HK1036008A1 - Isolated peptides corresponding to amino acid sequences of ny-eso-1, wherein bind to mhc class i and mhc class ii molecules, and uses thereof - Google Patents

Description

Separated peptide related to NY-ESO-1 amino acid sequence for combining MHC I and MHC II molecules and application thereof

RELATED APPLICATIONS

This application is a partial continuation of application No. 09/062,422 filed on 17.4.1998, application No. 09/062,422 is a partial continuation of application No. 08/937,263 filed on 15.9.1997, which is a partial continuation of application No. 08/725,182 filed on 3.10.1996, now U.S. patent No. 5,803,381. All of these applications are incorporated by reference.

Field of the invention

The present invention relates to HLA-binding peptides from cancer-associated antigens. These peptides bind to class I and class II MHC molecules.

Background and Prior Art

It has now been fully confirmed: many pathological conditions, such as infections, cancer, autoimmune diseases, etc., are characterized by inappropriate expression of certain molecules. These molecules may therefore serve as "markers" for a particular pathological or abnormal state. These molecules, in addition to being diagnostic "targets", i.e., agents that must be identified for the diagnosis of these abnormal conditions, can also be used as reagents for the generation of diagnostic and/or therapeutic agents. One non-limiting example of this is the use of cancer markers to generate antibodies specific for a particular marker. Yet another non-limiting example is the use of peptides that form complexes with MHC molecules to generate cytolytic T cells against abnormal cells.

Of course, the preparation of such materials necessitates the use of a source of reactants for the production of these materials. Purification from cells is a laborious and unreliable method of doing this. Another preferred method is to isolate a nucleic acid molecule encoding a particular marker and then use the isolated coding molecule to express the molecule of interest.

Currently, two strategies have been used to detect such antigens, e.g. in human tumors. These are called genetic methods and biochemical methods. Genetic methods were developed by, for example, depreen et al, national academy of sciences (proc.natl.sci.usa) 85: 2275(1988), which is incorporated by reference. In this method, hundreds of plasmid pools from a cDNA library obtained from a tumor are transfected into recipient cells, such as COS cells, or antigen-negative tumor cell line variants that are tested for expression of the specific antigen. Biochemical methods are described by, for example, o.mandelboim et al, Nature 369 (Nature): 69(1994) illustrates that it is based on acid elution of peptides bound to MHC class I molecules of tumour cells, followed by reverse phase High Performance Liquid Chromatography (HPLC). Antigenic peptides are recognized and induced after they bind to empty MHC-class I molecules on mutant cell lines deficient in antigen processingLeading to a specific reaction with cytotoxic T lymphocytes. These responses include induction of CTL proliferation, TNF release and lysis of target cells in MTT assays or⁵¹Cr release assay.

These two methods for the molecular determination of antigens have the following disadvantages: first, they are very cumbersome, time consuming and expensive; second, they rely on the establishment of cytotoxic T cell lines (CTLs) with predetermined specificity.

These two known methods for the identification and molecular determination of antigens have their inherent problems, which are best demonstrated by the fact that: to date, these two approaches have only succeeded in identifying a few new antigens in human tumors. See, e.g., van der Bruggen et al, Science 254: 1643-1647 (1991); brichard et al, journal of experimental medicine (j.exp.med.) 178: 489 + 495 (1993); coulie et al, journal of experimental medicine 180: 35-42 (1994); kawakami et al, national academy of sciences (proc.natl.acad.sci.usa) 91: 3515-3519(1994).

Furthermore, the methodology relies on the availability of established immortalized cell lines for the cancer type of interest. Establishing cell lines from specific cancer types is difficult, as Oettgen et al, north american immunology and allergy clinics (immunol. allerg. clin. north. am.) 10: 607 and 637 (1990). It is also known that some epithelial cell cancers have very low susceptibility to CTLs in vitro, preventing routine detection. These problems have prompted the art to develop additional methods for identifying cancer-associated antigens.

Sahin et al, national academy of sciences USA progression 92: 11810-11913(1995) describes a key approach, which is incorporated by reference. See also U.S. patent No. 5,698,396 and application No. 08/479,328 filed on 3.1.1996. All three of these documents are incorporated by reference. In summary, the method involves the expression of a cDNA library in a prokaryotic host. (all libraries were obtained from tumor specimens). The expression library is then immunoscreened with adsorbed and diluted serum in order to detect those antigens that elicit high titer humoral responses. This method is called the SEREX method (Serological identification of antigens by recombinant expression Cloning ")). This methodology has been used to confirm the expression of previously identified tumor associated antigens, as well as to detect novel antigens. See the above referenced patent applications and Sahin et al, supra, and Crew et al, journal of european molecular biology organization (EMBO J) 144: 2333-2340(1995).

The SEREX method has been applied to esophageal cancer specimens, and an antigen has now been identified and its encoding nucleic acid molecule isolated and cloned. This is the subject of several patent applications, some of which are incorporated by reference. The antigen and truncated forms thereof have been found to react with antibodies in the serum of cancer patients. It was also found that peptides derived from this molecule bind to MHC molecules and provoke cytolytic T cell and helper T cell responses. These features of the present invention can be seen in the disclosure which follows.

Brief Description of Drawings

FIG. 1 shows the expression pattern of RNA of NY-ESO-1 antigen in various types of tissues.

FIG. 2 shows Northern Blot (Northern Blot) hybridization analysis of NY-ESO-1mRNA, which was detectable in testis and cell line SK-MEL-19, but not in various other cell and tissue samples.

FIG. 3 shows potential sites for modification of the deduced NY-ESO-1 amino acid sequence.

FIG. 4 is a graph of the hydrophilicity of NY-ESO-1, showing a hydrophilic region at the amino terminus and a longer hydrophobic segment near the carboxy terminus.

FIG. 5 shows the results of CTL lysis studies using various HLA-A2 positive, NY-ESO-1 positive, double positive or double negative cells.

FIG. 6 provides data identifying HLA-A2 as presenting SEQ ID NO: 1-derived peptide.

Description of The Preferred Embodiment

Example 1

Total RNA is extracted from a rapidly frozen, well-or mid-differentiated esophageal squamous cell carcinoma specimen using well-known methods. See, e.g., Chomzynski, journal of analytical biochemistry (j.analyt.biochem.) 162: 156-159(1987). This RNA was used to prepare a cDNA library which was subsequently transfected into lambda ZAP phage vectors according to the manufacturer's instructions. The lambda ZAP library was then transfected into E.coli, yielding 1.6X 10⁶And (3) primary isolate.

Then using Sahin et al, the american national academy of sciences developed 92: 11810-. Briefly, antibodies against endogenous molecules of E.coli were removed from serum by combining autologous serum with lysates of E.coli transfected with lambda ZAP without esophageal cancer cell cDNA clones.

The cleared serum was then diluted and mixed with nitrocellulose containing plaques. Plaques were incubated overnight at room temperature. The filters were then washed and incubated with alkaline phosphatase-conjugated goat anti-human FC γ secondary antibody and developed by incubation with 5-bromo-4-chloro-indole phosphate and nitroblue tetrazolium. A total of 13 positive clones were found.

