GB2587177A - Polymerase - Google Patents

Polymerase Download PDF

Info

Publication number
GB2587177A
GB2587177A GB1900311.0A GB201900311A GB2587177A GB 2587177 A GB2587177 A GB 2587177A GB 201900311 A GB201900311 A GB 201900311A GB 2587177 A GB2587177 A GB 2587177A
Authority
GB
United Kingdom
Prior art keywords
polymerase
nucleic acid
primer
sequence
acid amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
GB1900311.0A
Other versions
GB201900311D0 (en
Inventor
Jain Nisha
Holme John
Asquith Steven
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
3cr Bioscience Ltd
Original Assignee
3cr Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 3cr Bioscience Ltd filed Critical 3cr Bioscience Ltd
Priority to GB1900311.0A priority Critical patent/GB2587177A/en
Publication of GB201900311D0 publication Critical patent/GB201900311D0/en
Priority to PCT/GB2020/050040 priority patent/WO2020144480A1/en
Priority to US17/309,998 priority patent/US20220090194A1/en
Priority to EP20700852.5A priority patent/EP3908677B1/en
Publication of GB2587177A publication Critical patent/GB2587177A/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A modified polymerase with reduced or no exonuclease function or activity for use in nucleic amplification reactions. The modification may be formed by an N-terminal truncation of a polymerase. Also claimed is the use of a quaternary ammonium salt (e.g. a halide salt, tetramethylammonium chloride) in a nucleic acid amplification reaction.

