelle nucleic acids and/or gene products of the organism is altered after treatment of the organism with the candidate compound. Furthermore, this also suggests that the compounds may have therapeutic and/or side effects when used in essentially related organisms. Thus, when the method of the invention is used to determine the therapeutic activity and/or side effects of a candidate compound in the treatment of dysfunction in a cellular organism, it is not necessary to use the same organism, but rather a substantially related organism.
In another aspect, the invention provides a method for determining the therapeutic activity and/or possible side effects of an agent comprising determining the relative ratio of endosymbiont cellular organelle nucleic acids and/or gene products thereof in a sample derived from an organism, preferably treated with said agent. According to the present invention, therapeutically active means capable of at least partially treating a disease. In one embodiment of the invention, said therapeutic activity comprises therapeutic activity against an HIV-associated disease and/or a tumor-associated disease. For example, the agent comprises cytostaticum, which may be suitably combined with other antiretroviral therapies. According to the ATHENA study in the netherlands, 40% of patients receiving a reverse transcription treatment need to be replaced with reverse transcription treatment due to adverse side effects. Thus, the method of the invention is very popular in such treatment, as it allows side effects to be found before (severe) clinical symptoms appear. The treatment can then be stopped and/or replaced before the clinical symptoms appear. In that case the clinical symptoms do not occur or occur to a lesser extent. This will prevent much pain. In its preferred aspect, therefore, the present invention provides a method wherein said side effects may be substantially absent when the method is used. According to the present invention, "substantially free" means that the side effects are absent (not yet), or only partially clinically symptomatic.
In one aspect, the compound or agent described in the methods provided herein comprises cytostaticum. Commonly used cytostatica include, for example, alkylating agents, antimitoxic cytostatica, antitumor antibiotics, topoisomerase inhibitors, and the like. Non-limiting examples include chloremobucine, cyclophosphamide (cyclophosfamide), estramustine (estramustine), ifosfamide (ifosamide), melfanothiotempathiufan (treosulfan), carmustine (carmustine), lomustine (lomustine), cisplatin (cissplatine), carboplatin (carboplatin), oxaliplatin (oxaliplatin), dacarbazine (dacarbazine), procarbazine (procarbazine), temozolomide (temozolomide), vinblastine (vindasatine), vincristine (vincristine), vindesine (vindesine), docetaxel (docetaxel), paclitaxel (paclitazone), daunorubine (daunorubine), actinomycin (epirubicin), epirubicin (epothilone), vincristine (vincristine), doxetaxelin (vincristine), doxicadine (epothilone), doxicamide (epothilone), vincristine (epothilone), vincristine (epothilone), vincristine (epothilone), vincristine (epothilone), vincristine (epothilone (, cladribine, hydroxyyarbaide, pentostatin, methotrexate (methotrexaat) and/or raltitrexed (raltitrexed). Nucleoside and/or nucleotide analogs are often used during antiretroviral therapy and/or treatment of tumor-related diseases. These analogs are susceptible to side effects because they interfere with the replication and/or transcription processes of the organism. The amount of endosymbiont cellular organelle nucleic acid is then often altered. Therefore, when an organism is treated with an agent comprising a nucleoside and/or nucleotide analog, it is well suited to the determination by the method of the present invention.
In one aspect, the invention provides a method wherein the compound or agent comprises a nucleoside and/or nucleotide analog. Non-limiting examples of such analogs are fludarabine, mercaptopurine, thioguanine, cytarabine, fluorouracil and/or gemeyrabine. In yet another aspect, the present invention provides a method wherein the compound or medicament comprises AZT, ddl, ddC, d4T, 3TC and/or tenofovir (tenofovir). The organism or substantially related organism in the methods of the invention has preferably been provided together with the compound or organism.
The treatment of certain diseases, such as HIV-related diseases, has to take a long time. The methods of the invention are particularly suitable for diseases that are treated over a long period of time. During said long period of time, many side effects may occur, but now the patient can be regularly checked (yet) without clinical symptoms. Thus, in one aspect, the agent described in the methods provided herein is used for at least 3 months, preferably at least 6 months, more preferably at least 12 months. In one aspect, a method of the invention is provided wherein the agent is administered over a period of at least 3 months, preferably over a period of at least 6 months. In one aspect, the medicament is for the treatment of a chronic disease. Chronic disease here refers to a disease that cannot be completely cured. Once the subject has acquired the disease, the disease will persist in the subject, although clinical symptoms will change constantly. The individual sometimes does not even notice the symptoms. Chronic diseases include diseases such as HIV-related diseases.
The side effects of the compounds herein refer to effects of the compounds other than the intended effects. Said side effects may be undesirable effects. For example, a therapeutic compound can relieve a disease, but also reduce the metabolism of the organism. Said so-called reduction of metabolism is called (negative) side effects. Alternatively, a side effect of the compound may be a beneficial effect, such as immunity to another disease.
Also provided herein are uses for (selective) detection of toxins, such as herbicides, pesticides, antiparasitic compounds, antibiotics, and like compounds. The present invention provides a method for determining the toxicity of a candidate compound, e.g. determining whether it causes a dysfunction of a cellular organism, e.g. by inhibition of cell proliferation or even a cytotoxic effect, said method comprising determining the relative ratio of endosymbiont cellular organelle nucleic acids and/or gene products thereof in a sample derived from said organism, preferably said organism or a related organism, using said compound.
In a preferred embodiment selectivity is also tested for detecting one organism and another substantially unrelated organism, desirably both belonging to different families or orders, preferably different species or phyla, most preferably different kingdoms, using or applying the methods provided herein, preferably by parallel experiments. For example, the selective aspect may be determined by testing the compound in one target organism (e.g., a bacterium or parasite), and if desired only in its cells, and in its host or its cells (belonging to another organism, such as a mammal or plant, which is not substantially related), or by testing the compound in a crop plant or its cells and a weed plant or its cells, which are not substantially related, to determine the selective toxicity or selective therapeutic effect of the compound. It may also be used in parallel or in comparison to normal and abnormal cells from an individual, for example tumour cells from the same individual, to detect or screen compounds which are tumour specific or at least selective for inhibition of cell proliferation or cytotoxicity in the treatment of said individual or other individuals with similar or related disease.
For example, determination of the relative ratio using the methods of the invention can be determined by measuring the amount of the nucleic acid and/or gene product in the sample, typically after at least one treatment step, such as amplification of the target nucleic acid. After measuring the amounts, the relative ratios can be obtained by dividing one amount by another.
Minute amounts of target nucleic acid can be detected and quantified by enzymatic amplification. Enzymatic amplification techniques include, for example, the Polymerase Chain Reaction (PCR)1Nucleic Acid Sequence Based Amplification (NASBA)2SDA, TMA, and other techniques. The specific amplification of the target nucleic acid sequence can be realized by adding two primer sequences in the amplification reaction. At the end of the amplification reaction, the amplified region can be detected using the amplification region-specific probe. Can also be arranged atDetecting an amplified region during the production of said nucleic acid in said amplification reaction. In this latter method, a label signal linked to the probe is detected when the probe hybridizes to a complementary nucleic acid. TaqMan3And molecular signaling probes4;5This is one such probe that enables real-time homogeneous detection in an amplification reaction.
Quantification of a target nucleic acid sequence is typically accomplished by adding a competitor molecule. The competitor molecule uses the same primer as the target nucleic acid and includes a sequence that distinguishes the competitor molecule from the target nucleic acid sequence2;6. The ratio of amplified competitor molecule to target nucleic acid sequence can be used to quantify the target nucleic acid. At the end of or during the amplification reaction, the competitor molecule or target nucleic acid sequence is detected with a probe specific for the competitor molecule or target nucleic acid sequence. In this latter method, when the probe hybridizes to a complementary nucleic acid and the target nucleic acid exceeds a threshold, a signal from the label attached to the probe is detected, and a positive time or cycle number is detected. In another quantification method, the time to positive detection can be quantified without adding a competitor.