Example 2

After identification, reactive clones were subcloned to monoclonality by dilution cloning and detection with human serum. These clones were then purified, excised in vitro, and converted to the pBK-CMV plasmid using the manufacturer's instructions. The inserted DNA was then evaluated using EcoRI-XbaI restriction mapping to determine the different inserts. 8 different inserts were identified, ranging in size from about 500 to about 1300 base pairs. Clones were sequenced using an ABI PRISM automatic sequencer.

Table 1 summarizes the results. One gene is represented by 4 overlapping clones, another by 3 overlapping clones, and the remaining 6 genes are represented by only one clone.

Homology searches revealed that clones designated as NY-ESO-2, 3, 6, 7 are known. See Elisei et al, journal of endocrine research (j. endocrins. invest.) 16: 533, 540 (1993); spritz, et al, nucleic acid studies (nucl. acids Res.) 15: 10373-10391 (1987); rabbits et al, Nature Genetics (Nature Genetics) 4: 175-180 (1993); crozart et al, Nature 363: 640-644 (1993); genbank H18386 and D25606. Two clones (NY-ESO-3 and NY-ESO-6) have previously been shown to be expressed in various normal tissues of the human body. No evidence of lineage restriction has been found. NY-ESO-6(cDNA) appears to be the 3' -untranslated portion of the FUS/TLS gene. In experiments not reported here, sequencing and Southern Blot (Southern Blot) analysis of NY-ESO-6 showed no evidence of translocation or point mutations in tumors. 4 clones, namely NY-ESO-1, 4, 5 and 8, showed no significant homology to the sequences in the database searched and were therefore further investigated.

TABLE 1 immunoscreening of genes isolated from esophageal cancer libraries with autologous serum

Gene	Clone number	Size and breadth	DNA database	Note
					NY-ESO-1	E1-5bE1-114bE1-153cE1-50	679bp614bp670bp679bp	No obvious homology	Expressed in testis and ovary
NY-ESO-2	E1-71a	605bp	U1 micronucleus RNP 1 homolog	Cloning by Ab screening (thyroid gland)

	E1-140E1-31	874bp750bp	Inflammation patients)
					NY-ESO-3	E1-141b	517bp	Colon 3' direct mboicddna; adult brain cDNA	(dbj D25606, gb H18638) is not published
NY-ESO-4	E1A-10c	400bp	No obvious homology	Is ubiquitously expressed in normal tissues
					NY-ESO-5	E1A-54	670bp	No obvious homology	Expressed in normal esophagus
NY-ESO-6	E1B-9b	-1.2kb	Human fus mRNA	Translocation of t (12; 16) in liposarcomas
					NY-ESO-7	E1B-20f	-1.0kb	Human U1-70k snRNP	Different from NY-ESO-2 (embHSU 17052, gbM22636)
NY-ESO-8	E1B-20g	-1.3kb	No obvious homology	Is ubiquitously expressed in normal tissues

Example 3

Studies were conducted to evaluate mRNA expression of NY-ESO-1, 4, 5 and 8 clones. To perform this study, specific oligonucleotide primers were designed for each sequence so that a 300-400 base pair cDNA fragment could be amplified and the primer melting temperature could be in the range of 65-70 ℃. Reverse transcription PCR was then performed using commercially available materials and standard methods. Various types of normal and tumor cells were detected. The clones NY-ESO-4 and NY-ESO-8 are ubiquitous and therefore were not investigated further. NY-ESO-5 showed high level expression in primary tumor and normal esophageal tissues, suggesting that it is a differentiation marker.

NY-ESO-1 is found expressed in tumor mRNA and testis, but not in normal colon, kidney, liver or brain tissue. This expression pattern is consistent with other tumor rejection antigen precursors.

Example 4

The above RT-PCR assay was performed on NY-ESO-1 in a more comprehensive set of normal and tumor tissues. Tables 2, 3 and 4 show these results. In short, NY-ESO-1 was found to be highly expressed in normal testis and ovary cells. A small amount of RT-PCR amplification was found in the normal myometrium but not in the endometrium, but the positive results were not consistent. Squamous epithelia of various cell types, including normal esophagus and skin, are also negative.

When tumors of unrelated cell lineages were detected, 2 of 11 melanocyte lines showed high expression, as did 16 of 67 melanoma samples, 6 of 33 breast cancer samples, and 4 of 4 bladder cancers. Sporadic expression is present in other tumor types.

Table 2: distribution of mRNA for NY-ESO-1 in Normal tissue

Tissue esophagus brainFetal brain, heart, lung, liver, spleen, stomach, small intestine, colon, rectum and mammary gland skin

mRNA--------------

Tissue adrenal gland seminal vesicle placenta thymus lymph gland tonsil PBLPBL, activated # melanocyte thyroid uterus testis ovary

mRNA-----------+/-++

Tissue from different sites was tested with IL-2 and PHA

Weak positive in some samples, negative by northern blot analysis

Table 3: distribution of mRNA of NY-ESO-1 in melanoma and breast cancer cell lines

Cell lines	NY-ESO-1 mRNA
		MZ2-MEL3.1MZ2-MEL2.2SK-MEL-13SK-EL-19SK-EL-23SK-MEL-29SK-MEL-30SK-MEL-31SK-MEL-33SK-MEL-37SK-MEL-179SK-BR-3SK-BR-5734BMDA-MB-231	---+-----+-----

Table 4: detection of NY-ESO-1mRNA expression in various human tumors by RT-PCR

Tumor type	mRNA (Positive/Total)	Tumor type	mRNA (Positive/Total)
				Melanoma breast cancer prostate cancer colon cancer glioma gastric cancer renal cancer lymphoma liver cancer	25/7717/434/160/160/150/125/170/100/102/7	Ovarian cancer thyroid cancer bladder cancer Burkitt lymphoma basal cell carcinoma myosarcoma other sarcoma pancreatic cancer seminoma myelomas	2/82/59/131/20/20/20/20/20/10/1

non-Hodgkin, non-Burkitt type

Another set of experiments was performed to confirm whether the presence of anti-NY-ESO-1 antibodies in the serum of cancer patients could be detected by ELISA.

