GB2596271A - Cancer screening test - Google Patents

Abstract

A method of diagnosing cancer or screening for cancer or a pre-cancerous condition in a subject comprising the steps of calculating the ratio value between the copy number at a first genomic locus that characteristically exhibits a copy number gain in cancer and a second genomic locus that characteristically exhibits a copy number loss in cancer in a DNA sample obtained from the subject; and determining whether the ratio value exceeds a predetermined threshold value. A PCR-based method that determines the relative copy numbers may be used and may involve a single primer that targets both the first locus and second locus and the ratio between the amount of PCR product indicates the ratio value. The method may be used to distinguish high-grade from low-grade dysplastic tissue.

Description

CANCER SCREENING TEST

FIELD OF THE INVENTION

This invention relates to a method of diagnosing cancer or screening for cancer or a pre-cancerous condition, as well as related methods, and products and kits for performing such methods.

BACKGROUND TO THE INVENTION

Cancer represents a significant healthcare challenge. In the United Kingdom alone, around 363,000 new cases of cancer are diagnosed every year and cancer accounts for approximately 28% of all deaths. The risk of cancer increases significantly with age and hence rates of cancer and the consequent burden on the healthcare system is expected to increase as a greater proportion of the global population live to an advanced age.

The development of cancer from normal tissue is a multi-step process that involves a number of genetic changes that typically occur over a long timescale.

Pre-cancerous cells (ie cells that have acquired some but not all of the genetic changes required to become cancerous) may form dysplastic tissue, which is an abnormal growth of tissue characterised by loss of normal tissue arrangement and cell structure. Dysplastic tissue does not always present the same risk of developing into cancer and can be divided into high-grade dysplasia, which carries a higher risk of developing into cancer, and low-grade dysplasia, which carries a lower risk of developing into cancer.

High-grade dysplasia can often be treated effectively by surgical removal once it has been identified, as is the case with colonic polyps and Barrett's oesophagus.

Distinguishing between high-grade and low-grade dysplasia is typically based on morphology, supplemented with immunohistochemistry where available, but remains challenging in routine clinical practices. In addition, effective curative treatments are often available for cancers that are detected at a sufficiently early stage. However, pre-cancerous dysplastic tissue growth and early-stage cancer are typically asymptomatic and hence cancer is often not identified until it is relatively advanced, at which point effective treatments may not be available.

Reliable screening tests offer the potential to detect asymptomatic early-stage cancers or pre-cancerous conditions. Screening tests are available for some specific cancers, such as the prostate cancer screening test using Prostate Specific Antigen (PSA). However, there are currently no reliable screening tests available for the majority of cancers that affect humans, including colon cancer, breast cancer, lung cancer, liver cancer and pancreatic cancer. In addition, there is currently a paucity of pan-cancer screening tests available.

Copy number variation is a phenomenon in which sections of the genome are duplicated or deleted. This is known to occur extensively in cancer cells and duplications (gains in copy number) and deletions (losses in copy number) of specific regions of the genome are known to be associated with cancer. However, these copy number variations are not sufficient on their own to enable the detection of cancer with sufficient sensitivity to be of any clinical use.

There has now been devised an improved method of screening for cancer or a pre-cancerous condition that overcomes or substantially mitigates the above-mentioned or other problems associated with the prior art.

GENERAL DESCRIPTION OF THE INVENTION

According to a first aspect of this invention, there is provided a method of diagnosing cancer or screening for cancer or a pre-cancerous condition in a subject, the method comprising the steps of; having obtained a sample of DNA from the subject; calculating the ratio value between the copy number at a first genomic locus that characteristically exhibits a copy number gain in cancer and a second genomic locus that characteristically exhibits a copy number loss in cancer; and, determining whether the ratio value exceeds a predetermined threshold value.

Although copy number gains and losses at specific genomic loci are known to be associated with cancer, detecting the presence of copy number variations at these loci is not sufficient to enable the detection of the presence of cancer or a pre-cancerous condition with sufficient sensitivity to be of any clinical use. However, the calculation of the ratio value between the copy number at a first locus that characteristically exhibits copy number gain in cancer and a second locus that characteristically exhibits copy number loss in cancer enables the detection of cancer using copy number variation data with a far greater sensitivity than any previously known method (see Examples 3 and 4).

There are a number of loci that characteristically exhibit copy number gain in cancer and a number of loci that characteristically exhibit copy number loss in cancer. The applicant has found that not all ratios between such loci indicate the presence of cancer or a pre-cancerous condition with the same level of sensitivity.

Without wishing to be bound by any particular theory, it is believed that the loci pairs that provide the ratios of greatest sensitivity may be functionally linked in the process of tumorigenesis such that cancers that do not gain copy number at the first locus are more likely to have lost copy number at the second locus and vice versa. Consequently, either a gain in copy number at the first locus or a loss in copy number at the second locus, either of which would be identified by the use of a ratio value of the copy number between these loci being greater than a predetermined threshold, may indicate the presence of cancer or high-grade dysplasia with a high level of sensitivity.

The presence of copy number variations that characterise cancer is also indicative of high-grade dysplasia (see Examples 2 and 4). Accordingly, the application of this method to dysplastic tissue may enable high-grade dysplastic tissue to be distinguished from low-grade dysplastic tissue, which presents a lower risk of developing into cancer. Accordingly, the method of diagnosing cancer or screening for cancer or a pre-cancerous condition may be a method of distinguishing high-grade dysplastic tissue from low-grade dysplastic tissue.

The ratio value is equal to the copy number at the first locus divided by the copy number at the second locus. Accordingly, the ratio value will be 1 if the copy number at the first locus is the same as the copy number at the second locus. The ratio value will be greater than 1 if the copy number at the first locus is greater than the copy number at the second locus, which may be due to either or both of a copy number gain at the first locus or a copy number loss at the second locus.

The ratio value being greater than or equal to the predetermined threshold value is indicative of the presence of cancer or a pre-cancerous condition and the ratio value being lower than the predetermined threshold value is indicative of the absence of cancer or a pre-cancerous condition. The pre-cancerous condition may be the presence of dysplastic tissue, and in particular the presence of high-grade dysplastic tissue, which presents a higher risk of developing into cancer.

The predetermined threshold value should be selected in order to maximise the specificity of the method by maximising the number of true negatives (ie samples from subjects that do not have cancer or a pre-cancerous condition that do not exceed the predetermined ratio value), or to maximise the sensitivity of the method by maximising the number of true positives (ie samples from subjects that do have cancer or a pre-cancerous condition that do exceed the predetermined ratio value.

Accordingly, if the predetermined threshold is set at a high value, this would have the effect of increasing the specificity of the method as a greater proportion of the subjects that do not have cancer or a pre-cancerous condition would not exceed the threshold value, but decrease the specificity of the method as a greater proportion of the subjects that do have cancer or a pre-cancerous condition would not exceed the threshold value. Conversely, if the predetermined threshold is set at a low level, this would decrease the specificity of the method but increase the sensitivity of the method.

The predetermined threshold may correspond to the ratio value that is exceeded by less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9% or less than 10% of subjects that do not have cancer or a pre-cancerous condition.

The predetermined threshold may also correspond to the ratio value that is exceeded by more than 50%, more than 60%, more than 70%, more than 80%, more than 90% or more than 95% of subjects that do have cancer or a pre-cancerous condition.

In particular, the predetermined threshold may be about 1.01, 1.02, 1.03, 1.04 or 1.05. More particularly, the predetermined threshold may be 1.010, 1.011, 10.12, 1.013, 1.014, 1.015, 1.016, 1.017, 1.018, 1.019, 1.020, 1.021, 1.022, 1.023, 1.024, 1.025, 1.026, 1.027, 1.028, 1.029, 1.030, 1.031, 1.032, 1.033, 1.034, 1.035, 1.036, 1.037, 1.038, 1.039, 1.040, 1.041, 1.042, 1.043, 1.044, 1.045, 1.046, 1.047, 1.048, 1.049, 1.050.