Among them, the method of the present invention is very suitable for the detection of the function (disorder) of cellular organisms, the test of candidate drugs and the test of selective toxins. A number of reactions have been carried out using this method and have proven to be a useful tool (see examples). When the double spreading (double spreading) in the result is eliminated, a more accurate result can be obtained by using the method of the invention. Generally, the bi-directional diffusion in the results obtained by the process of the present invention is due to the different conditions of the different reaction mixtures. For example, an amplification step is often necessary to detect and quantify specific nucleic acids in a sample. However, the temperature of the nucleic acid 1 reaction mixture may be slightly higher than the temperature of the nucleic acid 2 reaction mixture, which may result in a higher yield of nucleic acid 1, and thus a higher ratio of the amounts of nucleic acid 1 to nucleic acid 2 than would be obtained if the nucleic acid 1 mixture and the nucleic acid 2 mixture were amplified at the same temperature. Because of the temperature differences in the mixture, the ratio of the two nucleic acids determined in the initial sample does not exactly correspond to the actual ratio of the two. Likewise, minor changes in other conditions, such as the amount of enzyme added, can also result in changes in the measured amounts of nucleic acid 1 and nucleic acid 2. Thus, the measured values of nucleic acids 1 and 2 can be independently varied independently of each other. An independent change of the measured quantities causes a larger change of the calculated ratio of the measured quantities. This is known as bi-directional diffusion in the result. Thus, bi-directional diffusion herein refers to at least one change in the resulting results due to a change in at least one reaction condition of at least two reaction mixtures. For example, the total volume of the two reaction mixtures also varies slightly.
In particular instances, the organism may have bi-directional diffusion out of variance in the relative ratio results of endosymbiont cellular organelle nucleic acids and/or gene products thereof due to certain diseases or treatments. For example, viral polymerase inhibitors are often used in the treatment of HIV. Viral polymerase inhibitors also have an effect on mitochondrial polymerase γ. Thus, during the HIV treatment described, mitochondrial polymerase γ will decrease, resulting in a decrease in the number of mitochondria per cell. If mitochondria are reduced by 50%, side effects will occur. Factor 2 reduces the ratio of mitochondrial DNA to nuclear DNA. However, in some cases, the factor 2-induced reduction of mitochondrial DNA can include bidirectional diffusion in the ratiometric measurement due to the mentioned changes in conditions. Thus, this biologically important difference in mitochondria is not necessarily detectable due to the bi-directional diffusion in the results. Bidirectional diffusion in some instances can reduce the reliability of detection of biologically important differences in the ratio of nucleic acids and/or their gene products. Thus, one embodiment of the invention provides a method for determining the function of a cellular organism in the absence of bidirectional diffusion in the results, comprising determining the relative ratio of endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample derived from said organism relative to another endosymbiont cellular organelle nucleic acid and/or gene product thereof. In a preferred embodiment, the ratio is determined in the same experiment to prevent bi-directional diffusion. This means that the treatment steps and/or the quantification of at least two nucleic acids and/or their gene products are carried out in the same experiment. According to the invention, one reaction mixture is generally used for the experiments. The individual components of the experiments of the invention are preferably mixed randomly in the assay. The reaction mixture may be placed in a reaction tube.
However, one skilled in the art may devise more ways to prevent bi-directional diffusion in the results. For example he/she may use a reaction vessel which is divided into different sections by (semi-) permeable membranes. As long as one reaction condition varies with the different moieties, bi-directional diffusion is avoided and the results obtained are more accurate.
In one embodiment of the current invention, at least two target sequences are amplified in one experiment. The two target sequences may be the endosymbiont cellular organelle nucleic acid and the second nucleic acid. Thus one embodiment of the present invention provides an inventive method comprising amplifying said endosymbiont cellular organelle nucleic acid and said second nucleic acid in the same experiment. When amplifying at least two target sequences in the same experiment, changes in reaction conditions in the experiment can independently affect the amount of each sequence obtained in the experiment. For example, the amount of each sequence obtained in the described experiments will be affected by the same temperature, the same total volume, etc. The two target sequences are then detected during the production of the amplified nucleic acid during the amplification reaction using two specific probes. The two probes may be labeled with two labels that distinguish the two probes and thus the two different sequences. Quantification can be performed by combining the time at which a positive is detected with the relative fluorescence increase of the two real-time amplification reactions. Preferably, a reference curve is made before this. The nucleic acid is then quantified by comparing the value obtained with a reference value. Thus, an internal standard such as a competitor molecule is not required. The comparative quantification of two target nucleic acids in the same experiment is more accurate than the quantification in two separate experiments, and requires less handling time and reagent amount. We have found that two amplification reactions in the same tube provide an immediate indication of the ratio of two target nucleic acids. The conditions of both amplification reactions are identical, eliminating variations in conditions, and also eliminating the need for internal or external calibrators. Thus, bi-directional diffusion in the result is avoided. Thus, in one aspect, the invention provides a method in which the relative ratios are determined directly from the amount of one nucleic acid over the other. Preferably, the relative ratio is determined by comparison with a reference value. According to the invention, directly determining means that the ratio of the two target nucleic acids is immediately indicated, for example by comparing the intensities of the two specific probes labeled with different fluorescence. In this embodiment, the amount of one nucleic acid over the other is the corresponding fluorescence intensity of one nucleic acid over the fluorescence intensity of the other. No internal standard is used in the method of the invention, wherein the relative ratios are directly determined.
In one aspect, the organelle nucleic acid, gene product thereof, second nucleic acid and/or gene product thereof described in the present invention is taken from Peripheral Blood Mononuclear Cells (PBMC) and/or fibroblasts. A method, in particular monocytes, according to the invention is preferred for use, since then a blood sample of the organism can be used. Blood samples are readily available and in large quantities, so the sample used in the methods provided in the preferred embodiments comprises a blood sample.
The methods of the invention are particularly useful for quantifying a variable amount of a target nucleic acid and/or gene product thereof and a stable amount of the target nucleic acid and/or gene product thereof. An example is the quantification of variable amounts of mitochondrial DNA and stable amounts of nuclear gene DNA (two sets per diploid cell). Another example includes quantification of variably expressed RNA such as mitochondrial RNA and constitutively expressed RNA essential for cell survival such as nucleic acids encoding SNRPUlA involved in splicing or other ubiquitous nuclear DNA sources. We found that we can determine the relative ratio of the factor 2 a 3.
In one aspect, the invention provides an inventive method, wherein the first nucleic acid comprises RNA and the second nucleic acid comprises DNA. The method of the invention is particularly suitable for the quantification of the cellular content of e.g. mitochondrial RNA and the cellular content of nuclear genes such as U1. As in example 22.
Furthermore, the present invention provides a diagnostic kit comprising at least one means for using this method according to the present invention, said kit comprising at least one selective primer or probe for amplification and detection of nucleic acids associated with or derived from endosymbiotic organelles, and, if necessary, amplification reagents, such as those exemplified in the detailed description or shown elsewhere in the art. In particular, the invention provides a diagnostic kit comprising more than one primer or probe designed for organelle-associated nucleic acid amplification, preferably supplemented with primers or probes designed for chromosome-associated nucleic acid amplification, such as SNRP specific primers or probes. In particular, the invention also provides a kit comprising at least one primer or probe for amplifying a cellular organelle nucleic acid sequence according to table 1. It is of course preferred that the amplification reagents provided in the kit comprise an enzyme with reverse transcriptase activity as required for PCR or NASBA amplification. Of course the kit comprises a means for detecting the gene product rather than the nucleic acid, and the use of the methods of the invention is also provided herein.
Furthermore, the present invention provides the use of compounds obtainable or detectable according to the method of the invention for the preparation of medicaments, herbicides, insecticides, antiparasitic agents, proliferation inhibitors and the like, as well as medicaments, herbicides, insecticides, antiparasitic agents and the like obtainable, derived or identified according to the method of the invention.
The invention is further explained in the detailed description, in which most of the examples are indicated by examples of testing energy supply and usage centers in this cell, the mitochondrion. However, it is readily understood that this principle is also true when detecting other endosymbiont organelles such as chloroplasts (carbohydrate supply centers in plant cells).