Description

POLYMERASE
FIELD OF THE INVENTION
The present invention relates to methods and kits for nucleic acid detection and/or amplification, such as in an assay system.
BACKGROUND OF THE INVENTION
Advancements in molecular biology techniques, in particular the polymerase chain reaction (PCR) has enabled the development of processes which enable a greater understanding of an individual's genetic make-up (i.e. their genotype).
Genotyping is a generic term given to various nucleic acid analysis techniques that identify alterations or polymorphisms within known sequences, and usually for a given individual. These techniques are useful in many aspects of scientific, medical and forensic fields. For example, these techniques can be used to examine particular genetic loci in an individual in order to diagnose hereditary diseases or provide prognosis based on known genetic lesions. Particular modifications of interest include, for example, point mutations, deletions, insertions and inversions as well as polymorphisms within nucleic acid sequences of interest. These techniques can also be used for clinical purposes such as tissue typing for histocompatibility or for forensic purposes such as identity or paternity determination.
In many PCR based genotyping reactions, a signal producing system is employed to detect the production of amplified product. One type of signal producing system that is commonly used is the fluorescence energy transfer (FRET) system, in which a nucleic acid detector includes fluorescence donor and acceptor groups (see, for example, European Patent 1726664). A primary consideration with PCR-based techniques that employ a FRET-based system is that the signal generated must be highly specific and sensitive to ensure accurate results. High fidelity amplification is also critical.
Thus, there is a continuing need to improve both the sensitivity and accuracy of PCRbased genotyping systems.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides a method for detecting (and/or amplifying) one or more (target) sequences (e.g. in a sample), such as by amplification, the method comprising: a) providing an aqueous composition comprising: i) one or more (forward) oligonucleotide primers (each) having a 5' region which is a tag sequence and a 3' region specific for a target sequence; ii) a (reverse) oligonucleotide primer, such that a forward and the reverse primer may operably form a primer pair; iii) one or more probe(s) (each) having a reporter (label) and a quencher (label), each probe suitably comprising a sequence having at least 50% identity e.g. to the tag sequence of a (forward) oligonucleotide primer; and iv) one or more (enhancer) oligonucleotide primer(s) comprising a sequence having at least 50% identity e.g. to the sequence of a probe; b) suitably, incubating the primers and probes with the sample and at least one polymerase; and c) suitably, performing polymerase chain reaction (PCR) e.g. on the sample, for example to generate tagged nucleic acids, optionally whereby the probe(s) can bind the tagged nucleic acids.
In another aspect, the present invention also provides a kit suitable for use in a (nucleic acid amplification) method or process, comprising: i) one or more (forward) oligonucleotide primer(s) (each) having a 5' region which is a tag sequence and a 3' region specific for a target sequence; ii) a (reverse) oligonucleotide primer, such that a forward and the reverse primer may operably form a primer pair; iii) one or more probe(s) (each) having a reporter (label) and a quencher (label), each probe suitably comprising a sequence having at least 50% identity e.g. to the tag sequence of a forward oligonucleotide primer; iv) one or more (enhancer) oligonucleotide primers comprising a sequence having at least 50% identity to the sequence of a probe; and v) optionally, a polymerase.
In some embodiments, the reporter (label) may be located on or at a different portion of the probe compared to the quencher (label). The position of the labels maybe such that (e.g. when free in solution), the reporter (label) and quencher (label) may come into close proximity to each other such that the reporter is (at least partially) quenched, or little or no emission can be emitted and/or detected from the reporter (label).
Preferably the polymerase is a DNA polymerase, for example, a fragment or domain or a derivative of (Taq) polymerase. In some embodiments, the polymerase is a modified polymerase. In some embodiments, the polymerase is modified to reduce and/or remove exo-nuclease activity and/or modified to be a "hot-start" polymerase.
The one or more (enhancer) oligonucleotide primer(s) may comprise at least two (distinct) regions. Each region can comprise a sequence having at least 50% identity, such as to one or more probe(s). The two distinct regions may be separated, e.g. by a linker region. The linker region may be 2 to 5 or 10 oligonucleotides in length. In some embodiments, there may be no linker region.
Suitably the one or more probe(s) may comprise a sequence having at least 60%, 70%, 80%, 90%, 95%, 98% or 99% identity, such as to the tag sequence of a (forward) oligonucleotide primer. In some embodiments, the one or more probe(s) comprise a sequence identical to the tag sequence of a (forward) oligonucleotide primer.
The one or more (enhancer) oligonucleotide primer(s) can comprise a sequence having at least 60%, 70%, 80%, 90%, 95%, 98% or 99% identity e.g. to the sequence of a probe. In some embodiments, the one or more enhancer oligonucleotide primer(s) comprise a sequence identical to the sequence of a probe.
In some embodiments of the methods, at least 4, 10, 15, 20, 25 or 30 cycles of PCR are performed. In some embodiments, up to/no more than 35, 40, 45 or 50 cycles of PCR are performed.
In some embodiments the method may further comprise: d) detecting or measuring the signal generated by the binding of the probes to the (tagged) nucleic acid(s). The 10 measurement may be made in real time and/or at the end of the reaction.
In some embodiments of the methods and kits as provided herein, the composition or kit further comprises a quaternary ammonium salt.
Another aspect of the present invention provides the use of a quaternary ammonium salt (or source thereof) in a method as provided herein. It may have the formula N(Alk)x-I-I, Hal, N(Alk)"Hy where x + y=4, Alk=C1-4 alkyl, and Hal=halide.
The quaternary ammonium salt (QAS) may be a halide (e.g. chloride) salt The quaternary ammonium salt may comprise 1-4 methyl groups. Suitably, the quaternary ammonium salt may comprise a tetramethylammonium salt; preferably the tetramethylammonium salt is tetramethylammonium chloride (TMAC). In some embodiments, the presence of TMAC can increase the signal-to-noise ratio of the signal from the probe(s).
In another aspect, the present invention provides a modified polymerase with reduced or no exonuclease (herein abbreviated to P-ENF) function or activity for use in a nucleic acid amplification method or process, e.g. a DNA amplification method The polymerase may a fragment and/or domain and/or a derivative of Taq polymerase. The polymerase may be formed by an N-terminal truncation or modification.
The polymerase may be further modified to be a "hot-start" polymerase.
In another aspect, the present invention provides a method of conducting nucleic acid amplification using a P-ENF.
In another aspect, the present invention provides an aqueous composition suitable for nucleic acid amplification comprising one or more of a) a buffer; b) dNTPs, which may comprise deoxyribonucleotide triphosphates (A, T, G and 10 c) a polymerase, such as a P-ENF as defined herein; d) optionally, a (forward) primer and a (reverse) primer, preferably wherein the primers form a primer pair and/or are suitable for amplifying a target nucleic acid; e) preferably, a quaternary ammonium salt (QAS, for example as defined earlie and/or e) a source of divalent cations.
Such compositions may be suitable for amplifying DNA, for example in a polymerase chain reaction (PCR).