The predetermined threshold may be greater than or equal to 1.01, 1.010, 1.011, 10.12, 1.013, 1.014, 1.015, 1.016, 1.017, 1.018, 1.019, 1.02, 1.020, 1.021, 1.022, 1.023, 1.024, 1.025, 1.026, 1.027, 1.028, 1.029, 1.03 or 1.030. The predetermined threshold may also be less than or equal to 1.03, 1.030, 1.031, 1.032, 1.033, 1.034, 1.035, 1.036, 1.037, 1.038, 1.039, 1.04, 1.040, 1.041, 1.042, 1.043, 1.044, 1.045, 1.046, 1.047, 1.048, 1.049, 1.05 or 1.050. In particular, the predetermined threshold may be between about 0.01 and about 0.05, between about 0.02 and about 0.04 or between about 0.025 and about 0.035.

The sensitivity or specificity of the method may be improved with the use of multiple ratios. Accordingly, the method may further comprise calculating a second ratio value between the copy number at another first locus that characteristically exhibits a copy number gain in cancer and another second locus that characteristically exhibits a copy number loss in cancer, and determining whether the second ratio value exceeds a second predetermined threshold value. One or both of the first and second loci used to calculate the second ratio value may be different to the first and second loci used to calculate the first ratio value.

The second predetermined threshold value may be the same as or different to the first predetermined ratio value.

The method may further comprise calculating a third, fourth, fifth or further ratio values and determining whether they exceed a third, fourth, fifth or further predetermined threshold value.

In the case of methods that involve calculating two or more ratio values, the presence of cancer or a pre-cancerous condition may be indicated by any one or more of those ratio values exceeding the corresponding predetermined threshold, or preferably by all of the two or more ratio values exceeding the predetermined threshold.

The method may involve an initial step of obtaining a DNA sample from a subject. This may involve taking a solid tissue biopsy, typically from a lesion or nodule that is suspected of being cancerous or pre-cancerous dysplastic tissue. This may also involve obtaining a liquid biopsy sample (ie a blood sample) from the subject, or a sample of another bodily fluid from the subject, including but not limited to saliva, urine, stool, lymph or cerebrospinal fluid.

The sample of DNA may be extracted from solid tissue. The solid tissue would typically be tissue from a lesion or nodule that is suspected of being cancerous or pre-cancerous dysplastic tissue.

Cell free DNA (cfDNA) is made up of fragments of mostly double-stranded extracellular DNA present in the bloodstream. cfDNA is frequently non-specifically elevated in cancer as a result of DNA release from apoptotic and necrotic cells in cancerous tissue. The proportion of cfDNA originating from cancer is also termed circulating tumour DNA (ctDNA). Gains and losses in copy number at specific regions of the genome that are known to be characteristic of cancer can be detected in the cfDNA of cancer patients (see Examples 2 and 4). Accordingly, extracting cfDNA from blood (ie a liquid biopsy) provides a minimally invasive means of detecting the presence of cancerous or pre-cancerous dysplastic tissue located anywhere in the body to be detected.

The sample of DNA from the subject may be cfDNA extracted from a liquid biopsy (ie a blood sample), or DNA extracted from another bodily fluid including but not limited to saliva, urine, stool, lymph or cerebrospinal fluid. The use of DNA obtained from liquid biopsy or other bodily fluids is particularly desirable for methods of screening for cancer or a pre-cancerous condition.

The method may include a further step of the DNA having been extracted from the tissue or fluid sample obtained from the subject. This may be a step of extracting the DNA from the tissue or fluid sample obtained from the subject.

The subject is preferably a human. The subject may be a subject suspected of having cancer or identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue such that the method is a method of diagnosing cancer. The subject may also be asymptomatic or not identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue such that the method is a method of screening for cancer or a pre-cancerous condition.

The subject may have been identified as being at a high risk of developing cancer.

In particular, the subject may have been identified as having a phenotype or genotype that presents a higher than average risk of developing one or more types of cancer, may have a family history of one or more types of cancer, may have a disease or condition that is associated a higher than average risk of developing one or more types of cancer, such as chronic liver disease, cirrhosis of the liver, autoimmune disease and diabetes, may be or have been infected by an oncovirus such as human papillomavirus, hepatitis B or C, and Epstein-Barr virus, may be over the age of 50, over the age of 60 or over the age of 70, may have a history of alcohol abuse, smoking or drug abuse, may have a body mass index (BM I) of over 25, over 30 or over 35, may have previously been exposed to radiation or carcinogenic chemicals or materials, or any combination of the above.

The method may be a method of diagnosing or screening for any one or more of adrenocortical carcinoma, bladder urothelial carcinoma, breast invasive carcinoma, cervical and endocervical cancers, cervical squamous cell carcinoma, endocervical adenocarcinoma, cholangiocarcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, oesophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney chromophobe, kidney renal clear cell carcinoma, kidney renal papillary cell carcinoma, brain lower grade glioma, liver hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumours, uterine corpus endometrial carcinoma, uterine carcinosarcoma and uveal melanoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio value may be calculated by determining the copy number at the first locus and the second locus and dividing the copy number at the first locus by the copy number at the second locus. The copy number at the first locus and the second locus may be determined by any suitable means. In particular, in the event that the locus is a region of the genome such as a whole chromosomal arm or a specific chromosomal region, copy number may be calculated from a sequence of that region of the genome by calculating the mean copy number within that region. In the event that the locus is a specific point in the genome, the copy number at that point may be determined by quantitative polymerase chain reaction (qPCR).

The ratio value may also be calculated by directly determining the relative copy number between the first locus and the second locus, in which case it is unnecessary to determine the copy number at the first locus and the second locus.

The first locus may be any region of the genome that characteristically exhibits a copy number gain in cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened. In particular, the first locus may have a statistically significant copy number gain in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened. The first locus may also have a statistically significant copy number gain in over 50%, over 60%, over 70%, over 80% or over 90% of high grade dysplastic tissue in general or in high grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.

The second locus may be any region of the genome that characteristically exhibits a copy number loss in cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened. In particular, the second locus may have a statistically significant copy number loss in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened. The second locus may have a statistically significant copy number loss in over 50%, over 60%, over 70%, over 80% or over 90% of high-grade dysplastic tissue in general or in high-grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.

The first locus and the second locus may be any region of the genome that characteristically exhibit a copy number gain or loss in cancer respectively. In particular, each locus may be a chromosomal arm such that the copy number at a first locus is the arm-level copy number of one specific chromosomal arm and the copy number at the second locus is the arm-level copy number of another specific chromosomal arm.

Arm-level copy number is the mean copy number across the whole of each chromosomal arm. Accordingly, the calculation of arm-level copy number requires sequences representative of the whole sequence of each chromosomal arm for which copy number is to be determined. The method may therefore involve sequencing the sample of DNA from the subject either to obtain the sequence representative of the specific chromosomal arms of interest, or to obtain the whole genome sequence.

Whole genome sequences can be obtained from genomic DNA extracted from tissue samples using conventional Next Generation Sequencing techniques. Whole genome sequences can also be determined from cfDNA. The DNA extracted from the subject, such as from the buffy coat extracted from a blood sample, may be used as reference DNA for determining whole genome sequences from cfDNA.