Examples
Ingredients used and general methods
Primers and probes used in the examples are summarized in table 1. The standard NASBA nucleic acid amplification reaction volume is 20. mu.l, and the reaction system comprises: 40mM Tris-pH8.5, 70mM KCl, 12mM MgCl2, 5mM dithiothreitol, 1mM dNTP (each), 2mM rNTP (each), 0.2. mu.M primer (each), 0.05. mu.M molecular signal, 375mM sorbitol, 0.105. mu.g/. mu.l bovine serum albumin, 6.4 units of AMV RT, 32 units of T7 RNA polymerase, 0.08 units of RNAse H and added nucleic acid. Following mixing with the exception of enzyme, sorbitol and/or bovine serum albumin, the RNA was first heated at 65 ℃ for 2 minutes to denature secondary structures in the RNA and the primers annealed to the template prior to addition to the enzyme mixture. The mixture was cooled to 41 ℃ and then the enzyme was added. Amplification was carried out in a fluorimeter (CytoFluor2000) at 41 ℃ for 90min and the fluorescence signal was measured per minute (using a filter set at 530/25nm and 485/30 nm). If the DNA target sequence is amplified, the denaturation temperature is changed to 95 ℃ and the denaturation time is changed from 2min to 5 min.
To achieve quantification, a series of dilutions of the target sequence are amplified using a specific set of primers, and the time at which the reaction becomes positive (time to detect positive (TTP)) is plotted against the amount of nucleic acid added. Thus, a calibration curve is obtained, and if the amount of the nucleic acid to be input is unknown, the amount of the input can be inferred from the curve based on the TTP value of the reaction. FIG. 1 shows an example of a typical standard curve for RNA and DNA quantification.
For some target sequences, there are no available dilution series that can determine the absolute number of copies that are reliable. Those series given are arbitrary units resulting from some measure and not DNA or RNA copy number such as cell equivalent or ET-units. The results are sometimes contrary to what we expect, as if the RNA is less than the DNA.
The cells (fibroblasts and PBMCs) are cultured in standard media well known to those skilled in the art according to standard methods and with the addition of drugs or compounds which may have toxic or stimulatory effects as defined in the examples. Nucleic acids were isolated from cells as described by Boom et al (Boom R, Sol C J, Salimans M, Jansen C L, Wertheim-van DillenpM, van der Noordaa J, 1990.Rapid and simple method for purification of nucleic acids. J Clin Microbiol; 28 (3): 495 and 503) or by using a separation kit purchased from Qiagen (Qiagen GmbH, VoMax lmer Strass 4, 40724 Hilden, Germany) according to the manufacturer's operating manual. A small amount of the isolated nucleic acid solution was analyzed by agarose gel electrophoresis and the remainder was stored at-80 ℃ for further analysis. Usually, 5. mu.l of nucleic acid was diluted 10-fold with water and used for the NASBA amplification reaction.
Example 1
In this example it is illustrated which ratios can be measured according to the method of the invention and the diagnostic significance of these ratios:
for example, the present invention provides methods for determining the ratio of organelle DNA in comparison to chromosomal DNA. When the ratio is compared to normal or measured at least at two time points, the ratio indicates a decrease or increase in organelles in each cell. The invention also provides methods for determining the ratio of organelle RNA to chromosome-encoded RNA. When this ratio is compared to normal or measured at least at two time points, it is indicative of a decrease or increase in the transcriptional activity of the organelles in each cell, normalizing the activity state (i.e., transcriptional state) of the cell.
Also provided are methods for determining the ratio of organelle RNA to chromosomal DNA. When this ratio is compared to normal or measured at least at two time points, it indicates a decrease or increase in the transcriptional activity of the organelles in each cell.
Also provided are methods for determining the ratio of organelle DNA to organelle RNA. When this ratio is compared to normal or measured at least at two time points, that ratio indicates a decrease or increase in organelle transcription activity in each cell, indicating regulation at the transcription level to achieve a certain mRNA (and thus protein) level.
Also provided are methods for determining the ratio of organelle DNA to chromosome-encoded RNA. When the ratio is compared to normal or measured at least at two time points, the ratio indicates a decrease or increase in transcriptional activity in the cell, relative to the level of transcription of the chromosomal RNA, indicative of the organelle activity state. This method is particularly useful when the chromosomal RNA being assayed encodes an organelle protein or other component.
Example 2
Fibroblasts were cultured in vitro for 4 weeks, and antiviral drugs DDC, AZT and D4T were added to the medium, respectively, at two concentrations, 3. mu.M and 30. mu.M, respectively. Controls were made with ethidium bromide added to the cell culture and no drug added to the cell culture. Ethidium bromide is known to completely deplete mitochondria in cells and therefore acts as a positive control with an effect on mitochondrial content in cells. At weekly intervals, a portion of the cells were harvested and analyzed for the amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) according to the NASBA protocol. The ratio of mitochondrial DNA to chromosomal DNA did not show measurable changes in cultures supplemented with AZT, D4T and no additives over a 4-week culture period. The amount of mitochondrial DNA in cells to which ethidium bromide was added decreased as expected. The results for DDC are shown in figure 2.
The data in figure 2 clearly show that the amount of mitochondrial DNA in each cell was reduced by at least 2 log values, thus demonstrating the mitochondrial toxicity of the antiviral drug DDC.
Example 3
Fibroblasts were cultured in vitro for 4 weeks, and antiviral drugs DDC, AZT and D4T were added to the medium, respectively, at two concentrations, 3. mu.M and 30. mu.M, respectively. Controls were made with ethidium bromide added to the cell culture and no drug added to the cell culture. Ethidium bromide is known to completely deplete mitochondria in cells and therefore acts as a positive control with an effect on mitochondrial content in cells. At weekly intervals, a portion of the cells were harvested and analyzed for mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpRmb) according to the NASBA protocol described. The ratio of mitochondrial RNA to chromosomal RNA showed no measurable change in the cultures with AZT, D4T and no additives over a 4-week culture period. As expected, the amount of mitochondrial RNA in cells to which ethidium bromide was added was reduced. The results for DDC are shown in figure 3. The data in figure 3 clearly show that the amount of mitochondrial RNA per cell is reduced by at least 2 log values, thus demonstrating the mitochondrial toxicity of the antiviral drug DDC. The three week time point corresponds to a very low rate, presumably an escape value (outliersummary).
Example 4
Fibroblasts were cultured in vitro for 4 weeks, and antiviral drugs DDC, AZT and D4T were added to the medium, respectively, at two concentrations, 3. mu.M and 30. mu.M, respectively. Controls were made with ethidium bromide added to the cell culture and no drug added to the cell culture. Ethidium bromide is known to completely deplete mitochondria in cells and therefore acts as a positive control with an effect on mitochondrial content in cells. At weekly intervals, a portion of the cells were harvested and analyzed for the amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) according to the NASBA protocol described.
The ratio of mitochondrial RNA to chromosomal DNA did not show measurable changes in the cultures with AZT, D4T and no additives over a 4-week culture period. As expected, the amount of mitochondrial RNA in cells to which ethidium bromide was added was reduced. The results for DDC are shown in figure 4.
The data in figure 4 clearly show that the number of mitochondrial RNAs per cell was reduced by at least 2 log values, thus demonstrating the mitochondrial toxicity of the antiviral drug DDC. The three week time point corresponds to a very low ratio, presumably an escape value.
Example 5
Fibroblasts were cultured in vitro for 4 weeks, and antiviral drugs DDC, AZT and D4T were added to the medium, respectively, at two concentrations, 3. mu.M and 30. mu.M, respectively. Controls were made with ethidium bromide added to the cell culture and no drug added to the cell culture. Ethidium bromide is known to completely deplete mitochondria in cells and therefore acts as a positive control with an effect on mitochondrial content in cells. Every week, a portion of the cells were harvested and analyzed for the amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) according to the NASBA protocol.
The ratio of mitochondrial RNA to mitochondrial DNA did not show measurable changes in the cultures with AZT, D4T and no additives over a 4-week culture period. As expected, the amount of mitochondrial RNA in cells to which ethidium bromide was added was reduced. The results for DDC are shown in figure 5.
The data in figure 5 clearly show that the amount of mitochondrial RNA per cell was reduced by at least 2 log values, thus demonstrating the mitochondrial toxicity of the antiviral drug DDC. The three week time point corresponds to a very low ratio, presumably an escape value.