Specifically, the buffer solution (15mM Na) for coating was used as follows₂CO₃、30mM NaHCO₃、pH9.6，0.02％NaN₃) The medium concentration of 1. mu.g/ml of recombinant NY-ESO-1 was adsorbed to a microplate (10. mu.l per well) and then stored overnight at 4 ℃. The plate was washed with phosphate buffer and blocked with 10. mu.l/well 2% bovine serum albumin/phosphate buffer at 4 ℃ overnight. After washing, 10. mu.l/well of serum diluted in 2% bovine serum albumin was added to the wells. After incubation for 2 hours at room temperature, the plates were washed and 10. mu.l of goat anti-human IgG-alkaline phosphatase conjugate diluted 1: 1500 per well was added. The solution was incubated at room temperature for 1 hour, followed by washing and addition of a substrate solution of alkaline phosphatase (10. mu.l/well). After standing at room temperature for 25 minutes, each well was read with a fluorescence plate reader. The results are set forth in the following table:

eso 1 +/Total detection%

Cancer patients

The following steps:

melanoma 12/1279.4

Ovarian cancer 4/3212.5

Lung cancer 1/244.0

Breast cancer 2/267.7

Blood donor 0/700

To determine whether there is a correlation between NY-ESO-1mRNA expression in tumors and antibody response to NY-ESO-1 protein, data from 62 melanoma patients were compared. All patients whose sera were reactive with NY-ESO-1 protein (i.e., containing antibodies to NY-ESO-1) also had NY-ESO-1 positive tumors, whereas patients with NY-ESO-1 negative tumors did not have antibodies to NY-ESO-1 in their sera. NY-ESO-1 positive patients lacking the antibody account for a certain proportion. It is known that about 20-40% of melanoma express NY-ESO-1 and only patients with NY-ESO-1 positive tumors have antibodies, and the data indicate that a high proportion of patients with NY-ESO-1 positive tumors produce antibodies against this protein, thus suggesting that large-scale assays are useful in diagnosis and responsiveness to therapy.

Example 5

Northern blot analysis was then performed to study the size of NY-ESO-1 transcripts and confirm tissue expression patterns. By adopting the method of Ausubel and the like,novel method for molecular biology(Current Protocols in molecular Biology) (John Wiley and Sons, 1995). Specifically, 20. mu.g of total RNA per lane was dissolved in a buffer containing formamide and formaldehyde, heated to 65 ℃ and then separated on a 1.2% agarose gel containing 3% formaldehyde, followed by transfer onto nitrocellulose. Then use³²The P-labeled probe is hybridized followed by a high stringency wash. The final wash was performed in 0.1 XSSC, 0.1% SDS at 60 ℃ for 15 minutes.

RNA from testis and a melanoma cell line (SK-MEL-19) positive for NY-ESO-1 in the previous assay showed an RNA transcript of approximately 0.8-0.9 kb. One esophageal cancer sample showed a smear band (smear) in the range of 0.4-0.9kb, indicating partial degradation. RNA from other tissues or cell lines tested showed no transcripts.

To obtain cDNA encoding the full-length transcript, the esophageal cancer cDNA library was rescreened using plaque hybridization and the original cDNA clone as a hybridization probe. When screening for 3X 10⁵At the time of individual cloning, 6 positive clones were found. The 3 longest clones were sequenced. Open reading frame analysis showed that all 3 clones contained the entire coding region and 5' -untranslated region of varying size. The longest clone was 755 base pairs in length (excluding poly-A), containing a 543 base pair coding region, 53 untranslated bases at the 5 'end and 151 untranslated bases at the 3' end. See SEQ ID NO: 1 (also fig. 3).

The long ORF shows that the deduced NY-ESO-1 protein sequence is 180 amino acids. A single immunopositive clone contained sequences encoding 173 of them. The deduced molecular weight was 17,995 daltons.

Analysis showed a large number of glycine residues in the N-terminal part (30 in the first 80 and 4 in the remaining 100). Hydrophilicity analysis indicated a hydrophilic antigen sequence in the N-terminal half of the molecule, with alternating hydrophobic and hydrophilic sequences, and ending with a long C-terminal hydrophobic tail (amino acids 152-172), followed by a short hydrophilic tail. This pattern suggests a transmembrane protein. This molecule presents several potential N-myristoylation sites, 3 phosphorylation sites, but no N-glycosylation sites.

Example 6

A melanoma cell line "NW-MEL-38" was established in 1995 from a patient suffering from malignant melanoma. Serum samples, peripheral blood lymphocytes, and tumor samples were all taken from the patient and cryopreserved until the work described herein was performed. To evaluate the anti-tumor T cell response in this patient, the patient was HLA matched, HLA-A1 and HLA-A2.

To determine whether melanoma from this patient expresses NY-ESO-1, total RNA was isolated from tumor specimens and from the NW-MEL-38 cell line using standard techniques. Then, 2. mu.g of total RNA from each sample was used for cDNA synthesis using standard techniques.

The following primers were then used: 5'-CACACAGGAT CCATGGATGCTGCAGATGCG G-3' (SEQ ID NO: 2) and 5'-CACACAAAGC TTGGCTTAGCGCCTCTGCCC TG-3' (SEQ ID NO: 3) the cDNAs were subjected to RT-PCR experiments. These primers should amplify the sequence of SEQ ID NO: 1 which spans nucleotides 271 to 599.

The amplification was performed for 35 cycles using 60 ℃ as the annealing temperature. The PCR products were visualized by ethidium bromide staining in a 1.5% agarose gel.

The results indicate that both the tumor and cell lines express SEQ ID NO: 1. both the cell line and the tumor sample were used in subsequent experiments.

Example 7

The isolated cDNA molecules described above are then used to prepare recombinant proteins. Specifically, the cDNA was amplified using standard techniques and then cloned into a commercially available His-tagged plasmid vector, pQE 9. In a work not described in detail herein, another vector, pQE9K, was also used. It differs from pQE9 in that pQE9K is kanamycin resistance, but not ampicillin resistance.

The plasmid vector was transformed into E.coli strain XL1-Blue and positive transformants were identified by restriction mapping and DNA sequencing. Induction of recombinant protein production by isopropyl-beta-D-thiogalactoside and application to Ni according to well-known procedures²⁺Purifying the protein on an ion chromatography column. When analyzed by 15% SDS-PAGE and silver staining, the protein was identified as a protein with a molecular weight of about 22 kilodaltons. This is consistent with the size predicted from the sequence of the protein. 2 other forms of the recombinant protein were also identified. These consist of the amino acid sequences set forth in SEQ ID NO: 1, amino acids 10-180 and 10-121 of the amino acid sequence reported in 1. On SDS-PAGE as above, they had molecular weights of approximately 14kD and 20kD, respectively.

Another set of experiments was performed to express NY-ESO-1 in baculovirus. The method specifically comprises the following steps: the NY-ESO-1cDNA insert was released from the pQE9 vector by cleavage with BamH I and Hind III. This insert was then subcloned into a commercially available baculovirus vector cut with the same enzyme. Positive clones were determined by standard methods and transfected into Sf9 recipient cells. The recombinant virus was then used to infect insect cells using standard medium (IPL-41) supplemented with 10% fetal bovine serum. The multiplicity of infection used was 20. Expression of the recombinant protein was determined as described above. The recombinant protein produced in this vector carries a His-tag and is therefore also described above in Ni²⁺It was purified on an affinity column. The protein consists of 10-180 amino acids and has a molecular weight of 20 as determined by SDS-PAGEkD。

Additional eukaryotic transfectants were then prepared. For this experiment, the NY-ESO-1 coding sequence was isolated from pQE9 vector as described above and then cloned into the BamHI-HindIII site of eukaryotic expression vector pcDNA3.1. Next, COS-7 cells were transfected with the vector by contacting 150ng of the above plasmid and 150ng of plasmid pcDNA 1Amp containing cDNA for HLA-A2.1 or cDNA for HLA-A1 with a sample of COS-7 cells. The well-known DEAE-dextran chloroquine method is utilized. The cells were then incubated at 37 ℃ for 48 hours before they were detected in CTL stimulation experiments. Specifically, according to Traversari et al, Immunogenetics (Immunogenetics) 35: 145-148(1992), which is incorporated by reference. Briefly, 2500 CTLs (NW38-IVS-1, see example 9, below) in 100. mu.l of RPMI supplemented with 10% human serum and 25U/ml of recombinant IL-2 were added to microwells (20,000 cells/well) containing COS-7 transfectants. After 24 hours, 50 μ l of supernatant was collected from each well and the level of TNF-. alpha.was measured in a standard assay, a method that measures cytotoxicity against WEHI 164 clone 13 cells using MTT. Positive cells were used for Western Blot (Western Blot) analysis, which is described in the examples that follow.