The QAS and/or P-ENF may be used in a method or composition comprising one or more probes with a reporter and/or quencher, or with at least 50I/0 identity (to a primer), or one or more enhanced primer(s).
Also provided is a kit suitable for performing nucleic acid amplification comprising: a) a container; b) a P-ENF and/or a quaternary ammonium salt (QAS), suitably in an aqueous composition as defined herein.
BRIEF DESCRPTION OF THE FIGURES
These are provided for illustration and are not intended to be limiting.
FIGURE 1 -Schematic of the UPDS methods as employed herein FIGURE 2 -Schematic of the enhancer primer mechanism in UPDS.
FIGURE 3 -Data showing the endpoint fluorescence detection for a Single Nucleotide Polymorphic assay. The assay system utilises three unlabelled oligonucleotide primers (two allele-specific primers and one universal reverse primer) and two dual-labelled probes. The sequences of the primers and probes can be found in Example 1. The data obtained was then plotted as FAM signal divided by ROX on the X-axis, and HEX signal divided by ROX on the Y-axis (the signals are normalised by ROX). Three discernible groups associated with respective genotypes were observed.
FIGURE 4 -Data showing effect of an enhancer primer. The assay system utilises three unlabelled oligonucleotide primers and two dual-labelled probes. The sequences of the primers and probes can be found are the same as those from Example 1 and Figure 2, but with the addition of two enhancer primers (one for each probe/allele) as described in Example 2. The data obtained was then plotted as FAM signal divided by ROX on the X-axis, and HEX signal divided by ROX on the Y-axis (the signals are normalised by ROX). Three discernible groups associated with respective genotypes were observed.
FIGURE 5 -Data showing effect of another type of enhancer primer. The assay system utilises three unlabelled oligonucleotide primers and two dual-labelled probes. The sequences of the primers and probes can be found are the same as those from Example I and Figure 2, but with the addition of two enhancer primers (one for each probe/allele) as described in Example 3. These enhancer primers use a duplicated sequence when compared to Example 2. The data obtained was then plotted as FAIVI signal divided by ROX on the X-axis, and HEX signal divided by ROX on the Y-axis (the signals are normalised by ROX). Three discernible groups associated with respective genotypes were observed.
FIGURE 6 -Real time UPDS signal detection.
FIGURE 7 -Data showing the effect of using a truncated Taq polymerase with reduced 5'-3' exonuclease activity in the UPDS protocol. The assay system utilises three unlabelled oligonucleotide primers and two dual-labelled probes. The sequences of the primers and probes can be found in Example 5. The data obtained was then plotted as FAIVI signal divided by ROX on the X-axis, and HEX signal divided by ROX on the Y-axis (the signals are normalised by ROX). Three discernible groups associated with respective genotypes were observed.
DETAILED DESCRIPTION
These aspects relate to a new genotyping method, disclosed herein as UPDS (Universal polymorphism detection system). This assay may comprise the use of two (or more, for example, three or four or five or more) competing allele-specific oligonucleotide primers. Each may comprise a portion of template sequence at the 3' end (which may differentiate between the alleles) and different non-template sequence tails, or tags, to the 5' end, and a (common) reverse primer. This system can use a reporting system, such as a fluorescent reporting system. This system may use a probe, such as an oligonucleotide probe. This system can then bind to the complementary sequence introduced by each of the tails of the allele-specific primers, leading to generation of detectable signal, such as a light signal.
A schematic of an exemplary UPDS process is shown in Figure 1. In step (A), the correct allele specific primer 101 (only one shown for simplicity) with tail/tag 101a and reverse primer 102 are shown alongside the template DNA 100, showing the single nucleotide polymorphism (SNP) which exemplifies the specific allele (here it is a C-G). Following denaturation (into single stranded templates 100a and 100b), the primers anneal and extend, and step (B) shows the resulting synthesis of two new strands 103 and 104. One of these strands 103 is tailed/tagged as a result of the use of the allele-specific primer, and subsequent extension steps -for example step (C) -causes synthesis of a strand comprising the complement of the allele-specific primer tail/tag 105. In step (D), this shows that the generation of the complement of the allele-specific tail/tag allows a probe such as the exemplified dual-labelled probe 106 (with a FAM fluorophore and a quencher) to bind/base-pair to the tail/tag portion and generate a detectable signal.
The action of the enhancer primer in the UPDS process is shown in Figure 2. Here, following step (C) from Figure 1, the enhancer primer 107 is able to compete with the probe for binding to the allele-specific tail/tag of synthesised strand 105. This allows for further rounds of amplification to generate further strands 105 resulting in a greater number of probe binding sites.
Thus in one aspect, the present invention provides a method for detecting one or more target sequences in a sample by amplification, the method comprising: a) providing an aqueous composition comprising: i) one or more forward oligonucleotide primers having a 5' region which is a tag sequence and a 3' region specific for a target sequence; ii) a reverse oligonucleotide primer, such that a forward and the reverse primer operably form a primer pair; iii) one or more probes having a reporter label and a quencher label, each probe comprising a sequence having at least 50% identity to the tag sequence of a forward oligonucleotide primer; and iv) one or more enhancer oligonucleotide primers comprising a sequence having at least 50% identity to the sequence of a probe; b) incubating the primers and probes with the sample and at least a polymerase; and c) performing polymerase chain reaction (PCR) on the sample to generate tagged nucleic acids, whereby the probe(s) can bind the tagged nucleic acids.
The present invention also provides a kit for use in a nucleic acid amplification process, comprising: i) one or more forward oligonucleotide primers having a 5' region which is a tag sequence and a 3' region specific for a target sequence; ii) a reverse oligonucleotide primer, such that a forward and the reverse primer operably form a primer pair; iii) one or more probes having a reporter label and a quencher label, each probe comprising a sequence having at least 50% identity to the tag sequence of a forward oligonucleotide primer; iv) one or more enhancer oligonucleotide primers comprising a sequence having at least 50% identity to the sequence of a probe; and v) a polymerase.
The term "sample" as used herein should be understood to mean a sample comprising or consisting of DNA. Generally, the sample may be a biological sample, for example a biological fluid selected from blood or a blood derived product such as plasma or serum, saliva, urine, sweat, or cerebrospinal fluid. The sample may also be a sample of cells or tissue, for example muscle, nail, hair, bone, marrow, brain, vascular tissue, kidney, liver, peripheral nerve tissue, skin and epithelial tissue. The tissue or cells may be normal or pathological tissue. Generally, the sample may be treated to remove all material except DNA by techniques well known in the art. PCR sample preparation protocols are also well described in the literature and are available from the websites of Agilent, Life Technologies, Qi agen and Illumina. In one embodiment, the method of the invention may be employed to determine the presence of a particular allele of a DNA locus, for example the presence of a SNP in a gene or other locus in DNA. In some embodiments, the sample comprises DNA of unknown origin and the method of the invention may be employed to detect the presence of a target DNA in the sample. The DNA present in a sample may be referred to as the DNA template in the context of the present disclosure.