Chromosomal arms that characteristically exhibit arm-level copy number gain in cancer are the long arm of chromosome 1 (1q+), the long arm of chromosome 3 (3q+), the short arm of chromosome 7 (7p+), the long arm of chromosome 7 (7q+), the long arm of chromosome 8 (8q+), the short arm of chromosome 12 (12p+), the long arm of chromosome 17 (17q+) and the long arm of chromosome 20 (20q+).

Chromosomal arms that characteristically exhibit arm-level copy number loss in cancer are the short arm of chromosome 1 (1p-), the short arm of chromosome 3 (3p-), the long arm of chromosome 4 (4q-), the long arm of chromosome (6q-), the short arm of chromosome 8 (8p-), the long arm of chromosome (10q-), the long arm of chromosome (13q-), the short arm of chromosome 17 (17p-), the short arm of chromosome 18 (18p-), the long arm of chromosome (18q-) and the long arm of chromosome (22q-).

In particular, the ratios may be 12p:17p, 1q:10q, 1q:13q, 1q:17p, 1q:22q, 1q:3p, 20q:3p, 3q:18q, 3q:3p, 7p:1p, 7q:19q, 8q:17p, 8q:18p, 8q:18q, 8q:4q, 3q:6q, 17q:22q or 8q:8p. Any one or more of these ratios may be useful for diagnosing or screening for any form of cancer or pre-cancerous condition. However, some ratios may enable the diagnosis or screening of specific cancers with greater specificity or sensitivity than others and the preferred ratios for a number of specific cancers are summarised in Table 1.

In particular, the ratio 12p:17p is preferred for diagnosing or screening for ovarian serous cystadenocarcinoma, lung squamous cell carcinoma, testicular germ cell tumours, glioblastoma multiforme, adrenocortical carcinoma or kidney chromophobe, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 1q:10q is preferred for diagnosing or screening for breast invasive carcinoma, lung squamous cell carcinoma, lung adenocarcinoma. liver hepatocellular carcinoma, skin cutaneous melanoma or glioblastoma multiforme, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 1q:13q is preferred for diagnosing or screening for breast invasive carcinoma, ovarian serous cystadenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, liver hepatocellular carcinoma, testicular germ cell tumours or cholangiocarcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 1q:17p is preferred for diagnosing or screening for breast invasive carcinoma, ovarian serous cystadenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, liver hepatocellular carcinoma, uterine carcinosarcoma, cervical squamous cell carcinoma and endocervical adenocarcinoma or pancreatic adenocarcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 1q:22q is preferred for diagnosing or screening for breast invasive carcinoma, ovarian serous cystadenocarcinoma, lung adenocarcinoma, uterine carcinosarcoma or mesothelioma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 1q:3p is preferred for diagnosing or screening for breast invasive carcinoma, head and neck squamous cell carcinoma, lung squamous cell carcinoma, lung adenocarcinoma, cholangiocarcinoma or kidney renal clear cell carcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 20q:3p is preferred for diagnosing or screening for rectum adenocarcinoma, lung squamous cell carcinoma, uterine carcinosarcoma, oesophageal carcinoma, cholangiocarcinoma or kidney renal clear cell carcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 3q:1 8q is preferred for diagnosing or screening for rectum adenocarcinoma, head and neck squamous cell carcinoma, ovarian serous cystadenocarcinoma, lung squamous cell carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, pancreatic adenocarcinoma, oesophageal carcinoma or testicular germ cell tumours, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 3q:3p is preferred for diagnosing or screening for head and neck squamous cell carcinoma, ovarian serous cystadenocarcinoma, lung squamous cell carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, oesophageal carcinoma or kidney renal clear cell carcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 7p:1p is preferred for diagnosing or screening for rectum adenocarcinoma, testicular germ cell tumours, glioblastoma multiforme, kidney chromophobe or pheochromocytoma and paraganglioma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 7q:1 9q is preferred for diagnosing or screening for testicular germ cell tumours, glioblastoma multiforme or brain lower grade glioma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 8q:1 7p is preferred for diagnosing or screening for rectum adenocarcinoma, breast invasive carcinoma, head and neck squamous cell carcinoma, ovarian serous cystadenocarcinoma, stomach adenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, liver hepatocellular carcinoma or uterine carcinosarcoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 8q:1 8p is preferred for diagnosing or screening for rectum adenocarcinoma, testicular germ cell tumours or uveal melanoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 8q:1 8q is preferred for diagnosing or screening for rectum adenocarcinoma, head and neck squamous cell carcinoma, ovarian serous cystadenocarcinoma, stomach adenocarcinoma, uterine carcinosarcoma, pancreatic adenocarcinoma, oesophageal carcinoma or testicular germ cell tumours, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 8q:4q is preferred for diagnosing or screening for head and neck squamous cell carcinoma, ovarian serous cystadenocarcinoma, stomach adenocarcinoma, lung squamous cell carcinoma, uterine carcinosarcoma, oesophageal carcinoma or testicular germ cell tumours, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 3q:6q is preferred for diagnosing or screening for ovarian serous cystadenocarcinoma, lung squamous cell carcinoma or cervical squamous cell carcinoma and endocervical adenocarcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

The ratio 17q:22q is preferred for diagnosing or screening for mesothelioma, or a pre-cancerous condition that is capable of developing into mesothelioma.

The ratio 8q:8p is preferred for diagnosing or screening for ovarian serous cystadenocarcinoma or lung squamous cell carcinoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

Table 2: The preferred ratios for diagnosing or screening for a number of specific cancers or a pre-cancerous condition that is capable of developing into any one or more of these cancers are indicated with an "X" Rectum adenocarcinoma Breast invasive carcinoma Head and Neck squamous cell carcinoma Ovarian serous cystadenocarcinoma Stomach adenocarcinoma Lung squamous cell carcinoma Lung adenocarcinoma Liver hepatocellular carcinoma Uterine Carcinosarcoma Cervical squamous cell carcinoma and Pancreatic adenocarcinoma Oesophageal carcinoma Testicular Germ Cell Tumours Cholangiocarcinoma Skin Cutaneous Melanoma Glioblastoma multitorme Kidney renal clear cell carcinoma Adrenocortical carcinoma Kidney Chromophobe Mesothelioma Pheochromocytoma and Paraganglioma Brain Lower Grade Glioma Uveal Melanoma endocervical adenocarcinoma 12p:17p X X X X X 1q:10q X X X X X X 1q:13q X X X X X X X 1q:17p X X X X X X X X 1q:22q X X X X X 1q:3p X X X X X X 20q:3p X X X X X X 3q:18q X X X X X X X X 3q:3p X X X X X X 7p:1p X X X X X 7q:19q X X X 8q:17p X X X X X X X X X 8q:18p X X X 8q:18q X X X X X X X X 8q:4q X X X X X X X 3q:6q X X X 17q:22q X 8q:8p X X Arm-level copy number represents the mean copy number across a whole chromosomal arm although copy number variation is not typically consistent across the whole chromosomal arm with the amplitude of the variation tending to recurrently peak at specific regions or loci within the chromosomal arm. Such regions or loci are referred to as a "duplication hotspot" or "deletion hotspot" depending on whether the variation is a gain or a loss in copy number.

Accordingly, each locus may be a specific chromosomal region such that the copy number at a first locus is the copy number of one specific chromosomal region (ie a duplication hotspot) and the copy number at the second locus is the copy number of another specific chromosomal region (ie a deletion hotspot).

The ratio value may be determined using PCR-based methods. This is particularly suitable for methods in which each locus is a specific point in the genome. The Paralogue Ratio Test (PRT) is a PCR-based method that involves the use of a single primer sequence that targets two independent loci within the genome. The first of these loci is a test locus that is likely to exhibit copy number variation and the second is a reference locus that is likely to be copy number neutral.