The CTL used was CTL NW38-IVS-1, which was calculated according to Knuth et al, Proc. Natl. Acad. Sci USA 81: 3511 and 3515 (1984). Specifically, by mixing 10⁵Individual autologous NW38-MEL-1 tumor cells and 10 cells obtained from the subject⁶The individual peripheral blood lymphocytes are pooled to establish a mixed T lymphocyte culture. Cytokine IL-2 was added and the mixed cultures were incubated for one week at 37 ℃. Removing tumor cells, adding a new 5 × 10 part⁴Tumor cells and IL-2. This step is repeated once a week until it is right⁵¹A strong response was observed when Cr-labeled NW-MEL-38 cells were examined. The responding T cells were collected and frozen until used in further experiments.

Example 8

Western blot analysis was then performed using the serum samples described above as well as cell lysates taken from the NW-MEL-38 cell line described above and the COS-7 transfectants described above and purified recombinant proteins also described above. Serum samples were taken at various times during the course of treatment of the patient. The results were indistinguishable.

In these assays, 1. mu.g of recombinant NY-ESO-1 protein or 5. mu.l of lysate of each type of cells were diluted in SDS, boiled for 5 minutes, and then electrophoresed in a 15% SDS gel. After transfer onto nitrocellulose membrane (0.45 μm) overnight and blocking with 3% BSA, the blots were incubated with serum diluted 1: 1000, 1: 10,000 and 1: 100,000 or anti-NY-ESO-1 monoclonal antibody diluted 1: 50 (as a positive control). Monoclonal antibodies were prepared by Chen et al, Proc. Natl.Acad.Sci.USA, 5915-5919(1996), which is incorporated by reference and described in detail below. BALB/C mice were immunized by 5 subcutaneous injections of recombinant NY-ESO-1 protein at 2-3 week intervals. The immunological formulation included 50 μ g of recombinant protein in adjuvant. The first injection utilized complete Freund's adjuvant followed by incomplete Freund's adjuvant. Splenocytes were taken from the immunized mice and fused with the mouse myeloma cell line SP2/0 to generate hybridomas. Representative hybridoma E978 was used to prepare mabs.

Once the hybridomas were generated, they were cloned and the supernatants were screened for recombinant protein using a standard solid phase ELISA on microtiter plates. According to Dippold et al, Proc. Natl. Acad. Sci. USA 77: 6114-6118(1980), which is incorporated by reference. A series of negative controls were also set using recombinant NY-ESO-1. The serum antibody binding to the recombinant protein produced by the above E.coli was developed using goat anti-human IgG diluted 1: 10,000 and labeled with alkaline phosphatase, followed by development using NBT-phosphate. Untransfected COS-7 cells were also used as controls. Serum from a healthy individual was also used as a control.

Strong reactivity was found against recombinant proteins at serum dilutions as low as 1: 100,000, but also against NW-MEL-38 lysates. No reactivity was shown for untransfected COS-7 cells, nor did serum taken from healthy individuals.

Example 9

4 different forms of NY-ESO-1 are described above, namely: in E.coli consisting of SEQ ID NO: 1 and forms consisting of amino acids 10 to 180, forms consisting of amino acids 10 to 121 and forms consisting of amino acids 10 to 180 expressed in the baculovirus vector system discussed above. Each format was used for ELISA as described above. All forms of the protein were found to react equally with antibodies from various patients and the mouse monoclonal antibodies discussed above.

Example 10

A cytolytic T cell line "NW 38-IVS-1" was used in the assays for COS-7 transfectants above and in the assays discussed in this example. The "CTL" is produced by in vitro stimulation of the peripheral blood lymphocytes mentioned above with the tumor cell line NW-MEL-38. This is done using standard techniques.

CTL was used in cytotoxicity assays with NW-MEL-38 (which was HLA-A1, A2 positive and NY-ESO-1 positive), two NY-ESO-1 and HLA-A2 positive allogeneic cell lines (SK-MEL-37 and MZ-MEL-19), one MHC class I negative cell line (SK-MEL-19), one HLA-A2 positive and NY-ESO-1 negative cell line (NW-MEL-145), and a control cell line K562 and phytohemagglutinin-stimulated autologous mother cells. Using various effector/target cell ratios, and⁵¹lysis of Cr-labeled target cells was the assay parameter. As shown in fig. 5.

The results showed that CTL NW-38-IVS-1 lysed the autologous cell line NW-MEL-38 as well as the allogeneic cell line which was positive for both HLA-A2 and ESO-1. Thus, CTLs can react with allo-substances. See fig. 6.

Example 11

Since patient NW38 was double positive for HLA-A1 and HLA-A2, experiments were performed to determine which MHC molecules were presenting molecules.

The same experiment as described above for COS-7 cells was performed, except that care was taken to ensure that co-transformants were isolated that were transformed with HLA-A1cDNA or HLA-A2cDNA, respectively, rather than with them. These results show that CTL NW38-IVS-1 only lysed COS-7 transfectants containing NY-ESO-1 and HLA-A2. See fig. 6. This work also confirmed the specificity of CTL, since other molecules known to be processed into peptides presented by HLA-A2 molecules were contained in NY-ESO-1 negative, HLA-A2 positive cells as described in example 9.

Example 12

Once presented MHC molecules were identified as HLA-a2, Human immunology (Human Immunol) 43: 13-18(1995) and Drijfhout et al, human immunology 43: 1-12(1995) the proposed model screens the NY-ESO-1 amino acid sequence to identify all peptides that match this motif. The corresponding peptides of all the amino acid sequences deduced therefrom were synthesized using standard techniques and then, following the incorporation by reference of Knuth et al, Proc. Natl. Acad. Sci. USA 81: 3511-3515(1984) was used for cytotoxicity assays. In particular, the cell line cemx721.174.T2 (hereinafter "T2") was used because it does not process antigens into MHC complex peptides, thus making it well suited for carrying out the type of experiments described herein. Using standard methods with 100. mu. Ci of Na: (⁵¹Cr)O₄T2 cell samples were labelled and then washed 3 times and subsequently incubated with 10. mu.g/ml peptide and 2.5. mu.g/ml β 2-microglobulin. Incubate at room temperature for 1 hour. The responder cells (100. mu.l of CTL NW38-IVS-1 suspension) were then added at an effector/target cell ratio of 90: 1 and incubated in the presence of 5% CO at 37 ℃₂Was incubated in water-saturated air for 4 hours. The plate was then centrifuged at 200 Xg for 5 minutes, 100. mu.l of the supernatant removed and assayed for radioactivity. Determined according to known strategies⁵¹Percentage of Cr released. Peptides SLLMWITQCFL (SEQ ID NO: 4), SLLMWITQC (SEQ ID NO: 5) and QLSLLMWIT (SEQ ID NO: 6) were found to be the three best candidatesThe CTL stimulating substance of (1). Similar results were found when targeting NW-MEL-38 and cell lines SK-MEL-37 and MZ-MEL-19, as shown above.