The term "primer" as used herein refers to a synthetically or biologically produced single- stranded oligonucleotide. In use, primers can typically base pair/anneal to another single-stranded nucleic acid molecule using the rules defined by Watson-Crick base pairing to form a double-stranded nucleic acid duplex, whereby the primer strand can then be extended/elongated with an appropriate polymerase in the presence of nucleotide monomers. It is well known that many such nucleic acid polymerases or reverse transcriptases require the presence of a primer that may be extended to initiate such nucleic acid synthesis. For example, the oligonucleotides disclosed herein may be used as one or more primers in various extension, synthesis, or amplification reactions. It is also well known that in PCR assays, primers usually exist in primer pairs, which comprises of a nominal "forward" primer and a nominal "reverse" primer. Forward and reverse primers may be differentiated by the fact that they bind to different strands of a given duplex template, and operably form a primer pair such that the reverse primer binds downstream to the forward primer on the DNA duplex/template (i.e. in the 3' direction of the forward primer).
The term "portion" as used herein with reference to oligonucleotide constructs (such as primers) should be understood to mean a contiguous part of said oligonucleotide construct which comprises at least one, two, three or more contiguous bases.
In some embodiments, primers may have at least one portion which is specific for a target sequence (i.e. a sequence-specific primer). In other words, primers may be designed in such a way that at least one portion will have a sequence which is complementary to a target known sequence which is to be detected. Thus, in a given amplification reaction, a sequence-specific primer will preferentially base-pair/anneal to its target sequence.
Sequence-specific primers may also be allele-specific primers whereby the target sequence is a specific allele at a genetic locus which can be used to alleles that share a common polymorphism. The term "allele" as used herein refers to a genetic variation associated with a gene or a segment of DNA, i.e. one of two or more alternate forms of a DNA sequence occupying the same genetic locus. In other words, allele-specific primers may be used to amplify a single allele and may be capable of differentiating between two sequences that differ by only a single base difference of change. The difference between the two alleles may be a SNP, an insertion, or a deletion.
Sequence-specific primers may be universal for all alleles. In other words, sequence-specific primers may only be specific for a locus which is universal for all alleles and/or polymorphisms to be detected. These primers can therefore be used as universal primers.
In other words, one universal sequence-specific primer can be used in conjunction with two or more allele-specific primers in a method of the invention as described herein. Thus, in one embodiment of the method of the invention, the one or more forward oligonucleotide primers may be allele-specific primers which have a sequence-specific portion which is specific for one or more known allele(s). In such embodiments, the reverse oligonucleotide primers may be sequence-specific primers specific for a known sequence near the allele. In one example, the sequence bound by the reverse primer is known to not be polymorphic and/or not be allele dependent.
Sequence-specific and/or allele-specific primers may also comprise a 5' portion which is a tag sequence, wherein tag sequence is not complementary to the target sequence or allele. This organisation allows for a tag sequence to be incorporated as part of the primer during a specific polymerisation reaction. Subsequent cycles during a PCR reaction will then allow the tag sequence to be amplified further and become incorporated as part of the amplified duplex. Tag sequences may be useful as they can be designed to be specific for complementary probe sequences, whereby the probes can be labelled using a reporter label to allow for the generation of an associated signal in response to amplification from a sequence-specific and/or allele-specific primer.
In some embodiments, the sequence of the sequence-specific portion of target-specific primers as used herein, such as allele-specific primers, can be designed such they are at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to their target sequences (for example, a sequence comprising a SNP). In some embodiments, the sequence identity may be sufficient such that the target-specific primer is able to bind to the target sequence and allow for extension by the polymerase, for example the DNA polymerase, as part of the methods as provided herein. In some embodiments, the sequence identity is sufficient such that the target-specific primer is able to bind to the target sequence preferentially to the other target-specific primers which are present in the composition and/or kit.
Enhancer primers as used herein refer to sequence-specific primers which are specific for the same locus as a probe as used herein. Thus, in use, the enhancer primer may be able to compete with the binding of the probe in order to facilitate the amplification reaction and thus generate further tagged/tailed strands for probe binding and signal generation. Thus, in embodiments, the one or more enhancer oligonucleotide primers comprising a sequence having at least 50% identity to the sequence of a probe. In some embodiments, the sequence of the oligonucleotide enhancer primers as used herein can be designed such they are at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to their respective probe/tag sequences. In some embodiments, the sequence identity may be sufficient such that the enhancer primer is able to bind to the tag sequence and allow for extension by the polymerase, for example the DNA polymerase, as part of the methods as provided herein.
In some embodiments, the one or more enhancer oligonucleotide primers may comprise at least two distinct regions, each region comprising a sequence having at least 50% identity to that of the one or more probes. In such embodiments, the two distinct regions may be separated by a linker region. The linker region may be 1 to 10 or 2 to 5 oligonucleotides in length. In some embodiments, there may be no linker region.
For the purpose of this invention, in order to determine the percent identity of two sequences (such as two polynucleotide or two polypeptide sequences), the sequences may be aligned for optimal comparison purposes (e.g., gaps can be introduced in a first sequence for optimal alignment with a second sequence). The nucleotide residues at nucleotide positions may then be compared. When a position in the first sequence is occupied by the same nucleotide residue as the corresponding position in the second sequence, then the nucleotides are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions /total number of positions in the reference sequence x 100).
The skilled person is aware of different computer programs that are available to determine the homology or identity between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In an embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
The terms "complementarity" and "complementary" are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions.
Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region of equal length.
The term "probe" as used herein refers to synthetic or biologically produced nucleic acids (DNA or RNA) which, by design or selection, contain specific nucleotide sequences that allow them to hybridize, under defined stringencies, specifically (i.e., preferentially) to target nucleic acid sequences. Thus, probes may also be used interchangeably with "oligonucleotide probe". In the present teachings, probes may be labelled, e.g. with a reporter label such as a fluorophore or a quencher label. In some embodiments, probes may also comprise at least a pair of labels, comprising a reporter label such as a fluorophore and a quencher label, whereby the quencher label is able to attenuate the emission of the reporter label. The reporter label may be located at a different portion of the probe compared to the quencher label. In some embodiments, the position of the labels is such that when free in solution, the reporter label and quencher label come into close proximity to each other such that little or no emission can be detected from the reporter label.