Therefore, if the ratio of PCR product derived from the test locus and the reference locus is increased, this indicates a copy number gain at the test locus while a reduction in this ratio correspondingly indicates a copy number loss at the test locus. The FOR products from each loci may differ in length in order to enable them to be distinguished from one another.

The ratio value may therefore be determined directly from the relative copy number between the first locus and the second locus, which therefore makes it unnecessary to determine the copy number at the first locus and the second locus.

Accordingly, the relative copy number between the first locus and the second locus may be determined by a PCR-based method based on the PRT in which a single primer sequence is used that targets both the first locus, which characteristically exhibits a copy number gain in cancer, and the second locus, which characteristically exhibits a copy number loss in cancer. Accordingly, the ratio between the amount of PCR product derived from the first locus and the amount of FOR product derived from the second locus will indicate the ratio value of the copy number at each of these loci.

According to a second aspect of this invention, there is provided a PCR primer that targets a first locus and a second locus of the first aspect of this invention. The FOR primer ideally does not target any other region of the genome of the subject.

According to a third aspect of this invention, there is provided a kit for performing the method according to the first aspect of this invention, the kit comprising a PCR primer according to a second aspect of this invention.

According to fourth aspect of this invention, there is provided a method of identifying a primer according to the second aspect of this invention.

Ratios between different first loci that characteristically exhibit copy number gain in cancer and second loci that characteristically exhibit copy number loss in cancer are known to have different levels of sensitivity for different cancer types.

Thus, according to a fifth aspect of this invention, there is provided a method of determining the type of cancer from which a subject is suffering comprising the steps of calculating the ratio values for two or more ratios between the copy number at first loci that characteristically exhibit copy number gain in cancer and second loci that characteristically exhibit copy number loss in cancer and correlating these ratio values with the known ratio value profiles of particular cancer types. The method may further comprise a step of treating the subject with an appropriate treatment for the identified type of cancer. The treatment may include any one or more of chemotherapy, immunotherapy, radiotherapy and surgery According to a sixth aspect of this invention, there is provided a method of diagnosing cancer or the presence of high-grade dysplastic tissue in a subject comprising the steps of applying the method according to the first aspect of this invention to the subject, determining that the ratio value is greater than the predetermined threshold, and performing one or more additional diagnostic tests. The additional diagnostic tests may include biopsy and histological examination, screening for biomarkers, an MRI scan, a CT scan, a PET-CT scan and an ultrasound scan.

According to a seventh aspect of this invention, there is provided a method of treating cancer in a subject diagnosed with cancer according to the first aspect of this invention. The method may comprise treating the subject with any one or more of chemotherapy, immunotherapy, radiotherapy and surgery. In particular, in the event that the subject has been diagnosed with early stage cancer, the method may comprise the surgically removing the cancerous tissue followed by adjuvant chemotherapy, immunotherapy or radiotherapy.

According to an eighth aspect of this invention, there is provided a method of treating a subject identified as having a high-grade dysplasia according to the first aspect of this invention. The method may comprise surgically removing the high-grade dysplastic tissue.

According to a ninth aspect of this invention, there is provided a method of screening for cancer relapse, wherein the method comprises applying the method according to the first aspect of this invention to a subject who has previously suffered from cancer. The method may further comprise treating the subject with any one or more of chemotherapy, immunotherapy, radiotherapy and surgery.

DESCRIPTION OF THE DRAWINGS

Figure 1 is a plot of arm-level copy number in cancers genomes (n=11,411) and normal genomes (n=11,218) calculated from genome sequence data in The Cancer Gene Atlas. Arm-level copy number is determined from whole genome sequences by calculating the mean copy number across the whole of each chromosomal arm. Each chromosomal arm is represented along the X-axis and arm-level copy number is represented along the Y-axis. The Y-axis represents the baseline copy number such that deviation above the Y-axis indicates arm-level copy number gain and deviation below the Y-axis indicates arm-level copy number loss.

Figures 2 is a plot of the cumulative frequency of arm-level copy number in genomic DNA extracted from each of A) HCC tissue samples (n=115) and B) dysplastic tissue samples (n=46), and C) cfDNA extracted from liquid biopsy samples from HCC patients (n=22). Each chromosomal arm is represented along each X-axis and arm-level copy number cumulative frequency is represented along each Y-axis. Each Y-axis represents the baseline copy number such that deviation above each Y-axis indicates arm-level copy number gain and deviation below each Y-axis indicates arm-level copy number loss.

Figure 3A is a plot of the frequency of arm-level copy number of the long arm of chromosome 8 (8q) and Figure 3B is a plot of the frequency of arm-level copy number values of the short arm of chromosome 17 (17p) in the genomes of ten specific cancer types (n=4,812) in The Cancer Gene Atlas. The X-axis represents the arm-level copy number and the Y-axis represents frequency.

Figure 3C is a plot of the frequency of the value of the ratio between the arm-level copy number of 8q and the arm-level copy number of 17p (calculated by dividing the arm level copy number of 8q by the arm-level copy number of 17p for each individual genome) in the genomes of normal cells (n=4,833). The X-axis represents the ratio value, the Y-axis represents frequency and the horizontal dotted line indicates a ratio value of 1.03 (the 95th percentile of the ratio values for this dataset).

Figure 3D is a plot of the frequency of the values of the ratio between the arm level copy number of 8q and the arm-level copy number of 17p (calculated by dividing the arm level copy number of 8q by the arm-level copy number of 17p for each individual genome) in the cancer genomes considered above in Figures 3A and 3B (n=4,812). The X-axis represents the ratio value, the Y-axis represents frequency and the horizontal dotted line indicates a ratio value of 1.03 (the 95th percentile of the ratio values for the genomes of normal cells).

EXAMPLES

The invention is described further below by way of example only, with reference to the accompanying figures.

Example 1 -Cancer genomes exhibit consistent arm-level copy number variations The Cancer Gene Atlas is a publicly available repository containing the genome sequences of over 11,000 cancers of various types. The genome sequences of normal tissue taken from the cancer patients is also available for over 98% of the cancer genomes, which enables direct comparison of the genomes of cancers and normal tissue taken from the same individual.

The genome sequence data taken from The Cancer Gene Atlas was analysed in order to calculate arm-level copy number variations in cancer genomes. Arm-level copy number is calculated from whole genome sequences as the mean copy number across the whole of each chromosomal arm. Figure 1 is a plot of arm-level copy number in cancers genomes (n=11,411) and normal genomes (n=11,218) calculated from genome sequence data in The Cancer Gene Atlas.

This plot indicates that normal tissue genomes show minimal arm-level copy number deviation from the baseline (represented by the Y-axis). However, cancer genomes show marked arm-level copy number variations from the baseline with consistent deviations in copy number on specific chromosome arms. These include consistent copy number gains (indicated by deviation above the Y-axis) on the long arms of chromosome 1 (1q+) and chromosome 8 (8q+) and copy number loss (indicated by deviation below the Y-axis) on the long arm of chromosome 4 (4q-) and the short arms of chromosomes 8 (8p-) and chromosome 17 (17p-).

The Cancer Gene Atlas includes hepatocellular carcinoma (HCC) genomes (n=379). Arm-level copy number variations for these HCC genomes were calculated (data not shown) and the most common variations included 1q+ (90%), 4q-(77%), 8p-(76%), 8q+ (81%) and 17p-(79%).

Example 2 -Copy number variations present in cancer genomes are also present in hioh-orade dysplastic tissue and can be detected in liquid biopsy taken from cancer patients The genome sequences taken from two independent liver cancer cohorts were analysed for arm-level copy number variations.