Example 6
Fibroblasts were cultured in vitro for 4 weeks, and antiviral drugs DDC, AZT and D4T were added to the medium, respectively, at two concentrations, 3. mu.M and 30. mu.M, respectively. Controls were made with ethidium bromide added to the cell culture and no drug added to the cell culture. Ethidium bromide is known to completely deplete mitochondria in cells and therefore acts as a positive control with an effect on mitochondrial content in cells. Every other week, part of the cells were harvested and analyzed for the amount of chromosomal-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) according to the NASBA protocol.
The ratio of mitochondrial RNA to mitochondrial DNA did not show measurable changes in the cultures with AZT, D4T and no additives over a 4-week culture period. As expected, the amount of mitochondrial RNA in cells to which ethidium bromide was added was reduced. The results for DDC are shown in figure 6.
The data in figure 6 clearly show that the ratio of chromosomal DNA to RNA did not change significantly over the 4 week culture period.
Example 7
Fibroblasts were cultured in vitro for 4 weeks in the presence of the antiviral drug DCC at a concentration of 30. mu.M. The cells were then cultured without DCC. During the culture period without DCC, at 12 weeks, a portion of the cells were harvested and analyzed for the amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) by the NASBA protocol described. The analytical results are shown in FIG. 7.
The results in figure 7 clearly show that the mitochondrial mass increased by more than 2 log values per cell when DCC was removed from the culture. This result suggests that the toxic effects of DDC can be reversed if some mitochondria remain in the cell to be reaggregated in newly grown cells.
Example 8
Fibroblasts were cultured in vitro for 4 weeks in the presence of the antiviral drug DCC at a concentration of 30. mu.M. The cells were then cultured without DCC. During the culture period without DCC, at 12 weeks, a portion of the cells were harvested and analyzed for mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) according to the NASBA protocol described. The analysis results are shown in FIG. 8.
The results in figure 7 clearly show that the amount of mitochondrial RNA per cell increased by more than 2 log values when DCC was removed from the culture. This result indicates that the toxic effects of DDC can be reversed and that mitochondrial function through RNA and subsequent protein synthesis is also restored.
Example 9
Fresh Peripheral Blood Mononuclear Cells (PBMC) from healthy blood donors were cultured in vitro for 5 days, and the antiviral drugs DDC, AZT and D4T were added to the culture broth, at two concentrations, 6. mu.M and 60. mu.M, respectively. Controls were cell cultures with DMSO and without drug added to the cell culture. DMSO is part of the solvent that dissolves the drug. Cells were harvested after 5 days and analyzed for the amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) according to the NASBA protocol described.
The ratio of the culture with AZT, D4T, DMSO and no additives showed no measurable change over the 5 day culture period. The results for DDC are shown in figure 9.
The results in fig. 9 clearly show that the amount of mitochondrial DNA per PBMC decreased by more than 1 log over the 5 day culture period.
Example 10
Fresh Peripheral Blood Mononuclear Cells (PBMC) from healthy blood donors were cultured in vitro for 5 days, and the antiviral drugs DDC, AZT and D4T were added to the culture broth, at two concentrations, 6. mu.M and 60. mu.M, respectively. Controls were cell cultures with DMSO and without drug added to the cell culture. DMSO is part of the solvent that dissolves the drug. Cells were harvested after 5 days and analyzed for the amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpRmb) according to the NASBA protocol described.
The ratio of the culture with AZT, D4T, DMSO and no additives showed no measurable change over the 5 day culture period. The results for DDC are shown in figure 10. Interestingly, the results of figure 10 did not clearly show a decrease in the amount of mitochondrial RNA per PBMC at the highest DCC concentration over the 5 day culture period. This is in contrast to the results for mitochondrial DNA shown in example 9. It is likely that the increase in transcription compensates for the decrease in mitochondrial DNA, thereby maintaining mitochondrial RNA levels. This mechanism delays the reduction of mitochondrial RNA.
Thus, it can be said that mitochondrial RNA is a response to the current state of mitochondrial function, and that mitochondrial DNA is a precursor to future problems with (near) mitochondrial function, and is therefore more predictive.
Example 11
DNA and RNA of chloroplast of Oryza sativa (rice) can be quantified using primers and probes Rubisco-DNA p1, Rubisco-DNA p2, Rubisco-DNAMB, Rubisco-RNA p1, Rubisco-RNA p2, and Rubisco-RNA-MB (Table 1), and the ratio of chromosomal DNA and RNA can be determined using primers and probes Oryza DNA p1, Oryza DNA p2, Oryza DNA MB, Oryza RNA p1, Oryza RNA p2, Oryza RNA MB (Table 1). In the case of herbicidal (or other) compounds, the condition of the plant can be assessed by measuring the cellular chloroplast nucleic acid content using amplification methods such as PCR and NASBA, which are well known to those skilled in the art. Meanwhile, a set of primers specific to grass can be used for monitoring the unnecessary damage condition of the plants. It is clear that these molecular tools are very suitable for the study of new herbicides, in particular herbicides which attack only one plant specifically and no damage to the others.
Example 12
In this example, the reaction volume of the NASBA nucleic acid amplification reaction of the DNA target sequence was 20. mu.l, and the reaction system further included: 40mM Tris-pH8.5, 70mM KCl, 12mM MgCl2, 5mM dithiothreitol, 1mM dNTP (each), 2mM rNTP (each), 0.2. mu.M primer (each), 0.05. mu.M molecular signal, 1.5 units restriction enzyme Msp I, 375mM sorbitol, 0.105. mu.g/. mu.l bovine serum albumin, 6.4 units AMV RT, 32 units T7 RNA polymerase, 0.08 units RNAse H, and added nucleic acid. Following mixing with the exception of enzyme, sorbitol and/or bovine serum albumin, the DNA is denatured to allow annealing of the primer to the template by incubation at 37 ℃ for 25min followed by denaturation at 95 ℃ for 2min prior to addition to the enzyme mixture. The mixture was cooled to 41 ℃ and then the enzyme was added. Amplification was carried out in a fluorimeter (CytoFluor2000) at 41 ℃ for 90min and the fluorescence signal was measured per minute (using a filter set at 530/25nm and 485/30 nm). If the DNA target sequence is amplified, the denaturation temperature is changed to 95 ℃ and the denaturation time is changed from 2min to 5 min. To achieve quantification, a series of dilutions of the target sequence are amplified using a specific set of primers, and the time point at which the reaction becomes positive (time to detect positive (TTP)) is plotted against the amount of nucleic acid added. Thus, a calibration curve is obtained, and if the amount of the nucleic acid to be input is unknown, the amount of the input can be inferred from the curve based on the TTP value of the reaction. FIG. 1 shows an example of a typical standard curve for RNA and DNA quantification. For quantification, serially diluted target sequences were amplified with specific primer sets and the time point at which the reaction reached positive (time to detect positive (TTP)) was plotted against the amount of nucleic acid input. Fresh Peripheral Blood Mononuclear Cells (PBMCs) from healthy donors were cultured in vitro for 5 days. After 5 days, the cells were collected and the amount of chromosomal DNA (primers SnrpDp1 and SnrpD2 p2 and probe SnrpD mb) was analyzed by the NASBA method described in the section "ingredients and general methods" and compared with the results obtained by the NASBA method in this example as clearly seen in FIG. 11, pretreatment with endonuclease before the NASBA reaction was much more effective than that without treatment. The principle is the direct extension of Msp I generated from the T7 promoter portion of the p1 primer.
Example 13
Chloroplast DNA and RNA of Oryza sativa (rice) can be quantified using primers and probes tRNA-L-D p1, tRNA-L-D p2, tRNA-L-D MB, petRNA p1, petB RNA p2, and petB RNA MB (Table 1), and chromosomal DNA and RNA ratios can be determined using primers and probes OryzaDNA p1, OryzaDNA p2, OryzaDNA MB, OryzaRNA p1, OryzaRNA p2, and OryzaRNA MB (Table 1). In the case of herbicidal (or other) compounds, the condition of the plant can be assessed by measuring the cellular chloroplast nucleic acid content using amplification methods such as PCR and NASBA, which are well known to those skilled in the art. Meanwhile, a set of primers specific to grass can be used for detecting unnecessary damage conditions of plants. It is clear that these molecular tools are very suitable for the study of new herbicides, in particular herbicides which attack only one plant specifically and no damage to the others.