The term "reporter label" as used herein should be understood to mean a molecule that is capable of emitting a detectable signal and is capable of being quenched by the quencher molecule. Examples of reporter molecules include molecules that are detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of reporter labels that may be employed include enzymes, enzyme substrates, radioactive atoms, fluorescent dyes, chromophores, chemiluminescent labels, or ligands having specific binding partners.
In one embodiment, the reporter label may be detectable by spectroscopy, and can be a fluorescent dye. The fluorophores for the labelled oligonucleotide pairs may be selected so as to be from a similar chemical family or a different one, such as cyanine dyes, xanthenes or the like. Fluorophores of interest include, but are not limited to fluorescein dyes (e.g. 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6-FAM), 2%4%1,4,-tetrachlorofluorescein (TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX), and 2'7"-dimethoxy-4',5'dichloro-6-carboxyfluorescein (JOE)), cyanine dyes such as Cy5, dansyl derivatives, rhodamine dyes (e.g. tetramethyl-6-carboxyrhodamine (TAMRA), and tetrapropano-6-carboxyrhodamine (ROX)), DABCYL, DABCYL, cyanine, such as Cy3, anthraquinone, nitrothiazole, and nitroimidazole compounds, or other non-intercalating dyes. The term "quencher label" should be understood to a "quenching group", i.e. any fluorescence-modifying chemical group that can attenuate at least partly the light emitted by a fluorescent group. We refer herein to this attenuation as "quenching". Hence, illumination of the fluorescent group in the close proximity of a quenching group can lead to an emission signal that is less intense than expected, or even completely absent. Quenching occurs through energy transfer between the fluorescent group and the quenching group.
In embodiments of the present invention where the probe comprises both a reporter label such as a fluorophore and a quencher label, the labels are generally positioned such that when free in solution, the reporter label and quencher label come into close proximity to each other such that little or no emission can be detected from the reporter label. This may be, for example, due to the formation of secondary structure due to the sequence of the oligonucleotide probe. In such embodiments, binding of the probes to their respective tag sequences can separate the reporter label and the quencher label such that the level of attenuation from the quencher label is decreased when compared to the probe being free in solution. In other words, binding of the probe to the tag sequence should increase emission from the reporter label on the probe. In one example, this can be by positioning the reporter label and quencher label at opposing ends or end portions of a probe.
The terms "polymerase", "nucleic acid polymerase" and are used herein in a broad sense and refers to any polypeptide that can catalyse the 5'-to-3' extension of a hybridized primer by the addition of nucleotides and/or certain nucleotide analogs in a template-dependent manner. In one embodiment, the polymerase is a DNA polymerase. Non-limiting examples of DNA polymerases include RNA-dependent DNA polymerases, including without limitation, reverse transcriptases, and DNA-dependent DNA polymerases. It is to be appreciated that certain DNA polymerases (for example, but not limited to certain eubacterial Type A DNA polymerases and Taq DNA polymerase) may further comprise a structure-specific nuclease activity and that when an amplification reaction comprises an invasive cleavage reaction.
In some embodiments, the polymerase may be a modified polymerase. Polymerases can be modified in their structure either through genetic engineering (i.e. through known molecular biological techniques) or through chemical modification in order to confer certain properties. In other words, a modified polymerase as used herein refers to a polymerase, for example a DNA polymerase which has one or more of: a different primary structure (i.e. amino acid sequence), a different secondary structure, a different tertiary structure or a different quaternary structure to the one or more polymerase/s or fragments thereof, from which it is derived. As referred to above the term modified polymerase also includes within its scope fragments, derivatives and homologues of a modified polymerase as herein defined so long as it retains its polymerase function and modified properties as defined herein.
In some embodiments, the polymerase used may be a polymerase modified to attenuate or completely remove its 5'-3' exonuclease activity under the conditions used for the polymerisation reaction.
In some embodiments, the polymerase used may be a polymerase modified to be a "hot-start" polymerase. Hot-start polymerases are well known in the art as polymerases which have been modified such that they are completely inactivated at lower temperatures.
During a PCR reaction when the temperature is generally increased to > 90°C, the modification is reversed and the polymerase becomes active again. This technique allows to reduce non-specific amplification, particularly before the start of a PCR reaction.
Comprising in the context of the present specification is intended to meaning including.
Where technically appropriate, embodiments of the invention may be combined. Embodiments are described herein as comprising certain features/elements. The disclosure also extends to separate embodiments consisting or consisting essentially of said features/elements.
The invention will now be described with reference to the following examples, which are merely illustrative and should not in any way be construed as limiting the scope of the present invention.
EXAMPLES
Example 1: Endpoint fluorescence detection for a Single Nucleotide Polymorphic assay Abbreviations: FAM: 6-carboxy Fluorescein HEX: 2',4', 5',7', 1,4-Hexachlorofluoresce n IABkFQ: Iowa Black® FQ ROX: 5,6-carboxy-X-rhodamine, SE The system utilises three unlabelled oligonucleotide primers and two dual-labelled probes. The sequences of the primers and probes can be found below: Allele-specific Primer 1: 5'-GAAGGTGACCAAGTTCATGCTGAAGCTCCACAATTTGGTGAATTATCAAT3' (SEQ ID NO: 1) Allele-specific Primer 2: 5'-GAAGGTCGGAGTCAACGGATTGAAGCTCCACAATTTGGTGAATTATCAAA3' (SEQ ID NO: 2) Reverse Primer: 5'-CACTCTAGTACTATATCTGTCACATGGTA-3' (SEQ ID NO: 3) FAM Probe: 5'-/6-FAM/GAAGGTGACCAAGTTCATGCT/IABkFQ/-3' (SEQ ID NO: 4) HEX Probe: 5'-/HEX/GAAGGTCGGAGTCAACGGATT/IABkFQ/-3' (SEQ ID NO: 5) The Sequence of FAA/I-labelled probe is identical to the universal tag part of the allele-specific primer 1 and the sequence of HEX labelled probe is identical to tag part of the allele-specific primer 2.
All oligonucleotides were diluted to 100p.M initial concentration using Te buffer (10mM TRIS pH8.3 with 0.1mM EDTA).
A 2X genotyping master mix including assay primers was created which included the following components: 1. 0.33 pM Allele-specific Primer 1 2. 0.33 JIM Allele-specific Primer 2 3. 0.83 pM Reverse Primer 4. 400nM FAM Probe 5. 400nM HEX Probe 6. 10mM TRIS pH 8.3 7. 100mM KC1 8. 4.4mM Magnesium Chloride 9. 300 uM dNTPs 10. 300nM 5,6-carboxy-X-rhodamine, SE (5,6-ROX, SE, mixed isomer) 11. 0.05% Igepal 12. 10% Glycerol 13. 50-100 Units/mL N-terminally-truncated Tag Polymerase The genotyping assay was performed on a clear 384 well PCR plate using 4p1 final reaction volume. To the wells of the PCR plate, 2ti1 of Genomic DNA from various Caucasian individuals at final concentration of 2ng/g1 was added. Addition of DNA was followed by the addition of 2x genotyping master mix (described above). The PCR plate was sealed using StarSeal Advanced Polyolefin Film. The plate was then thermally cycled on Peltier thermal cycler MJ PTC-200 using the following thermal cycling conditions:
Step Description Temperature Time # Cycles
1 Enzyme 94'C 15 min 1 activation 2 Template 94'C 20 secs 10 denaturation Aimealing and 65-57' C 60 secs (drop extension 0.8°C per cycle) 3 Denaturation 94°C 20 secs 30 Annealing and 57'C 60 secs extension After thermal-cycling, endpoint fluorescence was recorded using Tecan Infinite F200 fluorescent plate reader, using the following wavelengths: FAM excitation: 485nm, FAM Emission: 520nm HEX excitation: 535nm, HEX Emission: 556nm ROX excitation: 575nm, ROX Emission: 610nm The data obtained was then plotted as FAM signal divided by ROX on the X-axis, and HEX signal divided by ROX on the Y-axis. Three clearly discernible groups associated with respective genotypes were observed (Figure 3).
Example 2: Effect of Enhancer Primer Type 1 (single length universal tag) This example demonstrates the increased signal generation and genotyping clustering in the presence of Enhancer Primer Type 1.
As for Example 1, a protocol was used to demonstrate the importance of addition of enhancer primer on the PCR-based endpoint fluorescent SNP genotyping detection system. SNP genotyping was performed in the presence of enhancer primer type 1. A pair of enhancer primers, one for each allele was added to the 2X concentrate genotyping master mix at a final concentration of 80nM.
Enhancer Primer 1: 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 6) Enhancer Primer 2: 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 7) Endpoint genotyping cluster plot dearly demonstrated increased signal to noise ratio, tighter clusters and enhanced amplification in the presence of enhancer primer. (Figure 4) Example 3: Effect of Enhancer Primer Type 2 (duplicated universal tag) As for Example 2, a protocol was used to demonstrate the importance of addition of enhancer primer type 2 on the PCR based endpoint fluorescent SNP genotyping detection system. SNP genotyping was performed in the presence of Enhancer Primer type 2. A pair of enhancer primers, one for each allele, was added to the 2X genotyping master mix at a final concentration of 80nIVE Enhancer Primer 3: 5'-GAAGGTGACCAAGTTCATGCTGAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 8) Enhancer Primer 4: 5'-GAAGGTCGGAGTCAACGGATTGAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 9) Three clearly discernible groups associated with respective genotypes were observed (Figure 5).
Example 4: Realtime detection of PCR product Realtime PCR was performed using the protocol described above (Example 1-3) to demonstrate the ability of the system to detect fluorescence in real-time at each PCR cycle.
Human DNA samples were tested in a serial dilution of 1:10 with a starting concentration of 2Ong/ml. Detection was performed only in the FAM channel using following primers and probes.
Allele-specific Forward Primer: 5'-GAAGGTGACCAAGTTCATGCTGAGTGCAGGTTCAGACGTCC-3' (SEQ ID NO: 10) Reverse Primer: 5'-CTCCCTTCCACCTCCGTACCAT-3' (SEQ ID NO: 11) FAM Probe: 5'-/6-FAM/GAAGGTGACCAAGTTCATGCT/IABkFQ/-3' (SEQ ID NO: 4) Enhancer Primer I: 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 6) All oligonucleotides were diluted to 100RM initial concentration using Te buffer (10mM TRIS pH8.3 with 0.1mM EDTA).
A 2X genotyping master mix including assay primers was created which included the following components: 0.33 uM Allele-specific Forward Primer 2. 0.83 uM Reverse Primer 3. 400n1b1 FAM Probe 4. 80nM Enhancer Primer type 1 5. 10mM TRIS pH 8.3 6. 100mM KCl 7. 4.4mM Magnesium Chloride 8. 300 uM dNTPs 9. 1000nM 5,6-carboxy-X-rhodamine. SE (5,6-ROX, SE, mixed isomer) 10. 0.05% Igepal 1 L 10% Glycerol 12. 20mM TMAC 13. 50-100 Units/mL N-terminal truncated Tag Polymerase PCR was performed on a clear 384 well PCR plate using lOul final reaction volume. To the wells of the PCR plate, 5u1 of Genomic DNA was added with a starting concentration of 2Ong/u1 to 0.02ng/ul. Addition of DNA was followed by the addition of 2x genotyping master mix (described above). The PCR plate was sealed using StarSeal Advanced Polyolefin Film.
The plate was then thermal cycled on Applied Biosystem 7900 using following thermal cycling conditions:
Step Description Temperature Time # Cycles
1 Enzyme 941: 15 min 1 activation 2 Template 94°C 20 secs 10 denaturation Annealing and 65-57°C 60 secs (drop extension 0.8°C per cycle) 3 Denaturation 94'C 20 secs 35 Annealing and 57°C 60 secs extension Fluorescence was recorded in real-time at each PCR cycle during annealing and extension step. Resulting data was plotted as deltaRn vs cycle and Cq values were calculated automatically using ABI 7900 software, as shown below and in Figure 6.
Sample Cone (ng/pL) Cq Values 24.0 2 27.2 0.2 30.4 0.02 34.0 This demonstrates the ability of the system to detect fluorescence in real-time.
Example 5: Use of Terminally-truncated Taq Polymerase with dual-labelled probes.
This example demonstrates the ability of N-terminally-deleted Taq Polymerase to release fluorescence from a quenched dual-labelled probe without the use of 5' nuclease activity of the full length Taq Polymerase.
SNP genotyping assay was performed using human genomic DNA.
Allele-specific Primer l: 5'-GAAGGTGACCAAGTTCATGCTGAGTGCAGGTTCAGACGTCC-3' (SEQ ID NO: 10) Allele-specific Primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTGAGTGCAGGTTCAGACGTCT-3' (SEQ ID NO: 12) Reverse Primer: 5'-CTCCCTTCCACCTCCGTACCAT-3' (SEQ ID NO: 11) FAM Probe: 5'/6-FAM/GAAGGTGACCAAGTTCATOCTRABkFQ/-3' (SEQ ID NO: 4) HEX Probe: 5'-/HEX/GAAGGTCGGAGTCAACGGATT/IAB1cFQ/-3' (SEQ ID NO: 5) All oligonucleotides were diluted to 10ORM initial concentration using Te buffer (10mM TRIS pH8.3 with 0.1mM EDTA).
A 2X genotyping master mix including assay primers was created which included the following components: 1. 0.33 gM Allele-specific Primer 1 2. 0.33 gM Allele-specific Primer 2 3. 0.83 p.M Reverse Primer 4. 400nM FAM Probe 5. 400nM HEX Probe 6. 10mM TRIS pH 8.3 7. 100mM KCI 8. 4.4mM Magnesium Chloride 9. 300 gM dNTPs 10. 300nM 5,6-carboxy-X-rhodamine, SE (5,6-ROX, SE, mixed isomer) 11. 0.05% Igepal 12. 10% Glycerol 13. 20mM TMAC 14. 50-100 Units/mL N-terminally-truncated Tag Polymerase The genotyping assay was performed in a clear 384-well PCR plate using 4p.1 final reaction volume. To the wells of the PCR plate, 2g1 of Genomic DNA from various Caucasian individuals at final concentration of 2ng/g1 was added. Addition of DNA was followed by the addition of 2x genotyping master mix (described above). The PCR plate was sealed using StarSeal Advanced Polyolefin Film. The plate was then thermally-cycled on MJ PTC-200 Peltier thermal cycler using the following thermal cycling conditions:
Step Description Temperature Time # Cycles
1 Enzyme 94°C 15 min 1 activation 2 Template 94°C 20 secs I () denaturation Annealing and 65-57'C 60 sees (drop extension 0.8°C per cycle) 3 Denaturation 94°C 20 sees 30 Annealing and 57°C 60 sees extension After thermal-cycling, endpoint fluorescence was recorded using Tecan Infinite F200 fluorescent plate reader using the following wavelengths: FAM excitation: 485nm, FAM Emission: 520nm HEX excitation: 535nm, HEX Emission: 556nm 10 ROX excitation: 575nm, ROX Emission: 610nm The data obtained was then plotted as FAM signal divided by ROX on the X axis, and HEX signal divided by ROX on the Y axis. Three clearly discernible groups associated with respective genotypes were observed (Figure 7).
It will of course be understood that, although the present invention has been described by way of example, the examples are in no way meant to be limiting, and modifications can be made within the scope of the claims hereinafter. Preferred features of each embodiment of the invention are as for each of the other embodiments mulatis;Jutland's.
All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as if each individual publication was specifically and individually indicated to be incorporated by reference herein. CLAIMS