The first cohort provided solid tissue samples from hepatocellular carcinoma lesions, which were fixed in 10% formalin for 24 to 48 hours and then sliced at <10mm intervals for classification. Relatively large nodules and/or with distinct coloration / soft bulging surface were embedded in separate paraffin blocks and routine Haematoxylin and Eosin sections on glass slides were used for morphological assessment. All Haematoxylin and Eosin slides were reviewed by a single experienced liver histopathologist who identified clear examples to represent the range of hepatocellular carcinoma lesions, outlined the lesions on the glass slides and recorded their differentiation and morphological pattern according to the World Health Organisation (WHO) classification. Nodules were classified as HCC (n=115) or dysplastic nodules (n=46), including high-grade (n=28) and low-grade (n-18) dysplastic nodules, using standard criteria (Sciarra et al; Morphophenotypic changes in human multistep hepatocarcinogenesis with translational implications, Journal of Hepatology; 64(1), 87-93 (2016)).

The second cohort was made up of patients diagnosed with HCC radiologically according to European Association for the Study of the Liver (EASL) criteria (n=22). An 8.5m1 blood sample was obtained from each patient and centrifuged within 1 hour to enable plasma and buffy coat extraction followed by storage at -80 degrees centigrade.

DNA was extracted from the solid tissue biopsy samples of the first cohort and from the bully coat samples of the second cohort using QIAamp DNA Micro Kit (Qiagen). cfDNA was extracted from the plasma samples of the second cohort using QIAamp MinElute ccfDNA Midi Kit (Qiagen).

Copy number variation was determined using fluorometry. The samples were prepared for IIlumina sequencing using the NEBnext Ultra kit (New England Biolabs) and labelled using custom designed primers incorporating unique 6bp tags as previously published (Samman et al; Next-generation sequencing analysis for detecting human papillomavirus in oral verrucous carcinoma; Oral Surgery, Oral Medicine, Oral Pathology and Oral Radiology; 118(1): 117-125.e1 (2014)).

For the first cohort, a generic reference DNA sample was constructed using data from a pool of 20 gender and sequencing platform matched individuals downloaded from the 1000 genomes project (Abecasis et al; A map of human genome variation from population-scale sequencing; Nature; 467: 1061-73 (2010)). For the second cohort, the DNA extracted from the buffy coat used as reference DNA for each individual.

Figure 2 is a plot of the cumulative frequency of arm-level copy number in each of A) the HCC tissue samples of the first cohort (n=115), B) the dysplastic tissue samples of the first cohort (n=46) and C) the liquid biopsy samples from the HCC patients of the second cohort (n=22). These plots indicate that genomic DNA extracted from HCC tissue, high-grade dysplastic tissue and cfDNA obtained from HCC patients show consistent arm-level copy number deviation from the baseline (represented by the Y-axis) on specific chromosomal arms. These include consistent copy number gains (indicated by deviation above the Y-axis) on the long arms of chromosome 1 (1q+) and chromosome 8 (8q+) and copy number loss (indicated by deviation below the Y-axis) on the long arm of chromosome 4 (4q-) and the short arms of chromosomes 8 (8p-) and chromosome 17 (17p-).

Figures 2A and 2B in relation to the first cohort indicate that the arm-level copy number gains and losses on specific chromosomal arms that characterise HCC genomes are also present in the genomes of dysplasia tissue cells. A screening test based on the identification of these copy number variations may enable the detection of pre-cancerous dysplastic tissue.

Figure 2C in relation to the second cohort indicates that arm-level copy number 30 gains and losses on the specific chromosomal arms that characterise HCC genomes are apparent in cfDNA extracted from liquid biopsy taken from HCC patients. This indicates that liquid biopsy samples have the potential to provide non-invasive cancer screening based on the identification of the presence of copy number variations that characterise cancer genomes in cfDNA.

However, the presence of any copy number variations that is known to be common in cancer genomes is not currently known to not permit the detection of cancer with sufficient sensitivity to be of any clinical use.

Example 3 -Calculation of copy number ratios between specific regions of the genome enables the detection of cancer with a high level of sensitivity Figure 3A is a plot of the frequency of arm-level copy number values of the long arm of chromosome 8 (8q) and Figure 3B is a plot of the frequency of arm-level copy number values of the short arm of chromosome 17 (17p), which were generated from the arm-level copy number values of the genomes of ten specific cancer types (hepatocellular carcinoma, bladder urothelial carcinoma, uterine carcinosarcoma, lung adenocarcinoma, lung squamous cell carcinoma, stomach adenocarcinoma, ovarian serous cystadenocarcinoma, head and neck squamous cell carcinoma, breast invasive carcinoma and rectum adenocarcinoma) in The Cancer Gene Atlas (n=4,812). Figure 3A indicates that the majority of these cancer genomes exhibit arm-level copy number gain in 8q and Figure 3B indicates that the majority of cancer genomes exhibit arm-level copy number loss in 17p.

Figure 3C is a plot of the frequency of the value of the ratio between the arm-level copy number of 8q and the arm-level copy number of 1 7p (calculated by dividing the arm level copy number of 8q by the arm-level copy number of 17p for each individual genome) in the genomes of normal cells (n=4,833), which indicates minimal variation from the baseline ratio (indicated by the X-axis). The horizontal dotted line indicates a ratio value of 1.03, which is the 95th percentile of normal values (ie 95% of normal genomes have 8q:1 7p ratio value of less than 1.03).

Figure 3D is a plot of the frequency of the values of the ratio between the arm-level copy number of 8q and the arm-level copy number of 1 7p (calculated by dividing the arm level copy number of 8q by the arm-level copy number of 1 7p for each individual genome) in the cancer genomes considered above in Figures 3A and 3B (n=4,812). There is a clear deviation from the spread of ratio values for normal cells (Figure 3C) as 86% of cancer genomes have a ratio value that is higher than the threshold of 1.03 (ie the 95th percentile for normal values) indicated by the horizontal dotted line.

Accordingly, the calculation of the copy number ratio value between the arm-level copy number of 8q and the arm-level copy number of 17p enables the detection of cancer using copy number variation data with a far greater sensitivity than any previously known method.

Example 4 -Validation of ratios for high sensitivity detection of cancer and pre-cancerous conditions The methodology described in Example 3 was used to generate threshold values for ratios that are indicative of >80% of each of hepatocellular carcinoma, bladder urothelial carcinoma, uterine carcinosarcoma, lung adenocarcinoma, lung squamous cell carcinoma, stomach adenocarcinoma, ovarian serous cystadenocarcinoma, head and neck squamous cell carcinoma, breast invasive carcinoma and rectum adenocarcinoma (data not shown).

In the case of hepatocellular carcinoma (HOC), the ratio that was determined to be of greatest value is between the arm-level copy number of the long arm of chromosome 1 (1q), which characteristically exhibits arm-level copy number gain in this type of cancer, and the arm-level copy number of the long arm of chromosome 4 (4q), which characteristically exhibits arm-level copy number loss in this type of cancer.

The threshold for this ratio was validated on data obtained from a first cohort in which arm-level copy number was determined from genomic DNA extracted from HCC tissue samples (n=115), high grade dysplastic tissue samples (n=33) and non-cancerous cirrhotic liver tissue samples (n=32), and a second cohort in which arm-level copy number was determined from cfDNA extracted from liquid biopsy samples taken from HCC patients (n=22) and liver cirrhosis (non-cancer) patients (n=9).

Each sample was classified as either negative if their lq:4q ratio value did not reach the threshold that is considered to be indicative of HCC or positive if their lq:4q ratio value exceeded this threshold (see Table 2).