Example 14
Thousands of plasmids containing Snrp DNA and 4X 105、2×105、105、5×104、2.5×104Or 104Plasmid molecules containing mitochondrial DNA are mixed and used as input nucleic acid for the reaction. The reaction system was similar to that of example 12, except that the primers and signals used to amplify Snrp-nuclear and mitochondrial DNA in one tube were different. The reaction mixture (double mix) included two sets of primers and signals: SnrpD p1 and SnrpD p2, MtD p1-2 and MtD p2-2 (each 0.2. mu.M) and signals SnrpD mb (ROX-label) and MtD mb-2 (FAM-label) (each 0.05. mu.M). Restriction enzyme digestion, amplification and detection were the same as in example 12. The filter set of the fluorometer (CytoFluor2000) is suitable for the simultaneous detection of FAM and ROX-label (FAM at 485/20 and 530/25 nm; ROX at 590/20 and 645/40 nm). In a simultaneous reaction of two competitive amplifications, the slope of the fluorescence curve versus time is proportional to the number of molecules in each amplified species (see FIG. 12).
Example 15
PBMC were cultured without and with the addition of 5. mu.M DDC, respectively. Samples were taken after 5 days of culture. According to the method of Boom et al from 105Nucleic acids were isolated from PBMC cells and dissolved in 50. mu.l of water containing no DNAse and RNAse. Then, the cells were diluted 10-fold and 100-fold, respectively, and 5. mu.l of each dilution (corresponding to 1000 or 100 PBMC cells, respectively) was added to the reaction mixture to amplify the specific target nucleic acid. Likewise, 10 comprising SnrpDNA3Plasmid molecules and 4X 10 DNA containing mitochondrial DNA5、2×105、105Or 5X 104The plasmid molecules are mixed and then added to the reaction mixture. The reaction system was similar to that of example 12, except that the primers and signals used to amplify Snrp-nuclear and mitochondrial DNA in one tube were different. The reaction mixture (double mix) included two sets of primers and signals: SnrpD p1 and SnrpD p2, MtD p1-2 and MtD p2-2 (each 0.2. mu.M) and the signals SnrpD mb (ROX-labeled) and MtD mb-2 (FAM-labeled) (each 0.05. mu.M). Restriction enzyme digestion, amplification and detection were the same as in example 12. The filter set of the fluorometer (CytoFluor2000) is suitable for the simultaneous detection of FAM and ROX-label (FAM at 485/20 and 530/25 nm; ROX at 590/20 and 645/40 nm). In a simultaneous reaction of two competitive amplifications, the slope of the fluorescence curve versus time is proportional to the number of molecules in each amplified species. The data for the plasmid Snrp/mitochondrial DNA mixture were used to make a standard curve from which the ratio of mitochondrial to Snrp nuclear DNA could be estimated after 10-fold and 100-fold dilution of PBMC samples in the presence and absence of 5 μ M ddC (see figure 13).
Example 16
4 blood samples were taken from the blood of one HIV-1 infected patient who died from severe lactic acidosis and analyzed for mitochondrial content in Peripheral Blood Mononuclear Cells (PBMC). Sample 1 was taken 1 year before the patient died, sample 2 was taken 3 months before the patient died, sample 3 was taken 1.5 months before the patient died, and sample 4 was taken at the time the patient just died. Peripheral Blood Mononuclear Cells (PBMC) were prepared from blood using the Ficoll-Isopaque purification method. PBMC cells were cryopreserved in 5% DMSO-supplemented medium and stored in liquid nitrogen. Nucleic acids were extracted from 10PBMC using Boom's method. Is equivalent to 105The nucleic acids of individual PBMC cells were used as input nucleic acids for NASBA for the determination of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb). Primer and probe sequences are shown in Table 1. The results of this analysis are expressed as the number of mitochondrial DNA copies per chromosomal DNA copy (see fig. 14). The results of this experiment are expressed as the number of mitochondrial DNA copies per chromosomal DNA copy (see fig. 14).
Example 17
In this example, different ratios of mitochondrial and chromosomal DNA target sequences in plasmids were analyzed: comprises 2 x 103Ula DNA/8×103Mt DNA、2×103Ula DNA/2×104MtDNA、2×103UlaDNA/4×104MtDNA、2×103UlaDNA/105MtDNA、2×103Ula DNA/2×105Mt DNA、2×103Ula DNA/4×105Mt DNA and 2X 103Ula DNA/8×105MtDNA molecules. The reaction mixture was prepared similarly to that in example 12 except that primers and signals for amplifying chromosomal and mitochondrial DNAs were different in the same tube. The reaction mixture (double mix) contained two sets of primers and signals: SnrpD P1 and SnrpD 2P 2 (first set of primers, 0.2. mu.M each), MtD P1-2 and MtD P2-2 (second set of primers, 0.3. mu.M each), and SnrpD mb-2 (FAM-labeled) and MtD mb-3 (ROX-labeled) (0.04. mu.M each). The primer and signal sequences are shown in Table 1. Restriction enzyme digestion, amplification and detection were the same as in example 12. The filter set of the fluorometer (CytoFluor2000) is suitable for the simultaneous detection of FAM and ROX-label (FAM at 485/20 and 530/25 nm; ROX at 590/20 and 645/40 nm). In a simultaneous reaction of two competitive amplifications, the slope of the fluorescence curve versus time is proportional to the number of molecules in each amplified species. The results are shown in FIG. 16. The relationship between the slope coefficients of FAM and ROX signals is linearly related to the ratio of input mitochondrial DNA to chromosomal DNA. This result can be plotted as a calibration curve, and the standard calibration curve can then be used to calculate the number of copies of mitochondrial DNA per cell.
Example 18
Fibroblasts were cultured for 4 weeks in the presence of the antiviral drug DDC (30 μ M), and then cultured for another 6 weeks in the presence and absence of DDC, respectively. During the incubation period, a portion of the cells are collected and analyzed for lactate-pyruvate ratio using standard methods well known to those skilled in the art. The results of the measurement of the lactate-pyruvate ratio are shown in FIG. 17.
The data in figure 17 clearly show that the lactate-pyruvate ratio increases in the presence of DCC, although a very significant increase is observed only after 4 weeks of culture. The ratio of lactate-pyruvate of the cells remained high in the continued culture in the presence of DCC, while the ratio of lactate-pyruvate decreased to normal in the culture in which DCC was no longer added after 4 weeks of culture.
Furthermore, we also determined the ratio of mitochondrial DNA and chromosomal DNA in the same samples as in example 17. The results are shown in FIG. 18.
The data in figure 18 clearly illustrate the loss of mitochondrial DNA from fibroblasts in the presence of DCC (gradual decrease in black lines in the top panel). After two weeks of incubation in the presence of DCC, a significant decrease in mitochondrial content was observed, whereas after three weeks hardly any mitochondrial DNA was observed. Unlike these data, the conventional lactate-pyruvate assay only detected significant changes after four weeks. These results clearly show that measuring the amount of mitochondrial DNA allows a timely predictive assessment of its effect on function.
When the culture was continued in the presence of DDC, the amount of mitochondrial DNA was kept at a very low level (two panels on the bottom left). When the culture was continued without DDC, there was a clear rebound in the amount of mitochondrial DNA in fibroblasts (bottom right two panels).
Example 19
PBMC were cultured for 11 days in the presence of the antiviral drug DDC (5. mu.M) and drug solvent (DMSO) at the corresponding concentration was used as a control. During the culture, a portion of the cells was collected every two days and analyzed for the ratio of mitochondrial DNA and Ula DNA as described in example 17. The results are shown in FIG. 19.
The data from this experiment clearly show that the mitochondrial DNA content of PBMC cells cultured in the presence of DCC decreases rapidly. Compared with the control, the content of mitochondrial DNA in the PBMC cells cultured in the presence of DCC is reduced to 20% the next day. The copy number of mitochondrial DNA in PBMCs cultured in the presence of DCC was further reduced to undetectable levels on day 11.