Claims (25)

  1. CLAIMS1. A (modified) polymerase with reduced or no exonuclease function or activity (herein abbreviated to P-ENF) for use in a nucleic acid amplification method or process.
  2. 2. The (modified) polymerase according to claim 1 for use in a DNA amplification method.
  3. 3. The polymerase according to claim 1 or 2 which is a fragment or domain or a derivative of Taq polymerase.
  4. 4 The modified polymerase according to any preceding claim which is formed by an N-terminal truncation or modification.
  5. 5. The modified polymerase according to any preceding claims, wherein the polymerase is further modified to be a "hot-start" polymerase.
  6. 6. A method of conducting nucleic acid amplification using a P-ENF (such as according to any preceding claims).
  7. 7. An aqueous composition suitable for nucleic acid amplification comprising: a) a buffer; b) dNTPs; c) a P-ENF; d) optionally, a forward primer and a reverse primer; and e) a source of divalent cations.
  8. 8. A composition according to claim 7 which is suitable for amplifying DNA, for example in a polymerase chain reaction (PCR).
  9. 9 A composition according to claim 7 or 8 wherein the dNTPs comprise (so far) deoxyribonucleotide triphosphates (A, T, G and C).
  10. 10. A composition according to any of claims 7 to 9 wherein the P-ENF is as defined in any of claims 1 to 6.
  11. 11. A composition according to claims 7 to 10 wherein the primers form a primer pair and/or are suitable for amplifying a target nucleic acid.
  12. 12. The use of a P-ENF in a nucleic acid amplification method.
  13. 13. A kit suitable for performing nucleic acid amplification comprising: a) a container; b) a P-ENF, suitably in an aqueous composition as defined in any of claims 7 to 10.
  14. 14. A kit according to claim 13 which is suitable for amplifying DNA, such as in a 15 PCR.
  15. 15. A kit according to claim 13 or 14 which is suitable for containing an aqueous composition and/or is suitable for thermal cycling (for example above 90°C).
  16. 16. The use of a quaternary ammonium salt (QAS) in a nucleic acid amplification method.
  17. 17. The use according to claim 16, wherein the quaternary ammonium salt is a halide salt.
  18. 18. The use according to claim 16 or 17, wherein the quaternary ammonium salt comprises from 1-4 methyl groups.
  19. 19. The use according to any one of claims 16 to 18, wherein the quaternary ammonium salt is a tetramethylammonium salt.
  20. 20. The use according to any of claims 16 to 19, wherein the salt is TMAC (tetramethylammonium chloride).
  21. 21. The use according to claim 19, wherein the tetramethylammonium salt is 5 tetramethylammonium chloride (TMAC).
  22. 22. A process for conducting nucleic acid amplification using quaternary ammonium salt.
  23. 23. An aqueous composition for use in a nucleic acid amplification process, the composition comprising: a) a buffer; b) dNTPs; c) a DNA polymerase (Such as a P-ENF); d) optionally, a forward primer and a reverse primer; e) a quaternary ammonium salt (QAS); and f) a source of divalent cations.
  24. 24. A composition according to claim 23 wherein the DNA polymerase is a modified polymerase as defined by any one of claims 1 to 5.
  25. 25. A kit suitable for performing nucleic acid amplification comprising: a) a container; b) a quaternary ammonium salt, suitably contained in a composition according to claims 23 or 24.
GB1900311.0A 2019-01-09 2019-01-09 Polymerase Withdrawn GB2587177A (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
GB1900311.0A GB2587177A (en) 2019-01-09 2019-01-09 Polymerase
PCT/GB2020/050040 WO2020144480A1 (en) 2019-01-09 2020-01-09 Method for detecting a nucleic acid sequence
US17/309,998 US20220090194A1 (en) 2019-01-09 2020-01-09 Method for detecting a nucleic acid sequence
EP20700852.5A EP3908677B1 (en) 2019-01-09 2020-01-09 Method for detecting a nucleic acid sequence