Table 2: Validation of the results lq:4q ratio and threshold value for indicating the presence of hepatocellular carcinoma (HCC) Cohort Case lq:4q negative lq:4q positive First (Tissue) HCC 12 103 Second (Blood) HCC 0 22 First (Tissue) High-grade 10 22 dysplasia First (Tissue) Cirrhosis 31 1 Second (Blood) Cirrhosis 9 0 These results indicate that the lq:4q ratio has a sensitivity of greater than 95% for discriminating between HCC and cirrhosis (a non-cancerous condition). This discriminative ability was achieved for both the first cohort using genomic DNA extracted from HCC tissue, and the second cohort, using cfDNA extracted from liquid biopsy taken from HCC patients.

The threshold ratio value was also exceeded for a significant proportion of high-grade dysplastic tissue samples, indicating the potential utility of this method for screening for the presence of high-grade dysplastic tissue along with asymptomatic early-stage cancer, as well as discriminating between high-grade and low-grade dysplasia.

Example 5: The Hybrid Paraloque Ratio Test (HPRT) The arm-level copy number variations considered in Examples 1 to 4 above are calculated from whole genome sequences as the mean copy number across the whole of each chromosomal arm.

A modified version of the Paralogue Ratio Test (PRT), referred to as the Hybrid Paralogue Ratio Test (HPRT). The PRT is a FOR-based method that uses a single primer sequence that targets two independent loci within the genome. The first of these loci is a test locus that is likely to exhibit copy number variation and the second is a reference locus that is likely to be copy number neutral.

Therefore, the ratio of FOR product derived from these two loci being increased indicates a copy number gain at the test locus while a reduction in this ratio correspondingly indicates a copy number loss at the test locus.

The HPRT uses a single primer sequence that targets both the first locus, which characteristically exhibits a copy number gain in cancer, and the second locus, which characteristically exhibits a copy number loss in cancer. Accordingly, the ratio between the amount of FOR product derived from the first locus and the amount of FOR product derived from the second locus indicates the ratio value of the copy number at each of these loci. The ratio value may therefore be determined directly from the relative copy number between the first locus and the second locus, which therefore makes it unnecessary to determine the copy number at the first locus and the second locus.

Primer design principles To amplify products from two different regions of the genome as a method to measure their genomic copy number ratio, HPRT primers need to match both targeted regions perfectly and avoid bases that are frequently variable in the population. The amplified products must also contain positions that can be used to distinguish the two loci from one another. In an implementation of the method separating the products using capillary electrophoresis, a length difference between the products can be used to distinguish products from the two regions.

Primer design methodology Appropriate primers can be identified by first identifying loci in the two regions to be compared that have similar DNA sequences. Relevant regions can be identified in practice using the 'Self-Chain' or 'Segmental Duplication' analysis tracks on publicly available genome browsers, and filtering to show DNA sequences present in closely similar form on exactly the two targeted regions. For example, using the coordinates of the GRCh37/hg19 human genome assembly, chr1:184041288-184042689 is closely similar to chr17:17360407-17361617, and primers designed from positions identical between these two DNA sequences can be used to amplify products from both regions in a single reaction. Primers must not include commonly polymorphic bases at either target, and commonly polymorphic positions can be marked using relevant database information resources, such as 'common SNPs (151)', which identifies positions variable in 1% or more of samples in dbSNP database version 151.

Example HPRT primers

From the regions chr1:184041288-184042689 and chr17:17360407-17361617 cited above, three different primer pairs were designed to amplify products from both chromosome 1q and chromosome 17p, thereby facilitating 1q/17p copy number ratio measurements.

Primer PRT1_184AF (TTTCCTGATGCTTGTTTTATTCA) and primer PRT1_184AR (TCTTCAGAATGAAAACCTTATGGA) are predicted to amplify a 136bp product from chromosome lq (GRCh37/hg19::chr1:184041990-184042125) and a 140bp product from chromosome 17p (GRCh37/hg19::chr17:17360582-17360721).

Primer PRT1_184A2F (TCATACAAGATTGGATTTGAGACC) and primer PRT1_184AR (TCTTCAGAATGAAAACCTTATGGA) are predicted to amplify a 116bp product from chromosome 1q (GRCh37/hg19::chr1:184042010-184042125) and a 120bp product from chromosome 17p (GRCh37/hg19::chr17:17360602-17360721).

Primer PRT1_184BF (TTTTGGCCACTGCAGCTA) and primer PRT1_184BR (GATGAACATATTTTGAGTTTTGATTT) are predicted to amplify a 178bp product from chromosome 1q (GRCh37/hg19::chr1:184042378-184042555) and a 174bp product from chromosome 17p (GRCh37/hg19::chr17:17361297-17361470).

Example experiments on control DNA Amplification of products using HPRT primers can be done using standard polymerase chain reaction (FOR) methods. For example, primers PRT1_184BF and PRT1_184BR above were used to amplify products from lOng of control DNA; in this experiment the primer PRT1_184BR was labelled with the fluorescent dye HEX' (Hexachlorofluorescein) to allow fluorescent detection. The FOR was conducted in a total volume of 10p1, with water, reaction buffer, deoxyribonucleoside triphosphates (dNTPs), primers, Taq DNA polymerase and input DNA. In a typical experiment the reaction buffer included Tris-HCI pH8.8 at a final concentration of 50mM and magnesium chloride at a final concentration of 1.4mM; the other reaction components other than water included dNTPs at a final concentration of 200pM each, primers at a final concentration of 0.5pM each, Taq DNA polymerase at a final concentration of 0.05 units/pland input DNA at a final concentration of lng/pl. The reaction employed 29 temperature cycles each of 95°C for 30 seconds, 57°C for 30 seconds and 70°C for 30 seconds.

After FOR, fluorescently labelled FOR products were separated by capillary electrophoresis, in a typical experiment using an Applied Biosystems 3130x1 Genetic Analyser. FOR products were mixed with formamide and ROX (carboxy-X-rhodamine)-labelled size markers, before electroinjecting the samples into a 36cm capillary at lkV for 30 seconds. Multiple FOR products differing in predicted size can be conveniently mixed and subjected to electrophoresis in the same capillary to provide a multiplex profile from several HPRT systems.

After capillary electrophoresis, separated peaks corresponding to specific length products can be detected and quantified using proprietary software such as PeakScanner2 (Applied Biosystems). The ratios between the yields of specific products can then be calculated. For example, in the specific case of primers PRT1 184BF and PRT1 184BR above, products of approximately 172-175bp were assigned as products from chromosome 17p, and products of approximately 176-179bp were assigned as products from chromosome 1q. In a typical experiment, the ratios of peak areas (1q:17p) produced using primers PRT1 184BF and PRT1 184BR above were measured in 15 normal control DNA samples and gave ratios between approximately 0.89 and 1.04. The mean value was approximately 0.97. This mean value of 0.97 represented the average value of the ratio between the PCR products in normal control samples, which we take to be an estimator of the value expected when the copy numbers at chromosome 1q and 17p are the same. To adjust the values to estimate the relative (1q:17p) copy number ratios of the different samples based on the experimental results, the raw ratio of product areas is divided by the mean value for all samples to give a normalised ratio. This normalised ratio has an expected value of 1; in the experiment quoted here, the observed mean value was 1, with a standard deviation of 0.047.

In similar experiments, measurement of PCR product ratios with the primers 184A2F and primer PRT1_184AR in 15 normal control DNA samples led to normalised (1q:17p) ratio values with a mean value of 1 and a standard deviation of 0.059.

Specific embodiments of the invention are set out in the following paragraphs: 1. A method of diagnosing cancer or screening for cancer or a pre-cancerous condition in a subject, the method comprising the steps of; having obtained a sample of DNA from the subject; calculating the ratio value between the copy number at a first genomic locus that characteristically exhibits a copy number gain in cancer and a second genomic locus that characteristically exhibits a copy number loss in cancer; and, determining whether the ratio value exceeds a predetermined threshold value.