Example 13

To a polypeptide consisting of SEQ ID NO: 1 the peptide sequence corresponding to the HLA binding motif was analyzed. Using a mass spectrum obtained from Parker et al, journal of immunology (j. immunol.) 142: 163(1994), which is incorporated by reference. The amino acid sequences, HLA molecules to which they may bind, and the amino acid sequences shown in SEQ ID NOs: 1. The resulting complex should elicit a cytolytic T cell response. This can be done by a person skilled in the art, for example, according to van der Bruggen et al, european journal of immunology (eur.j. immunol) 24: 3038 by the method taught in 3043 (1994).

Sequence MHC/HLA molecule location

GPESRLLEF HLA-A1 82-90

LLMWITQCF HLA-A3 158-166

LMWITQCFL HLA-A3 159-167

EPTVSGNIL HLA-A2 4125-133

LQLSISACL HLA-A2 4145-153

GARGPESRL HLA-B7 79-87

APRGPHGGA HLA-B7 60-68

ESRLLEFYL HLA-B7 84-92

APPLPVPGV HLA-B7 113-121

FATPMEAEL HLA-B7 96-104

AADHRQLQL HLA-B7 139-147

GARGPESRL HLA-B8 79-87

ESRLLEFYL HLA-B8 84-92

VPGVLLKEF HLA-B3 5118-126

ESRLLEFYL HLA-B3 584-92

GARGPESRL HLA-B3 579-87

LEFYLAMPF HLA-B4 488-96

PESRLLEFY HLA-B4 483-91

AELARRSLA HLA-B4 4102-110

MEAELARRS HLA-B4 4100-108

QQLSLLMWI HLA-B5 2154-162

AQDAPPLPV HLA-B5 2110-118

LQLSISSCL HLA-B5 2145-153

ITQCFLPVF HLA-B5 2162-170

LLEFYLAMPF HLA-A1 87-96

GPESRLLEFY HLA-A1 82-91

PLPVPGVLLK HLA-A3 115-124

RSLAQDAPPL HLA-A2 4107-116

APPLPVPGVL HLA-B7 113-122

GARGPESRLL HLA-B7 79-88

GPHGGAASLG HLA-B7 63-72

APRGPHGGAA HLA-B7 60-69

GPRGAGAARA HLA-B7 44-53

TAADHRQLQL HLA-B8 138-147

APPLPVPGVL HLA-B52 113-122

QQLSLLMWIT HLA-B52 154-163

LQQLSLLMWI HLA-B52 153-162

KEFTVSGNIL HLA-B52 124-133

Example 14

Further experiments were performed to determine other related peptides. In these experiments, a stable tumor cell line, i.e., MZ-MEL-19, was used. The cell line was generated using a cell line produced by jagerer et al, journal of experimental medicine (j.exp.med.) 187: 265-269(1998) was established from a patient named MZ 19. A cytolytic T cell line, i.e., MZ2-MEL19-IVS-1, was also established using MZ-MEL-19 and the methods of example 7 above and Jager et al above. The CTL lyses the autologous tumor cell line in a manner restricted by HLA-A2. This can be determined using standard methods. The model proposed by D' Amaro et al, supra, was used to identify all sequences that matched the HLA-A2 binding motif in ESO-1. In this way 26 peptides were identified. All these peptides were synthesized, purified, and tested for integrity using standard methods. The peptides were then synthesized and tested in subsequent experiments. MZ19-IVS-1 and the T2 cells described in example 12 were utilized. SEQ ID NO: 4 and SEQ ID NO: 5 bind to the HLA-a2 molecule and are recognized by CTLMZ19-IVS-1, which subsequently lyses these cells. The CTL also recognized a complex formed by HLA-A2 and decapeptide LLMWITQCFL (SEQ ID NO: 7), which was found to be located at the position shown in SEQ ID NO: the 156-167 site of 1.

Example 15

Whether CD4+ helper T cells recognize complexes of MHC class II molecules and peptides was determined by further studies.

The tumor cell line MZ-MEL-19 is positive for HLA-DR 53. Thus, for NY-ESO-1, Futaki et al, 42: 299-301(1995), which is incorporated by reference, indicates the binding motif of HLA-DR 53. A total of 28 peptides could theoretically bind to HLA-DR53 and antigen presenting cells on their own.

Peripheral blood lymphocytes ("PBLs") were isolated from 2 patients with metastatic melanoma and were matched positive for HLA-DR 53.

The formulation was carried out using standard commercially available reagents. One patient was matched to HLA-DRB1 (alleles 1501-05, 1601-1603, 1605 and 0701), HLA DRB4^*(alleles 0101-0103) and DRB5^*(allele 0101) positive, while the second patient is matched by HLA-DRB1^*(alleles 1401, 1407, 1408 and 0901), HLA-DRB3^*(alleles 0201-0203) and DRB4^*(allele 0101) -0103). According to Bodmer et al, human immunology 34: 4-18(1992), which is incorporated by reference, HLA-DRB4^*All alleles of (A) are designated HLA-DR 53.

CD4+ and CD8+ T lymphocytes were cleared by treatment of PBLs with magnetic beads coated with appropriate antibodies. The remaining cells were plated at 4X 10⁶Individual cells/well were seeded in 24-well plates and allowed to adhere to the well plastic for 24 hours. Any nonadherent cells are removed and the remaining cells are used as antigen presenting cells. These cells were stimulated with GM-CSF (1000U/ml) and IL-4(1000U/ml) for 5 days in 96-well flat-bottomed nitrocellulose plates coated with 5. mu.g/ml of anti-interferon-gamma antibody overnight at 4 ℃. Cells were cultured at 3.5X 10⁵Individual cells/well were seeded.

Then, the test peptide at 4. mu.g/well or the intact NY-ESO-1 protein at 2. mu.g/well was used as a control for the impact.

Then 1 × 10⁵CD4+ T cells were added to each well and suspended in RPMI 1640 medium supplemented with 10% human serum, L-asparagine (50mg/L), L-arginine (242mg/L) and L-glutamine (300mg/L) and IL-2 at 2.5ng/ml in a final volume of 100. mu.l.

The mixture was incubated at 37 ℃ in water-saturated air for 48 hours. The plate was then washed 6 times with 0.05% Tween 20/PBS solution, followed by the addition of biotinylated anti-gamma interferon antibody at 0.5. mu.g/ml. The antibodies were incubated at 37 ℃ for 2 hours, followed by treatment of the plates with standard reagents for 1 hour. The substrate 3-ethyl-9-aminocarbazole was added and incubated for 5 minutes, positive spots appeared red. The number of red spots in each well indicates the frequency of CD4+ T lymphocytes that recognize complexes of peptides and HLA-DR53 or complexes of HLA-DR53 and peptides processed by recombinant NY-ESO-1. The test was performed with reagents alone (i.e., CD4+ cells alone and stain alone) as controls.