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
GB1900311.0A GB2587177A (en) 2019-01-09 2019-01-09 Polymerase

Publications (2)

Publication Number Publication Date
GB201900311D0 GB201900311D0 (en) 2019-02-27
GB2587177A true GB2587177A (en) 2021-03-24

Family

ID=65528006

Family Applications (1)

Application Number Title Priority Date Filing Date
GB1900311.0A Withdrawn GB2587177A (en) 2019-01-09 2019-01-09 Polymerase

Country Status (1)

Country Link
GB (1) GB2587177A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005113829A2 (en) * 2004-05-20 2005-12-01 Kermekchiev Milko B Use of whole blood in pcr reactions
EP1726664A1 (en) 2005-05-28 2006-11-29 KBiosciences Ltd. Detection system for PCR assay
WO2010062776A2 (en) * 2008-11-03 2010-06-03 Kapabiosystems Chimeric dna polymerases
JP2017131164A (en) * 2016-01-28 2017-08-03 東洋紡株式会社 Improved virus detection method

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005113829A2 (en) * 2004-05-20 2005-12-01 Kermekchiev Milko B Use of whole blood in pcr reactions
EP1726664A1 (en) 2005-05-28 2006-11-29 KBiosciences Ltd. Detection system for PCR assay
WO2010062776A2 (en) * 2008-11-03 2010-06-03 Kapabiosystems Chimeric dna polymerases
JP2017131164A (en) * 2016-01-28 2017-08-03 東洋紡株式会社 Improved virus detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Omni Klentaq Enables Direct DNA Amplification Inhibition Resistant, High Performance, Hot-Start Taq DNA Polymerase", 1 January 2011 (2011-01-01), XP055620642, Retrieved from the Internet <URL:http://www.enzymatics.com/pdf/Ultra-Pure_Omni-Klentaq.pdf> [retrieved on 20190910] *
BASKARAN N ET AL: "Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content", PCR METHODS & APPLICATIONS, COLD SPRING HARBOR LABORATORY PRESS, US, vol. 6, no. 7, 1 July 1996 (1996-07-01), pages 633 - 638, XP002631370, ISSN: 1054-9803 *

Also Published As

Publication number Publication date
GB201900311D0 (en) 2019-02-27

Similar Documents

Publication Publication Date Title
US6440707B1 (en) Fluorescence polarization in nucleic acid analysis
KR102246600B1 (en) Probes for improved melt discrimination and multiplexing in nucleic acid assays
JP2022008577A (en) Amplification with primers of limited nucleotide composition
US20090081648A1 (en) Detection and analysis of influenza virus
Csako Present and future of rapid and/or high-throughput methods for nucleic acid testing
Pryor et al. Real-time polymerase chain reaction and melting curve analysis
US6355433B1 (en) Determination of nucleotide sequence variations through limited primer extension
US20060194222A1 (en) Triplex probe compositions and methods for polynucleotide detection
KR20050034651A (en) Methods of detecting sequence differences
CN109251965A (en) A kind of DNA polymerase activity enhancing PCR buffer composition with increased gene mutation specificity
JP2006500033A (en) Methods and compositions for detecting targets
EP3908677B1 (en) Method for detecting a nucleic acid sequence
EP3055430B1 (en) Method for the detection of target nucleic acid sequences
EP1502958A1 (en) New detection format for hot start real time polymerase chain reaction
US20070122811A1 (en) Compositions and processes for genotyping single nucleotide polymorphisms
JP2008264005A (en) Novel method of assaying nucleic acid using labeled nucleotide
US20110045485A1 (en) Analytical method and kit
CA2967912A1 (en) Detecting single nucleotide polymorphism using overlapping hydrolysis probes
GB2587177A (en) Polymerase
GB2587178A (en) Method
AU2003247603A1 (en) Methods and compositions for monitoring primer extension and polymorphism detection reactions
WO2023126624A1 (en) Method for detecting target sequences
US20160273036A1 (en) Photoinduced electron transfer (pet) primer for nucleic acid amplification
US8153403B1 (en) Process for identifying existence of single nucleotide polymorphism without DNA sequencing
EP1502961A1 (en) New detection format for hot start real time polymerase chain reaction

Legal Events

Date Code Title Description
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40039131

Country of ref document: HK

WAP Application withdrawn, taken to be withdrawn or refused ** after publication under section 16(1)