2. The method of paragraph 1, which is a method of distinguishing high-grade dysplastic tissue from low-grade dysplastic tissue.

3. The method of paragraph 1 or 2, wherein the pre-cancerous condition is the presence of high-grade dysplastic tissue.

4. The method of any preceding paragraph, wherein the predetermined threshold corresponds to the ratio value that is exceeded by less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9% or less than 10% of subjects that do not have cancer or a pre-cancerous condition.

5. The method of any preceding paragraph, wherein the predetermined threshold corresponds to the ratio value that is exceeded by more than 50%, more 15 than 60%, more than 70%, more than 80%, more than 90% or more than 95% of subjects that do have cancer or a pre-cancerous condition.

6. The method of any preceding paragraph, wherein the predetermined threshold is about 1.01, 1.02, 1.03, 1.04 or 1.05.

7. The method of any preceding paragraph, wherein the predetermined threshold is 1.010, 1.011, 1.012, 1.013, 1.014, 1.015, 1.016, 1.017, 1.018, 1.019, 1.020, 1.021, 1.022, 1.023, 1.024, 1.025, 1.026, 1.027, 1.028, 1.029, 1.030,1.031, 1.032, 1.033, 1.034, 1.035, 1.036, 1.037, 1.038, 1.039, 1.040, 1.041, 1.042, 1.043, 1.044, 1.045, 1.046, 1.047, 1.048, 1.049 or 1.050.

8. The method of any preceding paragraph further comprising calculating a second ratio value between the copy number at another first locus that characteristically exhibits a copy number gain in cancer and another second locus that characteristically exhibits a copy number loss in cancer, and determining whether the second ratio value exceeds a second predetermined threshold value.

9. The method of paragraph 8, wherein both of the first and second loci used to calculate the second ratio value are different to the first and second loci used to calculate the first ratio value.

10. The method of paragraph 9, wherein the second predetermined threshold value is different to the first predetermined ratio value.

11. The method of any of paragraph 8 to 10 further comprising calculating a third, fourth, fifth or further ratio values and determining whether they exceed a third, fourth, fifth or further predetermined threshold value.

12. The method of any of paragraph 8 to 11, wherein the presence of cancer or a pre-cancerous condition is indicated by any one of the ratio values exceeding the corresponding predetermined threshold.

13. The method of any of paragraph 8 to 11, wherein the presence of cancer or a pre-cancerous condition is indicated by all of the two or more ratio values exceeding the corresponding predetermined thresholds.

14. The method of any preceding paragraph further comprising an initial step of obtaining a DNA sample from the subject.

15. The method of paragraph 14 comprising taking a solid tissue biopsy from a lesion or nodule that is suspected of being cancerous or pre-cancerous dysplastic tissue from the subject.

16. The method of paragraph 14 comprising obtaining a sample of blood, saliva, urine, stool, lymph or cerebrospinal fluid from the subject.

17. The method of any preceding paragraph wherein the sample of DNA is a sample of cfDNA or DNA extracted from a lesion or nodule that is suspected of being cancerous or pre-cancerous dysplastic tissue.

18. The method of any preceding paragraph further comprising a step of the DNA having been extracted from a tissue or fluid sample obtained from the subject.

19. The method of any preceding paragraph further comprising extracting the DNA from a tissue or fluid sample obtained from the subject.

20. The method of any preceding paragraph wherein the subject is human.

21. The method of any preceding paragraph wherein the subject is suspected of having cancer or has been identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue.

22. The method of any preceding paragraph wherein the subject is asymptomatic or has not been identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue.

23. The method of any preceding paragraph wherein the subject has been identified as being at a high risk of developing cancer. 20 24. The method of paragraph 23 wherein the subject has a phenotype or genotype that presents a higher than average risk of developing one or more types of cancer, a family history of one or more types of cancer, may have a disease or condition that is associated a higher than average risk of developing one or more types of cancer, such as chronic liver disease, cirrhosis of the liver, autoimmune disease and diabetes, may be or have been infected by an oncovirus such as human papillomavirus, hepatitis B or C, and Epstein-Barr virus, is over the age of 50, over the age of 60 or over the age of 70, has a history of alcohol abuse, smoking or drug abuse, has a body mass index (BMI) of over 25, over 30 or over 35, has previously been exposed to radiation or carcinogenic chemicals or materials, or any combination of the above.

25. The method of any preceding paragraph which is a method of diagnosing or screening for any one or more of adrenocortical carcinoma, bladder urothelial carcinoma, breast invasive carcinoma, cervical and endocervical cancers, cervical squamous cell carcinoma, endocervical adenocarcinoma, cholangiocarcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, oesophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney chromophobe, kidney renal clear cell carcinoma, kidney renal papillary cell carcinoma, brain lower grade glioma, liver hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumours, uterine corpus endometrial carcinoma, uterine carcinosarcoma and uveal melanoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.

26. The method of any preceding paragraph, wherein the ratio value is calculated by determining the copy number at the first locus and the second locus and dividing the copy number at the first locus by the copy number at the second 20 locus.

27. The method of any preceding paragraph, wherein the ratio value is calculated by directly determining the relative copy number between the first locus and the second locus.

28. The method of any preceding paragraph, wherein the first locus has a statistically significant copy number gain in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened.

29. The method of any preceding paragraph, wherein the first locus has a statistically significant copy number gain in over 50%, over 60%, over 70%, over 80% or over 90% of high grade dysplastic tissue in general or in high grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.

30. The method of any preceding paragraph, wherein the second locus has a statistically significant copy number loss in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened.

31. The method of any preceding paragraph, wherein the second locus has a statistically significant copy number loss in over 50%, over 60%, over 70%, over 80% or over 90% of high-grade dysplastic tissue in general or in high-grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.

32. The method of any preceding paragraph wherein the first locus and/or the second locus is a chromosomal arm.

33. The method of paragraph 32, wherein the first locus is any of the long arm of chromosome 1 (1q+), the long arm of chromosome 3 (3q+), the short arm of chromosome 7 (7p+), the long arm of chromosome 7 (7q+), the long arm of chromosome 8 (8q+), the short arm of chromosome 12 (12p+), the long arm of chromosome 17 (17q+) and the long arm of chromosome 20 (20q+).

34. The method of paragraph 32 or 33, wherein the second locus is any of the short arm of chromosome 1 (1p-), the short arm of chromosome 3 (3p-), the long arm of chromosome 4 (4q-), the long arm of chromosome (6q-), the short arm of chromosome 8 (8p-), the long arm of chromosome (10q-), the long arm of chromosome (13q-), the short arm of chromosome 17 (17p-), the short arm of chromosome 18 (18p-), the long arm of chromosome (18q-) and the long arm of chromosome (22q-).

35. The method of paragraph 32 to 34, wherein the first locus and second locus are 12p:17p, 1q:10q, 1q:13q, 1q:17p, 1q:22q, 1q:3p, 20q:3p, 3q:18q, 3q:3p, 7p1p, 7q:19q, 8q:17p, 8q:18p, 8q:18q, 8q:4q, 3q:6q, 17q:22q or 8q:8p.

36. The method of paragraph 1 to 31, wherein the ratio value is determined using a PCR-based method.

37. The method of paragraph 36, wherein the PCR-based method determines the relative copy number between the first locus and the second locus.

38. The method of paragraph 36 or 37, wherein a single primer sequence targets both the first locus and the second locus and the ratio between the amount of PCR product derived from the first locus and the second locus indicates the ratio value.

39. A PCR primer that targets a first locus and a second locus according to paragraph 1.

40. The PCR primer of paragraph 39, wherein the primer does not target any other region of the genome of the subject.

41. The PCR primer of paragraph 39 or 40, wherein the primer avoids bases that are frequently variable in the population.