Example 20
48 HIV-1 infected patients were randomized to antiviral treatment with AZT, AZT + ddI or AZT + ddC, respectively. Blood samples were taken at 0, 4, 24 and 48 weeks after treatment initiation. Peripheral blood mononuclear cells were prepared from blood by Ficoll-Isopaque purification. PBMC cells were cryopreserved in 5% DMSO-supplemented medium and stored in liquid nitrogen prior to use.
By Boom method from 105Nucleic acid was extracted from each PBMC. Nucleic acids equivalent to 1,000 PBMCs were subjected to one-tube real-time duplex NASBA as described in example 17 to determine mitochondrial and chromosomal DNA. The results of the assay are expressed as the mitochondrial content in individual cells (i.e., PBMCs) in the patient sample. Table 2 summarizes the results.
mtDNA content of patient PBMC at the start of treatment was compared to mtDNA content at 4, 24 and 48 weeks of treatment and analyzed for statistically significant changes (see table 3 and figures 20 and 21). These data clearly show a significant reduction in mitochondrial DNA content in PBMCs of patients treated with AZT + ddI or ddC.
Example 21
In this example, different ratios of mitochondrial RNA and chromosomal DNA target sequences in plasmids were analyzed: comprises 2 x 103 Ula DNA/5×104 Mt RNA、2×103 UlaDNA/2.5×105Mt RNA、2×103 Ula DNA/5×105Mt RNA、2×103 UlaDNA/2.5×106Mt RNA、2×103Ula DNA/5×106Mt RNA、2×103 UlaDNA/107/Mt RNA、2×103Ula DNA/2.5×107Mt RNA molecules. The reaction mixture was prepared similarly to that in example 12 except that primers and signals for amplifying chromosomal DNA and mitochondrial RNA were different in the same tube. The reaction mixture (double mix) contained two sets of primers and signals: SnrpD P1 and SnrpD 2P 2 (first set of primers, 0.2. mu.M each), MtR P1-2 and MtR P2-2 (second set of primers, 0.3. mu.M each), and SnrpD mb-2 (FAM-labeled) and MtR mb-3 (ROX-labeled) (0.04. mu.M each). The primer and signal sequences are shown in Table 1. Restriction enzyme digestion, amplification and detection were the same as in example 12. A filter set (CytoFluor2000) for a fluorometer is suitable for the simultaneous detection of FAM and ROX-labelsNote (FAM at 485/20 and 530/25 nm; ROX at 590/20 and 645/40 nm). In a simultaneous reaction of two competitive amplifications, the slope of the fluorescence curve versus time is proportional to the number of molecules in each amplified species. The results are shown in FIG. 22. The relationship between the slope coefficients of FAM and ROX signals is linearly related to the ratio of input mitochondrial RNA to chromosomal DNA. This result can be plotted as a calibration curve, and the standard calibration curve can then be used to calculate the number of copies of mitochondrial DNA per cell.
Example 22
Fibroblasts were cultured for 8 weeks in the presence of the antiviral drug DDC (30 μ M), and then cultured for another 8 weeks in the presence and absence of DDC, respectively. During this incubation time, a fraction of the cells were collected at different time points and analyzed for the ratio of mitochondrial RNA and chromosomal DNA using the method described in example 21. The results are shown in FIG. 23.
The data in figure 23 clearly show that mitochondrial RNA is lost from fibroblasts when culture is continued in the presence of DDC, and mitochondrial RNA remains in a very low amount in the presence of DCC. When the culture was continued in the absence of DDC, there was a clear rebound in the amount of mitochondrial RNA in fibroblasts (time points 10, 12, 14 and 16 weeks).
Example 23
Mitochondrial RNA levels were analyzed in PBMCs of 2 HIV-1 infected patients (patients 1 and 2) treated with antiviral therapy (AZT + ddI). Blood samples were taken at 0, 4, 24 and 48 weeks after treatment initiation. Peripheral blood mononuclear cells were prepared from blood by Ficoll-Isopaque purification. PBMC cells were cryopreserved in 5% DMSO-supplemented medium and stored in liquid nitrogen prior to use.
By Boom method from 105Nucleic acid was extracted from each PBMC cell. Mitochondrial RNA and chromosomal DNA were determined by single-tube real-time duplex NASBA using nucleic acids equivalent to 1,000 PBMCs as described in example 21. The results of the assay are expressed as the amount of mitochondrial RNA (i.e., PBMC) in each cell. Table 4 shows the resultsAnd (5) carrying out knotting.
There appeared to be no significant change in mitochondrial RNA content in PBMCs of patients 1 and 2 after treatment (drug and dose) in this study. Current research will involve more individuals and different therapies to allow a better assessment of changes in mitochondrial RNA brought about by treatment including nucleoside analogues.
TABLE 1 primers and probes used in the examples
Name (R) Sequence of1
MtD p1 5′AATTCTAATACGACTCACTATAGGGAGAAGAGCCGTTGAGTTGTGGTA3′
MtD p2 5′TCTCCATCTATTGATGAGGGTCTTA3′
MtD mb 5′GCATGCCCCTCCTAGCCTTACTACTAATGCATGC
MtD p1_2 AATTCTAATACGACTCACTAAGGGAAGAACCGGGCTCTGCCATCTTAA
MtD p2_2 GTAATCCAGGTCGGTTTCTA
MtD mb_2 GGACCCCCCACACCCACCCAAGAACAGGGTCC
SnrpD p1 5′AATTCTAATACGACTCACTATAGGGAGAGGCCCGGCATGTGGTGCATAA3′
SnrpD p2 5′TTCCTTACATCTCTCACCCGCTA3′
SnrpD mb 5′GCATGCTGTAACCACGCACTCTCCTCGCATGC 3′
SnrpD2 p2 5′TGCGCCTCTTTCTGGGTGTT 3′
MtR p1 5′AATTCTAATACGACTCACTATAGGGAGGAGAAGATGGTTAGCTCTAC3′
MtR p2 5′CGATATGGCGTTCCCCCGCATAAA3′
MtRmb 5′GCTCCGAAGCTTCTGACTCTTACCTCCCCGGAGC3′
MtR p1_2 AATTCTAATACGACTCACTATAGGGAGAGGAGACACCTGCTAGGTGT
MtR p1_3 AATTCTAATACGACTCACTATAGGGAGAAGGGTAGACTGTTCAACCTGTT
MtR p2_2 GGTGCCCCCGATATGGCGTTCC
MtR p2_3 GTAATAATCTTCTTCATAGTAA
SnrpR p1 5′AATTCTAATACGACTCACTATAGGGAGAGGCCCGGCATGTGGTGCATAA3′
SnrpR p2 5′CAGTATGCCAAGACCGACTCAGA3′
SnrpR mb 5′CGTACGAGAAGAGGAAGCCCAAGAGCCACGTACG3′
SnrnpR p1_2 AATTCTAATACGACTCACTATAGGGAGAAGAAGATGACAAAGGCCTGGCC
SnrnpR p1_3 ATTTCTAATACGACTCACTAAGGGAGAAAAAGGCCTGGCCCCTCATCTT
SnrnpR p2_2 TCCATGGCAGTTCCCGAGA
Name (R) Sequence of1
SnrnpR p2_3 CACTATTTATATCAACAACC
SnRNpR p2_4 TCAATGAGAAGATCAAGAA
SnrnpR mb_2 CGATCGAGTCCCTGTACGCCATCTTCCGATCG
Rubisco-DNA p1 5′AATTCTAATACGACTCACTATAGGGGGATAATTTCATTACCTTCACGAG3′
Rubisco-DNA p2 5′GGAGTCCTGAACTAGCCGCAG3′
Rubisco-DNA MB 5′GCATGCGGTAGATAAACTAGATAGCTAGGCATGC3′
Rubisco-RNA p1 5′AATTCTAATACGACTCACTATAGGGGAGTTGTTGTTATTGTAAGTC3′
Rubisco-RNA p2 5′CAAGTCTTATGAATTCCTATAG3′
Rubisco-RNA-MB 5′GCTAGCACACAGGGTGTACCCATTATGCTAGC3′
OryzaDNA p1 5′AATTCTAATACGACTCACTATAGGGGGATCTTAATTACATGCCGTTCA3′
OryzaDNA p2 5′AAAGGTGCCGGTTCTCACTA3′
OryzaDNA mb 5′GCTAGCCTCTGCAAGCTTCATCAGTAATAGGCTAGC3′
OryzaRNA p1 5′AATTCTAATACGACTCACTATAGGGGCTAATGCCCTTTTCTTTTCTTCCTC3′
OryzaRNA p2 5′CATATTGGCTTTCGAAGATT3′
OryzaRNA mb 5′GCTAGCCTTCAGCCATTATTCAAGATGGTGGCTAGC3′
tRNA-L-D p1 5′AATTCTAATACGACTCACTATAGGGGGGTTCTAGTTCGAGAACCGCTTG3′
tRNA-L-D p2 5′GCGAAATCGGTAGACGCTACG3′
tRNA-L-D MB 5′GCTAGCCAACTTCCAAATTCAGAGAAGCTAGC3′
petB RNA p1 5′AATTCTAATACGACTCACTATAGGGAAACCGGTAGCAACTTGTACTAG3′
petB RNA p2 5′GGTTTCGGTATCTCTGGAATATGAG3′
petB RNA MB 5′GCTAGCGAGGAACGTCTTGAGATTCAGCTAGC3′
SnrnpD mb_2 CGCATGCTGTAACCACGCACTCTCCTCGCATGCG
MtD mb_3 CGTACGTGATATCATCTCAACTTAGTATCGTACG
The T7 promoter portion of the 1 primer P1 sequence is shown in italics and the main sequence of the molecular signaling probe is shown in bold. The 3 'end of the molecular signal sequence is labeled with DABCYL (quencher) and the 5' end with 6-FAM (fluorescent label).