The following peptides were found to sensitize CD4+ T lymphocytes to release gamma interferon.

AADHRQLQLSISSCLQQL

VLLKEFTVSGNILTIRLT

PLPVPGVLLKEFTVSGNI

(SEQ ID NOS：8-10)

These 3 peptides match the above-mentioned motif for binding HLA-DR53 of Futaki et al, which has the anchor residues Tyr, Phe, Trp or Leu, and the third residue, counted from the first residue after this residue, is Ala or Ser.

Other peptides were found that bound HLA-DR 53.

These peptides are:

GAASGLNGCCRCGARGPE

SRLLEFYLAMPFATPMEA

TVSGNILTIRLTAADHRQ

(SEQ ID NOS：11-13)

the above examples describe the isolation of a nucleic acid molecule encoding an esophageal cancer-associated antigen. "related" is used herein because, although it is clear that the molecule of interest is expressed by esophageal cancer, other cancers also express the antigen, such as melanoma, breast, prostate, and lung cancers.

The invention relates to those nucleic acid molecules which code for said antigen and which are homologous under stringent conditions to the reference sequence SEQ ID NO: 1. As used herein, "stringent conditions" refer to conditions such as those defined in U.S. Pat. No. 5,342,774, i.e., hybridization at 65 ℃ for 18 hours, followed by 4 washes in 2 XSSC, 0.1% SDS for 1 hour, and finally in 0.2 XSSC, more preferably 0.1 XSSC, 0.1% SDS for 30 minutes, as well as other conditions that provide the same level of stringency and conditions of greater stringency.

Also part of the invention are expression vectors comprising a nucleic acid molecule of the invention operably linked (i.e., "operably linked") to a promoter. The construction of such vectors is known to those skilled in the art, as are the transformation or transfection of cells, the preparation of eukaryotic or prokaryotic cell lines encoding the molecule of interest. Examples of host cells that may be selected for use in this manner are COS cells, CHO cells, yeast cells, insect cells (e.g., Spodoptera frugiperda), NIH 3T3 cells, and the like. Prokaryotic cells such as E.coli and other bacteria may also be used.

Also part of the invention are the antigens described herein, both in the original peptide form and in a post-translationally modified form, and the antigen defined by SEQ ID NO: 1 at least 10-121 amino acids and at most 10-180 amino acids of the encoded protein. The molecule is sufficiently large to be antigenic without any post-translational modification so that when combined with an adjuvant (or without it), it can be used as an immunogen, either in precursor or post-translationally modified form. As indicated above, these proteins can be used to determine the presence or absence of antibodies in a sample, such as serum or blood. Antibodies prepared using the antigen, whether polyclonal or monoclonal, and hybridomas that produce monoclonal antibodies are also part of the invention. These antibodies can be used therapeutically or diagnostically as whole molecules or as parts thereof, as described below. A further part of the invention is a reactive fragment, e.g.Fab, F (ab)₂' and other fragments, as well as chimeras, humanized antibodies, recombinant productionAntibodies of (a), and the like. Especially preferred are chimeras, in which the entire antibody except for the complementarity determining regions "CDRs" is human and the CDRs are mouse.

The present disclosure shows that the proteins and nucleic acid molecules of the invention can be used for diagnostics. The SEREX methodology discussed herein is premised on an immune response to a pathology-associated antigen. Thus, the pathology of interest can be detected, for example, by detecting the reactivity of a sample of a body fluid, such as serum, of the subject with the antigen itself. Reactivity may be considered an indication of the possible presence of the pathology. Thus, antigen expression may also be detected by any standard nucleic acid hybridization assay well known in the art without further elaboration. Antibodies to the test molecule can also be detected using standard immunoassay methods.

SEQ ID NO: 1, indicating the presence of 5 'and 3' non-coding regions. The present invention relates to those isolated nucleic acid molecules comprising at least the coding segment, i.e., SEQ ID NO: 1, and which may contain nucleotides 54-593 of SEQ ID NO: 1, any or all of nucleotides 1-53 and/or 594-747.

As discussed above, further studies revealed that these molecules were also processed into peptides that initiate cytolytic T cell lysis. Example 7 shows how such a motif analysis can be performed on HLA-A2 molecules. There has been a great deal of work on the motifs of various MHC or HLA molecules, which are applicable here. Thus, another aspect of the invention is a method of treatment, wherein one or more peptides that bind to HLA molecules on the surface of tumor cells of a patient are administered to the patient in an amount sufficient to bind to MHC/HLA molecules and provoke lysis of the cells by T cells. The examples of HLA-A2 molecules described above are by no means the only type available for this approach. Any combination of peptides may also be used, such as those of other HLA molecules, as described above. These peptides, as well as the whole protein or immunoreactive portion thereof, may be administered to a subject, alone or in combination, using any standard form of administration, such as intravenous, intradermal, subcutaneous, oral, rectal, and transdermal, depending on the needs of the subject. Standard pharmaceutical carriers, adjuvants, such as saponin, GM-CSF, and interleukins, etc., may also be used. In addition, these peptides and proteins can be formulated into vaccines with the listed materials as can be formulated with dendritic cells or other cells presenting the relevant MHC/peptide complex. These peptides can also be used to form multimeric complexes of HLA/peptide, such as those produced by Dunbar et al, modern biology (curr. biol.) 8: 413-416(1998), which is incorporated by reference, wherein 4 peptide/MHC/biotin complexes are attached to streptavidin or avidin molecules. Such complexes can be used to identify and/or stimulate T cell precursors.

Similarly, the present invention contemplates therapies in which a nucleic acid molecule encoding NY-ESO-1 is inserted into a vector, such as an adenovirus-based vector, to enable transfection into eukaryotic cells, such as human cells. Similarly, nucleic acid molecules encoding one or more of these peptides can be inserted into these vectors, which then become an integral part of nucleic acid-based therapies.

Any of these assays may also be used for progression/regression studies. Abnormal processes involving expression of NY-ESO-1 can be monitored by monitoring the levels of the protein, its expression, etc., using only any or all of the methods set forth above.

It should be clear that these methods can also be used to track the efficacy of a treatment regimen. Essentially, a baseline value for NY-ESO-1 can be obtained using any of the assays discussed above, a given therapeutic agent is administered, and the protein levels thereafter are monitored, and changes in ESO-1 levels are observed as an indicator of the efficacy of the treatment regimen.