42. A kit for performing the method of any of paragraph 36 to 38, the kit comprising a PCR primer according to any of paragraph 39 to 41.

43. A method of identifying a primer according to any of paragraph 39 to 41.

44. A method of determining the type of cancer from which a subject is suffering comprising the steps of calculating the ratio values for two or more ratios between the copy number at first loci that characteristically exhibit copy number gain in cancer and second loci that characteristically exhibit copy number loss in cancer and correlating these ratio values with the known ratio value profiles of particular cancer types.

45. A method of diagnosing cancer or the presence of high-grade dysplastic tissue in a subject comprising the steps of applying the method of paragraph 1 to the subject, determining that the ratio value is greater than the predetermined threshold, and performing one or more additional diagnostic tests.

46. The method of paragraph 1, wherein the additional diagnostic tests include 10 any one or more of screening for biomarkers, an MRI scan, a CT scan, a PET-CT scan and an ultrasound scan.

47. A method of treating cancer in a subject diagnosed with cancer according to the method of paragraph 1.

48. The method of paragraph 47 comprising treating the subject with any one or more of chemotherapy, immunotherapy, radiotherapy and surgery.

49. The method of paragraph 47, wherein the subject has been diagnosed with early stage cancer and the method comprises surgically removing the cancerous tissue followed by adjuvant chemotherapy, immunotherapy or radiotherapy.

50. A method of treating a subject identified as having a high-grade dysplasia according to the method of paragraph 1, the method comprising surgically removing the high-grade dysplastic tissue.

51. A method of screening for cancer relapse, wherein the method comprises applying the method of paragraph 1 to a subject who has previously suffered from cancer.

52. The method of paragraph 51 further comprising treating the subject with any one or more of chemotherapy, immunotherapy, radiotherapy and surgery.

Claims (25)

1. Claims: 1. A method of diagnosing cancer or screening for cancer or a pre-cancerous condition in a subject, the method comprising the steps of: calculating the ratio value between the copy number at a first genomic locus that characteristically exhibits a copy number gain in cancer and a second genomic locus that characteristically exhibits a copy number loss in cancer in a DNA sample obtained from the subject; and, determining whether the ratio value exceeds a predetermined threshold value.
2. 2. The method of Claim 1, which is a method of distinguishing high-grade dysplastic tissue from low-grade dysplastic tissue.
3. 3. The method of Claim 1 or 2, wherein the pre-cancerous condition is the presence of high-grade dysplastic tissue.
4. 4. The method of any preceding claim, wherein the predetermined threshold is about 1.01, 1.02, 1.03, 1.04 or 1.05.
5. S. The method of any preceding claim further comprising calculating a second ratio value between the copy number at another first locus that characteristically exhibits a copy number gain in cancer and another second locus that characteristically exhibits a copy number loss in cancer, and determining whether the second ratio value exceeds a second predetermined threshold value.
6. 6. The method of Claim 5 further comprising calculating a third, fourth, fifth or further ratio values and determining whether they exceed a third, fourth, fifth or further predetermined threshold value.
7. 7. The method of any preceding claim wherein the sample of DNA is a sample of cfDNA or DNA extracted from a lesion or nodule that is suspected of being cancerous or pre-cancerous dysplastic tissue.
8. 8. The method of any preceding claim wherein the subject is human.
9. 9. The method of any preceding claim wherein the subject is suspected of having cancer or has been identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue.
10. 10. The method of any preceding claim wherein the subject is asymptomatic or has not been identified as having tissue that is suspected of being cancerous or pre-cancerous dysplastic tissue.
11. 11. The method of any preceding claim wherein the subject has been identified as being at a high risk of developing cancer.
12. 12. The method of Claim 11 wherein the subject has a phenotype or genotype that presents a higher than average risk of developing one or more types of cancer, a family history of one or more types of cancer, may have a disease or condition that is associated a higher than average risk of developing one or more types of cancer, such as chronic liver disease, cirrhosis of the liver, autoimmune disease and diabetes, may be or have been infected by an oncovirus such as human papillomavirus, hepatitis B or C, and Epstein-Barr virus, is over the age of 50, over the age of 60 or over the age of 70, has a history of alcohol abuse, smoking or drug abuse, has a body mass index (BMI) of over 25, over 30 or over 35, has previously been exposed to radiation or carcinogenic chemicals or materials, or any combination of the above.
13. 13. The method of any preceding claim which is a method of diagnosing or screening for any one or more of adrenocortical carcinoma, bladder urothelial carcinoma, breast invasive carcinoma, cervical and endocervical cancers, cervical squamous cell carcinoma, endocervical adenocarcinoma, cholangiocarcinoma, colon adenocarcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, oesophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney chromophobe, kidney renal clear cell carcinoma, kidney renal papillary cell carcinoma, brain lower grade glioma, liver hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumours, uterine corpus endometrial carcinoma, uterine carcinosarcoma and uveal melanoma, or a pre-cancerous condition that is capable of developing into any one or more of these cancers.
14. 14. The method of any preceding claim, wherein the ratio value is calculated by determining the copy number at the first locus and the second locus and dividing the copy number at the first locus by the copy number at the second locus.
15. 15. The method of any preceding claim, wherein the ratio value is calculated by directly determining the relative copy number between the first locus and the second locus.
16. 16. The method of any preceding claim, wherein the first locus has a statistically significant copy number gain in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened, or of high grade dysplastic tissue in general or in high grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.
17. 17. The method of any preceding claim, wherein the second locus has a statistically significant copy number loss in over 50%, over 60%, over 70%, over 80% or over 90% of cancer in general or in each of one or more specific forms of cancer that are to be diagnosed or screened, or of high-grade dysplastic tissue in general or in high-grade dysplastic tissue that is capable of developing into one or more specific forms of cancer that are to be diagnosed or screened.
18. 18. The method of any preceding claim wherein the first locus and/or the second locus is a chromosomal arm.
19. 19. The method of Claim 18, wherein the first locus is any of the long arm of chromosome 1 (1q+), the long arm of chromosome 3 (3q+), the short arm of chromosome 7 (7p+), the long arm of chromosome 7 (7q+), the long arm of chromosome 8 (8q+), the short arm of chromosome 12 (12p+), the long arm of chromosome 17 (17q+) and the long arm of chromosome 20 (20q+).
20. 20. The method of Claim 18 or 19, wherein the second locus is any of the short arm of chromosome 1 (1p-), the short arm of chromosome 3 (3p-), the long arm of chromosome 4 (4q-), the long arm of chromosome (6q-), the short arm of chromosome 8 (8p-), the long arm of chromosome (10q-), the long arm of chromosome (13q-), the short arm of chromosome 17 (17p-), the short arm of chromosome 18 (18p-), the long arm of chromosome (18q-) and the long arm of chromosome (22q-).
21. 21. The method of Claims 1 to 17, wherein the ratio value is determined using a PCR-based method that determines the relative copy number between the first locus and the second locus.
22. 22. The method of Claim 21, wherein a single primer sequence targets both the first locus and the second locus and the ratio between the amount of PCR product derived from the first locus and the second locus indicates the ratio value.
23. 23. A kit for performing the method of Claim 21 or 22, the kit comprising a PCR primer that targets a first locus and a second locus according to Claim 1.
24. 24. A method of determining the type of cancer from which a subject is suffering comprising the steps of calculating the ratio values for two or more ratios between the copy number at first loci that characteristically exhibit copy number gain in cancer and second loci that characteristically exhibit copy number loss in cancer and correlating these ratio values with the known ratio value profiles of particular cancer types.
25. 25. A method of screening for cancer relapse, wherein the method comprises applying the method of Claim 1 to a subject who has previously suffered from cancer.