TABLE 2 mitochondrial DNA content in PBMCs of patients treated for 48 weeks with different treatment regimens
Week Median value Extent of float
AZT 0 196 111-252
4 157 103-191
24 182 123-224
48 155 110-224
AZT/ddI 0 174 150-243
4 126 89-235
24 93 42-200
48 112 66-170
AZT/ddC 0 132 83-200
4 48 36-76
24 68 29-107
48 74 51-83
TABLE 3 analysis of significant changes in mitochondrial DNA content in PBMCs of patients performing different treatment regimens
Antiviral medicine Week Percent reduction P value
AZT 4 11% 0.22
24 1% 0.80
48 5% 0.55
AZT+ddI 4 13% 0.04
24 24% 0.09
48 16% 0.02
AZT+ddC 4 22% 0.002
24 22% 0.06
48 25% 0.04
TABLE 4 mitochondrial RNA content in PBMCs of patients treated for 48 weeks with different treatment regimens
Week Patient 1 Patient 2
0 632 680
4 1482 605
24 516 1106
48 448 Invalidation
Table 5 mitochondrial toxicity of HIV-1 inhibitor nucleosides and nucleoside analogs was extracted from a. carr, DA cooper. lancet 2000; 356; 1423-1430
Affected organ Clinical symptoms Laboratory features Ratio (%) Medicine
Muscle Fatigue, myalgia, weakness at the proximal end, exhaustion Creatine kinase ↓ × 17 AZT
Heart and heart Dilated cardiomyopathy Is rarely AZT
Nerve Distal pain, numbness, paresthesia, reduced reflex/power 10-30 ddC=d4T>ddI>3TC
Liver disease Hepatomegaly, nausea, hepatic ascites, acidosis, encephalopathy Enzyme ↓ ] anion gap ↓ ] bicarbonate ↓ ] in lactic acid ↓ ] liver in lactic acid poisoning blood serum <1 All except 3TC, ABC
Pancreas gland Abdominal pain Amylase <1-6 ddI>TC/ddC
Fat Peripheral atrophic lipid dystrophy 50 d4T > others
Drawings
FIG. 1. example of standard curves for DNA and RNA target sequences.
FIG. 2 shows the ratio of mitochondrial DNA and chromosomal DNA in fibroblasts cultured in the presence of DDC.
FIG. 3 is a graph showing the ratio of mitochondrial RNA to chromosomal-encoded RNA in fibroblasts cultured in the presence of DDC.
FIG. 4 shows the ratio of mitochondrial RNA to chromosomal DNA in fibroblasts cultured in the presence of DDC.
FIG. 5 shows the ratio of mitochondrial RNA to mitochondrial DNA in fibroblasts cultured in the presence of DDC.
FIG. 6 shows the ratio of chromosomal-encoding RNA to chromosomal DNA in fibroblasts cultured in the presence of DDC.
FIG. 7 shows the ratio of mitochondrial DNA to chromosomal DNA in fibroblasts cultured in the presence of DDC after 4 weeks of culture without DDC.
FIG. 8 shows the ratio of mitochondrial RNA to chromosomal-encoded RNA in fibroblasts cultured with DDC removed after 4 weeks of culture in the presence of DDC.
FIG. 9 ratio of mitochondrial DNA and chromosomal DNA in PBMCs cultured for 5 days in the presence of DDC.
FIG. 10 is a graph of the ratio of mitochondrial RNA to chromosomal-encoded RNA in PBMCs cultured for 5 days in the presence of DDC.
FIG. 11 comparison of SNRNP DNA NASBA reactions with and without pretreatment with restriction enzyme Msp I.
FIG. 12 shows 1000 plasmid molecules containing Snrp DNA and 4X 105(A)、2×105(B)、105(C)、5×104(D)、2.5×104(E) Or 104(F) Fluorescence at different reaction time points after mixing of plasmid molecules with mitochondrial DNA. The curve (G) was plotted as the ratio of the amount of amplified mitochondrial DNA molecules to the amount of Snrp nuclear DNA and the ratio of the fluorescence slope at the corresponding time.
FIG. 13 shows 1000 plasmid molecules containing Snrp DNA and 4X 105(A)、2×105(B)、105(C)、5×104(D) Fluorescence at different reaction time points after mixing of plasmid molecules with mitochondrial DNA. A standard curve (E) was plotted as the ratio of the amount of amplified mitochondrial DNA molecules to the amount of Snrp nuclear DNA and the ratio of the fluorescence slopes at the corresponding time points from plots A-D. F. G is the point corresponding to 10-fold or 100-fold dilution of PBMC cells cultured in the absence of ddC; H. i is the point corresponding to 10-fold or 100-fold dilution of PBMC cultured in the presence of 5. mu.M ddC. In panel E, squares represent PBMC samples cultured without ddC, while diamonds represent PBMC samples in the presence of 5 μ M ddC.
FIG. 14 mitochondrial DNA copy number per chromosomal DNA copy in four PBMC blood samples of HIV-1 infected patients who died from lactic acidosis. See the description for further explanation of the time points.
FIG. 15A number of CD4 positive cells and HIV-1 RNA copy number of HIV-1 infected individuals. The bars marked with ddC and AZT below the X-axis indicate the time periods of treatment with these drugs. The 4 arrows below the X-axis indicate the time points at which the mitochondrial DNA content and lactate-pyruvate ratio in PBMC samples were analyzed. Patients died from lactic acidosis approximately 1 month after time point 4.
Figure 15b. left bar graph shows lactate-pyruvate ratio for PBMC samples 1 to 4. No increase in the lactate-pyruvate ratio was detected in these PBMCs. The column on the right shows the mitochondrial DNA content of PBMC samples 1 to 4. In this experiment a significant decrease in mitochondrial DNA content was observed.
FIG. 16. fluorescence values (chromosomal DNA, gray line) and FAM fluorescence signals (mitochondrial DNA, black line) for ROX using different ratios of mitochondrial DNA to chromosomal DNA as input values. The lower panel shows the linear relationship of signal ratio to RNA and DNA ratio.
FIG. 17 lactic acid-to-pyruvic acid ratios measured after fibroblasts were cultured for 4 weeks in the presence and absence of ddC, respectively, and then cultured further in the presence and absence of ddC.
FIG. 18 ROX fluorescence values (chromosomal DNA, gray line) and FAM fluorescence signals (mitochondrial DNA, black line) of fibroblasts cultured in the presence of ddC. The lower graph shows the linear relationship of signal ratio to RNA and DNA ratio. The upper diagram is from left to right: results of 1, 2, 3 and 4 weeks of culture in the presence of ddC, respectively. The two panels on the bottom left show the results of 7 and 10 weeks of culture in the presence of ddC, respectively. While the two panels on the bottom right are the results of continued culture without ddC for 7 and 10 weeks.