As indicated above, the present invention is particularly concerned with the recognition of an "integrated" immune response to NY-ESO molecules. One branch of this is the ability to monitor the course of cancer treatment. In this method, which is part of the present invention, a subject in need of treatment receives an inoculation of the type described herein. Such a vaccination elicits a T cell response, for example, against cells that present HLA/peptide complexes on their surface. The response also includes an antibody response, possibly as a result of antibody-stimulated protein release by lysis of the cells by T cells. Thus, the effectiveness of the vaccine can be monitored by monitoring the immune response. As indicated above, an increase in antibody titer or T cell number may be an indicator of vaccine progress and vice versa. Thus, another aspect of the invention is a method of monitoring the effect of a vaccine by determining the level of antibodies in a subject specific for the vaccine itself or one of the macromolecules of which the vaccine is a part, following administration.

The effectiveness of the vaccine can also be determined by monitoring the T cell response of the subject receiving the vaccine. A variety of assays can be used to determine the frequency of precursors in these in vitro stimulated T cells. These include, but are not limited to, chromium release assays, TNF release assays, IFN γ release assays, ELISPOT assays, and the like. Changes in the frequency of precursor T cells can be measured and correlated with the effectiveness of the vaccine. Other methods that may be utilized include the use of multimeric complexes of MHC/peptides. An example of such a complex is Dunbar et al, modern biology 8: 413-416(1998), which is incorporated by reference.

The identification of the NY-ESO-1 protein involved in pathological conditions such as cancer also suggests various therapeutic approaches other than those discussed above. The above experiments demonstrate that antibodies are produced in response to protein expression. Thus, another embodiment of the present invention is the treatment of conditions characterized by abnormal or abnormal levels of NY-ESO-1 protein by administering an antibody, such as a humanized antibody, antibody fragment, or the like. These antibodies or fragments may be linked to or labeled with an appropriate cytostatic or cytotoxic agent.

T cells may also be administered. It is noted that the T cells can be induced in vitro using immune response cells, such as dendritic cells, lymphocytes or any other immune response cells, and infused back into the subject to be treated.

It is noted that the production of T cells and/or antibodies can also be accomplished by administering cells, preferably cells treated to be non-proliferative, which present T cell or B cell epitopes associated with the response, such as the epitopes discussed above.

The method of treatment may also include antisense therapies in which an antisense molecule, preferably of 10 to 100 nucleotides in length, is administered to the subject "neat" or in a carrier that facilitates its incorporation into cells, such as liposomes, and expression of the protein is subsequently inhibited. Such antisense sequences may also be incorporated into suitable vaccines, such as viral vectors (e.g., vaccinia virus), bacterial constructs, such as variants of known BCG vaccines, and the like.

Yet another part of the invention is a peptide, which may be a nonamer, decamer or undecamer defined as having the core sequence of LLMWIT (SEQ ID NO: 14), which has at least one additional residue, preferably serine, after the first L residue, and may have up to 3 residues, where serine is attached to L to form-SL-, and 0-4 additional amino acids at the C-terminus, which binds to HLA-A2 molecule as indicated above, thereby eliciting a CTL response. These peptides can be used therapeutically by administering to a patient positive for HLA-A2 and expressing NY-ESO-1 in pathological conditions, and can also be used diagnostically, i.e., to determine the presence or absence of HLA-A2 positive cells or the presence or absence of associated CTLs, and the like.

HLA-A2 molecules are MHC class I molecules, and T cells responding to complexes of peptides and class I molecules are typically CD8⁺A cell. Another subset of T cells, CD4⁺Cells, responsive to a complex of MHC class II molecules and peptides, and MHC class II molecule-restricted CD4 presented by autologous cultured dendritic cells to recombinant NY-ESO-1 have been detected in melanoma patients⁺T cell response. In particular, in results not described herein, CD4 was generated using well-known techniques⁺Cells are separated from other cells in PBL or serum samples. They were then mixed with dendritic cells that had been pulsed with the NY-ESO-1 protein. CD4 was observed⁺Proliferation of the cells reflects, on the other hand, the integrated immune response discussed herein. Thus, another aspect of the present invention is these CDs 4⁺T cells, peptides that bind MHC class II molecules, and their use in therapy.

Consisting of SEQ ID NO: 14 is a peptide defined by the core sequence of SEQ ID NO: 7. As shown, the peptide binds to the HLA-A2 molecule. It is therefore a "marker" for HLA-A2 and also a component of the peptide/MHC complex which stimulates CTL proliferation as described above.

As shown in the examples, ESO-1 is also processed into peptides that form complexes with MHC class II molecules, particularly HLA-DR 53. These molecules match the motifs described by Futaki et al, above, i.e., Tyr, Phe, Trp, or Leu, and the third amino acid, counted from the first residue after this residue, is Ala or Ser. Such peptides must be at least 18 amino acids in length and preferably no more than 25 amino acids in length. They preferably consist of 18 amino acids, such as SEQ ID NO: 8. 9, 10, 11, 12 and 13. These peptides were used to identify HLA-DR53 positive cells. In addition, nucleic acids such as SEQ ID NO: 8. peptides of 9 and 10 can be used to stimulate proliferation of helper T cells, as shown in the examples. All of the applications described above for MHC class I restricted peptides can also be used for these MHC class II restricted peptides. Furthermore, since the immune response to MHC class I molecules/peptide complexes is different from the immune response to MHC class I molecules/peptide complexes, the two classes of peptides can be combined, as in an immunological composition, thereby generating a combined immune response. Thus, all of the applications described may be restricted to peptides only to class I molecules, to peptides only to class II molecules, or to a combination of both.

Other features and applications of the present invention will be apparent to those of ordinary skill and need not be described herein.

The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, it being recognized that various modifications are possible within the scope of the invention.

Sequence listing

(1) General information:

(i) the applicant: stockert, Elisabeth; jager, Elke; chen, Yao-Tseng;

Scanlan，Matthew；Knuth，Alexander；Old，Lloyd J.

(ii) title of the invention: antibodies binding to NY-ESO-1 cancer-associated proteins, uses thereof, truncated forms of NY-ESO-1, and HLA-binding peptides derived therefrom

(iii) Sequence number: 7

(iv) Contact address:

(A) the addressee: felfe & Lynch

(B) Street: third street 805

(C) City: new york city

(D) State: new York, New York

(E) United states of America

(F) And E, postcode: 10022

(v) A computer-readable form:

(A) type of medium: disk, 3.5 inch, 144kb capacity

(B) A computer: IBM

(C) Operating the system: PC-DOS

(D) Software: WordPerfect

(vi) Data of the current application:

(A) application No.:

(B) submission date:

(C) and (4) classification:

(vii) prior application for data:

(A) application No.: 08/937,263

(B) Submission date: 9/15/1997

(vii) Prior application for data:

(C) application No.: US 08/752,182

(D) Submission date: 1996, 10 months and 3 days

(viii) Lawyer/attorney information:

(A) name: hanson, Norman D.