FIG. 19. bar graph represents the percentage of mitochondria in PBMCs cultured in the absence (dotted bars) and presence (striped bars) of ddC. The amount of mitochondrial DNA of the control (DMSO) was set to 100% at each time point.
FIG. 20 reduction of mitochondrial DNA content in 8 patient cohorts treated with AZT, AZT + ddI and AZT + ddC, respectively. The P on the bar shows a significant change in mitochondrial DNA content compared to time point zero, i.e. the time at which treatment began.
FIG. 21 mitochondrial DNA content in 3 patients treated with AZT, AZT + ddI and AZT + ddC, respectively.
FIG. 22 fluorescence values (chromosomal DNA, gray line) and FAM fluorescence signals (mitochondrial RNA, black line) for ROX using different ratios of mitochondrial RNA to chromosomal DNA as input values. The lower graph shows the linear relationship of signal ratio to RNA and DNA ratio.
FIG. 23 is a bar graph showing the amount of mitochondrial RNA measured after fibroblasts were cultured in the presence of ddC for 8 weeks, and then cultured in the presence and absence of ddC for a further 16 weeks.
FIG. 24 ATHENA study of patients with altered antiretroviral therapy due to side effects.
FIG. 25 schematic DNA-NASBA amplification.
FIG. 26 two regions of the mitochondrial DNA genetic map show the positions of the partial amplification primers shown in Table 1. The other amplification primers in Table 1 are located in other regions of the mitochondrial genome and are not shown in the figure.
Reference documents:
saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horngt, Mullis KB, Erlich HA: primer directed dnazyme amplification using thermostable DNA polymerase Science 239: 487 491, 1988
Van Gemen B, Van Beuningen R, Nabbe A, Van Strijp D, Jurriaans S, Lens P, Kievits T: single tube quantitative HIV-1 RNA NASBA nucleic acid amplification assay using Electrochemiluminescence (ECL) labeled probes j.virol.methods 49: 157-
Heid CA, Stevens J, Livak KJ, Williams PM: real-time quantitative pcr genome res.6: 986 and 994, 1996
Tyagi S, Kramer FR: molecular signal: probe that emits light after hybridization nat. biotechnol.14: 303-308, 1996
Leone G, Van Schijndel H, Van Gemen B, Kramer FR, SchoencD: the homologous real-time determination of RNA is carried out by combining a molecular signal probe with NASBA amplification Nucleic acid Res.26: 2150-21551998
Piatak M, Luk KC, Williams B, Lifson JD: quantitative competitive pcr for precise quantification of HIV DNA and RNA biotechniques 14: 70-81, 1993
De bair, MP, Van Dooren, MW, De Rooij, E, Bakker, M, Van Gemen, B, Goudsmit, J, and De Ronde, a. single rapid real-time monitoring isothermal RNA amplification assay to quantify HIV-1 extracts from M, N and O groups j.clin.microbiol.39 (4): 1378 1384, 2001
Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-vanKillen PM, van der NJ: a rapid and simple method for nucleic acid purification j.clin.microbiol.28: 495-503, 1990

Claims (17)

1. A method for determining the therapeutic activity and/or possible side effects of a drug comprising determining the relative ratio of mitochondrial nucleic acid and/or gene products thereof in a blood sample derived from an organism relative to the amount of detectable nuclear gene nucleic acid and/or gene products thereof in said sample.
2. The method of claim 1, wherein said medicament is administered for at least 3 months.
3. The method of claim 1 or2, wherein the medicament is for the treatment of a chronic disease.
4. The method of any one of claims 1 to 3, wherein said side effects are substantially absent using said method.
5. The method of any one of claims 1 to 4, wherein said therapeutic activity comprises therapeutic activity against an HIV-related disease and/or a tumor-related disease.
6. The method of any one of claims 1 to 5, wherein the drug comprises a nucleoside and/or nucleotide analog.
7. The method of claim 6, wherein said nucleoside and/or nucleotide analog comprises fludarabine, mercaptopurine, thioguanine, cytarabine, fluorouracil, and/or gemeyrabine.
8. The method of any one of claims 1 to 7 wherein the medicament comprises AZT, ddI, ddC, d4T, 3TC and/or tenofovir.
9. The method of any one of claims 1 to 8, wherein the organism or a substantially related organism has been administered the drug.
10. A method according to any one of claims 1 to 9, wherein said relative ratios are determined in the same experiment.
11. The method of claim 10, comprising amplifying said mitochondrial nucleic acid and said nuclear gene nucleic acid in the same experiment.
12. The method of claim 10 or 11, wherein the relative ratio is determined directly from one amount of nucleic acid divided by another amount.
13. The method of any one of claims 1 to 12, wherein said relative ratio is determined by comparison with a reference curve.
14. The method of any one of claims 1 to 13, wherein the mitochondrial nucleic acid, the gene product thereof, the nuclear gene nucleic acid and/or the gene product thereof are derived from peripheral blood mononuclear cells.
15. A diagnostic kit comprising at least one means for performing the method of any one of claims 1 to 14.
16. The kit of claim 15, comprising at least one primer or probe for selectively amplifying and detecting nucleic acids associated with or derived from mitochondria.
17. The kit of claim 16, wherein the at least one primer or probe is listed in table 1.
HK05101744.2A 2000-12-04 2001-12-04 A method for determining the activity and/or side-effects of a medicament by detecting the ratio of a mitochondrial nucleic acid in relation to a nuclear nucleic acid HK1069189B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP00204322.2 2000-12-04
EP00204322A EP1211323A1 (en) 2000-12-04 2000-12-04 Tests based on nucleic acids of endosymbiont cellular organelles
EP01202168 2001-06-06
EP01202168.9 2001-06-06
PCT/NL2001/000883 WO2002046470A2 (en) 2000-12-04 2001-12-04 Testing endosymbiont cellular organelles and compounds identifiable therewith

Publications (2)

Publication Number Publication Date
HK1069189A1 HK1069189A1 (en) 2005-05-13
HK1069189B true HK1069189B (en) 2008-02-06

Family

ID=

Similar Documents

Publication Publication Date Title
CN1322143C (en) Method for detecting the ratio of mitochondrial nucleic acid to nuclear gene nucleic acid to determine drug activity and/or side effects
US8623602B2 (en) Lysis and reverse transcription for MRNA quantification
US9719133B2 (en) Qualitative and quantitative detection of microbial nucleic acids
CA2802548C (en) Qualitative and quantitative detection of microbial nucleic acids
EP3891302B1 (en) Compositions and methods for detection of candida auris
US12018324B2 (en) Method of detecting minor BCR-ABL1 gene
CN1735695A (en) Method for quantifying a ratio between at least two nucleic acid sequences
HK1069189B (en) A method for determining the activity and/or side-effects of a medicament by detecting the ratio of a mitochondrial nucleic acid in relation to a nuclear nucleic acid
US20230416824A1 (en) Systems for the detection of targeted gene variations and viral genomes and methods of producing and using same
JP2013538585A (en) Method for cell lysis in RT-PCR reaction buffer
JP2006333821A (en) Method for quantitative detection of DNA
JP2006523455A (en) Target nucleic acid detection by polymerase reaction and enzymatic detection of released pyrophosphate
US20230094433A1 (en) Methods and kits for the detection of sars-cov-2
RU2509808C1 (en) METHOD FOR DETERMINING NON-SMALL CELLS LUNG CANCER SENSITIVITY TO PREPARATIONS REACTIVATING PROTEIN p53
CN101314792A (en) Tripartite genome urinalysis method for kidney transplantation immunological rejection, reagent kit and diagnosis agent thereof
KR20250153924A (en) Composition for detection of drug-resistant mutations of cytomegalovirus and uses thereof
KR20250059620A (en) Composition For Detecting SARS-CoV-2 and Method of Detecting SARS-CoV-2 Using the Same
WO2004042085A2 (en) Method for quantifying a ratio between at least two nucleic acid sequences
CN114686618A (en) Primer probe composition, kit and detection method for detecting SARS-COV-2
EP1418242A1 (en) Method for quantifying a ratio between at least two nucleic acid sequences