(B) Registration number: 30,946

(C) Reference/case No.: LUD 5466.3

(ix) Communication information:

(A) telephone: (212)688-9200

(B) Faxing: (212)838-3884

(2) SEQ ID NO: 1, information:

(i) sequence characteristics:

(A) length: 752 base pairs

(B) Type (2): nucleic acids

(C) Chain type: double chain

(D) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 1

ATCCTCGTGG GCCCTGACCT TCTCTCTGAG AGCCGGGCAG AGGCTCCGGA GCC 53

ATG CAG GCC GAA GGC CGG GGC ACA GGG GGT TCG ACG GGC GAT GCT 98

Met Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala

5 10 15

GAT GGC CCA GGA GGC CCT GGC ATT CCT GAT GGC CCA GGG GGC AAT 143

Asp Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn

20 25 30

GCT GGC GGC CCA GGA GAG GCG GGT GCC ACG GGC GGC AGA GGT CCC 188

Ala Gly Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Aly Pro

35 40 45

CGG GGC GCA GGG GCA GCA AGG GCC TCG GGG CCG GGA GGA GGC GCC 233

Arg Gly Ala Gly Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly Ala

50 55 60

CCG CGG GGT CCG CAT GGC GGC GCG GCT TCA GGG CTG AAT GGA TGC 278

Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly Leu Asn Gly Cys

65 70 75

TGC AGA TGC GGG GCC AGG GGG CCG GAG AGC CGC CTG CTT GAG TTC 323

Cys Arg Cys Gly Ala Arg Gly Pro Glu Ser Arg Leu Leu Glu Phe

80 80 90

TAC CTC GCC ATG CCT TTC GCG ACA CCC ATG GAA GCA GAG CTG GCC 368

Tyr Leu Ala Met Pro Phe Ala Thr Pro Met Glu Ala Glu Leu Ala

95 100 105

CGC AGG AGC CTG GCC CAG GAT GCC CCA CCG CTT CCC GTG CCA GGG 413

Arg Arg Ser Leu Ala Gln Asp Ala Pro Pro Leu Pro Val Pro Gly

110 115 120

GTG CTT CTG AAG GAG TTC ACT GTG TCC GGC AAC ATA CTG ACT ATC 458

Val Leu Leu Lys Glu Phe Thr Val Ser Gly Asn Ile Leu Thr Ile

125 130 135

CGA CTG ACT GCT GCA GAC CAC CGC CAA CTG CAG CTC TCC ATC AGC 503

Arg Leu Thr Ala Ala Asp His Arg Gln Leu Gln Leu Ser Ile Ser

140 145 150

TCC TGT CTC CAG CAG CTT TCC CTG TTG ATG TGG ATC ACG CAG TGC 548

Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile Thr Gln Cys

155 160 165

TTT CTG CCC GTG TTT TTG GCT CAG CCT CCC TCA GGG CAG AGG CGC 593

Phe Leu Pro Val Phe Leu Ala Gln Pro Pro Ser Gly Gln Arg Arg

170 175 180

TAA GCCCAGCCTG GCGCCCCTTC CTAGGTCATG CCTCCTCCCC TAGGGAATGG 646

TCCCAGCACG AGTGGCCAGT TCATTGTGGG GGCCTGATTG TTTGTCGCTG GAGGAGGACG 706

GCTTACATGT TTGTTTCTGT AGAAAATAAA ACTGAGCTAC GAAAAA 752

(2) SEQ ID NO: 2, information:

(i) sequence characteristics:

(A) length: 31 base pairs

(B) Type (2): nucleic acids

(C) Chain type: single strand

(D) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 2

CACACAGGAT CCATGGATGC TGCAGATGCG G 31

(2) SEQ ID NO: 3, information:

(i) sequence characteristics:

(A) length: 32 base pairs

(B) Type (2): nucleic acids

(C) Chain type: single strand

(D) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 3

CACACAAAGC TTGGCTTAGC GCCTCTGCCC TG 32

(2) SEQ ID NO: 4:

(i) sequence characteristics:

(A) length: 11 amino acids

(B) Type (2): amino acids

(D) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 4

Ser Leu Leu Met Trp Ile Thr Gln Cys Phe Leu

5 10

(2) SEQ ID NO: 5, information:

(i) sequence characteristics:

(A) length: 9 amino acids

(B) Type (2): amino acids

(E) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 5

Ser Leu Leu Met Trp Ile Thr GlnCys

5

(2) SEQ ID NO: 6:

(i) sequence characteristics:

(A) length: 9 amino acids

(B) Type (2): amino acids

(F) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 6

GIn Leu Ser Leu Leu Met Trp Ile Thr

5

(2) SEQ ID NO: 7, information:

(i) sequence characteristics:

(A) length: 6 amino acids

(B) Type (2): amino acids

(G) Topological configuration: linearity

(xi) Description of the sequence: SEQ ID NO: 7

Leu Leu Met Trp Ile Thr

Claims (14)

1. An isolated NY-ESO-1(SEQ ID NO: 1) polypeptide selected from the group consisting of SEQ ID NO: 8. 9 or 10.

2. The isolated peptide according to claim 1, wherein the peptide stimulates recognition and proliferation of CD4+ cells, the CD4+ cells being specific for complexes of the peptide with HLA-DR53 molecules.

An isolated complex of an MHC class II molecule HLA-DR53 and a polypeptide of claim 1 or 2.

4. A composition comprising the isolated polypeptide of claim 1 or 2 and at least one adjuvant.

5. An isolated nucleic acid molecule consisting of a nucleotide sequence encoding the isolated polypeptide of claim 1 or 2.

6. An expression vector comprising the isolated nucleic acid molecule of claim 5 operably linked to a promoter.

7. A recombinant cell comprising the isolated nucleic acid molecule of claim 5 or the vector of claim 6.

8. An in vitro method of stimulating helper T cell proliferation comprising contacting a T cell-containing sample with a complex of the MHC class II molecule HLA-DR53 and a sequence selected from the group consisting of SEQ ID NO: 8. 9 and 10 in an amount sufficient to stimulate proliferation of helper T cells recognizing said complex.

9. Selected from the group consisting of SEQ ID NO: 8. 9 and 10, wherein the peptide is for use in a method of treating a patient positive for HLA-DR53 by stimulating helper T cells through complex formation of the peptide with HLA-DR 53.

10. Selected from the group consisting of SEQ ID NO: 8. 9 and 10 for the manufacture of a medicament for the treatment of a patient with HLA-DR53 by stimulating helper T cells by forming a complex between the peptide and HLA-DR 53.

11. Use of a cell line transfected with an isolated nucleic acid molecule encoding the polypeptide of claim 1 or 2 in the preparation of a medicament for diagnosing a cancer state in a subject, wherein a sample of the subject containing immunoreactive cells is contacted with the transfected cell line to determine the interaction of the transfected cell line with the immunoreactive cells, said interaction being indicative of the cancer state.

12. Use according to claim 11, wherein the immunoreactive cells are helper T cells.

13. Use of an agent in the manufacture of a medicament for determining the regression, progression or occurrence of a cancer state, wherein the agent monitors a parameter in a sample taken from a patient having the cancer state, the parameter being selected from (i) a complex of a peptide according to claim 1 or 2 and an MHC class II molecule, and (II) a helper T cell specific for the complex, and wherein the amount of the parameter is indicative of the progression or regression or occurrence of the cancer state.

14. Comprises the amino acid sequence of SEQ ID NO: 7 and at least one other peptide whose amino acid sequence is found in a peptide consisting of SEQ ID NO: 1 and which is the protein encoded by SEQ id no: 8. 9 or 10.